See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/233761540

Effect of high temperature on color, chlorophyll fluorescence and volatile

biosynthesis in green-ripe banana fruit

Article in Postharvest Biology and Technology · December 2011

DOI: 10.1016/j.postharvbio.2011.06.011

CITATIONS READS

81 1,586

5 authors, including:

Jun Song
Agriculture and Agri-Food Canada
132 PUBLICATIONS 3,552 CITATIONS

SEE PROFILE

All content following this page was uploaded by Jun Song on 01 July 2018.

The user has requested enhancement of the downloaded file.

G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
Postharvest Biology and Technology xxx (2011) xxx–xxx

Contents lists available at ScienceDirect

Postharvest Biology and Technology

journal homepage: www.elsevier.com/locate/postharvbio

Effect of high temperature on color, chlorophyll fluorescence and volatile

biosynthesis in green-ripe banana fruit夽
Xiaotang Yang a , Jun Song b,∗ , Sherry Fillmore b , Xuequn Pang c , Zhaoqi Zhang a,∗
a
College of Horticulture, South China Agriculture University, Guangzhou, China
b
Agriculture and Agri-Food Canada. AFHRC, Kentville, Nova Scotia, Canada B4N 1J5
c
College of Life Science, South China Agricultural University, Guangzhou 510642, China

a r t i c l e i n f o a b s t r a c t

Article history: Banana (Musa AAA group) is one of the most consumed fruits in the world. It has been reported that
Received 29 September 2010 chlorophyll breakdown and color formation in banana is inhibited by ripening temperatures above 24 ◦ C.
Accepted 15 June 2011 At this temperature thylakoid membranes are retained resulting in reduced chlorophyll degradation. In
this study, green mature, untreated banana fruit were obtained from a local wholesale market and half
Keywords: of the fruit were subjected to ethylene treatment at 10 ␮L L−1 for 24 d. After ethylene treatment, both
Fruit ripening
treated and untreated fruit were stored at 20 ◦ C or 30 ◦ C for 7 d. Fruit were sampled after 0, 1, 4 and 7 d
Ethylene
of storage and evaluated for color, chlorophyll fluorescence, volatile production and expression of genes
Degreening
Gene expression and stress
related to volatile biosynthesis. Storage at 30 ◦ C reduced yellow color development in the peel, decreased
chlorophyll fluorescence (Fv/Fm), but increased Fo, indicating possible heat stress of the fruit. A total of 19
volatile compounds were identified using SPME/GC/MS. Both ethylene treatment and high temperature
enhanced volatile production. The increase of Fo and hexanoate and acetate esters are coincided with the
stress of high temperature. Using real time PCR (qPCR), expression of genes related to volatile biosynthesis
including branched-chain amino acid transaminase (BCAT), lipoxygenase (LOX), hydroperoxide lyase (HPL),
pyruvate decarbolxylase (PDC), alcohol dehydrogenases (ADH, short and medium chains), and alcohol acetyl
transferase (AAT) were investigated in both peel and pulp tissues. Among the tested genes, BCAT, HPL, ADH
and AAT in peel and pulp tissues increased significantly in response to ethylene and storage at 30 ◦ C. PDC,
ADH and BCAT (in pulp tissue) were induced by storage at 30 ◦ C in ethylene-treated fruit. LOX decreased
during ripening and storage at 30 ◦ C in the peel, but increased in the pulp tissue of ethylene-treated
fruit. This study demonstrates that both ethylene and high temperature influence volatile biosynthesis
in banana fruit at the transcriptional level and confirms findings that high temperature causes stress in
banana fruit during ripening.
Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.

Banana (Musa acuminata, AAA group) is a tropical fruit that
belong to the Musaceae family, which is one the most consumed
fruit in the world with an average per capita consumption of 11.8 kg
in 2007 in North America (Pollack and Perez, 2008). Most of the fruit
from this family are usually harvested while they are at mature
green stage, and initiated to ripen before marketing. As a typi-
cal climacteric fruit, banana undergoes significant changes during
ripening including respiration, ethylene production, color, volatile
production and texture. The golden yellow color of the ripe fruit
夽 Use of trade names does not imply endorsement of the products named or
criticism of similar ones not named. Contribution no. 2382 of the Atlantic Food &
Horticulture Research Centre, Agriculture and Agri-Food Canada.
∗ Corresponding authors. Tel.: +1 902 679 5607; fax: +1 902 679 2311.
E-mail addresses: jun.song@agr.gc.ca (J. Song), zqzhang@scau.edu.cn (Z. Zhang).
is due to chlorophyll (Chl) breakdown, which unmasks carotenoid
pigments in the plastids (Seymour et al., 1987). However, when
ripened at temperatures above 24 ◦ C, bananas fail to develop a
fully yellow peel and stay green (Blackbourn et al., 1990). These
‘green-ripe’ fruits are perceived to be of poor market quality and
consequently receive a lower market price. Although it is very
common in tropical areas, this green-ripe phenomenon appears to
be abnormal, when compared to many other fruits, which degreen
rapidly at temperatures above 24 ◦ C. Retention of Chl could be
the result of partial retention of granualar-thlakoid membranes
(Blackbourn et al., 1990; Ding et al., 2007). Additionally, a novel
protein assigned as senescence-inducible chloroplast stay-green
protein (SGR, STAY-GREEN) may be one of the upstream factors reg-
ulating the Chl degradation pathway at the gene expression level
(Yang et al., 2009). It was further suggested that sugar, regarded as
a plant development and senescence signal, was the major factor

0925-5214/$ – see front matter. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.postharvbio.2011.06.011

