Printed on: Tue Dec 22 2020, 02:58:46 AM Official Status: Currently Official on 22-Dec-2020 DocId: 1_GUID-668A1A4D-9CE5-4DD3-AB06-19A48E8A1DDC_1_en-US

(EST)
Printed by: Jinjiang Yang Official Date: Official as of 01-Aug-2017 Document Type: DIETARY SUPPLEMENTS @2020 USPC
1

0.5 mg/mL of ethidium bromide in water and de-stain with

Lactobacillus acidophilus La-14
DEFINITION
Lactobacillus acidophilus La-14 (ATCC strain designation
SD5212) is a lactic acid-producing, Gram-positive,
rod-shaped, non-motile, non-spore-forming bacterium that
is homofermentative. Lactobacillus acidophilus La-14 occurs
as a white- to cream-colored powder that is produced via
fermentation of a pure, specific strain of Lactobacillus
acidophilus. Suitable cryoprotectants may be added to the
concentrated bacteria following fermentation, after which
the product is frozen and then freeze-dried. The formulated
product may be blended with suitable diluents and/or
bulking agents. It contains NLT 100% of the labeled viable
cell count of Lactobacillus acidophilus La-14.
IDENTIFICATION
• A. NUCLEIC ACID-BASED IDENTIFICATION
[NOTE—In all cases for the Identification test, “sterile
water” refers to sterile, nuclease-free water
acceptable for use in molecular biology.1 ]
Buffer: Use a molecular biology-grade 10 mM tris
deionized water. [CAUTION—Ethidium bromide is
considered a toxic substance and a potential mutagen. Use
appropriate personal protective equipment (including
nitrile gloves) when handling this reagent.] Use a DNA
ladder standard (1 KB plus)7 suitable for determining the
size of linear double-stranded DNA fragments between
100 and 12,000 base pairs. The ladder standard should be
used in the first and last lanes on the gel to allow for proper
comparison of amplicons.
Analysis of the PCR negative control must result in the
absence of any amplification products, or the preparation
of the PCR sample preparations and the PCR negative
control must be repeated, followed by PCR amplification
and Analysis.
Acceptance criteria: The PCR sample preparations prepared
with the Primer set gives an amplification product of
184 base pairs. There should be no amplification product
of 600 base pairs.
ASSAY
• ENUMERATION
Agar medium: Prepare as follows or use a suitable

al
hydrochloride, 1 mM EDTA sodium buffer.2
Sample solution: 100 mg/mL of the freeze-dried probiotic commercially available agar (see Table 1).8
powder in Buffer
Table 1. Lactobacilli MRS Agar
Primer set: Use a primer set comprised of forward primer
sequence (5′-3′) AAACTGCAATTTAAGATTATGAGTTTC and Quantity
Reagent (g)
reverse primer sequence (5′-3′)
GGTACCGTCTTGATTATTAGTGTA.3 Primers should be
diluted in Buffer to a stock concentration of 100 µM, then
further diluted to 25 μM in Buffer, and stored at −20°. A
ci Proteose peptone no. 3

Beef extract
10.0

10.0

positive test for this Primer set is expected to give an Yeast extract 5.0
amplification product of 184 base pairs.
ffi
Dextrose 20.0
Polymerase chain reaction (PCR) sample preparations:
Prepare a solution containing 1 µL of the Sample solution, Polysorbate 80 1.0
10 µL of mastermix polymerase,4 1 µL of diluted forward Ammonium citrate 2.0
primer (25 µM), 1 µL of diluted reverse primer (25 µM), and
12 µL of sterile water. Sodium acetate 5.0
PCR negative control: Prepare as directed for the PCR
O

Magnesium sulfate 0.1

sample preparations, replacing the 1 µL of Sample solution
with 1 µL of sterile water.
PCR amplification: Perform PCR on each PCR sample
preparation and the PCR negative control using an
appropriate thermal cycler.5 Incubate at 95° for 7 min (step
1); 95° for 30 s (step 2); 51.0° for 30 s (step 3); and at 72°
for 60 s (step 4). Repeat steps 2–4 for 34 cycles, then
incubate at 72° for 5 min and hold at 4°.
Analysis: Analyze the products of the PCR amplification for
each PCR sample preparation and for the PCR negative
control using an automated on-chip electrophoresis system
with a DNA kit.6 Follow the manufacturer’s instructions for
analysis. Alternatively, analysis and visualization may be
accomplished using gel electrophoresis. Prepare or use a
commercially available 1% (w/v) agarose gel in a 1X
tris-acetic acid–EDTA buffer (40 mM tris hydrochloride, 1%
glacial acetic acid, and 1 mM EDTA). Stain the gel with
1 Suitable PCR-Certified Waters, RNase and DNase Free, are available
from www.teknova.com.
2 Suitable buffers (e.g. TE Buffer 1X, Molecular Biology Grade) are
available from www.promega.com.
3 DNA primers are commercially available (custom manufacture) from
Integrated DNA Technologies (www.idtdna.com) and other commercial
sources.
4 5 Prime MasterMix polymerase from 5 Prime.
5 Suitable thermal cyclers are available from Eppendorf®
(www.eppendorf.com).
6 Suitable automated on-chip electrophoresis systems with a DNA kit are
available from Agilent (Agilent 2100 Bioanalyzer with Agilent DNA 1000 Kit
www.genomics.agilent.com).
Manganese sulfate 0.05
Dipotassium phosphate 2.0
Agar 15.0
Suspend Lactobacilli MRS Agar in 1 L of purified water in an
appropriately sized conical flask or beaker (sufficiently
large to not boil over). Cover the flask or beaker with
aluminum foil and heat with stirring to boiling on a hot
plate. Allow to boil for 1 min to completely dissolve the
medium, then autoclave the solution at 121° for 15 min.
Cool to 45° and use immediately. Boiled Agar medium
may also be aseptically transferred into individual media
bottles in 100- or 200-mL aliquots before sterilizing, and
then autoclaved and stored for later use. [NOTE—Can be
stored at 4° (heat gently to 45° to melt the agar
before use).] Immediately before use, aseptically add
1.0 mL of a sterile 5% (w/v) cysteine hydrochloride
solution for each 100 mL of Agar medium prepared, such
that the final concentration of cysteine hydrochloride in
the Agar medium is 0.05%.
7 Suitable1 KB plus DNA ladders are available from
www.lifetechnologies.com.
8 Difco™ Lactobacilli MRS Agar, or equivalent. Suitable Lactobacilli MRS
Agars are available from www.vwr.com or other chemical/
microbiological suppliers.

