Carbohydrate Polymers 237 (2020) 116163

Contents lists available at ScienceDirect

Carbohydrate Polymers
journal homepage: www.elsevier.com/locate/carbpol

The effect of doxycycline-containing chitosan/carboxymethyl chitosan T

nanoparticles on NLRP3 inflammasome in periodontal disease
Shuo Xua,b, Qihui Zhouc, Zhongxin Jiangd, Yanwen Wange, Kai Yanga,b, Xiaohui Qiua,b,
Qiuxia Jia,*
a
Department of Periodontology, The Affiliated Hospital of Qingdao University, Qingdao, 266003, China
b
School of Stomatology of Qingdao University, Qingdao, 266003, China
c
Institute for Translational Medicine, State Key Laboratory of Bio-fibers and Eco-textiles, Qingdao University, Qingdao, 266021, China
d
Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, 266003, China
e
Stuart Country Day School of the Sacred Heart, 1200 Stuart Road, Princeton, New Jersey, 08628, United States

A R T I C LE I N FO A B S T R A C T

Keywords: A polyelectrolyte complex nanoparticle comprising chitosan (CS) and carboxymethyl chitosan (CMCS) was
Chitosan prepared (CS/CMCS-NPs) by ionic gelation, which was then used as a doxycycline carrier (Dox:CS/CMCS-NPs).
Carboxymethyl chitosan The obtained CS/CMCS-NPs and Dox:CS/CMCS-NPs were characterized for various parameters and bacterio-
Doxycycline static ability against Porphyromonas gingivalis. The regulation of related genes and proteins of NLRP3 in-
NLRP3 inflammasome
flammasome and IL-1β in human gingival fibroblasts (HGFs) was characterized by qRT-PCR, western blotting
Periodontitis
and ELISA. The results showed that Dox:CS/CMCS-NPs had an orderly morphology and an excellent cyto-
compatibility. P. gingivalis was strongly inhibited by Dox:CS/CMCS-NPs contrasted with control group. Dox:CS/
CMCS-NPs effectively down-regulated both gene and protein levels of NLRP3 inflammasome and IL-1β in HGFs.
This study provides a new method for rational application of Dox in the clinical treatment of periodontal disease
and a new direction for explaining the mechanism of action of Dox:CS/CMCS-NPs and more drug-carrying
nanoparticles.

1. Introduction through a series of signal transduction pathways and activate acquired

Periodontal disease is an infectious bacterial disease occurring in
periodontal supporting tissues (Sanz et al., 2017). It is a common and
frequently occurring disease that can lead to continuous irreversible
destruction of periodontal supporting tissues, which will eventually
lead to the loss of teeth and seriously affect quality of life(Kassebaum
et al., 2014). Dental plaque is the initiating factor of periodontitis. Host
responses caused by periodontal pathogens in the subgingival area play
a crucial role in the destruction of connective tissue and bone (Graves,
2008). Immune response is closely related to the occurrence and de-
velopment of periodontal disease (Chatzopoulos, Mansky, Lunos,
Costalonga, & Wolff, 2019; Jing et al., 2019; Zhang & Deng, 2019).
NLRP3 inflammasome plays an important role in regulating innate
immune responses in chronic inflammatory diseases such as period-
ontitis (Olsen & Yilmaz, 2016).Pattern recognition receptors (PRRs) are
an important component of the innate immune system that can re-
cognize pathogen-associated molecular patterns (PAMPs) and danger-
associated molecular patterns (DAMPs), release inflammatory factors
immunity (Schenten & Medzhitov, 2011). NOD-like receptors (NLRs)
are a class of intracytoplasmic PRRs, with an activation of multiple
protein complexes, or inflammasomes typical structure, after ligand
recognition. NLRP3 inflammasome is the most intensively-studied in-
flammasome complex, comprising NLRP3, ASC and Caspase-1. After
activation, NLRP3 can interact with the adaptor protein ASC to recruit
Caspase-1 and lead to the autocatalysis of Caspase-1, which splits into
active p20 and p10 fragments and shears pro-IL-1β and pro-IL-18. This
generates mature cytokines IL-1β and IL-18, which are released to the
outside of the cell and play a role in immunity and inflammation
(Hansen, Vojtech, & Laing, 2011). The main pathogenic bacteria of
periodontal disease include Porphyromonas gingivalis, Tannerella for-
sythia and Prevotella intermedia (Hajishengallis, 2015). Porphyromonas
gingivalis (P. gingivalis), a gram-negative obligate anaerobic bacterium,
is the dominant bacteria in periodontal disease, especially in a lesion
area or active site of chronic periodontitis. It is closely associated with
NLRP3 inflammasome activation. Inflammasomes recognize the fla-
gellin and secreting system components of pathogens by the Naip

⁎
Corresponding author.
E-mail address: jqx_1@163.com (Q. Ji).