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
2 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
regulating Chl degradation (Yang et al., 2009). However, regula-
tion of Chl degradation in response to temperature is still under
investigation.
Production of aroma volatile compounds is another important
factor determining final quality of banana fruit. By using different
methods in volatile analysis, more than 250 volatile components
have been identified in banana (Macku and Jennings, 1987; Shiota,
1993; Tressl and Drawert, 1973). Banana mainly produces volatile
esters, such as 3-methylbutyl-acetate and 2-methylbutyl-acetate,
which represent the major contribution to aromatic flavour in
banana. High temperature can cause a dramatic increase in the pro-
duction of off-flavour aroma compounds during the storage of fruits
(Liu and Yang, 2002; Petracek et al., 2002). However, despite the
progress in characterizing the volatile profile and metabolism in
fruits, little information is yet known about how high temperature
affects volatile biosynthesis in green-ripe banana.
To explore the effect of temperature on ripening and volatile
biosynthesis in green-ripe banana, we characterized the changes
in production of aroma volatile compounds, by using a solid-phase
micro extraction (SPME) method. By monitoring color changes and
chlorophyll fluorescence as measurement of photochemical effi-
ciency of photosystem II, we also assessed the degreening and
the progress of senescence in green-ripe banana. Finally, we per-
formed quantitative real-time PCR analysis for volatile related
genes expression of branched-chain amino acid transaminase (BCAT),
lipoxygenase (LOX), hydroperoxide lyase (HPL), pyruvate decarboxy-
lase (PDC), alcohol dehydrogenase (ADH) and alcohol acryl transferase
(AAT), respectively, with the aim to explore the volatile production
mechanism.
1. Materials and methods
1.1. Plant materials samplings, treatments and storage
Boxes of mature green banana fruit (Musa spp. AAA group,
Cavendish subgroup) were purchased from a local wholesale mar-
ket prior to ethylene treatment. Fruit uniform in color and free from
obvious defects were selected from different branches of the boxes
for the study. Banana fruit were then separated in four groups for
four treatments. Two groups were placed in glass chambers and
ethylene treatment was carried out by flow air at 0.42 mL s−1 with
10 ␮L L−1 ethylene for 24 h at 20 ◦ C to initiate ripening, the other
two groups were placed in air chamber at 20 ◦ C for 24 h without
any ethylene treatment. Treatments were performed separately as
follows: T1: 10 ␮L L−1 ethylene for 24 h at 20 ◦ C and stored at 30 ◦ C.
T2: 10 ␮L L−1 ethylene for 24 h at 20 ◦ C and stored at 20 ◦ C. T3: no-
ethylene treated 24 h at 20 ◦ C and stored at 30 ◦ C. T4: no-ethylene
treated 24 h at 20 ◦ C and stored at 20 ◦ C.
After each treatment, fruit were allowed to ripen at 20 ◦ C or 30 ◦ C
in unsealed polyethylene plastic bags for 8 d. Zero, one, four, and
seven days after ethylene treatment, three fruit were picked from
each group and subjected to the measurement of color, chlorophyll
fluorescence, volatile compounds and tissue sampling. The sampled
peel and pulp tissues were then separately sliced, mixed, frozen into
liquid N2 . Frozen tissue was then ground into powder, stored under
−85 ◦ C immediately and kept until further use.
1.2. Measurements of color and chlorophyll fluorescence
The color of the fruit peel, lightness (L*), chroma (C*) and hue
angle (h◦ ) values, was measured using a Chromameter CR-400 color
spectrophotometer (KONIC MINOLTA, Canada). Chlorophyll fluo-
rescence was determined using an OS-500 modulated Fluorometer
(OPTI Sciences, USA) in the ‘Fv/Fm’ mode. Fo (minimum fluores-
cence), Fv (variable fluorescence), Fm (maximum fluorescence),
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
and Fv/Fm (exciton transfer efficiency) were determined after dark-
adaptation for 30 min at room temperature. The fluorescence was
measured using a photodiode in the 710–760 nm range (Song et al.,
1997a). The fluorometer probe was placed firmly on the banana
fruit and a pulse of 10 mmol m−1 s−1 was applied for 0.8 s. Mea-
surements of fruit color and chlorophyll fluorescence were taken
on each fruit of three fruit, at three different locations from bottom
to top.
1.3. Analysis of volatile compounds
Headspace volatile production of banana fruit were determined
by using the SPME technique described by Song et al. (1997b) with
modifications. Three banana fruit (ca. 400–500 g) were placed in a 4
L glass jar sealed with a Teflon lid for 2 h at 20 ◦ C. Headspace volatile
compounds were extracted by exposing SPME fiber (PDMS/DVB
60 ␮m, Supelco Co., Bellefonte, PA) to the headspace for 4 min,
and then transferred it to the injector port of a GC/MS (Varian
3400, Palo Alto, USA). Absorbed volatiles were desorbed from the
fiber coating by inserting the SPME fiber through a pre-drilled
septum (ThermogreenTM LB-2, Supelco Co., Bellefonte, PA) and
into a glass-lined, splitless injector port (220 ◦ C) of an Magnum
gas chromatograph-mass spectrometer (GC–MS) system (Finnigan
MAT, San Jose, CA) with a 70 eV electron ionization source, and
transfer line temperature of 250 ◦ C. Mass spectra were generated
at a rate of 3 spectra/s over the range of m/z 30–300. Identification of
volatile components was confirmed by retention time and compar-
ison of collected mass spectra with external authenticated chemical
standards (Sigma–Aldrich Canada Ltd., Oakville, Ontario L6H 6J8),
and reference spectra in a mass spectral library (National Institute
for Standard Technology, Search Version 1.6, Gaithersburg, MD).
Quantization of volatile compounds was performed by using exter-
nal standard curves established. All measurements were conducted
in triplicate. Volatile production was expressed as nL kg−1 s−1 fresh
weight and results were expressed as Log 10 of volatile production.
1.4. Total RNA extraction and cDNA synthesis
Total RNA was extracted from frozen banana peel and pulp
tissues according to the hot borate method of Wan and Wilkins
(1994) with some modifications in extraction buffer, which con-
tained 200 mM sodium tetraborate decahydrate, 30 mM EGTA, 1%
deoxycholic acid sodium salt, 10 mM DTT, 2% PVP 40, and 1% NP-40.
Quantity and quality of RNA were determined spectrophotometri-
cally by measuring the OD260/280 and OD260/230 . RNA integrity was
assessed by visual inspection after electrophoresis on a formalde-
hyde agarose gel in the presence of ethidium bromide. All RNA
extracts were treated with DNAse I using Ambion@ DNA-freeTM Kit
following the manufacturer’s recommendations (Applied Biosys-
tems, USA). First-strand cDNA synthesis was performed on 2 ␮g
total RNA in 20 ␮L reaction volume, using oligo dT as a primer
(5 ␮M) and reverse transcriptase from RETROscript@ Kit (Applied
Biosystems, USA) as per the manufacturer’s instructions. Controls
with no RETROscript reverse transcriptase (NRT) were used to
assess for potential genomic DNA contamination. The concentra-
tion of cDNA used for Real-time qPCR was measured using Nano
drop (Thermo, Canada) and each sample was diluted to 213 g L−1
with Tris–EDTA buffer (pH 8.0).
1.5. Designing of oligonucleotide primers for real-time
quantitative PCR analysis
The oligonucleotide primers used for real-time quantitative
PCR (qPCR) analysis were designed within the gene coding region
of BanBCAT, BanLOX, BanHPL, BanPDC, BanADH-medium chain,
BanADH-short chain and BanAAT (Table 1). All primers were
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx 3

Table 1
Sequences of primers used in this study. BanBCAT, BanLOX, BanHPL, BanPDC, BanADHs and BanAAT are specific primers designed within each of the ORF region of published
gene sequences registered on NCBI. BanActin and BanS18 were those published in the literature (Endah et al., 2008; Fu et al., 2009). All primers used in this study were
designed using the Primer Express 2.0 program according to the default parameters, except Actin and 18S RNA.

Target Name Oligonucleotide sequence (5 –3 ) Size of PCR product (bp) Accession numbers

BanBCAT BCAT-245F CTGGCAAATAAACGATGGGTA 202 FF561560

BCAT-447R CGGCACGGTGAAACTCATT
BanLOX LOX-58F CGATCAAAGCATCTCACATC 188 EU126853
LOX-246R TCAGAGTGCCATCATCCTTG
BanHPL HPL-509F CCATAGAGCAGGGGATCG 231 A65873
HPL-740R AAGGAGTGGAGGAGGATCT
BanPDC PDC-143F TTCGCTTGCCAGAGAACTGT 96 FJ268999
PDC-239R CTGGAAGCCTGAGCATATC
BanADH-medium chain ADH1-20F AGGTTATGGTGCTACTGTCA 130 DT723842
ADH1-150R GACCAATAATCCTTGATGCC
BanADH-short chain ADH2-251F CTTCCTTTGATGAGGCAGTG 274 DT723831
ADH2-525R GTAGGCAGCAGCACCAGTA
BanAAT AAT-451F CTCATCTCCGTCCATACCATC 144 AX025506
AAT-595R GAGGCAGCTTAGGTGGGTTG
BanActin ActinF ACCGAAGCCCCTCTTAACCC 170 AY904067
ActinR GTATGGCTGACACCATCACC
BanS18 S18F AGGTCCGGGCAATCTTTGA 98 U42083.1
S18R ACAAAGGGCAGGGACGTAAT

