Journal of Neuropathology and Experimental Neurology Vol. 63, No.

11
Copyright q 2004 by the American Association of Neuropathologists November, 2004
pp. 1144 1154

Ganglion-Specific Patterns of Diabetes-Modulated Gene Expression Are Established in

Prevertebral and Paravertebral Sympathetic Ganglia Prior to the Development of
Neuroaxonal Dystrophy

STEVEN L. CARROLL, MD, PHD, STEPHANIE J. BYER, BS, DENISE A. DORSEY, BA, MARK A. WATSON, MD, PHD,
AND ROBERT E. SCHMIDT, MD, PHD

Abstract. In both humans and animal models, diabetic sympathetic autonomic neuropathy is associated with the selective
development of markedly enlarged distal axons and nerve terminals (neuroaxonal dystrophy, NAD). NAD occurs in the
prevertebral superior mesenteric and celiac ganglia (SMG-CG), but not in the paravertebral superior cervical ganglion (SCG).
To identify molecular differences between these ganglia that may explain their selective vulnerability to NAD, we have
examined global gene expression patterns in control and diabetic rat sympathetic ganglia before and after the onset of structural
evidence of NAD. As predicted, major differences in transcriptional profiles exist between SCG and SMG-CG in normal
young adult animals including, but not limited to, known differences in neurotransmitter-related gene expression. Gene ex-
pression patterns of diabetic SMG-CG and SCG, prior to the development of NAD lesions, also differ from their age-matched
non-diabetic counterparts. However, diabetes has ganglion-specific effects on gene expression; of approximately 110 transcripts

Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016

that were differentially expressed between diabetic and control sympathetic ganglia, only 5 were differentially expressed as
a result of diabetes in both SCG and SMG-CG. Genes involving synapse and mitochondrial structure and function, oxidative
stress, and glycolysis were highly represented in the differentially expressed gene set. Differences in the number of synapse-
related gene alterations in diabetic SMG-CG (18 genes) versus SCG (2 genes) prior to the onset of NAD may also well
explain the selective development of NAD in the SMG-CG. These results provide support for the specificity of diabetes-
modulated gene expression for selected neuronal subpopulations of sympathetic noradrenergic neurons.

Key Words: Diabetes; Gene microarray; Neuroaxonal dystrophy; Sympathetic autonomic neuropathy.

INTRODUCTION STZ-induced diabetes demonstrates that NAD develops

Diabetic autonomic neuropathy, a condition affecting
the sympathetic and parasympathetic nervous systems,
results in significant patient morbidity and substantially
increased mortality (1–3). The neuropathologic hallmark
of diabetic sympathetic autonomic neuropathy is neu-
roaxonal dystrophy (NAD), a distinctive and unambigu-
ous distal axonopathy resulting in markedly enlarged dis-
tal axons and nerve terminals (4). Intraganglionic
dystrophic axons are thought to represent aberrant intra-
ganglionic sprouts that occur in the absence of significant
neuron loss and are hypothesized to produce dysfunction
and loss of ganglionic synapses. Rats with streptozotocin
(STZ)-induced diabetes mellitus, like human diabetic pa-
tients, also develop pathologically distinctive degenerat-
ing, regenerating, and markedly swollen dystrophic axons
and nerve terminals that are not accompanied by neuron
or axon loss (5, 6).
Examination of the postganglionic sympathetic axons
projecting to a variety of endorgans in rats with chronic
From Department of Pathology (SLC, SJB), The University of Ala-
bama School of Medicine, Birmingham, Alabama; and Department of
Pathology and Immunology (DAD, MAW, RES), Washington Univer-
sity School of Medicine, St. Louis, Missouri.
Correspondence to: Robert E. Schmidt, MD, PhD, Washington Uni-
versity School of Medicine Division of Neuropathology, Department of
Pathology and Immunology, 660 South Euclid Avenue, Box 8118, St.
Louis, MO 63110-1093. E-mail: reschmidt@pathology.wustl.edu
Support was provided by NIH awards R01 AG10299, R37 DK19645,
and R01 NS37514.
most reproducibly in the distal segments of long norad-
renergic axons innervating the intramural submucosal
and myenteric ganglia of the ileum. Dystrophic changes
do not develop in the equally lengthy nerves innervating
arteries and veins within nearby neurovascular arcades
(4). The distinctive morphologic changes of NAD first
become evident in rat superior mesenteric and celiac gan-
glia (SMG-CG) approximately 3 months after the onset
of diabetes and fail to develop in the superior cervical
ganglia (SCG), even in animals with diabetes of long
duration (6). It has been suggested that the differential
development of NAD in nerves projecting to the ileum
and those innervating neurovascular arcades reflects their
origin from prevertebral and paravertebral sympathetic
ganglia, respectively (4, 7, 8). Consistent with this hy-
pothesis, sympathetic ganglia are not equally affected by
NAD in human diabetes (9), with diabetic SMG-CG
showing marked NAD and comparable changes being
virtually absent in the SCG. Prevertebral and paraverte-
bral sympathetic ganglia also differ in their response to
aging (9, 10), neonatal administration of NGF antisera or
6-hydroxydopamine (7, 11), clonidine withdrawal (12),
speed of axonal regeneration after experimental injury
(8), and guanethidine sympathectomy (11). These obser-
vations indicate that there are major differences between
prevertebral and paravertebral sympathetic ganglia, some
of which may predispose the prevertebral ganglia to the
development of pathologies such as NAD.