https://doi.org/10.1016/j.carbpol.2020.116163
Received 10 July 2019; Received in revised form 10 March 2020; Accepted 11 March 2020
Available online 12 March 2020
0144-8617/ © 2020 Elsevier Ltd. All rights reserved.
S. Xu, et al.
subfamily proteins in the nod-like receptor family (Hajishengallis et al.,
2011; Huck, Elkaim, Davideau, & Tenenbaum, 2015; Lian et al., 2018).
Therefore, NLRP3 inflammasome inhibition is a new strategy for
treating periodontitis.
Periodontal scaling and periodontal curettage are the main clinical
treatment methods for periodontitis. Recently, local drug delivery sys-
tems have gained increasing attention owing to their better perfor-
mance than systemic administration (Jain et al., 2008). Chitosan (CS),
one of the natural cationic polysaccharide, has good histocompatibility,
biodegradation and non-toxicity (Goncalves, Antunes, & Barbosa, 2012;
Ragelle et al., 2014). Increasing attention has also been paid to the
regulatory effect of chitosan nanoparticles (NPs) on immunity (Gjoseva
et al., 2018). Carboxymethyl chitosan (CMCS) is a water-soluble chit-
osan derivative with good biocompatibility and tissue compatibility
(Gujarathi, Rane, & Patel, 2012). Negatively-charged CMCS can form
polyelectrolyte complexes with positively-charged CS through electro-
static interaction, which can then be used to encapsulate drugs and
better penetrate the internal mucosal barrier (Feng et al., 2014). These
CS/CMCS nanoparticles are more stable than pure CS nanoparticles,
and have better water solubility and better tolerance to acidic en-
vironment, so we speculated that they are more suitable for periodontal
pocket (Feng et al., 2014).
Doxycycline (Dox) is a semi-synthetic second-generation tetra-
cycline, an effective tetracycline antibiotic for periodontitis (Buduneli
et al., 2004; Nelson & Levy, 2011; Preshaw, 2018). Dox can inhibit
periodontal pathogen activity and down-regulate NLRP3 inflammasome
(Hu et al., 2018; Zhang et al., 2017). However, the direct application of
Dox in local, especially an oral environment, still has some problems,
such as systemic exposure and off-target toxicity, not sufficient local
delivery, poor response rate of this disease to systemic Dox (Golub
et al., 2016). Therefore, we need a new drug carrier, preferably with a
certain degree of targeting and slow release, can better play the role of
Dox. The gums are thin and the gingival sulcus is shallow, making it
difficult for traditional drug paste or film to fit into the gingival sulcus.
Previous studies have shown that nanoparticles are much more absor-
bent than microparticles, so it would be better to build a mobile drug
nanocarrier that can go into the gingival sulcus and function
(Gregoriadis, 1978).
At present, there is little research on the mechanism of action of
nanoparticles in reducing inflammation. For periodontal disease, the
inflammasome pathway may be a good entry point (Xu et al., 2019). So,
this study aimed to construct the effect of Dox:CS/CMCS-NPs on NLRP3
inflammasome and IL-1β in a human gingival fibroblasts (HGFs) in-
flammatory model stimulated by Porphyromonas gingivalis-lipopoly-
saccharide (P. gingivalis-LPS) and find a new pathway for the treatment
of periodontal disease.
2. Materials and methods
2.1. Materials
CS (molecular weight, MW:10 kDa, degree of deacetylation, DD: 89
%) and CMCS (MW: 12 kDa, DD: 81 %, degree of substitution, DS: 92
%) was supplied by Department of Marine biology, Ocean University of
China. Triphenyl phosphate (TPP) was purchased from Sigma (St. Louis,
USA). Alpha minimum essential medium (α-MEM), fetal bovine serum,
penicillin/ streptomycin and trypsin in this experiment were purchased
from Biological Industries (Kibbutz Beit Haemek, Israel). Doxycycline,
phosphate buffer saline (PBS) solution, Tryptic Soy Agar (TSA) medium
and Cell Counting Kit-8 (CCK-8) assay were provided by Solarbio
(Shanghai, China). Porphyromonas gingivalis ATCC 33277 was supplied
by microbial culture preservation center of Guangdong Province
Guangzhou, China. Bacterial culture bottle was supplied by BD BACTEC
Benex Limited Dun Laoghaire, Ireland. Porphyromonas gingivalis
Lipopolysaccharide (P. gingivalis-LPS) was supplied provided by
InvivoGen (San Diego, USA). Adenosine Triphosphate (ATP) was
2
Carbohydrate Polymers 237 (2020) 116163
obtained by MedChemExpress (Monmouth Junction, USA). Human IL-
1β ELISA Kit was purchased by Elabscience (Wuhan, China). RNAiso
Plus, PrimeScript™ RT reagent Kit with gDNA Eraser and TB Green™
Premix Ex Taq™ II were provided by Takara (Dalian, China). PCR
Primers were supplied by Sangon Biotech (Wuhan, China). All other
reagents were analytical grade and were used without further pur-
ification. The experiment was approved by the Ethics Committee of The
Affiliated Hospital of Qingdao University approval no. QYFY WZLL
25589.
2.2. Preparation of CS/CMCS-NPs and Dox:CS/CMCS-NPs
NPs were prepared by a simple ion crosslinking method. A Dox
aqueous solution (1 mg/ml, 1 ml) and CS solution (3 mg/ml, 1 ml,
dissolved by 1 % acetic acid, pH 6.0) were pre-mixed at room tem-
perature and constant velocity for 30 min under magnetic agitation
(IKA C-MAG HS 4) and different concentrations of CMCS (4 mg/ml, 1
ml) and TPP (5 mg/ml, 100 μl) were stirred with the mixture for 1 h to
form nanoparticles at room temperature and constant velocity under
magnetic agitation. It is worth mentioning that in the experiment, we
selected 0.5, 1, 2, 5 mg/ml Dox solutions for the synthesis of nano-
particles, but only 1 mg/ml Dox solution produced the most stable
nanoparticles with the most regular appearance, so we finally de-
termined the concentration of 1 mg/ml Dox in the experiment. The
obtained NPs were washed three times with deionized water, collected
by ultrafast centrifugation BECKMAN COULTER at 12000 RPM for 30
min, and then freeze-dried LABCONCO at −50 ℃ and vacuum for 48 h.
2.3. Characterization of the prepared CS/CMCS-NPs and Dox:CS/CMCS-
NPs
The morphology of CS/CMCS-NPs and Dox:CS/CMCS-NPs was ob-
served via scanning electron microscopy (SEM) (VEGA3, TESCAN,
China) and transmission electron microscopy (TEM) (Spectra 300,
Thermo Fisher Scientific, USA).
The size analysis and zeta potential of NPs were determined using a
particle size analyzer (Microtrac Nanotrac Wave Ⅱ). The obtained
samples were not filtered and diluted prior to testing.
To determine Dox loading and encapsulation efficiency, the free
Dox in the supernatants was filtered (0.45 μm), and the absorbance of
Dox at 273 nm was recorded by a spectrophotometer. The encapsula-
tion efficiency (EE) (Eq. 1) and loading capacity (LC) (Eq. 2) were ex-
pressed by the following equation (Feng et al., 2014):
total amount of Dox added − free Dox
EE (%) = × 100
total amount of Dox added (1)
total amount of Dox added − free Dox
LC (%) = × 100
weight of nanoparticles (2)
2.4. Bacteriostatic testing
P. gingivalis ATCC 33277 was used to identify antibacterial activity
of CS/CMCS-NPs and Dox:CS/CMCS-NPs. It was inoculated in culture
bottle at 37 °C, under anaerobic conditions, and cultured by water bath
thermostat JBXL-70X, Jingbo at 200 rpm for 5 days. In the experimental
group, 500 μg/ml CS/CMCS-NPs and Dox:CS/CMCS-NPs were added
and cultured for 5 days under the same conditions. The cultured bac-
terial liquid was coated on the blood plate with TSA medium, and the