designed using Primer Express 2.0 program according to the default
criteria. The specificity of PCR amplification was examined by mon-
itoring the dissociation curves during real-time PCR reactions using
the Stratagene MX4000 (Agilent, USA).
1.6. Optimization of real-time qPCR analysis
Conditions for all PCRs were optimized in an Eppendorf Mas-
tercyler ep gradient PCR Thermocycler (Eppendorf, USA) and a
Stratagene MX4000 (Agilent, USA) with regard to forward and
reverse primers, various annealing temperatures (50–65 ◦ C) and
cDNA concentration. Amplification products were separated by 1%
agarose gel electrophoresis and analyzed with the PharosFX Molec-
ular Imager (Bio-Rad, Canada). Optimized results were used on
real-time qPCR analysis for all gene analysis. For the measurement
of primer efficiency, a 6 log amplification of a ten-fold serial dilution
made from cDNA from fruit peel samples ripened at 20 ◦ C for 7 d
was used. For each dilution, a qPCR was run in triplicate. Only the
primers that generate above 85% efficiency were used for further
analysis. Two reference genes, BanActin and BanS18, were analyzed
in each real-time PCR to normalize the expression patterns. Nor-
malization factors were calculated by taking the geometric mean of
the two reference genes (Vandesompele et al., 2002). Raw quantifi-
cation cycle (Cq ) was converted to quantities representing relative
expression levels using a modified comparative cycle threshold
method (Pfaffl, 2001) with correction for different amplification
efficiencies (Ramakers et al., 2003). In these methods, sample from
day 0 was used as a calibrator to calculate relative expression ratio.
1.7. Real-time PCR analysis
A 25 ␮L real-time PCR reaction system for each cDNA sample
was repeated 3 times on a Stratagene MX4000 (Agilent, USA) using
1 ␮L of dilute cDNA, 1.5 ␮L primers (F:R = 300 nM:300 nM), 12.5 ␮L
Brilliant SYBR Green QPCR Master Mix (Agilent, USA) and 0.38 ␮L
1:500 diluted ROX dye as a reference. For all genes, cycling condi-
tions included an initial hot start at 95 ◦ C for 10 min, followed by 40
cycles of 95 ◦ C for 30 s, 60 ◦ C for 1 min and 72 ◦ C for 30 s. Each real-
time PCR was ended by the addition of a dissociation curve analysis
of the amplified product, involving denaturation at 95 ◦ C for 1 min,
cooling to 50 ◦ C for 30 s and then gradual heating at 1 degree per
cycle to a final temperature of 95 ◦ C. Individual PCR products were
separated on 1% agarose gels and stained with SYBR green to exam-
ine their size and ensure that a single PCR product was detected for
each primer pair. The real-time PCR reaction was repeated three
times.
1.8. Statistical analysis
This study was designed with 4 biological replicates in a
split–split plot design using GenStat 12th edition. On the main plot
all bananas received either ethylene or not, followed by storage at
two temperatures (20 ◦ C and 30 ◦ C) on the sub-plot of the design.
The sub-sub plot had 4 removal times where bananas were evalu-
ated for changes in chemical and physical properties resulting from
ripening. The data was analyzed using an ANOVA procedure with a
polynomial contrast across the evaluation times. To provide a gen-
eral overview of the results, a principal component analysis (PCA)
was developed to outline the relationship between treatments as
described by the total volatiles, groups of esters, color (h◦ ), chloro-
phyll fluorescence and Fo.
2. Results
2.1. Color and chlorophyll fluorescence changes in banana
Banana ripening and degreening were affected by both temper-
ature and ethylene. Without ethylene treatment, fruit remained
green when stored at 20 ◦ C for 7 d. On the other hand, ethylene
treatment turned fruit yellow within 4 d at 20 ◦ C. Fruit stored at
30 ◦ C remained green regardless of ethylene treatment. The visual
color changes were confirmed by instrumental measurements: yel-
low fruit showed L* > 67, C* > 44 and h◦ < 97; green fruit had L* < 60,
C* < 40 and h◦ > 104 (Fig. 1).
To further confirm the correlation between peel degreening
and chloroplast functionality, we measured the chlorophyll flu-
orescence over time. Without ethylene treatment, only a slight
reduction of chlorophyll fluorescence was observed in banana fruit
at 20 ◦ C (Fig. 2). The value of Fv/Fm was about 0.8 before storage,
and stayed almost the same when stored at 20 ◦ C. During incuba-
tion at 30 ◦ C, Fv/Fm values in banana fell to 0.16 at 7 d. The ratio also
started to decrease rapidly after ripening was initiated by ethy-
lene treatment at both temperatures. Fv/Fm decreased faster in
the ethylene-treated fruit at 30 ◦ C than in those at 20 ◦ C. For the
ethylene-treated fruit at 20 ◦ C, the ratio fell to 0.32. Regardless of
the greenness of the fruit at 30 ◦ C after 7 d, the ratio for these fruit

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
4 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
Fig. 1. Changes in peel color of bananas during ripening at 20 ◦ C and 30 ◦ C after
treatment with ethylene. The peel color was evaluated by measurement of color
scores C* (p = 0.05), L* (p = 0.04) and Hue angle (h◦ ) (p = 0.035) values. The values
presented were measured from 4 biological replications. Error bars indicate standard
error of means.
declined to almost zero (Fig. 2A). The reduction of Fm was accel-
erated in banana at 30 ◦ C. Fm was reduced predominantly when
banana fruit were treated with ethylene, but the final Fm in 20 ◦ C-
ripening fruits were lower than that of the 30 ◦ C ripening fruits
(Fig. 2B). We further analyzed Fo, which decreased faster when
fruit were treated with ethylene at 20 ◦ C. In contrast, Fo increased
in banana fruit stored at 30 ◦ C during the first 4 days of storage. Fo
was affected by ethylene treatment in the first 4 days of storage
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
(Fig. 2C). Fv, which is the difference between Fm and Fo, showed
pattern similar to Fm (Fig. 2D).
2.2. Volatile compounds produced in banana
To exam the effect of temperature on volatile production in
banana fruit, concentration of flavour related volatiles during stor-
age was investigated. We identified 19 major volatile compounds
in whole banana (data not shown). Among all the esters that have
been detected in our present study, branched chain esters, such
as 2-methylpropyl acetate, 2-methylbutyl acetate, 3-methylbutyl
acetate, 2-methylpropyl butanoate, pentyl 2-methylpropanoate,
and 3-methylbutyl butanoate, were most abundant. In order to
reveal the temperature and ethylene effects on volatile forma-
tion, we determined the total volatile production emitted from
banana fruit (Fig. 3). When stored at 20 ◦ C, only a small accumula-
tion of total volatile compounds was found in non-ethylene-treated
banana. Higher temperature (30 ◦ C) initiated a faster synthesis of
volatile compounds and ethylene treatment further accelerated
this process. No difference was observed between 20 ◦ C-ripening
and 30 ◦ C-ripening banana fruits when they were treated with
ethylene.
Individual volatile compounds showed similar trends as the
total volatile production (Fig. 4). Statistical analysis revealed that
ethylene treatment significantly increased most of the individual
volatile compounds when compared with non-ethylene treated
banana fruit. Volatile compounds that produced in banana mainly
belong to acetate esters, butanoate esters, branched-chain esters
and hexanoate esters (Fig. 4A–D). Four acetate esters have been
identified, these being ethyl acetate, 2-methylpropyl acetate, butyl
acetate and 3-methylbutyl acetate (Fig. 4A), and the production
of these compounds was higher in banana stored at 30 ◦ C and
ethylene treated fruit, compared to that in non-ethylene treated
fruit stored at 20 ◦ C. The most formation of acetate esters was
observed in ethylene-treated fruit stored at 30 ◦ C. In our present
study, most butanoate esters were induced upon high temper-
ature at 30 ◦ C and ethylene treatment (Fig. 4B). No significant
difference was observed for butanoate esters when ethylene-
treated fruits were stored at 20 ◦ C and 30 ◦ C. Ethylene treatment
significantly increased the formation of branched-chain esters,
including 2-methylpropyl 2-methylpropanoate, 2-methylpropyl
3-methylbutanoate, butyl-3-methylbutanoate and 3-methylbutyl
2-methylbutanoate (Fig. 4C). High temperature at 30 ◦ C induced
branched-chain esters production in non-ethylene treated fruit,
while for 3-methylbutanoate esters, high temperature deduced the
production in ethylene treated fruit, especially at day 7 (Fig. 4C).
Banana produced only small amount of hexanoate esters and
ethylene treatment increased their production (Fig. 4D). Ethy-
lene treatment in combination with high temperature showed the
significant effect on hexyl hexanoate, comparing to that in fruit
ripened at 20 ◦ C. In addition to esters, 3-methyl-2-butanone was
also identified and found to be significantly changed to ethylene
and temperature (data not shown).
The principle component analysis outlines the correlation
between the esters, total volatiles, h◦ , Fo, Fv/Fm and their rela-
tionship to the treatment combinations (Fig. 5). The varieties used
explain 79% of the variation between the treatments on score 1
as a contrast between the volatiles vs. h◦ and Fv/Fm. Treatments
with ethylene and at both 20 and 30 ◦ C for 4 and 7 d showed high
in volatiles while being low in mean h◦ and Fv/Fm. On the second
score 17% of the treatment variation is explained as a weighted
average dominated by Fo. The score 2 variation separates the dif-
ferences between ethylene treatment at 20 ◦ C vs. 30 ◦ C. All volatiles
in the PCA were highly correlated and negatively correlated to the
h◦ and Fv/Fm. In this analysis, Fo was not correlated to any other
varieties tested.
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx 5

A 1.0 B 1800
1600
0.8 1400

Mean Fv/Fm
1200

Mean Fm
0.6
1000
800
0.4
- E 20 600 - E 20
- E 30 - E 30
0.2 + E 20 400 + E 20
+ E 30 200 + E 30

0.0 0
0 1 4 7 2 x SEM, n=4 0 1 4 7 2 x SEM, n=4

Day Day
C 600 D 1400

500 1200

1000
400
Mean Fo

Mean Fv
800
300
600
200
- E 20 400 - E 20
- E 30 - E 30
100 + E 20 + E 20
200
+ E 30 + E 30
0 0
0 1 4 7 2 x SEM, n=4 0 1 4 7 2 x SEM, n=4

Day Day

Fig. 2. Changes in the chlorophyll fluorescence of banana peel during 7 d of storage at 20 ◦ C and 30 ◦ C after treatment with ethylene. The values for Fv/Fm (p = 0.005), Fm
(p = 0.01), Fo (p < 0.001), and Fv (p = 0.031) presented were measured from 4 biological replications. Error bars indicate standard error of means.