1144
 GENE EXPRESSION IN DIABETIC GANGLIA
Some of the distinctions between prevertebral and
paravertebral sympathetic ganglia have been defined.
Studies of the peripheral projections, neurotrophin sen-
sitivity, and function of rat SCG demonstrate that this
ganglion receives presynaptic inputs from the interme-
diolateral column of the spinal cord and then transmits
signals to multiple postsynaptic targets. By comparison,
prevertebral sympathetic ganglia have a more complex
presynaptic input and a greater degree of neuronal het-
erogeneity (13, 14). Analyses of the effects of surgical
denervation and deafferentation and the expression of
neurotransmitters, their synthetic enzymes, and a variety
of neuropeptides indicate that prevertebral sympathetic
ganglia are innervated by fibers projecting not only from
the intermediolateral column of the spinal cord, but also
from dorsal root ganglia, other sympathetic ganglia, the
vagus nerve, and retrogradely from the intramural my-
enteric ganglia of the alimentary tract. Prevertebral sym-
pathetic ganglia also contain nerve terminals representing
intraganglionic projections from neighboring neurons, a
source that may become particularly relevant in patho-
logic situations. Neurons within prevertebral sympathetic
ganglia likewise differ from paravertebral chain ganglia
in structural, functional, electrophysiologic and immu-
nohistochemical characteristics (15–20). Therefore, the
SCG acts more as a simple ‘‘relay station,’’ whereas pre-
vertebral ganglia such as the SMG-CG appear to mediate
the complex integration of a variety of visceral reflexes.
Despite improved understanding of the anatomy and
function of prevertebral and paravertebral ganglia, the
biochemical differences underlying their distinct function
and the basis for the differences in their response to di-
abetes remain poorly understood. Furthermore, the mo-
lecular alterations that precede the development of NAD
and the time course with which these alterations occur
have not previously been investigated. Therefore, to bet-
ter define molecular differences between sympathetic
ganglia and their selective vulnerability to diabetes-in-
duced NAD, we have used oligonucleotide microarrays
to compare the transcriptomes of adult rat SCG and
SMG-CG, both before and after the onset of STZ-induced
diabetes. Data from this report demonstrates selective
gene expression alterations in SCG and SMG-CG ganglia
prior to onset of NAD, which may represent the molec-
ular basis for the development of this neuropathology.
MATERIALS AND METHODS
Animals and Surgical Procedures
Male Sprague-Dawley rats (;300 grams; Charles Rivers,
Belmont, MA) received a single dose of STZ (65 mg/kg, i.v.;
Upjohn, Kalamazoo, MI) in 0.01 M citrate/saline buffer (pH
4.5) and within a few days developed plasma glucose levels
$350 mg% (mg/dl). Animals were housed and cared for in
accordance within the guidelines of the National Institutes of
1145
Health and the Washington University Committee for the Hu-
mane Care of Laboratory Animals. Rats were killed 2, 6, or 17
weeks after the onset of diabetes. At each time point, right and
left SCG, SMG, and CG from 11 to 12 diabetic rats were re-
moved, cleaned of adherent tissue, and frozen on dry ice. For
each time point, SCG from all animals were pooled together,
as were SMG and CG. Ganglia from 11 to 12 control rats were
similarly dissected, pooled, and frozen. The microarray data
reported in this study reflect the results of 3 separate experi-
ments (2 experiments performed at 2 weeks after the onset of
diabetes and 1 performed 6 weeks after the onset of diabetes),
each utilizing a pool of ganglia from 11 to 12 animals. Initial,
independent analyses of microarray data from ganglia collected
2 and 6 weeks after the induction of diabetes showed that the
transcriptional profile of each ganglion type was essentially
identical at both of these time points. Therefore, for the pur-
poses of this study analysis, we elected to treat all 3 experi-
ments as identical ‘‘prelesion diabetic’’ time points.
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
High Density Oligonucleotide Microarray Hybridization
and Scanning
Total RNA was isolated from ganglia using TRIzol reagent
(Invitrogen, Carlsbad, CA) as recommended by the manufac-
turer. Double-stranded cDNA was synthesized from 20 mg of
total RNA using the SuperScript Choice System (Invitrogen)
and an HPLC-purified oligo-dT primer containing an adjacent
T7 RNA polymerase promoter (GENSET Corporation, La Jolla,
CA). Biotinylated cRNA was transcribed from cDNA templates
using an Enzo BioArray High Yield Transcript Labeling Kit
(Affymetrix, Inc., Santa Clara, CA). Biotinylated cRNA was
purified using RNeasy columns, fragmented and hybridized to
rat genome U34A oligonucleotide arrays (Affymetrix) follow-
ing the manufacturer’s recommended protocol. After 16 hours
hybridization, arrays were washed and stained with streptavi-
din-phycoerythrin. Hybridization signals were then amplified
by labeling stained arrays with a biotinylated goat anti-strep-
tavidin antibody (Vector Laboratories, Burlingame, CA) and
restaining with streptavidin-phycoerythrin (Affymetrix EUK-
GE-WS2 version 4 protocol). Arrays were scanned twice at 570
nm using an Affymetrix GeneArray scanner.
Analysis of Microarray Data
Microarray image data was analyzed using Affymetrix Mi-
croarray Analysis Suite 5.0 (MAS5). For each experiment, the
MAS5 software was used to perform 3 relevant, binary array
comparisons (i.e. control SCG vs control SMG-CG, control
SCG vs diabetic SCG, control SMG-CG vs diabetic SMG-CG).
The software output provided a statistical call regarding differ-
ential hybridization signal between the 2 arrays (‘‘increase,’’
‘‘decrease,’’ ‘‘no change’’) and a calculated fold change in gene
expression. For the purposes of this study analysis, only probe
sets that showed a consistent ‘‘increase’’ or ‘‘decrease’’ in all
3 independent experiments were considered. The complete
MIAME-compliant data set is available at http://bioinformatics.
wustl.edu.
Real-Time Quantitative RT-PCR
Total RNA was isolated from ganglia using TRIzol reagent
(Invitrogen) following the manufacturer’s recommendations.
J Neuropathol Exp Neurol, Vol 63, November, 2004
1146 CARROLL ET AL
One mg of each total RNA was reverse transcribed in a 20-ml
reaction containing random hexamer primers and Moloney mu-
rine leukemia virus reverse transcriptase; a parallel reaction,
performed identically except for the addition of reverse tran-
scriptase, was used to verify an absence of genomic DNA con-
tamination. After completion of reverse transcription, samples
were diluted to 100 ml with distilled water, boiled for 5 min
and stored at 2808C until used in real-time PCR experiments.
Primers for real-time quantitative RT-PCR of b-actin and test
mRNA were designed using Primer Express software (Version
2.0; Applied Biosystems, Inc., Foster City, CA) following the
manufacturer’s recommendations. Real-time PCR primers were
designed from the following sequences: rat b-actin, GenBank
accession # NM03144; rat prepronociceptin exon 2, GenBank
accession # X97374; rat VGF, GenBank accession # M74223;
rat chromogranin B, GenBank accession # AF019974; rat in-
sulin-like growth factor I (IGF-I), GenBank accession #
X06043. The sequences of the real-time PCR primers designed
from these sequences are as follows:
b-actin forward primer, TTCAACACCCCAGCCATGT
b-actin reverse primer, GTGGTACGACCAGAGGCATACA
Prepronociceptin forward primer, CCCTTATGTGTTTCAGCC
TCTTG
Prepronociceptin reverse primer, GCAGCAGGACATCACAA
AACAG
VGF forward primer, CCCGTTGGTCATGAAAACCT
VGF reverse primer, CCCCCGGATGAGTAGAAGGA
Chromogranin B forward primer, CCAGTGGATAACAGGGA
TCACA
Chromogranin B reverse primer, TAGGGCATTTGAGAGGA
CTTCAA
IGF I forward primer, GCCACGTCACCGCAAGAT
IGF I reverse primer, TGGCAGGTGTTCCGATGTT
The relative abundance of each test transcript was determined
using an ABI 5700 Gene Quantitation System (Applied Bio-
systems) and normalized to the levels of b-actin mRNA in the
same specimen. Our microarray analyses showed no evidence
of alterations in b-actin mRNA levels in diabetic SMG-CG or
SCG. In addition, preliminary experiments in which we assayed
b-actin mRNA levels in control and diabetic SMG-CG and
SCG by real-time PCR and normalized these values to the lev-
els of 18S ribosomal RNA in the same specimens showed no
evidence of alterations in b-actin mRNA levels, indicating that
it was an appropriate standard for normalization. Amplification
of each specimen was performed in 6 replicates of a 25-ml
reaction containing 1 ml of reverse transcription reaction and
SYBR Green PCR Master Mix per the manufacturer’s recom-
mendations (Applied Biosystems). Preliminary experiments
were performed to determine the optimal concentration of each
forward and reverse primer and to verify that each primer set
demonstrated similar amplification efficiencies under our reac-
tion conditions. The relative quantity of each test mRNA was
then established by normalizing the level of the corresponding