number of bacterial colonies was observed after culture at 37 °C for 5
days.
2.5. Cell culture, identification and effect of Dox:CS/CMCS-NPs on cell
viability
Primary HGFs were derived from adolescent gingival tissues
S. Xu, et al.
removed during alveolar surgery at the Department of Stomatology, the
Affiliated Hospital of Qingdao University. The present study with the
patients’ informed consent was approved by the Research Ethics
Committee of the Affiliated Hospital of Qingdao University, P.R. China.
The cells were cultured in complete medium, α-MEM containing 10 %
fetal bovine serum and 1 % penicillin/streptomycin, in a humidified
incubator of 5 % CO2 at 37 °C. Cells passaged three to five times were
used in the following analysis. HGFs were identified by immuno-
fluorescence staining with anti-vimentin (VIM) and anti-cytokeratin
(CK).
Studies on cytocompatibility of P. gingivalis-LPS were carried out in
the supplementary material (Figs. S1 and S2) to determine the required
concentration of LPS in the experiment. HGFs at a density of 103 were
incubated with CS/CMCS-NPs and Dox:CS/CMCS-NPs (0–1000 μg/ml)
for 24, 48 and 72 h at 37 °C in a 96-well cell culture plate and 10 μl/
well CCK-8 was added. After incubating for 2 h at 37 °C, the optical
density of the samples at 450 nm was measured.
2.6. Total RNA isolation and quantitative real-time polymerase chain
reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA)
The total RNA from induced, treated and normal HGFs was isolated
using the RNAiso Plus (TRIzol method). RNA was reverse transcribed
using the RT reagent Kit with gDNA Eraser. The cDNA was synthesized
for SYBR Assay in the Light Cycler LC480 (Roche). mRNA expression
was normalized to the levels of the housekeeping gene GAPDH. The
relative level of expression of a gene was calculated using the 2−ΔΔCt
method. Primers are listed in the Supplementary Table 1.
The cell culture supernatant from HGFs were collected, centrifuged
by centrifuge tube (1 ml) for 10 min at 250×g and stored at −20 °C for
cytokine measurement. The level of IL-1β was measured with a com-
mercial ELISA kit following the manufacturers’ protocols.
2.7. Western blot analysis
The total protein from induced, treated and normal HGFs was col-
lected by lysing in (5×) Laemmli SDS buffer containing 0.01 % bro-
mophenol blue, 1 % β-mercaptoethanol, and a protease inhibitor
cocktail (Roche). Subsequently, equal amounts of protein were sepa-
rated by SDS-PAGE gels and transferred onto PVDF membranes. After
blocking with 5 % fat-free milk, the membranes were washed with
TBST and incubated with primary and secondary antibodies according
to the manufacturers’ instructions. Primary antibodies against NLRP3
(1:1000), ASC (1:1000), caspase-1 (1:1000) and IL-1β (1:1000) were
from Cell Signaling Technology. Secondary HRP-linked antibodies
against rabbit IgG (1:8000) and anti-GAPDH (1:5000) were from
Elabscience. The protein was analyzed using an enhanced chemilumi-
nescence kit and the band intensity was quantified with Image J 1.46 r
and GraphPad Prism 7.04 software. GAPDH served as the loading
control.
Table 1
Sequence of primers used for quantitative polymerase chain reaction assays.
Gene Primer Sequence (5′-3′)
NLRP3 FORWARD: TGGCTGTAACATTCGGAGATTGTGG
REVERSE: GCTTCTGGTTGCTGCTGAGGAC
Caspase-1 FORWARD: GGTGCTGAACAAGGAAGAGATGGAG
REVERSE: TGCCTGAGGAGCTGCTGAGAG
PYCARD (ASC) FORWARD: GCTGCTGGATGCTCTGTA
REVERSE: GGCTGGTGTGAAACTGAAG
IL-1β FORWARD: CAGTGGCAATGAGGATGA
REVERSE: TAGTGGTGGTCGGAGATT
GAPDH FORWARD: TGAAGGTCGGAGTCAACGGATTTGGT
REVERSE: CATGTGGGCCATGAGGTCCACCAC
3
Carbohydrate Polymers 237 (2020) 116163
2.8. Statistical analysis
Data are presented as mean ± SD. Statistical analyses were per-
formed by one-way ANOVA followed by the Student's t test. Differences
were considered significant at p < 0.05.
3. Results and discussion
3.1. Preparation and characterization Dox:CS/CMCS-NPs
As shown in Fig. 1, Dox:CS/CMCS-NPs were produced by ionic ge-
lation in Dox, positively-charged CS and negatively-charged CMCS at
pH 6.0. TPP was used as a crosslinking agent to stabilize the structure of
the NPs. According to Feng et al., the most stable content were obtained
at a ratio of 3:4:0.5 of CS: CMCS: TPP (Feng et al., 2013). At this ratio,
CS/CMCS-NPs had a stable mean particle size (203.1 ± 10.51 nm), PDI
(0.23 ± 0.10) and zeta potential (+32.3 ± 0.4 mV). In our study, we
used a ratio of 1:3:4:0.5 for Dox: CS: CMCS: TPP. At this ratio, Dox:CS/
CMCS-NPs had a stable mean particle size, PDI and zeta potential
shown in Table 2. The absolute value of the zeta potential was greater
than 30 mV indicated that the prepared NP system was stable.
Scanning electron micrographs, transmission electron micrographs
and particle size distribution of CS/CMCS-NPs and Dox:CS/CMCS-NPs
were shown in Fig. 2. The results showed that both NPs were typically
spherical and capsular. They had good dispersion, clear edges, no ag-
glomeration and uniform particle distribution. The average particle size
of CS/CMCS-NPs and Dox:CS/CMCS-NPs were showed in volume frac-
tion (Table 2). The results were consistent with those obtained by the
particle size analyzer.
Most of the current studies on local drug delivery systems in-
vestigate the effect, and few studies investigate the mechanism of action
(Ji, Zhao, Deng, & Lu, 2010; Sah, Dewangan, & Suresh, 2019). In this
study, a novel drug-loaded NP system, Dox:CS/CMCS-NPs, was suc-
cessfully constructed as a periodontal pocket administration. Both the
anti-inflammatory effect on cell inflammation model and deeper un-
derstanding of the mechanism of action were explored. The particle size
measurement showed that the Dox:CS/CMCS-NPs loaded with the drug
was approximately 50 nm larger than that of CS/CMCS-NPs, and the
PDI was smaller. Encapsulation efficiency (75 ± 7.21) % and loading
capacity (28 ± 4.01) % had good performance which indicated that
Dox was successfully packed. Previous studies have shown that CS/
CMCS-NPs have slow-release properties, resulting in the Dox:CS/CMCS-
NPs to release Dox continuously over longer periods of time, thus
achieving better efficacy (Feng et al., 2013).
3.2. Culture and identification of HGFs
To identify gingival fibroblasts, we observed the cell morphology
and characterized the specific protein markers by immunofluorescence.
Adhesion cells of human gingival tissue appeared about 7 days after the
primary culture, showing a spindle shape, which is one of the most
characteristic shapes of gingival fibroblasts (Park, Salem, Semlali,
Leung, & Rouabhia, 2017). Additionally, the cells retained their spindle
shape after passage (Fig. 3A). Immunofluorescence images showed that
intracellular anti-vimentin staining was positive (Fig. 3B) and in-
tracellular anti-keratin staining was negative (Fig. 3C), which further
indicated that the obtained cells were gingival fibroblasts (Mohd Nor,
Berahim, Azlina, Mokhtar, & Kannan, 2017). In summary, these results
suggest that the cells originating from human tissue masses were gin-
gival fibroblasts.
3.3. Bacteriostatic properties of CS/CMCS-NPs and Dox:CS/CMCS-NPs
The results showed that the liquid mediums of P. gingivalis (negative
control) and P. gingivalis with CS/CMCS-NPs were cloudy, whereas the
liquid medium of P. gingivalis with Dox and Dox:CS/CMCS-NPs was
S. Xu, et al. Carbohydrate Polymers 237 (2020) 116163