2.3. Gene expression of aroma-related genes in banana BanAAT was strongly expressed in peel tissue and induced by
ethylene treatment when fruit were stored at both temperatures
The differences in volatile emissions encouraged us to assess at 20 ◦ C and 30 ◦ C (Fig. 6A). In ethylene treated fruit, expression
the gene expression involved in volatile biosynthesis in banana of BanAAT in peel was suppressed at 30 ◦ C comparing to that in
under influence of ethylene and temperature conditions (Fig. 6). fruit ripened at 20 ◦ C. However, strong expression of BanAAT was
BanAAT, BanADH (short and medium chain), BanPDC, BanHPL, Ban- found on day 4 in non-ethylene treated fruit when held at 30 ◦ C. The
LOX, and BanBCAT, which play an important role in the formation expression of BanAAT in pulp tissue was relatively low compared
of volatiles, were chosen and examined using real-time PCR. Both with peel, but similar pattern was found (Fig. 6B). We observed low
banana peel and pulp expressed all these genes, but clear difference levels of BanAAT gene expression in pre-ripe banana pulp and peel
in expression level was observed. Interestingly, with the process of tissues. Ethylene treatment significantly elevated the expression
fruit ripening, especially in the ethylene-treated fruit where ripen- level, especially in banana peel with levels being 200–250 folds
ing process was accelerated by ethylene treatment, expressions for higher in peel and 7–8 folds higher in pulp compared with fruit not
all the genes that were tested in our present study were increased. treated with ethylene.
Similar expression pattern of BanADH gene of medium-chain
in both peel and pulp was found as in BanAAT only with relative
less expression (Fig. 6C and D). Expression of BanADH gene of short
Total volatile production (nL kg S ), log10

1.5 chain was significantly enhanced by ethylene treatment in peel tis-

- E 20
- E 30 sue, however, no significant effect of ethylene was found on gene
1.0 expression in pulp tissue (Fig. 6F).
-1 -1

+ E 20
+ E 30 BanPDC was also expressed in both peel and pulp tissues and
0.5 expression at 30 ◦ C of BanPDC decreased during the storage at 20 ◦ C
from 1 d to 4 d. At 30 ◦ C BanPDC was strongly expressed in ethylene-
0.0 treated fruit at day 1, although it declined to a very low level by 4 d
(Fig. 6G). This increase in expression was also seen in pulp tissue
-0.5 (Fig. 6H).
Similar to AAT and ADH (short and medium chain), BanHPL
-1.0 expression was increased 3–5 folds by ethylene and temperature
at 30 ◦ C in peel (Fig. 6I). An early increase at day 1 by ethylene
-1.5 Ethy x Lin Eval; p = 0.002 treatment was also found in pulp tissue (Fig. 6J).
BanLOX was expressed in both banana peel and pulp tissues
0 1 4 7 2 x SEM, n=4
(Fig. 5K and L). For both banana peel and pulp, the transcription
Day level of BanLOX was highest at 1 d and exhibited lower expression at
4 d. At 30 ◦ C this decline of BanLOX expression was enhanced. Ethy-
Fig. 3. Changes of total volatile production in banana during 7 d of storage at 20 ◦ C
lene treatment resulted in different expression between peel and
and 30 ◦ C after treatment with ethylene. Ethylene treatment significantly increased
the total volatile compounds production (p = 0.029). The values presented were pulp. In peel tissue, the expression of BanLOX was not significantly
measured from 4 biological replications. Error bars indicate standard error of means. changed by ethylene. In pulp tissue, ethylene treatment markedly

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
6 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx

increased the expression level of BanLOX, especially for the fruit increases in membrane permeability and malondialdehyde (MDA)
stored at 20 ◦ C. content (Yang et al., 2009). Loss of green color is one of the symp-
Gene expression of BanBCAT was similar in both banana peel toms of ripening, senescence or different environmental stresses.
and pulp tissues (Fig. 6M and N). In both banana peel and pulp, By assessment of peel color change, we found that the banana peel
the transcription level of BanBCAT was highest at 1 d and exhibited stayed partially green when stored at 30 ◦ C, but turned completely
lower expression at 4 d. The expression of BanBCAT was signifi- yellow at 20 ◦ C. This contradiction was unique in banana compared
cantly induced by ethylene, with an exception on 4 d at 30 ◦ C, where to the most other fruits, which degreen at a faster rate at higher
BanBCAT expression increased. Ethylene treatment resulted in sim- temperature (Pang et al., 2008).
ilar expression in peel and pulp. Chlorophyll fluorescence is a sensitive and powerful tool to
monitor the physiological statues of chloroplast (Song et al., 1997a).
3. Discussion Fv/Fm is often used to illustrate the activity of photosystem II (PSII)
and has been used to indicate postharvest high temperature effects
Banana fruit stay green and fail to develop a full yellow peel on fruit, which is one of the most-sensitive sites in the photosyn-
and when ripened at temperatures above 24 ◦ C (Seymour et al., thetic apparatus and its activity is decreased significantly by high
1987). Our previous studies revealed that the banana fruit held at temperature (Berry and Bjorkman, 1980; Havaux, 1996). After 3
temperature of 30 ◦ C displayed faster softening, decrease in starch months storage at 0 ◦ C, Fv/Fm dropped to 0.2 in apple fruit treated
content, stronger expression of ethylene biosynthesis genes, and at 46 ◦ C for 12 h, compared with 0.5–0.6 for control fruit (Fan et al.,

A 1.0 0.5
Ethyl acetate 2-Methylpropyl acetate
a b
0.5 0.0
- E 20
0.0 - E 30
-0.5
Volatile production (nL kg-1 S-1), log10

+ E 20
-0.5 + E 30 -1.0
-1.0
-1.5
-1.5
-2.0
-2.0 Ethy x Lin Eval; p <0.01 Ethy x Quad Eval; p = 0.02
0.0 0.0
Butyl acetate 3-Methylbutyl acetate d
c
-0.5 -0.5

-1.0 -1.0

-1.5 -1.5

-2.0 -2.0
Temp x Lin Eval; p = 0.042 Ethy x Temp x Quad Eval; p <0.01
0 1 4 7 2 x SEM, n=4 0 1 4 7 2 x SEM, n=4
Day Day
B 0.50 2-Methylpropyl butanoate Butyl butanoate
a 0.0 b
- E 20
0.00 - E 30
Volatile production (nL kg S ), log10

+ E 20 -0.5
-0.50
+ E 30
-1.0
-1.00
-1 -1

-1.50 -1.5

-2.00
Ethy x Quad Eval; p =0.035 -2.0 Ethy x Quad Eval; p = 0.05

0.00 3-Methylbutyl butanoate c -1.40

Pentyl butanoate d
-1.50
-0.50
-1.60

-1.00 -1.70

-1.80
-1.50
-1.90
-2.00 Ethyl x Quad Eval; p =0.026 -2.00 Temp x Lin Eval; p =0.034
0 1 4 7 2 x SEM, n=4 0 1 4 7 2 x SEM, n=4

Day Day

Fig. 4. Production of selected individual volatile compounds production in banana during 7 d of storage at 20 ◦ C and 30 ◦ C after treatment with ethylene. Production was
expressed as log 10. Only the compounds that showed significant temperature effect are presented here. The values presented were measured from 4 biological replications.
Error bars indicate standard error of means. (A) Acetate esters; (B) butanoate esters; (C) branched esters; (D) hexanoate esters.

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx 7

-0.6
C -1.2 2-Methylpropyl-2-methylpropanoate
a 2-Methylpropyl-3-methylbutanoate
-0.8 b
- E 20
-1.4 -1.0
- E 30
+ E 20 -1.2

Volatile production (nL kg-1 S-1), log10

-1.6 + E 30 -1.4

-1.6
-1.8 -1.8

-2.0
-2.0 Ethy x Lin Eval; p = 0.001 -2.2 Ethy x Temp x Lin Eval; p = 0.011
-1.0
Buty-3-methylbutanoate 3-Methylbutyl-2-methylbutanoate
c 0.0 d
-1.2
-0.5
-1.4

-1.6 -1.0

-1.8
-1.5
-2.0
-2.0
-2.2 Ethy x Temp Quand Eval; p = 0.008 Ethy x Temp Quand Eval; p = 0.002
0 1 4 7 2 x SEM, n=4 0 1 4 7 2 x SEM, n=4

Day Day

D -1.0 2-Methylpropyl hexanoate

a
-1.2 - E 20
-1.4 - E 30
+ E 20
-1.6
+ E 30
-1.8

-2.0

-2.2

-2.4 Ethy x Temp Lin Eval; p <0.01

Volatile production (nL kg-1 S-1), log10

-0.80 3-Methylbutyl hexanoate

-1.00
b
-1.20

-1.40

-1.60

-1.80

-2.00

-2.20

-2.40 Ethy x Temp Quad Eval; p =0.013

-1.96 Hexyl hexanoate

c
-1.97

-1.98

-1.99

-2.00

-2.01
Ethy x Temp Quad Eval; p <0.01

0 1 4 7 2 x SEM, n=4

Day

Fig. 4. (Continued ).