cDNA to that of b-actin cDNA in the same reverse transcription
reaction. Dissociation curves were performed after the comple-
tion of each PCR reaction to verify an absence of extraneous
reaction products (e.g. primer-dimers) that might confound the
quantitation of each target. Controls lacking added template
J Neuropathol Exp Neurol, Vol 63, November, 2004
were performed in parallel with each primer set to verify an
absence of contamination.
RESULTS
Expression Profiling of Normal Rat SMG-CG and SCG
Sympathetic Ganglia
To test the hypothesis that the differing response of
prevertebral and paravertebral sympathetic ganglia to a
variety of experimental and clinical insults reflects, in
part, distinct transcriptional programs, we enumerated the
transcriptome of normal SCG and SMG-CG in 3 inde-
pendent experiments. We identified 141 unique tran-
scripts that were consistently expressed at higher levels
in SMG-CG relative to SCG, and 118 unique transcripts
that were expressed at lower levels (Table 1). Most no-
tably, we identified numerous differences in the expres-
sion of transcripts coding for specific neurotransmitters
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
(e.g. somatostatin, prepronociceptin, and proenkephalin)
and neurotransmitter receptors (e.g. tachykinin receptor
1, cholecystokinin A receptor, G protein-coupled receptor
51 [forms part of the GABA-B receptor], serotonin re-
ceptor and solute carrier family 6, member 4 [a serotonin
transporter]). We also found major differences in expres-
sion of multiple genes encoding proteins necessary for
synaptic structure and synaptic vesicle transport, fusion,
and membrane recovery (e.g. synaptic vesicle glycopro-
tein 2b, synaptic cell adhesion molecule [similar to
RA175 OC 363058], Arg/Abl-interacting protein
ArgBP2). Given the cytoskeletal abnormalities evident in
NAD, it was also notable that a large number of cyto-
skeletal protein transcripts (e.g. neurofilament heavy pep-
tide, tubulin, peripherin, and actin) were expressed at
substantially lower levels in SMG-CG relative to SCG.
Thus, as predicted by anatomic and functional studies,
major biochemical differences exist between these pre-
vertebral and paravertebral sympathetic ganglia. Many of
these differences involve transcripts encoding proteins
whose function is likely affected during the development
of NAD.
Identification of Genes with Altered Expression in
Diabetic Sympathetic Ganglia
To identify genes whose expression is altered prior to
the overt development of the morphologic lesions char-
acteristic of NAD, rats were injected with a single dose
of streptozotocin, a treatment that produced diabetes as-
sociated with markedly elevated plasma glucose levels
(Table 2). The expression profiles of diabetic SCG and
SMG-CG were compared with those of control SCG and
SMG-CG and consistent differences in all 3 experiments
were identified (Table 3). While we identified 82 tran-
scripts with altered expression in diabetic SMG-CG, us-
ing the same criteria we identified a total of only 28 tran-
scripts whose expression was changed in diabetic SCG.
 GENE EXPRESSION IN DIABETIC GANGLIA
In pre-NAD, diabetic SMG-CG, we observed upregu-
lation of transcripts encoding multiple neuropeptides
(VGF nerve growth factor-inducible secreted protein,
prepronociceptin) and neurotransmitter receptors (puri-
nergic receptor P2X2, serotonin receptor). The expression
of mRNA encoding proteins essential for synapse struc-
ture and function (N-ethylmaleimide sensitive factor
(NSF), RAB 3A, RAB 11B, synapsin, chromogranin B,
solute carrier family 18, membrane 1 [a chromaffin gran-
ule amine transporter], G PCR kinase-interactor 1) was
typically increased in diabetic SMG-CG, although the ex-
pression of a number of transcripts was significantly de-
creased (monoamine oxidase A, B/K protein [synaptotag-
min], annexin V, similar to MUM-2 protein). Increased
expression of cytochrome P450 and diabetes-inducible
P450RLM6 (which may eventually prove to be the same
gene), as well as genes encoding enzymes essential for
energy metabolism (particularly glycolysis, oxidative
phosphorylation, and lipid metabolism) were also iden-
tified. On the other hand, diabetes was associated with a
marked decrease in the expression of transcripts coding
for mitochondrial uncoupling protein, as well as several
other mitochondria-based enzymes. A transcript encoding
galectin-related inter-fiber protein also demonstrated a
striking and consistent 10-fold decrease in expression.
In contrast to SMG-CG, we identified very few chang-
es in the transcriptome of diabetic SCG. For example, we
identified only 2 synapse-related transcripts (similar to
VAT-1, diazepam binding inhibitor) that were altered in
diabetic SCG. Furthermore, diabetic SCG exhibited less
prominent increases in transcripts encoding enzymes in-
volved in glycolysis, oxidative phosphorylation, and lipid
metabolism than were observed in prelesion diabetic
SMG-CG.
Overall, diabetes-induced changes in gene expression
were markedly different between sympathetic ganglia
types. For example, expression of mRNA encoding ty-
rosine hydroxylase, a key enzyme in norepinephrine syn-
thesis, is increased in diabetic rat SMG-CG but not in
diabetic SCG, consistent with our previous studies indi-
cating that the activity of this enzyme is selectively in-
creased in diabetic SMG-CG (21). In fact, of the 110
differentially expressed transcripts that were identified
(82 in SMG-CG and 28 in SCG), only 5 demonstrated
consistent changes in both types of diabetic ganglia (Ta-
ble 3). These include mRNA for mitochondrial uncou-
pling protein (UCP-1), early growth response 1 (NGF-
IA/Krox-24/EGR1), and cytochrome oxidase, all of
which are substantially decreased in both ganglia, and
‘‘upregulated by vitamin D1’’ (Vdup1) and diabetes-in-
ducible cytochrome P450RLM6, which are modestly in-
creased in both ganglia.
Confirmation of Diabetes-Responsive Gene Expression
in Sympathetic Ganglia
To validate the results of our microarray analyses and
to further examine the expression of a set of transcripts
1147
potentially important in NAD pathogenesis, we quanti-
tated the expression of selected mRNA in pre-lesion di-
abetic ganglia and ganglia with NAD. For these experi-
ments, cDNA was prepared from RNA isolated from
SMG-CG and SCG collected from rats 2 or 17 weeks
after the injection of streptozotocin or vehicle. Real-time
quantitative PCR was then used to assay the levels of
mRNA-encoding neuropeptides (VGF, prepronociceptin),
synaptic function (chromogranin B), or growth factors
(IGF-I). The assayed levels of these messenger RNAs
were normalized to the levels of b-actin mRNA in the
same cDNA.
Using this approach, we found that each of the mRNAs
whose expression was altered specifically in prelesion di-
abetic SMG-CG showed qualitatively similar changes by
real-time PCR (Fig. 1). We did note that the exact fold
change determined by real-time quantitative PCR differed
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
somewhat from the fold change determined in microarray
experiments, a common finding in this type of compari-
son that has been described by several other laboratories.
These alterations in mRNA expression persisted to 17
weeks after the induction of diabetes, a time well after
the morphologic lesions of NAD have begun to appear.
In contrast, none of these transcripts demonstrated
mRNA levels that were significantly altered in diabetic
SCG relative to SCG from vehicle-treated animals.
DISCUSSION
Comparison of the Gene Expression Profiles of SCG
and SMG-CG in Control Rats
Neurons within normal prevertebral sympathetic gan-
glia differ from those in paravertebral chain ganglia in
structural, functional, electrophysiologic, and immuno-
histochemical characteristics (15–20). Our systematic mi-
croarray analysis has also demonstrated marked differ-
ences in gene expression between pre- and paravertebral
ganglia. Although we cannot exclude the possibility that
some differentially expressed mRNA is expressed by oth-
er cell types within each ganglion (e.g. Schwann and sat-
ellite cells), it is likely that many of these transcripts are
neuronally derived. The differences we have identified in
the expression of somatostatin and prepronociceptin (both
increased selectively in prevertebral ganglia) and the ex-
pression of serotonin receptors and transporters, calbin-
din, G protein-coupled receptor 51 [GABA-B receptor]
and proenkephalin (all selectively increased in the SCG)
parallel the results of immunohistochemical and in situ
hybridization studies in rat and other species (16, 22–29)
and support the validity of our microarray analyses. Fur-
ther, the substantially higher expression of mRNA-encod-
ing tachykinin receptor 1 and cholecystokinin A receptor
in SMG-CG compared to SCG is consistent with the
known collateral projections of DRG and possibly vagal
J Neuropathol Exp Neurol, Vol 63, November, 2004
 TABLE 1 1148
Differential Gene Expression in Non-Diabetic Sympathetic SMG-CG versus SCG