Fig. 1. Schematic illustrations showing the preparation and action pattern of Dox:CS/CMCS-NPs.

Table 2 effects. Bacterial adhesion growth on plaque biofilm is difficult to re-

Mean particle size, PDI and zeta potential of CS/CMCS-NPs and Dox:CS/CMCS- move and can resist the killing effect of antibiotics and host defense
NPs. function (Sanz, van Winkelhoff, & Working Group 1 of Seventh
Mean particle size (nm) PDI Zeta potential (mV) European Workshop on, 2011). Among them, P. gingivalis, especially in
the lesion area or active site of chronic periodontitis, can activate a host
CS/CMCS-NPs 203.1 ± 10.51 0.23 ± +32.3 ± 0.4 inflammatory reaction and destroy periodontal tissues (Trindade et al.,
0.10
2014). In this study, the antibacterial effect of Dox:CS/CMCS-NPs on P.
Dox:CS/CMCS-NPs 252.3 ± 4.78 0.12 ± +30.6 ± 0.4
0.08 gingivalis was very effective. We speculated that because chitosan has
good bacteriostatic properties and has been proven to inhibit P. gingi-
valis (Liu et al., 2019; Peng, Hsieh, Chen, Tsai, & Chen, 2016). As a
clear after the oscillating culture for 5 days (Fig. 4A). The formation of powerful antibiotic, Dox is superior in bacteriostasis (Golub,
bacterial colony was not observed in the Dox and Dox:CS/CMCS-NPs, Ramamurthy, McNamara, Greenwald, & Rifkin, 1991). It should be
while P. gingivalis in CS/CMCS-NPs, which were cultured in the same noted that P. gingivalis grows in a specific environment that requires a
condition, were denser (Fig. 4B). The colonies were counted, and the high demand for an oxygen-free environment and nutrition (Song et al.,
number of colonies were showed in Fig. 4C. 2019). Dox:CS/CMCS-NPs changed the composition of the liquid cul-
The surface of the Dox:CS/CMCS-NPs has a positive charge, which ture medium and the growth environment of bacteria, which has a
enables better targeting of plaque biofilm with a negative charge (Ng, synergistically effect on the improvement of bacteriostatic properties of
Ke, Lee, Hedrick, & Yang, 2013). In other words, the packed Dox can be Dox:CS/CMCS-NPs.
delivered to the plaque biofilm more accurately and kill bacteria more
effectively (Fig. 1). This was the advantage of the composite nano- 3.4. Cytocompatibility of Dox:CS/CMCS-NPs
system constructed in the experiment. It could be greatly improved the
efficiency of Dox, reduce the dosage, and thus reduce the risk of side We investigated the effects of different concentrations of Dox:CS/

Fig. 2. SEM, TEM and particle size distribution (volume fraction) of CS/CMCS-NPs (A) and Dox:CS/CMCS-NPs (B).