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12
8 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
5 et al., 1996). High temperature at 30 ◦ C accelerated ester formation
4
3 (Figs. 3 and 4). Ethylene treatment induced volatile production at
2 both storage temperatures. Interestingly, no significant difference
1 G
Score 2, 17%
N
AMIF
E B 0 vidual volatiles (Fig. 4). Data for the volatile production in banana
-5 -4 -3 -2 C J -1D 0 1
-1
-2
-3
-4
-5
Score 1, 79%
Total volatiles
20 - 20°C
Acetate esters
30 - 30°C
Butanoate esters
Hexanoate esters
d - Day
e - Ethylene treatment
Branched chain esters
n - no Ethylene treatment
Mean H, colour
Fo fluorescence
Fv/Fm fluorescence
Fig. 5. PCA analysis of treatment conditions for the total volatiles, groups of esters,
color (h◦ ), chlorophyll fluorescence and Fo. Variables are labelled as indicated in
figure legends.
2005). A similar decrease of Fv/Fm was also found in broccoli, avo-
cado and mango fruits (Joyce and Shorter, 1994; Tian et al., 1996;
Woolf and Laing, 1996). In this study, Fv/Fm decreased from 0.8
to 0.35 upon the ethylene initiated fruit ripening and senescence
at 20 ◦ C (Fig. 2A), where banana turned completely yellow (Fig. 1).
Banana fruit maintain green color when stored at 30 ◦ C compared
to that at 20 ◦ C (Fig. 1), while Fv/Fm decreased sharply to 0–0.2
after 7 d storage, indicating that exposure to high temperature com-
pletely deactivate the PSII system (Fig. 2A). It was suggested that
high temperature-induced perturbation of thylakoid membranes
leads to the separation of light-harvesting chlorophyll a/b pro-
tein complexes of PSII (LHCII) from the PSII core complex and a
block of the PSII reaction center, which may cause the Fm decrease
and the Fo increase (Cao and Govindjee, 1990; Yamane et al.,
1997). In banana stored at 30 ◦ C, decrease in Fm level accompa-
nied an increase in the Fo level (Fig. 2B and C). When banana was
stored at 20 ◦ C, fruit peel degreening accompanied the decrease
in Fm level due to less fluorescent in PSII. Increase of Fo as a
response to stress such as low oxygen has been reported in apple
fruit (Wright et al., 2010). The chlorophyll fluorescence data indi-
cated that regularly degreened fruit (ethylene treated and stored
at 20 ◦ C) had low Chl content and (low Fo value), thus had low
photosystem II activity (low Fv/Fm). Volatile production in banana
fruit is an important quality index and plays an important role in
consumer consumption of bananas (Song and Forney, 2008). How-
ever, limited information has been reported about temperature
effects on banana volatile compounds formation. In our present
study, 19 volatile compounds, have been isolated and identified as
major volatile compounds produced after ethylene treatment and
in response to storage temperatures, there were 13 branched chain
esters and 5 straight chain esters. This is consistent with former
results that branched chain esters contribute typical banana aroma
characteristics (Myers et al., 1970; Tressl and Drawert, 1973), and
were previously reported as contributors of banana flavour (Salmon
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
ARTICLE IN PRESS
in non-ethylene treated banana compared to that at 20 ◦ C, which is
reflected in both total and individual volatile compound production
O
P for total esters was observed in ethylene-treated banana at the two
H temperatures (Fig. 3), but different profiles were found for the indi-
2 3 4 5 ripened at 20 ◦ C and 30 ◦ C suggest that the processes responsible for
generating esters may be affected by temperature at similar control
points of volatile biosynthesis pathway at both temperatures, such
K
L as due to enhanced respiration.
Volatile compound which dominant the flavour of ripe banana
mainly belonged to acetate esters, butanoate esters and branched-
chain esters, such as butyl acetate, 3-methylbutyl acetate,
3-methylbutyl butanoate, and 3-methylbutyl-2-methylbutanoate
which are biosynthesized from either lipids or amino acid pre-
A=n20d0 cursors through a series of enzyme-mediated steps (Sanz et al.,
B=n20d1
C=n20d4
1997; Tressl et al., 1970). The production of most volatile com-
D=n20d7 pounds was significantly increased by ethylene treatment. High
E=n30d0
F=n30d1 temperature induced some volatile compounds production in non-
G=n30d4 ethylene treated fruit. However, high temperature treatment only
H=n30d7
I=e20d0 induced certain groups of volatiles in ethylene treated fruit, includ-
J=e20d1
K=e20d4 ing acetate esters (Fig. 4). It is possible that banana stored at high
L=e20d7 temperature produced higher acetate esters, which may be respon-
M=e30d0
N=e30d1 sible for the differences between the flavour of green-ripe banana
O=e30d4 and yellow-ripe banana. More incorporation of acetate esters in
P=e30d7
high temperature treated banana suggest that acetyl-CoA might be
more freely available or a better co-substrate at high temperature.
This result was consistent with the previous observation that the
factor most limiting to ester production during banana ripening
was not the availability of the alcohol precursors, but may be the
availability of the precursor to the acid portion of the ester molecule
(Jayanty et al., 2002).
Increases of alcohols, such as ethanol, during maturation and
ripening were associated with increases in other aroma volatiles,
as they are one of the precursors of natural aroma compounds
(Defilippi et al., 2009). In banana, high temperature resulted in
banana fruit with strongly elevated levels of ethanol (data not
shown), ethyl acetate and other acetate esters (Fig. 4). Ethanol
and its esters are usually regarded as the components that con-
tribute of off-flavour developing in many fruit (Ke and Kader, 1990;
Rudell et al., 2002). These compounds could be very important for
the volatile profile in banana. Furthermore, the levels of ethanol
and ethanol-derived esters that cause off-flavour may vary con-
siderably among different types of fruits (Ke and Kader, 1990).
Whether ethanol and related esters are the major contributors to
the off-flavour in banana stored at high temperature remain to
be determined. Six-carbon (C6 ) volatile products, such as hexanol,
hexanal and related esters are released from the enzymatic action
of LOX pathway and form the basis of the ‘green-note’ flavour char-
acteristic of many fruits and vegetables (Hatanaka et al., 1987).
This group of volatiles is among the earliest to be released from
damaged tissue (Bate et al., 1998). It was also suggested that C6
volatile compounds were associated with the defence response as
signal molecules (Bate and Rothstein, 1998). Although banana only
produced a small amount of hexanoate esters, ripening and senes-
cence upon ethylene and high temperature treatment significantly
induced their production (Fig. 4D). PCA analysis revealed that the
increase of Fo as an indication of stress was caused by high tem-
perature, while there is a negative relationship between CF and h◦
with the increase of production of total volatiles with all group of
esters. This provided evidence that the banana fruit is under high
temperature stress and accelerated senescence.
Observation of different volatile profiles under different treat-
ments of ethylene and temperature raises the question of their
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx 9

Fig. 6. Expressions of banana volatile related genes (BanAAT, BanADH-medium chain, BanADH-short chain, BanPDC, Ban HPL, BanLOX, and BanBCAT) at day 1 and day 4 of
storage at 20 ◦ C and 30 ◦ C after treatment with ethylene. Quantitative real-time PCR was used to analyze the mRNA changes of banana volatile related genes in peel (A, C,
E, G, I, K, M) and pulp (B, D, F, H, J, L, N) as described in materials and methods. The y-axis represents the relative fold difference of mRNA level and was calculated using a
modified 2−Ct formula (Ramakers et al., 2003) with BanActin and BanS18 as references. The values presented were obtained from 3 biological replications and within each
replicate, each data point is the mean of values obtained from qPCR reaction performed in triplicate on one sample. Error bars indicate standard error of means.

Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
10 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
effects on the critical steps of volatile biosynthesis in banana. It
was reported in apple that it is often the first step and the last
steps contain enzymes that are ethylene regulated (Schaffer et al.,
2007). The large increase of volatile compounds formed in ethy-
lene treated banana suggested a role of ethylene as a regulator of
volatile accumulation during fruit ripening (Fig. 3). In the present
study, along with a higher volatile production, BanAAT gene expres-
sion was observed to be up-regulated in both banana peel and pulp
after ripening was initiated with ethylene (Fig. 6A and B), which was
consistent with a previous report (Medina-Suarez et al., 1997). Sim-
ilar findings were also reported in apple and melon where volatile
production was inhibited by 1-MCP treatment, or accelerated by
ethylene treatment (Defilippi et al., 2005; Yahyaoui et al., 2002).
Our analysis suggests that the final enzymatic step of esterification
of alcohols and acyl-CoAs by BanAAT is an important transcriptional
regulation point of ethylene for aroma production in banana. As
the ripening of banana fruit progressed, we observed a decrease in
BanAAT transcript levels and higher temperature accelerated this
decrease. However, BanAAT transcript levels did not correlate with
an increase in volatile production during ripening and high level of
volatile compounds at 30 ◦ C. Previous study has found that AAT may
be a stress-related gene and has an additional function as a fruit-
scent-related gene (Li et al., 2008). BAHD family members have
been classified into five major clades. BanAAT belongs to one of
subgroups in Clade V which consists mostly of enzymes that are
involved in volatile ester biosynthesis. However, BanAAT does not
belong to any of the other subgroups either in the type of sub-
strates used or the conditions under which it is active (D’Auria,
2006). Furthermore, based on the sequence homology to known
acyltransferases, the BanAAT enzyme is exceptional and does not
match any of the sequence groups (Beekwilder et al., 2004). These
findings raise the hypothesis that, besides volatile ester biosynthe-
sis, BanAAT may be involved in other aspects of banana ripening,
such as senescence and stress.
ADH is at the crossroad of alcohol formation upstream of the
LOX pathway or glycolysis and, therefore, may be one of the regu-
lation points of fruit volatile compounds production during fruit
ripening (Defilippi et al., 2009). According to the identification
of EST sequences (data not shown), two BanADH genes obtained
so far belong to two evolutionary groups, one characterized by
short protein chains which does not require zinc as a cofactor,
and another characterized by medium-chain zinc-binding pro-
tein. Medium-chain ADHs were involved in stress tolerance during
plants development and fruit storage (Matton et al., 1990), but also
played a role in aroma compounds biosynthesis during the pro-
cess of fruit ripening (Speirs et al., 1998). ADH genes are expressed
in a developmentally regulated manner during fruit ripening. In
grape berries, VvADH2, a zinc-binding medium-chain dehydroge-
nase, exhibited a transcript level 6–10-fold higher in ripe berries
than at onset of ripening (Tesniere and Verries, 2000). Le-ADH2,
one of ADH genes in tomato, may participate in the formation of
flavour volatiles during fruit ripening, where gene expression accu-
mulated during fruit ripening when there was a large increase in the
synthesis of flavour volatiles (Speirs et al., 1998). In non-ethylene
treated fruit, the expression of BanADH-medium chain declined
steadily during banana fruit ripening at 20 ◦ C, but dramatically
increased when ripening at 30 ◦ C (Fig. 6C and D). Ethylene treat-
ment increased its expression level in both peel and pulp, except
in the case of 30 ◦ C at 4 d where the expression was decreased.
BanADH-short chain belongs to the short-chain type of ADHs sub-
family, whose diversity in amino acid sequences can be related to
a wide range of biological functions and a wide range of substrates
(Jornvall, 1995). Similar to BanADH-medium chain, significant accu-
mulation in BanADH-short chain mRNA was observed in banana peel
tissue with ethylene treatment when ripened at 30 ◦ C (Fig. 6E and
F). It was suggested that both BanADH-medium chain and BanADH-
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
short chain may have an impact on flavour profiles by enhancing
alcohol supply for ester production during ripening. Alcohols and
their related esters were often regarded as indicators of plant injury
from stress (Toivonen, 1997). Enhanced emission of ethanol and
ethyl acetate have been previously reported in heat-stressed apple
and broccoli (Fan et al., 2005; Forney and Jordan, 1998), and was
also found in apples when stored at the high temperature of 46 ◦ C.
Pyruvate decarboxylase (PDC; EC 4.1.1.1) is one of the impor-
tant enzymes responsible for acetaldehyde production (Manning,
1998). The transcript levels of PaPDC from apricot and FaPDC3 from
strawberry remained quantitatively constant in all maturity stages
and ripening process (González-Agüero et al., 2009; Moyano et al.,
2004). Another PDC gene, FaPDC1 in strawberry was induced dur-
ing fruit ripening and was under hormonal control (Moyano et al.,
2004). We observed the presence of BanPDC transcript throughout
storage, although it decreased during fruit ripening and ethylene
treatment further inhibited its expression. Surprisingly, we noticed
an induction in ethylene treated fruit when incubated at 30 ◦ C at
day 1, followed by a sharp decrease (Fig. 6G and H). This induce-
ment may explain the increased production of ethyl acetate. It has
been reported in many plants that the expression of PDC genes
were induced under anaerobic conditions and the induction may
be the trigger for the onset of fermentation and ethanol production
(Moyano et al., 2004).
Fatty acids, which are oxidized in a reaction catalyzed by lipoxy-
genases (LOX) to C6 aldehydes, play a major role in ester synthesis
providing straight chains (Feussner and Wasternack, 2002). LOX
has been associated with the development of fruits. Within the
cloned fruit genes, expression of some isoforms of LOX increased
during fruit maturing and ripening, and was up-regulated by ethy-
lene treatment in tomato and kiwifruit (Griffiths et al., 1999; Zhang
et al., 2006). By contrast, BanLOX expression declined during banana
fruit ripening and was down-regulated by ethylene treatment and
high temperature in banana peel. This was negatively associated
with volatile accumulation after ethylene treatment (Fig. 6K and
L). Interestingly, expression of BanLOX was variable in different tis-
sues where the transcript abundance in banana pulp remarkably
increased when fruit were treated with ethylene. Among the roles
associated with plant development, is an association of LOX with
plant senescence and fruit ripening. A poor relationship between
LOX activity and fruit volatile production was found in ‘Golden
Delicious’ apples at early and mid-maturity harvests, while LOX
in late-harvested fruit associated with fruit senescence (Song and
Bangerth, 2003). It was suggested that BanLOX in banana pulp may
be more involved in aroma and flavour generation during banana
ripening, while the important role of BanLOX in banana peel may
be associated with senescence, resulting in cell breakdown, tissue
browning and loss of firmness. However, for more detailed anal-
ysis of the banana other LOX family genes are needed to reveal
the roles for BanLOX in banana ripening and development of fruit-
quality characteristics and the response of individual members to
post-harvest conditions, including ethylene induction of ripening
and high temperature response.
In the LOX pathway, HPL is an enzyme that cleaves a fatty acid
hydroperoxide (HPO) derived from the activity of a lipoxygenase
(LOX) into two carbonyl compounds, metabolizing either 9, or 13-
hydroperoxylinolic acid to aldehydes and keto acids. No increase
of gene expression of HPL has been found in apple fruit after ethy-
lene treatment (Schaffer et al., 2007). In our present study, the
expression of BanHPL seemed to be similar to BanAAT which were
induced by both ethylene and high temperature ripening (Fig. 6I
and J). However, the combination of ethylene and high tempera-