SMG-CG specific expression (n 5 141) SCG specific expression (n 5 118)

Locus link Gene description Fold D Locus link Gene description Fold D

Synaptic structure/function Synaptic structure/function

24797 Somatostatin 35.2 29237 Preproenkephalin, related sequence 30.2
24889 Cholecystokinin A receptor 14.4 25553 Solute carrier family 6, member 4 14.9
24807 Tachykinin receptor 1 4.2 79246 5-hydroxytryptamine (serotonin) receptor 3a 7.2
25516 Prepronociceptin* 3.3 24166 Adenylate cyclase activating peptide I 4.4
114901 Arg/Abl-interacting protein ArgBP2 2.6 117556 Synaptic vesicle glycoprotein 2 b 4.3
24259 Chromogranin B* 2.5 116457 MAP kinase 8 interacting protein 3.0
29483 Solute carrier family 1, member 3 2.1 24166 Adenylate cyclase activating polypeptide 1 2.8
25380 Annexin 1 2.1 363058 Similar to RA175 OC363058 2.4

J Neuropathol Exp Neurol, Vol 63, November, 2004

83633 G protein-coupled receptor 51 2.2
Biosynthetic and metabolic pathways Biosynthetic and metabolic pathways
24340 Carboxyl esterase (ES-10) 21.3 81743 Cyclic GMP stimulated phosphodiesterase 7.0
362282 Phosphoenolpyruvate carboxykinase 1 11.2 25739 Brain glycogen phosphorylase 3.7
113902 Carboxylesterase 3 7.0 64157 Dimethylarginine dimethylaminohydrolase 1 2.7
24539 Lipoprotein lipase 7.0 83792 Stearoyl-Coenzyme A desaturase 2 2.4
29184 CD36 antigen 4.7
79451 Fatty acid binding protein 4 4.5
54249 Adipsin 4.2
25703 Retinol binding protein 4 3.6
25698 Arginosuccinate synthetase 3.3
54232 Carbonic anhydrase 3 3.0
CARROLL ET AL

29289 Xanthine dehydrogenase 2.9

58952 Plasma glutamate carboxypeptidase 2.7
29692 Phospholipase A2, group IIA 2.6
29516 Phosphodiesterase 3B 2.6
Mitochondrial and oxidative stress Mitochondrial and oxidative stress
24294 Cytochrome P450, subfamily 11B 6.7
25756 Carnitine palmitoyltransferase 1b 4.6
25288 Fatty acid Coenzyme A ligase, chain 2 2.8
113976 Fatty acid Coenzyme A ligase, chain 4 2.7
171341 Microsomal glutathione S-transferase 1 2.3
Growth factors, cytokines, hormones Growth factors, cytokines, hormones
24180 Angiotensin II receptor, type 1 (AT1A) 4.6 60663 Insulin receptor-related receptor 4.4
24482 Insulin-like growth factor 1* 3.2
24484 IGF binding protein 3 3.1
Signaling/ECM/other Signaling/ECM/other
83839 Calbindin 1 8.9 25216 Syndecan 1 5.0
117130 Galectin-related inter-fiber protein 4.4 84014 RalA binding protein 1 3.9
116745 K channel, subfamily H, member 6 4.2 25523 Protein kinase, cGMP- dependent, type II 3.4
24877 Visinin-like 1 3.2 24245 Calcium/calmodulin-dependent protein kinase 3.3
24330 Early growth response 1 3.4 25510 Purkinje cell protein 4 3.2

Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016

 GENE EXPRESSION IN DIABETIC GANGLIA 1149

only known genes with a greater than 2-fold expression difference are represented in this table. The full MIAME-compliant data set is available at http://bioinfor-
Locus Link ID, gene description, and average fold increase of gene expression in indicated ganglion are shown (n 5 3 independent experiments). For brevity,
TABLE 2
Serum Glucose Levels in Diabetic and Control Rats

Fold D

2.7
2.5
2.2
2.2
Duration N Glucose
Group of diabetes (rats) (mg% 6 SEM)

Diabetic 2 weeks 12 490 6 12

Control 12 109 6 31
Diabetic 2 weeks 12 454 6 14
Control 12 115 6 31
SCG specific expression (n 5 118)

Actinin alpha 2 associated LIM protein

6

Ptpn1 non-receptor phosphatase type 1

Diabetic 6 weeks 12 510 16
Control 11 114 6 4
Diabetic 17 weeks 4 422 6 21
Control 4 116 6 2
Gene description

Neurofilament heavy peptide

1
Glucose levels were assayed in a representative animal from
each cage (4 total).

sensory axons as they pass through the prevertebral gan-

glia to visceral targets (13–15).
matics.wustl.edu. Transcripts whose altered expression was confirmed by RT-PCR are indicated with an asterisk.

Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016

The explanation that differences in neurotrophin sup-
Keratin 19

port are responsible for the variation in ganglionic re-

sponse between SCG and SMG-CG has been advanced
(30) and disputed (31). Our current studies are consistent
Signaling/ECM/other

with our previous immunohistochemical and in situ hy-

bridization studies (31) demonstrating that trkA and
p75NTR dominate the neurotrophin receptor profile in both
TABLE 1 (Continued)

Locus link

24587
360626
114108
24697

SMG-CG and SCG, far exceeding the expression of trkB

and trkC. IGF-I gene expression is 2.8-fold higher in nor-
mal SMG-CG compared to the SCG, which suggests the
possibility of autocrine or paracrine release of this im-
portant neurotrophic substance. Normal SMG-CG and
SCG also differ markedly in expression of multiple genes
Fold D

3.1
2.9
2.8
2.4

encoding proteins involved in synaptic function or struc-

ture, including elements important in vesicle transport,
fusion, and synaptic membrane recovery, which may un-
derlie differences in the development of synaptic pathol-
ogy and NAD.
SMG-CG specific expression (n 5 141)

Comparison of Diabetic and Control Rat Ganglia

Amiloride-sensitive cation channel 1

Experimental and clinical diabetes differentially target

Sodium channel, type 1, alpha

the SMG-CG and SCG and their peripheral projections

Gene description

in human (9) and several experimental rodent models (6,

32), including the STZ-diabetic rat. We found that dia-
betes alters the expression of multiple genes in both SCG
and SMG-CG. Remarkably, only 5 genes of a combined
total of 110 are increased in expression in both diabetic
Calbindin 2

SMG-CG and diabetic SCG relative to their respective

Lumican

control ganglia. This degree of ganglionic specificity in

diabetes-modulated gene expression is striking and un-
anticipated. STZ-diabetic rats develop NAD in postgan-
Signaling/ECM/other

glionic noradrenergic axons innervating the ileal intra-

mural ganglia but not adjacent, equally lengthy
noradrenergic axons innervating the mesenteric vascula-
Locus link

117059

ture (4), which may reflect the origin of these axons from
81574
25364
81682

pre- and paravertebral ganglia, respectively (7, 8). Selec-

tive involvement of the nitrergic innervation of the stom-
ach of NOD mice (33) and differences in the degenerative

J Neuropathol Exp Neurol, Vol 63, November, 2004

 1150
TABLE 3
Altered Gene Expression in Diabetic Sympathetic Ganglia versus Control

Altered in diabetic SMG-CG (n 5 82) Altered in diabetic SCG (n 5 28)

Locus link Gene description Fold D Locus link Gene description Fold D

Synaptic structure/function Synaptic structure/function

25516 Prepronociceptin* 12.5 NA Similar to Vat-1 AA892520 11.3
114115 Purinergic receptor P2X 12.2 25045 Diazepam binding inhibitor 21.5
29461 VGF nerve growth factor inducible* 12.1
60355 N-ethylmaleimide sensitive factor 12.1
25693 Solute carrier family 18, member 1 11.9
25085 Tyrosine hydroxylase 11.8
24765 Secretogranin 2 11.7

J Neuropathol Exp Neurol, Vol 63, November, 2004

24259 Chromogranin B* 11.6
83709 G PCR kinase-interactor 1 11.6
266668 NMDA receptor glutamate-binding chain 11.5
79434 RAB11B 11.5
25531 RAB3A 11.4
29179 Synapsin 11.4
59104 Neurotransmitter-induced early gene 4 21.5
29253 Monoamine oxidase A 21.4
192189 B/K protein (synaptotagmin) 21.3
NA Similar to MUM-2 protein (LOC287427) 21.3
25673 Annexin 5 21.3
Biosynthetic and metabolic pathways Biosynthetic and metabolic pathways
CARROLL ET AL

NA AI176456- Metallothionein-like 15.0 29692 Phospholipase A2, group IIA 12.7

25058 Hexokinase 1 11.6 29184 CD36 antigen 12.4
117596 ATPase, beta 56/58 kDa, isoform 2 11.5
246074 Stearoyl-Coenzyme A desaturase 1 2 2.9
24539 Lipoprotein lipase 2 1.8
84050 Ectonucleotide phosphodiesterase 2 2 1.7
24679 Prkar2b 2 1.5
50555 UDP-glucuronosyltransferase 8 2 1.5
Mitochondrial and oxidative stress Mitochondrial and oxidative stress
25086 Cytochrome P450, subfamily 2E, polypep- 10.4
tide 1
NA S48325- diabetes-inducible P450RLM6 13.6 NA S48325- diabetes-inducible P450RLM6 11.8
64317 Glutathione peroxidase 3 12.0
24294 Cytochrome P450, subfamily 11B, polypep- 11.7
tide 2
NA D00636- NADH-cytochrome b5 reductase 11.4
24860 Uncoupling protein 1 229.1 24860 Uncoupling protein 1 224.8
25250 Cytochrome c oxidase subunit VIII-H 215.0 25250 Cytochrome c oxidase subunit VIII-H 28.5
25756 Carnitine palmitoyltransferase 1b 27.2
24158 Acetyl-coenzyme A dehydrogenase, medium 24.7
chain

Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016

 GENE EXPRESSION IN DIABETIC GANGLIA 1151

Locus Link ID (where available), gene description, and fold change of expression in the indicated diabetic ganglion are shown. Transcripts with similarly altered
expression in both ganglia types are indicated in bold. Transcripts whose altered expression was confirmed by RT-PCR are indicated with an asterisk. For brevity,
Fold D

11.8
22.7
22.3

only representative known genes are displayed in this table. The full MIAME-compliant data set is available at http://bioinformatics.wustl.edu.
Upregulated by Vitamin D 1 (Vdup1)
Altered in diabetic SCG (n 5 28)

Neurofilament heavy peptide

Gene description

Early growth response 1

Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016

Signaling/ECM/other
Locus link

117514
24587
24330
TABLE 3 (Continued)

Fig. 1. Real-time PCR validation of altered expression of

selected transcripts in control, pre-lesion, and NAD diabetic
Fold D

superior mesenteric/celiac ganglia and superior cervical gan-

11.8
210.9
24.3

glia. Real-time quantitative RT-PCR was used to quantitate lev-

els of insulin-like growth factor I (IGF-I), chromogranin B, pre-
pronociceptin, and VGF nerve growth factor-inducible mRNAs
in RNA isolated from pooled (8 to 24 ganglia per pool) superior
mesenteric/celiac or superior cervical ganglia collected from
rats injected with vehicle or streptozotocin after 2 weeks (‘‘pre-
Altered in diabetic SMG-CG (n 5 82)

Upregulated by Vitamin D 1 (Vdup1)

lesion,’’ A–D) or 17 weeks (‘‘post-lesion,’’ E–G). The levels

of synapse-associated protein messenger RNA were normalized
to the levels of b-actin mRNA measured in the same specimens.
Galectin-related inter-fiber protein

The normalized levels of each mRNA in normal superior mes-

enteric/celiac ganglia were used as a reference (1-fold), with
Gene description

the mRNA levels in all other ganglia calibrated relative to this

Early growth response 1

standard (indicated by fold change on the vertical axis). Rela-

tive expression levels determined for each mRNA are repre-
sented by bars, with standard errors of the mean indicated for
each bar.

response of established dissociated SCG and CG neuron

cultures to a high glucose medium challenge in vitro (34)
have also been reported. Our demonstration that diabetic
Signaling/ECM/other