4
S. Xu, et al. Carbohydrate Polymers 237 (2020) 116163

Fig. 3. Images of passaged cells (A), the staining of specific proteins for cell identification (B, C). HGFs were observed under the microscope (A). Immunofluorescence
images showed that intracellular anti-vimentin staining was positive (B) and intracellular anti-cytokeratin staining was negative (C).

Fig. 4. Bacteriostatic testing (P. g referred to Porphyromonas gingivalis) of CS/CMCS-NPs (500 μg/ml), Dox (10 μg/ml) and Dox:CS/CMCS-NPs (500 μg/ml) cultured
with Porphyromonas gingivalis for 5 days at 37 ℃ and anaerobic environment (A). Agar culture of bacterial suspension (B) and the number of individual colonies (C).

5
S. Xu, et al.
Fig. 5. Treated HGFs with CS/CMCS-NPs and Dox:CS/CMCS-NPs in different concentration (62.5, 125, 250, 500, 1000 μg/ml) for 24 h, 48 h, and 72 h. (A) Images of
cells after 24 h and 72 h treated with Dox:CS/CMCS-NPs. (B) Cell viability detected by CCK-8 assay.
CMCS-NPs on HGFs to determine the appropriate concentration of NPs
for cell stimulation. After 24 h culture, there was no significant dif-
ference in cell morphology or the cell number of the experimental and
control groups. After 72 h culture, the number of cells in the 1000 μg/
ml group increased compared with that in the blank control group, and
24 h group. The difference was statistically significant; however, the
morphology did not change (Fig. 5A).
The CCK-8 experiment showed that cell activity slightly increased
with the increase of NP concentration at 24 h, 48 h or 72 h, while the
number of cells in the 72 h group increased compared with that in the
24 h group, and the difference was statistically significant (Fig. 5B). At
62.5, 125, 250, 500, 1000 μg/ml, the Dox:CS/CMCS-NPs had no ob-
vious inhibitory effect on cell viability, and the concentrations can be
used.
The effect of CS/CMCS-NPs on cells is mild, even slightly promoting
cell growth (Wang et al., 2016). We found that the CS/CMCS-NPs had
no obvious inhibitory effect on cell viability at 62.5, 125, 250, 500 or
1000 μg/ml (Fig. 5B). This proved that the CS/CMCS-NPs were not
toxic to HGFs. In this experiment, the action of Dox:CS/CMCS-NPs with
a concentration less 1000 μg/ml for 72 h showed no decrease in cell
activity, which proves that Dox:CS/CMCS-NPs were cell-friendly.
3.5. Effects of Dox:CS/CMCS-NPs on the expression of NLRP3
inflammasome and IL-1β induced by P. gingivalis-LPS and ATP
The mRNA level of NLRP3, ASC and Caspase-1 in the LPS + ATP
group were significantly higher than those in the blank control group
(Fig. 6A–C). This implied that LPS + ATP had a synergistic effect on the
activation of NLRP3 inflammasome and we had successfully established
the model of inflammasome. However, Dox:CS/CMCS-NPs significantly
inhibited the expression of LPS + ATP-induced NLRP3, ASC and Cas-
pase-1 at the gene level.
To study the effect of LPS + ATP and Dox:CS/CMCS-NPs on in-
flammasome activation and IL-1β production, the mRNA in HGFs and
their cellular supernatant induced by LPS + ATP was investigated.
Fig. 6D illustrated Dox:CS/CMCS-NPs did not increase the expression of
IL-1β. The Dox:CS/CMCS-NPs addition in the LPS + ATP group in-
hibited the expression of IL-1β at the gene level. In Fig. 6E, the protein
expression of IL-1β in the group with LPS + ATP was greater than that
6
Carbohydrate Polymers 237 (2020) 116163
in the blank control, indicating a model of cellular inflammation.
However, adding Dox:CS/CMCS-NPs to the LPS + ATP group sig-
nificantly inhibited the protein expression of IL-1β. The above results
all proved that Dox:CS/CMCS-NPs had anti-inflammatory effect.
To detect the effect of Dox:CS/CMCS-NPs on P. gingivalis-LPS +
ATP-induced NLRP3 inflammasome (Fig. 7A and B) and IL-1β (Fig. 7C),
the expression of related proteins on the total intracellular protein of
HGFs was studied. LPS + ATP-induced HGFs stimulated with 1 μg/ml
P. gingivalis-LPS for 11 h followed by stimulation with 5 mM ATP for 1
h. LPS + ATP + Dox-induced HGFs stimulated with 1 μg/ml P. gingi-
valis-LPS for 11 h followed by stimulation with 5 mM ATP and 10 μg/ml
Dox for 1 h. LPS + ATP + NPs-induced HGFs stimulated with 1 μg/ml
P. gingivalis-LPS for 11 h followed by stimulation with 5 mM ATP and
500 μg/ml Dox:CS/CMCS-NGs for 1 h. Based on the gray value of the
Western Blot strip, the LPS + ATP addition increased the expression of
NLRP3 inflammasome and IL-1β in HGFs, while Dox:CS/CMCS-NPs
inhibited LPS + ATP-induced NLRP3 (Fig. 7D), ASC (Fig. 7E), Pro-
caspase-1 (Fig. 7F), Cleaved caspase-1 (Fig. 7G), Pro- IL-1β (Fig. 7H)
and Cleaved IL-1β (Fig. 7I) in HGFs. Doxycycline alone could also
down-regulate protein level of NLRP3 inflammasome and IL-1β (Fig. 7),
which is consistent with our previous results (Xu et al., 2019). However,
there is no significance in the inhibitory effect of Dox:CS/CMCS-NPs
and doxycycline on NLRP3 inflammasome and IL-1β, which proved that
our nano-drug delivery system has good physical properties but does
not reduce the effectiveness of doxycycline.
The regulatory effect of Dox and chitosan on immunity should not
be ignored (Chang, Wu, Wu, Huang, & Tsai, 2019; Li et al., 2015;
Preshaw, 2018). Dox alone has been shown to down-regulate the ex-
pression of NLRP3 inflammasome, and our previous study also found
that Dox has a similar effect in HGFs (Zhang et al., 2017). This was
illustrated in the supplementary materials (Figs. S3 and S4). CS/CMCS-
NPs alone had no down-regulation effect on NLRP3 inflammasomes
whether in mRNA or protein level. This was illustrated in the supple-
mentary materials (Fig. S5). Furthermore, the regulatory effect of
Dox:CS/CMCS-NPs on HGFs and the NLRP3 inflammasome model on
related genes and proteins was observed. Our results demonstrated that
Dox:CS/CMCS-NPs had a strong inhibitory effect on LPS + ATP-in-
duced NLRP3 inflammasome by down-regulating the expression of
NLRP3, ASC and Caspase-1 in HGFs. Importantly, the expression of IL-
S. Xu, et al. Carbohydrate Polymers 237 (2020) 116163