ture suppressed the expression level in both peel and pulp, which
did not correlate with the increase of volatile production in green-
ripe banana. These results indicated that BanHPL may not be the
regulation point of volatile production in green-ripe banana.
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
The pathways of the formation of branched amino acid-derived
volatiles has been well understood in microorganisms, such as
in lactic acid bacteria in cheese. In majority cases it was found
initially to involve transamination followed by decarboxylation.
Transamination is the initial step that leads to the formation of
aroma compounds (Fernández and Zúñiga, 2006). In contrast, only
a small family of BcAA transaminase (BCAT) genes in plant has been
characterized in some species such as potato (Solanum tuberosum),
Arobidopsis, barley (Hordeum vulgare), tobacco (Nicotiana benthami-
ana), and melon fruit (Campbell et al., 2001; Diebold et al., 2002;
Gao et al., 2009; Gonda et al., 2010; Malatrasi et al., 2006). Infor-
mation about the involvement of transaminases in plant volatile
biosynthesis is rare. Very recently, the study on melon fruit demon-
strated that CmBCAT1 is involved in the initial step of the formation
of amino acid-derived aroma compounds (Gonda et al., 2010).
We also observed that the expression level of BanBCAT is higher
in ethylene-treated banana fruit compared with non-ethylene-
treated fruit (Fig. 6M and N). Although higher temperature (30 ◦ C)
decreased the gene expression level in peel, high expression level
was still found in pulp which correlated well to volatile production
in banana fruit (Fig. 5M and N), indicating that BanBCAT may play
an important role in regulating the formation of branched aroma
compounds during banana fruit ripening.
In summary, we have investigated the changes in color and
chlorophyll fluorescence in green ripe banana fruit stored at 30 ◦ C
and concluded that green-ripening in banana is a high temperature
stress related phenomenon, even though chlorophyll degradation
in peel tissue was retarded. We have found that production of both
total volatile and individual compounds is related to treatment of
ethylene and high temperature. We have also demonstrated that
both ethylene and high temperature influence volatile biosynthesis
in banana fruit at transcriptional level in the volatile biosynthesis
pathway.
Acknowledgements
We thank Drs. Charles Forney and John DeLong at AAFC for
critical review, Micheal Jordan for technical assistance on volatile
analysis and Brad Walker for assistance on statistical analysis. We
thank the MOE and AAFC for the PhD fellowship provided to X.T.
Yang. We also thank the National Natural Science Foundation of
China (Grant No. 30871762) for the partial support.
References
Bate, N.J., Rothstein, S.J., 1998. C6 -volatiles derived from the lipoxygenase pathway
induce a subset of defense-related genes. The Plant Journal 16, 561–569.
Bate, N.J., Sivasankar, S., Moxon, C., Riley, J.M.C., Thompson, J.E., Rothstein, S.J.,
1998. Molecular characterization of an Arabidopsis gene encoding hydroperox-
ide lyase, a cytochrome P-450 that is wound inducible. Plant Physiology 117,
1393–1400.
Beekwilder, J., Alvarez-Huerta, M., Neef, E., Verstappen, F.W.A., Bouwmeester, H.J.,
Aharoni, A., 2004. Functional characterization of enzymes forming volatile esters
from strawberry and banana. Plant Physiology 135, 1865–1878.
Berry, J., Bjorkman, O., 1980. Photosynthetic response and adaptation to temperature
in higher plants. Annual Review of Plant Physiology 31, 491–543.
Blackbourn, H.D., Jeger, M.J., John, P., Thompson, A.K., 1990. Inhibition of degreening
in the peel of bananas ripened at tropical temperatures. III. Changes in plas-
tid ultrastructure and chlorophyll-protein complexes accompanying ripening
in bananas and plantains. Annals of Applied Biology 117, 147–161.
Campbell, M.A., Patel, J.K., Meyers, J.L., Myrick, L.C., Gustin, J.L., 2001. Genes encoding
for branched-chain amino acid aminotransferase are differentially expressed in
plants. Plant Physiology and Biochemistry 39, 855–860.
Cao, J., Govindjee, 1990. Chlorophyll a fluorescence transient as an indicator of active
and inactive photosystem II in thylakoid membranes. Biochimica et Biophysica
Acta (BBA) – Bioenergetics 1015, 180–188.
D’Auria, J.C., 2006. Acyltransferases in plants: a good time to be BAHD. Current
Opinion in Plant Biology 9, 331–340.
Defilippi, B.G., Kader, A.A., Dandekar, A.M., 2005. Apple aroma: alcohol acyltrans-
ferase, a rate limiting step for ester biosynthesis, is regulated by ethylene. Plant
Science 168, 1199–1210.
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
11
Defilippi, B.G., Manríquez, D., Luengwilai, K., González-Agüero, M., 2009. Chapter
1 Aroma volatiles. Biosynthesis and mechanisms of modulation during fruit
ripening. Advances in Botanical Research 50, 1–37.
Diebold, R., Schuster, J., Daschner, K., Binder, S., 2002. The branched-chain amino
acid transaminase gene family in Arabidopsis encodes plastid and mitochondrial
proteins. Plant Physiology 129, 540–550.
Ding, P., Ahmad, S.H., Razak, A.R.A., Saari, N., Mohamed, M.T.M., 2007. Plastid
ultrastructure, chlorophyll contents, and colour expression during ripening of
Cavendish banana (Musa acuminata ‘Williams’) at 18 ◦ C and 27 ◦ C. New Zealand
Journal of Crop and Horticultural Science 35, 201–210.
Endah, R., Beyene, G., Kiggundu, A., van den Berg, N., Schlüter, U., Kunert, K., Chik-
wamba, R., 2008. Elicitor and Fusarium-induced expression of NPR1-like genes
in banana. Plant Physiology and Biochemistry 46, 1007–1014.
Fan, L., Song, J., Forney, C.F., Jordan, M.A., 2005. Ethanol production and chlorophyll
fluorescence predict breakdown of heat-stressed apple fruit during cold storage.
Journal of the American Society for Horticultural Science 130, 237–243.
Fernández, M., Zúñiga, M., 2006. Amino acid catabolic pathways of lactic acid bac-
teria. Critical Reviews in Microbiology 32, 155–183.
Feussner, I., Wasternack, C., 2002. The lipoxygenase pathway. Annual Review of Plant
Biology 53, 275–297.
Forney, C.F., Jordan, M.A., 1998. Induction of volatile compounds in broccoli by
postharvest hot-water dips. Journal of Agricultural and Food Chemistry 46,
5295–5301.
Fu, H.C., Hu, J.M., Hung, T.H., Su, H.J., Yeh, H.H., 2009. Unusual events involved in
Banana bunchy top virus strain evolution. Phytopathology 99, 812–822.
Gao, F., Wang, C., Wei, C., Li, Y., 2009. A branched-chain aminotransferase may
regulate hormone levels by affecting KNOX genes in plants. Planta 230, 611–623.
Gonda, I., Bar, E., Portnoy, V., Lev, S., Burger, J., Schaffer, A.A., Tadmor, Y., Gepstein,
S., Giovannoni, J.J., Katzir, N., Lewinsohn, E., 2010. Branched-chain and aromatic
amino acid catabolism into aroma volatiles in Cucumis melo L. fruit. Journal of
Experimental Botany 61, 1111–1123.
González-Agüero, M., Troncoso, S., Gudenschwager, O., Campos-Vargas, R., Moya-
León, M.A., Defilippi, B.G., 2009. Differential expression levels of aroma-related
genes during ripening of apricot (Prunus armeniaca L.). Plant Physiology and
Biochemistry 47, 435–440.
Griffiths, A., Barry, C., Alpuche-Solis, A., Grierson, D., 1999. Ethylene and develop-
mental signals regulate expression of lipoxygenase genes during tomato fruit
ripening. Journal of Experimental Botany 50, 793–798.
Hatanaka, A., Kajiwara, T., Sekiya, J., 1987. Biosynthetic pathway for C6 -aldehydes
formation from linolenic acid in green leaves. Chemistry and Physics of Lipids
44, 341–361.
Havaux, M., 1996. Short-term responses of Photosystem I to heat stress. Induction of
a PS II-independent electron transport through PS I fed by stromal components.
Photosynthesis Research 47, 85–97.
Jayanty, S., Song, J., Rubinstein, N.M., Chong, A., Beaudry, R.M., 2002. Temporal rela-
tionship between ester biosynthesis and ripening events in bananas. Journal of
the American Society for Horticultural Science 127, 998–1005.
Jornvall, H., 1995. Short-chain dehydrogenases/reductases (SDR). Biochemistry 34,
6003–6013.
Joyce, D.C., Shorter, A.J., 1994. High-temperature conditioning reduces hot
water treatment injury of ‘Kensington Pride’ mango fruit. HortScience 29,
1047–1051.
Ke, D., Kader, A.A., 1990. Tolerance of ‘Valencia’ oranges to controlled atmospheres
as determined by physiological responses and quality attributes. Journal of the
American Society for Horticultural Science 115, 779–783.