SMG-CG and SCG develop distinct patterns of gene ex-

pression prior to the development of the morphologic le-
sions of NAD may provide a molecular underpinning for
Locus link

the differential development of this pathology. In light of

117514
117130
24330

the selectivity of NAD for the SMG-CG, it is notable that

diabetes resulted in the altered expression of nearly 3-
fold more transcripts in the SMG-CG than SCG. Further,

J Neuropathol Exp Neurol, Vol 63, November, 2004

1152 CARROLL ET AL
the proteins encoded by these diabetes-responsive
mRNAs mediate functions that provide important insights
into the molecular mechanisms resulting in NAD.
Synaptic Structure/Function Genes
NAD in the diabetic rat SMG-CG is a progressive,
synapse-directed process requiring 3 or more months to
develop as gauged by ultrastructural criteria. As NAD
develops, dystrophic presynaptic axon terminals accu-
mulate neurotransmitter granules, clathrin-coated vesi-
cles, tubulovesicular elements, disorganized microtu-
bules, and neurofilaments. In the SCG, which does not
develop NAD, these abnormal accumulations are not ev-
ident. Synapse-directed processes, particularly those re-
lated to synaptic vesicle function, membrane retrieval,
and turnover of subcellular organelles, are thus likely key
targets during the pathogenesis of NAD.
We grouped genes involved in neurotransmitter syn-
thesis and metabolism, receptor synthesis, and synapse-
directed structural and functional elements into a single
category for comparison. In the SMG-CG of diabetic an-
imals, the expression of 18 genes encoding proteins in-
volved in synaptic structure/function genes is altered. In
contrast, only 2 genes showed minimally altered expres-
sion in the SCG from the same diabetic animals and these
were different transcripts. Abnormalities affecting vari-
ous nerve terminal constituents, particularly those in-
volved in neurotransmitter release and recycling, are
thought to play a role in the development of synaptic
pathology in neurodegenerative diseases (35). Our studies
show diabetes likewise results in a ganglion-specific
change in many synaptically directed genes. Increased
expression of chromogranin B and solute carrier family
18, member 1 (chromaffin granule amine transporter)
genes in diabetic SMG-CG may contribute directly to
abnormal neurotransmitter granule number, structure, or
function, perhaps providing a surplus of the enlarged, dis-
organized or neurotransmitter-deficient nerve terminal
synaptic vesicles and their membranous aggregates prom-
inent in NAD. Diabetes also results in the SMG-CG-spe-
cific altered expression of N-ethylmaleimide sensitive
factor (NSF), secretogranin 2, B/K protein (synaptotag-
min), annexin V, several Rabs (Rab 3A, Rab 11B), syn-
apsin and purinergic receptor P2X, which are known to
participate in synaptic vesicle transport, aggregation,
docking, fusion, Ca12 dynamics, neurotransmitter release,
and reuptake (36–41). Also increased is G PCR kinase
interactor 1 protein, a molecule known to regulate b-2
adrenergic receptor endocytosis and, in excess, to hinder
b2-adrenergic receptor signaling (42). VGF, a secreted
protein whose expression is increased more than 2-fold
in diabetic SMG-CG (but not SCG) is an NGF- and
BDNF-inducible gene product that is widely distributed
in the CNS and PNS where it undergoes regulated release
from dense core secretory vesicles (43). VGF release is
J Neuropathol Exp Neurol, Vol 63, November, 2004
also regulated in vivo by electrical activity, injury, sei-
zures, and feeding and its expression is modulated in as-
sociation with circadian variation (44), synaptic remod-
eling, and axonal sprouting (45). Of particular relevance
to diabetes, VGF plays a critical role in energy balance,
with mice with a targeted deletion of this gene becoming
hypermetabolic and demonstrating markedly reduced lep-
tin levels and fat stores (46, 47).
Mitochondria and Oxidative Stress
Oxidative stress in diabetic peripheral nerve (48) is
thought to result from a variety of physiologic and path-
ophysiologic pathways (e.g. metabolism of nitric oxide,
polyol pathway, arachidonic acid and catecholamines,
leukocyte function, ischemia, formation of glycated pro-
teins). Brownlee has proposed that a diabetes-induced in-
crease in endothelial cell glucose metabolism produces
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
an exaggerated proton gradient in mitochondria, resulting
in the generation of excess ubiquinone intermediates and
increased superoxide production (49), although others
have reported an insulin- and NT-3-sensitive decrease in
mitochondrial membrane potential in adult cultured DRG
neurons (50). Any of these processes may generate in-
creased amounts of reactive oxygen species (ROS) in the
sympathetic ganglia of diabetic animals, particularly in
dystrophic nerve terminals, which may contain large ag-
gregates of mitochondria (32).
In the SMG-CG, diabetes alters the expression of nu-
merous transcripts encoding mitochondrial proteins
whose function is relevant to the metabolic alterations
noted above. Particularly striking is a 20- to 30-fold de-
crease in the expression of uncoupling protein (UCP)-1,
a protein initially identified on the basis of its thermo-
genic role (51). Numerous recent studies have demon-
strated that UCPs are also involved in ATP synthesis,
control of the NAD1/NADH ratio, weight regulation,
control of fatty acid metabolism, and flux of lipid sub-
strates across the mitochondrial membrane (52), and, in
particular, control of the generation of ROS. Overexpres-
sion of UCP in transgenic mice decreases the diabetes-
induced proton gradient and normalizes deranged polyol,
advanced glycosylation endproduct, protein kinase C, and
hexosamine pathways (53). Exposure to high glucose in
vitro and in vivo also decreases expression of UCP-3, an
event associated with increased generation of ROS (54).
Diabetes-induced reductions in ganglionic UCP-1 ex-
pression is thus likely to have multiple effects potentially
contributing to NAD pathogenesis.
Of note, UCP-1 expression is decreased in both dia-
betic SCG and SMG-CG and so cannot by itself be re-
sponsible for selectivity of neuroaxonal dystrophy for
SMG-CG. However, the expression of cytochrome P450,
subfamily 2E (CYP2E1), which is present in both mito-
chondrial and microsomal intracellular compartments, is
increased more than 10-fold in the diabetic SMG-CG but
 GENE EXPRESSION IN DIABETIC GANGLIA
is unchanged in the SCG. Increased expression of mito-
chondrial CYP2E1 (55) has been proposed to increase