Fig. 6. (A, B, C, D, E) HGFs infected by LPS + ATP and treated by Dox:CS/CMCS-NPs. (A, B, C, D) The level of mRNA of NLRP3, ASC, Caspase-1 and IL-1β analyzed
by quantitative real-time polymerase chain reaction. (E) The level of protein of IL-1β analyzed by ELISA. The mRNA levels of cytokines in untreated controls were set
as 1.0. Bars show the levels of cytokines with mean SD (n = 3) and analyzed by the Student's t test. *p < 0.05. **p < 0.01. ***p < 0.001 versus control.

1β in protein or at the gene level was down-regulated in HGFs treated
by Dox:CS/CMCS-NPs. That means that Dox:CS/CMCS-NPs had an anti-
inflammatory effect in HGFs. There may be two possible mechanisms by
which Dox:CS/CMCS-NPs down-regulates LPS + ATP-induced NLRP3
inflammasome in HGFs or Dox:CS/CMCS-NPs killed bacteria and in-
teracted with their endotoxins (Henehan, Montuno, & De Benedetto,
2017). On the other hand, as an immune-related pattern recognition
receptor, inflammasome could be directly regulated by Dox:CS/CMCS-
NPs through the regulation of immune pathways (Fig. 1) (Broz & Dixit,
2016).
4. Conclusion
experiments in this study and drafted the article. Professor Qihui Zhou
directed the synthesis of the materials, analysis and interpretation of
data, and revise this article critically for important intellectual content.
Zhongxin Jiang contributed to acquisition of data of cell identification
and wrote this part of the article. Yanwen Wang and Xiaohui Qiu
contributed to acquisition, analysis and interpretation of data of genes
as well as wrote this part of the article. Kai Yang contributed to ac-
quisition, analysis and interpretation of data of protein as well as wrote
this part of the article. Professor Qiuxia Ji contributed to the concep-
tion, designed of the study and revise this article critically for important
intellectual content. All authors have read and approved the final
submission.

The new drug-loaded nanoparticles Dox:CS/CMCS-NPs prepared by

ion crosslinking method have a complete morphology and stable
structure, and have good bacteriostasis against Porphyromonas gingi-
valis. Dox:CS/CMCS-NPs can effectively down-regulate the mRNA and
protein levels of NLRP3 inflammasome and IL-1β induced by LPS +
ATP in HGFs. It provides a potential new option for the rational ad-
ministration of doxycycline in the clinical treatment of periodontal
disease.
Author contribution
Acknowledgements
This work was primarily supported by the National Natural Science
Foundation of China (Grant No. 81401526), the Scientific Research
Foundation of Qingdao University (Grant No. DC1900009689), the
Natural Science Foundation of Shandong Province, China (Grant No.
ZR2019QC007 and Grant No. ZR2019MH003), China Postdoctoral
Science Foundation (Grant no. RZ1900011066), the Major Research
Plan of the National Natural Science Foundation of China (Grant no.
91849209).