Li, D., Shen, J., Wu, T., Xu, Y., Zong, X., Shu, H., 2008. Overexpression of the apple
alcohol acyltransferase gene alters the profile of volatile blends in transgenic
tobacco leaves. Physiologia Plantarum 134, 394–402.
Liu, T.T., Yang, T.S., 2002. Optimization of solid-phase microextraction analysis for
studying change of headspace flavor compounds of banana during ripening.
Journal of Agricultural and Food Chemistry 50, 653–657.
Macku, C., Jennings, W.G., 1987. Production of volatiles by ripening bananas. Journal
of Agricultural and Food Chemistry 35, 845–848.
Malatrasi, M., Corradi, M., Svensson, J., Close, T., Gulli, M., Marmiroli, N., 2006. A
branched-chain amino acid aminotransferase gene isolated from Hordeum vul-
gare is differentially regulated by drought stress. TAG Theoretical and Applied
Genetics 113, 965–976.
Manning, K., 1998. Isolation of a set of ripening-related genes from strawberry:
their identification and possible relationship to fruit quality traits. Planta 205,
622–631.
Matton, D.P., Constabel, P., Brisson, N., 1990. Alcohol dehydrogenase gene expression
in potato following elicitor and stress treatment. Plant Molecular Biology 14,
775–783.
Medina-Suarez, R., Manning, K., Fletcher, J., Aked, J., Bird, C.R., Seymour, G.B., 1997.
Gene expression in the pulp of ripening bananas (two-dimensional sodium
dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation prod-
ucts and cDNA cloning of 25 different ripening-related mRNAs). Plant Physiology
115, 453–461.
Moyano, E., Encinas-Villarejo, S., López-Ráez, J.A., Redondo-Nevado, J., Blanco-
Portales, R., Bellido, M.L., Sanz, C., Caballero, J.L., Muñoz-Blanco, J., 2004.
Comparative study between two strawberry pyruvate decarboxylase genes along
fruit development and ripening, post-harvest and stress conditions. Plant Sci-
ence 166, 835–845.
Myers, M.J., Issenberg, P., Wick, E.L., 1970. l-Leucine as a precursor of isoamyl alcohol
and isoamyl acetate, volatile aroma constituents of banana fruit discs. Phyto-
chemistry 9, 1693–1700.
G Model
POSTEC-9315; No. of Pages 12 ARTICLE IN PRESS
12 X. Yang et al. / Postharvest Biology and Technology xxx (2011) xxx–xxx
Pang, X.Q., Yang, X.T., Zhang, Z.Q., 2008. Chlorophyll degradation and its control in
postharvest fruits. Stewart Postharvest Review 4, 1–4.
Petracek, P.D., Joles, D.W., Shirazi, A., Cameron, A.C., 2002. Modified atmosphere
packaging of sweet cherry (Prunus avium L., ev. ‘Sams’) fruit: metabolic responses
to oxygen, carbon dioxide, and temperature. Postharvest Biology and Technol-
ogy 24, 259–270.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Research, 29.
Pollack, S., Perez, A., 2008. Fruit and Tree Nuts Sitiuation and Outloook Yearbook.
USDA.
Ramakers, C., Ruijter, J.M., Lekanne Deprez, R.H., Moorman, A.F.M., 2003.
Assumption-free analysis of quantitative real-time polymerase chain reaction
(PCR) data. Neuroscience Letters 339, 62–66.
Rudell, D.R., Mattinson, D.S., Mattheis, J.P., Wyllie, S.G., Fellman, J.K., 2002. Investi-
gations of aroma volatile biosynthesis under anoxic conditions and in different
tissues of ‘Redchief Delicious’ apple fruit (Malus domestica Borkh.). Journal of
Agricultural and Food Chemistry 50, 2627–2632.
Salmon, B., Martin, G.J., Remaud, G., Fourel, F., 1996. Compositional and isotopic
studies of fruit flavours. Part I. The banana aroma. Flavour and Fragrance Journal
11, 353–359.
Sanz, C., Olias, J.M., Perez, A.G., 1997. Aroma biochemistry of fruits and vegetables.
Phytochemistry of Fruit and Vegetables, 125–155.
Schaffer, R.J., Friel, E.N., Souleyre, E.J.F., Bolitho, K., Thodey, K., Ledger, S., Bowen,
J.H., Ma, J.H., Nain, B., Cohen, D., Gleave, A.P., Crowhurst, R.N., Janssen, B.J., Yao,
J.L., Newcomb, R.D., 2007. A genomics approach reveals that aroma produc-
tion in apple is controlled by ethylene predominantly at the final step in each
biosynthetic pathway. Plant Physiology 144, 1899–1912.
Seymour, G.B., John, P., Thompson, A.K., 1987. Inhibition of degreening in the peel
of bananas ripened at tropical temperatures. I. Effect of high temperature on
changes in the pulp and peel during ripening. Annals of Applied Biology 110,
153–161.
Shiota, H., 1993. New esteric components in the volatiles of banana fruit (Musa
sapientum L.). Journal of Agricultural and Food Chemistry 41, 2056–2062.
Song, J., Bangerth, F., 2003. Fatty acids as precursors for aroma volatile biosynthesis in
pre-climacteric and climacteric apple fruit. Postharvest Biology and Technology
30, 113–121.
Song, J., Deng, W., Beaudry, R.M., Armstrong, P.R., 1997a. Changes in chlorophyll fluo-
rescence of apple fruit during maturation, ripening, and senescence. HortScience
32, 891–896.
Song, J., Forney, C.F., 2008. Flavour volatile production and regulation in fruit. Cana-
dian Journal of Plant Science 88, 537–550.
Song, J., Gardner, B.D., Holland, J.F., Beaudry, R.M., 1997b. Rapid analysis of volatile
flavor compounds in apple fruit using SPME and GC/Time-of-Flight Mass Spec-
trometry. Journal of Agricultural and Food Chemistry 45, 1801–1807.
Speirs, J., Lee, E., Holt, K., Yong-Duk, K., Scott, N.S., Loveys, B., Schuch, W., 1998.
Genetic manipulation of alcohol dehydrogenase levels in ripening tomato fruit
Please cite this article in press as: Yang, X., et al., Effect of high temperature on color, chlorophyll fluorescence and volatile biosynthesis
in green-ripe banana fruit. Postharvest Biol. Technol. (2011), doi:10.1016/j.postharvbio.2011.06.011
View publication stats
affects the balance of some flavor aldehydes and alcohols. Plant Physiology 117,
1047–1058.
Tesniere, C., Verries, C., 2000. Molecular cloning and expression of cDNAs encoding
alcohol dehydrogenases from Vitis vinifera L. during berry development. Plant
Science 157, 77–88.
Tian, M.S., Woolf, A.B., Bowen, J.H., Ferguson, I.B., 1996. Changes in color and chloro-
phyll fluorescence of broccoli florets following hot water treatment. Journal of
the American Society for Horticultural Science 121, 310–313.
Toivonen, P.M.A., 1997. Non-ethylene, non-respiratory volatiles in harvested fruits
and vegetables: their occurrence, biological activity and control. Postharvest
Biology and Technology 12, 109–125.
Tressl, R., Drawert, F., 1973. Biogenesis of banana volatiles. Journal of Agricultural
and Food Chemistry 21, 560–565.
Tressl, R., Drawert, F., Heimann, W., Emberger, R., 1970. About the biogenesis of
aroma substances in plants and fruits. VI. Esters, alcohols, carbonyl-compounds
and phenolether as constituents of banana-aroma. Zeitschrift für Lebensmittel-
Untersuchung und Forschung 142, 313–321.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Spele-
man, F., 2002. Accurate normalization of real-time quantitative RT-PCR data
by geometric averaging of multiple internal control genes. Genome Biology 3,
research0034.0031–research0034.0011.
Wan, C.Y., Wilkins, T.A., 1994. A modified hot borate method significantly enhances
the yield of high-quality RNA from cotton (Gossypium hirsutum L.). Analytical
Biochemistry 223, 7–12.
Woolf, A.B., Laing, W.A., 1996. Avocado fruit skin fluorescence following hot water
treatments and pretreatments. Journal of the American Society for Horticultural
Science 121, 147–151.
Wright, H., DeLong, J., Harrison, P.A., Gunawardena, A.H.L.A.N., Prange, R., 2010.
The effect of temperature and other factors on chlorophyll a fluorescence and
the lower oxygen limit in apples (Malus domestica). Postharvest Biology and
Technology 55, 21–28.
Yahyaoui, F.E.L., Wongs-Aree, C., Latché, A., Hackett, R., Grierson, D., Pech, J.-C., 2002.
Molecular and biochemical characteristics of a gene encoding an alcohol acyl-
transferase involved in the generation of aroma volatile esters during melon
ripening. European Journal of Biochemistry 269, 2359–2366.
Yamane, Y., Kashino, Y., Koike, H., Satoh, K., 1997. Increases in the fluores-
cence F(o) level and reversible inhibition of photosystem II reaction center
by high-temperature treatments in higher plants. Photosynthesis Research 52,
57–64.
Yang, X., Pang, X., Xu, L., Fang, R., Huang, X., Guan, P., Lu, W., Zhang, Z., 2009. Accu-
mulation of soluble sugars in peel at high temperature leads to stay-green ripe
banana fruit. Journal of Experimental Botany 60, 4051–4062.
Zhang, B., Chen, K., Bowen, J., Allan, A., Espley, R., Karunairetnam, S., Ferguson, I.,
2006. Differential expression within the LOX gene family in ripening kiwifruit.
Journal of Experimental Botany 57, 3825–3836.