ROS production in diabetic rat brain. Further, expression
of diabetes-inducible cytochrome P450RLM6 (a gene
product that is highly similar and may prove to be iden-
tical to the CYP2E1 protein identified in diabetic rat liv-
er) is increased 1.8-fold in diabetic SCG and 3.6-fold in
SMG-CG while expression of NADH cytochrome b5 re-
ductase, a superoxide generator (56) is increased 40% in
the SMG-CG but is decreased 30% in the SCG of the
same animals. These alterations may interfere with re-
spiratory chain function in diabetic ganglia, resulting in
increased ROS production. Decreased expression of
UCP-1 may worsen mitochondrial dysfunction and, in
combination with the respiratory chain abnormalities oc-
curring in SMG-CG, contribute to the pathogenesis of
NAD.
Other Mechanisms
There are modest increases in the expression of tran-
scripts encoding several enzymes in the glycolytic path-
way, including hexokinase (1.6-fold), aldolase (1.3-fold:
data not shown), and glyceraldehyde-3-phosphate dehy-
drogenase (1.3-fold: data not shown), of diabetic SMG-
CG without comparable change in the SCG of the same
animals. Increased glycolytic flux would be expected to
increase mitochondrial activity, possibly resulting in an
increase in ROS production, and increase activity in com-
plication-related polyol, glucosamine, protein kinase C,
and advanced glycosylation product pathways (49).
The expression of the gene for galectin-related inter-
fiber protein (GRIFIN), a key factor in injury-related
axon growth (57, 58), is 4.4-fold increased in normal rat
SMG-CG compared to SCG, and responds to diabetes
with a 10-fold decrease in expression in the SMG-CG in
the absence of an effect on the SCG. Decreased GRIFIN
expression in diabetic SMG-CG may interfere with ter-
minal axon regeneration or collateral sprouting, thought
to contribute to the pathogenesis of NAD (4). Galectin-
3 upregulation in diabetic kidney protects against AGE-
induced tissue injury (59) and a similar role in sympa-
thetic ganglia could worsen AGE effects.
In summary, our analyses of the transcriptomes of the
SMG-CG and SCG demonstrate that these ganglia ex-
press remarkably distinct profiles of mRNA, consistent
with their distinct functions and differential susceptibility
to the development of NAD. Our findings also indicate
that the strikingly different responses of SMG-CG and
SCG to diabetes occurs before the development of the
morphologic lesions of NAD and involves genes encod-
ing proteins mediating synaptic structure and function,
mitochondrial function and responses to oxidative stress,
glycolysis, and axon outgrowth. These observations sug-
gest that alterations in one or more of these functions are
important for the development of NAD. The genes we
1153
have identified in our studies should be highly useful
markers for future investigations of the pathogenesis of
this important diabetic autonomic neuropathy.
REFERENCES
1. Ewing DJ, Campbell IW, Clarke BF. The natural history of diabetic
autonomic neuropathy. Quart J Med 1980;49:95–108
2. Rundles RW. Diabetic neuropathy: General review with report of
125 cases. Medicine (Baltimore) 1945;24:111–60
3. Hosking DJ, Bennett T, Hampton JR. Diabetic autonomic neurop-
athy. Diabetes 1978;27:1043–55
4. Schmidt RE. Neuropathology and pathogenesis of diabetic auto-
nomic neuropathy. In: Tomlinson DR, ed. Neurobiology of diabetic
neuropathy. Amsterdam: Academic Press, 2002:267–92
5. Schmidt RE. Neuronal preservation in the sympathetic ganglia of
rats with chronic streptozotocin-induced diabetes. Brain Res 2001;
921:256–59
6. Schmidt RE, Plurad SB. Ultrastructural and biochemical character-
ization of autonomic neuropathy in rats with chronic streptozotocin
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
diabetes. J Neuropathol Exp Neurol 1986;45:525–44
7. Hill CE, Hendry IA, Ngu MC, Van Helden DF. Subpopulations of
sympathetic neurons differ in their sensitivity to nerve growth fac-
tor antiserum. Dev Brain Res 1985;23:121–30
8. Hill CE. Selectivity in sympathetic innervation during development
and regeneration in the rat. Experientia 1985;41:857–62
9. Schmidt RE, Plurad SB, Parvin CA, Roth KA. The effects of dia-
betes and aging on human sympathetic autonomic ganglia. Am J
Pathol 1993;143:143–53
10. Schmidt RE, Plurad SB, Modert CW. Neuroaxonal dystrophy in the
autonomic ganglia of aged rats. J Neuropathol Exp Neurol 1983;
42:376–90
11. Schmidt RE, McAtee SJ, Plurad DA, Parvin CA, Cogswell BE,
Roth KA. Differential susceptibility of prevertebral and paraverte-
bral sympathetic ganglia to experimental injury. Brain Res 1988;
460:214–26
12. Kane WH, Johnson EM. Effect of chronic clonidine treatment and
withdrawal on tyrosine hydroxylase activity in peripheral ganglia
and the locus ceruleus. Eur J Pharmacol 1978;51:309–12
13. Sejnowski TJ. Peptidergic synaptic transmission in sympathetic
ganglia. Fed Proc 1982;441:2923–28
14. Llewellyn-Smith IJ. Neuropeptides and the microcircuitry of the
enteric nervous system. Experientia 1987;43:813–21
15. Szurszewski JH. Physiology of mammalian prevertebral ganglia.
Annu Rev Physiol 1981;43:53–68
16. Elfvin LG, Lindh B, Hokfelt T. The chemical neuroanatomy of
sympathetic ganglia. Annu Rev Neurosci 1993;16:471–507
17. Janig W, McLachlan EM. Characteristics of function specific path-
ways in the sympathetic nervous system. Trends Neurosci 1992;15:
475–81
18. Boyd HD, McLachlan EM, Keast JR, Inokuchi H. Three electro-
physiologic classes of guinea pig sympathetic postganglionic neu-
rons have distinct morphologies. J Comp Neurol 1996;369:372–87
19. Chau YP, Lu KS. Investigation of the blood-ganglion barrier prop-
erties in rat sympathetic ganglia by using lanthanum ion and horse-
radish peroxidase as tracers. Acta Anat 1995;153:135–44
20. Wang HS, McKinnon D. Potassium channel expression in prever-
tebral and paravertebral sympathetic neurons: Control of firing
properties. J Physiol (Lond) 1995;485:319–35
21. Schmidt RE, Cogswell BE. Tyrosine hydroxylase activity in sym-
pathetic nervous system of rats with streptozocin-induced diabetes.
Diabetes 1989;38:959–68
22. Grkovic I, Anderson CR. Calbindin D28K-immunoreactivity iden-
tifies distinct subpopulations of sympathetic pre- and postganglionic
neurons in the rat. J Comp Neurol 1997;386:245–59
J Neuropathol Exp Neurol, Vol 63, November, 2004
1154 CARROLL ET AL
23. Mantyh PW, Catton MD, Allen CJ, Labenski ME, Maggio JE, Vig-
na SR. Receptor binding sites for cholecystokinin, galanin, somato-
statin, substance P and vasoactive intestinal polypeptide in sym-
pathetic ganglia. Neurosci 1992;46:739–54