Shuo Xu is the first author of this paper, completed most of the

7
S. Xu, et al.
Fig. 7. LPS + ATP increasing the expression and Dox and Dox:CS/CMCS-NPs inhibiting the expression of protein levels of NLRP3 and ASC (A), Pro-caspase-1 and
Cleaved caspase-1 (B), Pro-IL-1β and Cleaved IL-1β (C) in HGFs. Western blot were performed to assess the protein level of NLRP3 (D), ASC (E), Pro-caspase-1 (F),
Cleaved caspase-1 (G), IL-1β (H) and Cleaved IL-1β (I). The blots were stripped and re-probed with GAPDH as a loading control. Data are presented as mean SEM of
three independent experiments. *p < 0.05. **p < 0.01. ***p < 0.001 versus control.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.carbpol.2020.116163.
References
Broz, P., & Dixit, V. M. (2016). Inflammasomes: Mechanism of assembly, regulation and
signalling. Nature Reviews Immunology, 16(7), 407–420.
Buduneli, E., Vardar, S., Buduneli, N., Berdeli, A. H., Turkoglu, O., Baskesen, A., & Atilla,
G. (2004). Effects of combined systemic administration of low-dose doxycycline and
alendronate on endotoxin-induced periodontitis in rats. The Journal of Periodontology,
75(11), 1516–1523.
Chang, S. H., Wu, G. J., Wu, C. H., Huang, C. H., & Tsai, G. J. (2019). Oral administration
with chitosan hydrolytic products modulates mitogen-induced and antigen-specific
immune responses in BALB/c mice. International Journal of Biological Macromolecules,
131, 158–166.
Chatzopoulos, G. S., Mansky, K. C., Lunos, S., Costalonga, M., & Wolff, L. F. (2019).
Sclerostin and WNT-5a gingival protein levels in chronic periodontitis and health.
Journal of Periodontal Research Supplement.
Feng, C., Sun, G., Wang, Z., Cheng, X., Park, H., Cha, D., & Chen, X. (2014). Transport
mechanism of doxorubicin loaded chitosan based nanogels across intestinal epithe-
lium. European Journal of Pharmaceutics and Biopharmaceutics: Official Journal of
Arbeitsgemeinschaft Fur Pharmazeutische Verfahrenstechnik EV, 87(1), 197–207.
Feng, C., Wang, Z., Jiang, C., Kong, M., Zhou, X., Li, Y., & Chen, X. (2013). Chitosan/o-
carboxymethyl chitosan nanoparticles for efficient and safe oral anticancer drug
delivery: in vitro and in vivo evaluation. International Journal of Pharmaceutics,
457(1), 158–167.
Gjoseva, S., Geskovski, N., Sazdovska, S. D., Popeski-Dimovski, R., Petrusevski, G.,
Mladenovska, K., & Goracinova, K. (2018). Design and biological response of dox-
ycycline loaded chitosan microparticles for periodontal disease treatment.
Carbohydrate Polymers, 186, 260–272.
Golub, L. M., Elburki, M. S., Walker, C., Ryan, M., Sorsa, T., Tenenbaum, H., & Gu, Y.
(2016). Non-antibacterial tetracycline formulations: Host-modulators in the treat-
ment of periodontitis and relevant systemic diseases. International Dental Journal,
66(3), 127–135.
Golub, L. M., Ramamurthy, N. S., McNamara, T. F., Greenwald, R. A., & Rifkin, B. R.
(1991). Tetracyclines inhibit connective tissue breakdown: New therapeutic im-
plications for an old family of drugs. Critical Reviews in Oral Biology and Medicine: an
Official Publication of the American Association of Oral Biologists, 2(3), 297–321.
Goncalves, R. M., Antunes, J. C., & Barbosa, M. A. (2012). Mesenchymal stem cell re-
cruitment by stromal derived factor-1-delivery systems based on chitosan/poly
(gamma-glutamic acid) polyelectrolyte complexes. European Cells & Materials, 23,
8
Carbohydrate Polymers 237 (2020) 116163
249–260 discussion 260-241.
Graves, D. (2008). Cytokines that promote periodontal tissue destruction. The Journal of
Periodontology, 79(8 Suppl), 1585–1591.
Gregoriadis, G. (1978). Liposomes in therapeutic and preventive medicine: The devel-
opment of the drug-carrier concept. Annals of the New York Academy of Sciences, 308,
343–370.
Gujarathi, N. A., Rane, B. R., & Patel, J. K. (2012). pH sensitive polyelectrolyte complex of
O-carboxymethyl chitosan and poly (acrylic acid) cross-linked with calcium for sus-
tained delivery of acid susceptible drugs. International Journal of Pharmaceutics,
436(1–2), 418–425.
Hajishengallis, G. (2015). Periodontitis: From microbial immune subversion to systemic
inflammation. Nature Reviews Immunology, 15(1), 30–44.
Hajishengallis, G., Liang, S., Payne, M. A., Hashim, A., Jotwani, R., Eskan, M. A., & Curtis,
M. A. (2011). Low-abundance biofilm species orchestrates inflammatory periodontal
disease through the commensal microbiota and complement. Cell Host & Microbe,
10(5), 497–506.
Hansen, J. D., Vojtech, L. N., & Laing, K. J. (2011). Sensing disease and danger: A survey
of vertebrate PRRs and their origins. Developmental and Comparative Immunology,
35(9), 886–897.
Henehan, M., Montuno, M., & De Benedetto, A. (2017). Doxycycline as an anti-in-
flammatory agent: Updates in dermatology. Journal of the European Academy of
Dermatology and Venereology: JEADV, 31(11), 1800–1808.
Hu, F., Zhou, Z., Xu, Q., Fan, C., Wang, L., Ren, H., & Chen, X. (2018). A novel pH-
responsive quaternary ammonium chitosan-liposome nanoparticles for periodontal
treatment. International Journal of Biological Macromolecules, 129, 1113–1119.
Huck, O., Elkaim, R., Davideau, J. L., & Tenenbaum, H. (2015). Porphyromonas gingi-
valis-impaired innate immune response via NLRP3 proteolysis in endothelial cells.
Innate Immunity, 21(1), 65–72.
Jain, N., Jain, G. K., Javed, S., Iqbal, Z., Talegaonkar, S., Ahmad, F. J., & Khar, R. K.
(2008). Recent approaches for the treatment of periodontitis. Drug Discovery Today,
13(21–22), 932–943.
Ji, Q. X., Zhao, Q. S., Deng, J., & Lu, R. (2010). A novel injectable chlorhexidine ther-
mosensitive hydrogel for periodontal application: Preparation, antibacterial activity
and toxicity evaluation. Journal of Materials Science Materials in Medicine, 21(8),
2435–2442.
Jing, L., Kim, S., Sun, L., Wang, L., Mildner, E., Divaris, K., & Offenbacher, S. (2019). IL-
37- and IL-35/IL-37-Producing plasma cells in chronic periodontitis. Journal of Dental
Research22034519847443.
Kassebaum, N. J., Bernabe, E., Dahiya, M., Bhandari, B., Murray, C. J., & Marcenes, W.
(2014). Global burden of severe periodontitis in 1990-2010: A systematic review and
meta-regression. Journal of Dental Research, 93(11), 1045–1053.
Li, R., Luo, X., Pan, Q., Zineh, I., Archer, D. F., StanWilliams, R., & Chegini, N. (2015).
Doxycycline alters the expression of inflammatory and immune-related cytokines and
chemokines in human endometrial cells: Implications in irregular uterine bleeding.
Human Reproduction, 30(1), 249.
S. Xu, et al.
Lian, D., Dai, L., Xie, Z., Zhou, X., Liu, X., Zhang, Y., & Chen, Y. (2018). Periodontal
ligament fibroblasts migration injury via ROS/TXNIP/Nlrp3 inflammasome pathway
with Porphyromonas gingivalis lipopolysaccharide. Molecular Immunology, 103,
209–219.
Liu, J., Xiao, Y., Wang, X., Huang, L., Chen, Y., & Bao, C. (2019). Glucose-sensitive de-
livery of metronidazole by using a photo-crosslinked chitosan hydrogel film to inhibit
Porphyromonas gingivalis proliferation. International Journal of Biological
Macromolecules, 122, 19–28.
Mohd Nor, N. H., Berahim, Z., Azlina, A., Mokhtar, K. I., & Kannan, T. P. (2017).
Identification and characterization of intraoral and dermal fibroblasts revisited.
Current Stem Cell Research & Therapy, 12(8), 675–681.
Nelson, M. L., & Levy, S. B. (2011). The history of the tetracyclines. Annals of the New York
Academy of Sciences, 1241, 17–32.
Ng, V. W., Ke, X., Lee, A. L., Hedrick, J. L., & Yang, Y. Y. (2013). Synergistic co-delivery of
membrane-disrupting polymers with commercial antibiotics against highly oppor-
tunistic bacteria. Advanced Material, 25(46), 6730–6736.
Olsen, I., & Yilmaz, O. (2016). Modulation of inflammasome activity by Porphyromonas
gingivalis in periodontitis and associated systemic diseases. Journal of Oral
Microbiology, 8, 30385.
Park, H. J., Salem, M., Semlali, A., Leung, K. P., & Rouabhia, M. (2017). Antimicrobial
peptide KSL-W promotes gingival fibroblast healing properties in vitro. Peptides, 93,
33–43.
Peng, P. C., Hsieh, C. M., Chen, C. P., Tsai, T., & Chen, C. T. (2016). Assessment of
photodynamic inactivation against periodontal Bacteria Mediated by a chitosan hy-
drogel in a 3D gingival model. International Journal of Molecular Sciences, 17(11).
Preshaw, P. M. (2018). Host modulation therapy with anti-inflammatory agents.
Periodontology 2000, 76(1), 131–149.
Ragelle, H., Riva, R., Vandermeulen, G., Naeye, B., Pourcelle, V., Le Duff, C. S., ... Preat,
V. (2014). Chitosan nanoparticles for siRNA delivery: Optimizing formulation to in-
crease stability and efficiency. Journal of Controlled Release : Official Journal of the
Controlled Release Society, 176, 54–63.
Sah, A. K., Dewangan, M., & Suresh, P. K. (2019). Potential of chitosan-based carrier for
Carbohydrate Polymers 237 (2020) 116163
periodontal drug delivery. Colloids and Surfaces B, Biointerfaces, 178, 185–198.
Sanz, M., Ceriello, A., Buysschaert, M., Chapple, I., Demmer, R. T., Graziani, F., & Vegh,
D. (2017). Scientific evidence on the links between periodontal diseases and diabetes:
Consensus report and guidelines of the joint workshop on periodontal diseases and
diabetes by the international diabetes Federation and the European Federation of
periodontology. Diabetes Research and Clinical Practice.
Sanz, M., van Winkelhoff, A. J., & Working Group 1 of Seventh European Workshop on, P.
(2011). Periodontal infections: Understanding the complexity–Consensus of the se-
venth European workshop on periodontology. Journal of Clinical Periodontology,
38(Suppl 11), 3–6.
Schenten, D., & Medzhitov, R. (2011). The control of adaptive immune responses by the
innate immune system. Advances in Immunology, 109, 87–124.
Song, J. M., Woo, B. H., Lee, J. H., Yoon, S., Cho, Y., Kim, Y. D., & Park, H. R. (2019). Oral
administration of Porphyromonas gingivalis, a major pathogen of chronic period-
ontitis, promotes resistance to paclitaxel in mouse xenografts of oral squamous cell
carcinoma. International Journal of Molecular Sciences, 20(10).
Trindade, F., Oppenheim, F. G., Helmerhorst, E. J., Amado, F., Gomes, P. S., & Vitorino, R.
(2014). Uncovering the molecular networks in periodontitis. Proteomics Clinical
Applications, 8(9–10), 748–761.
Wang, J., Xu, M., Cheng, X., Kong, M., Liu, Y., Feng, C., & Chen, X. (2016). Positive/
negative surface charge of chitosan based nanogels and its potential influence on oral
insulin delivery. Carbohydrate Polymers, 136, 867–874.
Xu, S., Zhou, Q., Fan, C., Zhao, H., Wang, Y., Qiu, X., & Ji, Q. (2019). Doxycycline inhibits
NAcht Leucine-rich repeat protein 3 inflammasome activation and interleukin-1beta
production induced by Porphyromonas gingivalis-lipopolysaccharide and adenosine
triphosphate in human gingival fibroblasts. Archives of Oral Biology, 107, 104514.
Zhang, L., & Deng, S. (2019). Effects of astragaloside IV on inflammation and immunity in
rats with experimental periodontitis. Brazilian Oral Research, 33, e032.
Zhang, W., Xie, X., Wu, D., Jin, X., Liu, R., Hu, X., & Cao, Y. (2017). Doxycycline at-
tenuates leptospira-induced IL-1beta by suppressing NLRP3 inflammasome priming.
Frontiers in Immunology, 8, 857.