24. Anderson RL, Jobling P, Matthew SE, Gibbins IL. Development of
convergent synaptic inputs to subpopulations of sympathetic neu-
rons. J Comp Neurol 2002;447:218–33
25. Kummer W, Fischer A. Nociceptin and its receptor in guinea-pig
sympathetic ganglia. Neurosci Lett 1997;234:35–38
26. Karhula T. Comparison of immunohistochemical localization of
[Met5] enkephalin-Arg6-Gly7-Leu8, [Met5] enkephalin, neuropep-
tide Y and vasoactive intestinal polypeptide in the superior cervical
ganglion of the rat. J Auton Nerv Syst 1995;51:9–18
27. Nishimura M, Sato K, Shimada S, Tohyama M. Expression of nor-
epinephrine and serotonin transporter mRNAs in the rat superior
cervical ganglion. Mol Brain Res 1999;67:82–86
28. Filipov AK, Couve A, Pangalos MN, Walsh FS, Brown DA, Moss
SJ. Heteromeric assembly of GABA(B)R1 and GABA(B)R2 recep-
tor subunits inhibits Ca(21) current in sympathetic neurons. J Neu-
rosci 2000;20:2867–74
29. Kaprielian Z, Cho KO, Hadjiargyrou M, Patterson PH. CD9, a ma-
jor platelet cell surface glycoprotein, is a ROCA antigen and is
expressed in the nervous system. J Neurosci 1995;15:562–73
30. Dixon JE, McKinnon D. Expression of the trk gene family of neu-
rotrophin receptors in prevertebral sympathetic ganglia. Devel
Brain Res 1994;77:177–82
31. Schmidt RE, Dorsey DA, Selznick LA, et al. Neurotrophin sensi-
tivity of prevertebral and paravertebral rat sympathetic autonomic
ganglia. J Neuropathol Exp Neurol 1998;57:158–67
32. Schmidt RE, Dorsey DA, Beaudet LN, et al. Non-obese diabetic
(NOD) mice rapidly develop dramatic sympathetic neuritic dystro-
phy—A new experimental model of diabetic autonomic neuropathy.
Am J Pathol 2003;163:2077–91
33. Cellek S, Foxwell NA, Moncada S. Two phases of nitrergic neu-
ropathy in streptozotocin-induced diabetic rats. Diabetes 2003;52:
2353–62
34. Lincoln J, Semra Y, Smith N. Effects of high glucose in vitro on
adult sympathetic neurons from rat superior cervical and celiac gan-
glia. J Periph Nerv Syst 2003;8:188
35. LoPachin RM, Ross JF, Lehning EJ. Nerve terminals as the primary
site of acrylamide action: A hypothesis. Neurotoxicol 2002;23:43–59
36. Schiavo G, Stenbeck G. Molecular analysis of neurotransmitter re-
lease. Essays Biochem 1997;32:30–41
37. Gotow T, Sakata M, Funakoshi T, Uchiyama Y. Preferential locali-
zation of annexin V to the axon terminal. Neurosci 1996;75:507–21
38. Gerdes H-H, Rosa P, Phillips E, et al. The primary structure of
human secretogranin II, a widespread tyrosine-sulfated secretory
granule protein that exhibits low pH-and calcium-induced aggre-
gation. J Biol Chem 1989;264:12009–15
39. Geppert M, Goda Y, Hammer RE, et al. Synaptotagmin I: A major
Ca21 sensor for transmitter release at a central synapse. Cell 1994;
79:717–27
40. Li L, Chin L-S. The molecular machinery of synaptic vesicle exo-
cytosis. Cell Mol Life Sci 2003;60:942–60
41. Sperlagh B, Erdelyi F, Szabo G, Vizi ES. Local regulation of [(3)]-
noradrenaline release from the isolated guinea-pig right atrium by
P(2X)-receptors located on axon terminals. Brit J Pharmacol 2000;
131:1775–83
42. Premont RT, Claing A, Vitale N, et al. b2-adrenergic receptor reg-
ulation by GIT1, a G protein-coupled receptor kinase-associated
J Neuropathol Exp Neurol, Vol 63, November, 2004
ADP ribosylation factor GTPase-activating protein. Proc Natl Acad
Sci USA 1998;95:14082–87
43. Levi A. A protein induced by NGF in PC12 cells is stored in se-
cretory vesicles and released through the regulated pathway. EMBO
J 1989;8:2217–23
44. Salton SR. Neurotrophins, growth factor regulated genes and the
control of energy balance. Mt Sinai J Med 2003;70:93–100
45. Snyder SE, Cheng HW, Murray KD, Isackson PJ, McNeill TH,
Salton SR. The messenger RNA encoding VGF, a neuronal peptide
precursor, is rapidly regulated in the rat central nervous system by
neuronal activity, seizure and lesion. Neurosci 1998;82:7–19
46. Hahm S, Tooru M, Mizuno T, et al. Targeted deletion of the Vgf
gene indicates that the encoded secretory peptide precursor plays a
novel role in the regulation of energy balance. Neuron 1999;23:
537–48
47. Hahm S, Fekete C, Toonu MM, et al. VGF is required for obesity
induced by diet, gold thioglucose treatment and agouti and is dif-
ferentially regulated in pro-opiomelanocortin- and neuropeptide Y-
containing arcuate neurons in response to fasting. J Neurosci 2002;
22:6929–38
48. Obrosova IG. How does glucose generate oxidative stress in pe-
Downloaded from http://jnen.oxfordjournals.org/ by guest on March 21, 2016
ripheral nerve? In: Tomlinson DR, ed. Neurobiology of diabetic
neuropathy. Amsterdam: Academic Press, 2002:3–35
49. Brownlee M. Biochemistry and molecular cell biology of diabetic
complications. Nature 2001;414:813–20
50. Fernyhough P, Huang T-J, Verkhratsky A. Mechanism of mito-
chondrial dysfunction in diabetic sensory neuropathy. J Periph Nerv
Syst 2003;8:227–35
51. Boss O, Muzzin P, Giacobino JP. The uncoupling proteins, a review.
Eur J Endocrinol 1998;139:1–9
52. Ricquier D, Bouillaud F. The uncoupling protein homologues:
UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem J 2000;345:
161–79
53. Vincent AM, Olzmann JA, Brownlee M, Sivitz WI, Russell JW.
Uncoupling proteins prevent glucose-induced neuronal oxidative
stress and programmed cell death. Diabetes 2004;53:726–34
54. Vincent AM, Berent AR, Brownlee M, Russell JW. Uncoupling
proteins are associated with regulation of high glucose induced ox-
idative stress and neuronal death [abstract]. J Periph Nerv Syst
2001;6:188
55. Raza H, Prabu SK, Robin M-A, Avadhani NG. Elevated mitochon-
drial cytochrome P450 2E1 and glutathione S-transferase A4-4 in
streptozotocin-induced diabetic rats. Diabetes 2004;53:185–94
56. Whatley SA, Curti D, Das Gupta F, et al. Superoxide, neuroleptics
and the ubiquinone and cytochrome b5 reductases in brain and lym-
phocytes from normals and schizophrenic patients. Molecular Psy-
chiatry 1998;3:227–37
57. Sango K, Tokashiki A, Ajiki K, et al. Synthesis, localization and
externalization of galectin-1 in mature dorsal root ganglion neurons
and Schwann cells. Eur J Neurosci 2004;19:55–64
58. Fukaya K, Hasegawa M, Mashitani T, et al. Oxidized galectin-1
stimulates the migration of Schwann cells from both proximal and
distal stumps of transected nerves and promotes axonal regenera-
tion after peripheral nerve injury. J Neuropathol Exp Neurol 2003;
62:162–72
59. Iacobini C, Amadio L, Oddi G, et al. Role of galectin-3 in diabetic
nephropathy. J Am Soc Nephrol 2003;14:S264–S270
Received May 26, 2004
Revision received July 12, 2004
Accepted July 20, 2004