https://online.uspnf.com/uspnf/document/1_GUID-668A1A4D-9CE5-4DD3-AB06-19A48E8A1DDC_1_en-US 1/2
Printed on: Tue Dec 22 2020, 02:58:46 AM Official Status: Currently Official on 22-Dec-2020
(EST)
Printed by: Jinjiang Yang Official Date: Official as of 01-Aug-2017
2
Sample broth: Prepare as follows or use a suitable
commercially available broth (see Table 2).9
Table 2. Lactobacilli MRS Broth
Quantity
Reagent (g)
Proteose peptone no. 3 10.0
Beef extract 10.0
Yeast extract 5.0
Dextrose 20.0
Polysorbate 80 1.0
Ammonium citrate 2.0
Sodium acetate 5.0
Magnesium sulfate 0.1
Manganese sulfate 0.05
Dipotassium phosphate 2.0
Suspend Lactobacilli MRS Broth in 1 L of purified water in
an appropriately sized conical flask or beaker (sufficiently
large to not boil over). Cover the flask or beaker with
aluminum foil and heat with stirring to boiling on a hot
plate. Allow to boil for 1 min to completely dissolve the
broth ingredients, then autoclave the solution at 121° for
15 min. Broth may also be aseptically transferred into
individual media bottles in 100- or 200-mL aliquots before
sterilizing, and then autoclaved and stored for later use.
ci
[NOTE—Can be stored at 4° (allow broth to come to room
temperature before use).]
ffi
Peptone diluent: Prepare a solution of 0.1% peptone10 in
water (w/v) and adjust with a solution of lactic acid to a pH
of 7.0. Using an autoclave, steam sterilize the solution at
121° for NLT 15 min, then allow to cool in the unopened
autoclave. Dispense into sterile containers as needed for
preparing samples.
O
Sample preparation: Aseptically transfer 11.0 g of
freeze-dried probiotic powder into a sterile stomacher bag.
Add 99 mL of previously sterilized (room temperature)
Sample broth to the bag and blend at 230 rpm for 2 min
in a stomacher. Hold the mixture at room temperature for
30 min to allow rehydration of the freeze-dried sample,
then blend in the stomacher for an additional 2 min at
230 rpm. This is the primary 10−1 dilution.
Using sterilized, filtered pipet tips, make serial dilutions by
aseptically transferring 1.0 mL of the primary 10−1 dilution
to sterile media bottles, each containing 99.0 mL of
Peptone diluent (10−3 dilution). Repeat this operation until
the desired dilution series is obtained. [NOTE—The
dilutions used in the Analysis should be expected to
contain 25–250 cfu/mL.] Shake the media bottles for
complete mixing before proceeding with the Analysis.
9 Difco™ Lactobacilli MRS Broth, or equivalent are available from
www.vwr.com or other chemical/microbiological suppliers.
10 Suitable peptone for microbiological analysis is available from BD
Bacto™ (www.bd.com).
https://online.uspnf.com/uspnf/document/1_GUID-668A1A4D-9CE5-4DD3-AB06-19A48E8A1DDC_1_en-US
DocId: 1_GUID-668A1A4D-9CE5-4DD3-AB06-19A48E8A1DDC_1_en-US
Document Type: DIETARY SUPPLEMENTS @2020 USPC
Analysis: For each Sample preparation to be plated, prepare
the Petri plates as follows. Using three sterile, filtered 1-mL
pipet tips, aseptically transfer 1.0 mL of the Sample
preparation separately into three appropriately labeled
sterile 15-mm × 100-mm Petri plates, then pour about
15 mL of the 45° Agar medium into each plate, flaming the
lip of the bottle between pours. Place the lid on each plate
after adding the Agar medium, then gently swirl the plates
to mix the Sample preparation and the Agar medium.
[NOTE—Be careful to avoid spillage onto the lid of the dish
when swirling the plates.] Repeat this procedure for
additional dilutions of the Sample preparation. Prepare one
blank plate that contains only the Agar medium and a
second blank plate in which 1.0 mL of Peptone diluent has
been mixed with the Agar medium. Allow the plates to sit
at room temperature on a level surface until the Agar
medium solidifies, then incubate the plates at 38° for 72 h
under anaerobic conditions.11
After 72 h of incubation, count the colonies and record the
results as viable cfu/g, taking into account the appropriate
dilution factor of the Sample preparation. Only count
plates containing 25–250 colonies. Determine the
al
average plate count, in cfu/g.
Acceptance criteria: NLT 100% of the labeled viable cell
count, in cfu/g
CONTAMINANTS
[NOTE—The methods of microbial analysis included in this
section as examples represent currently accepted
methods commonly used in industry. Users may
substitute other validated test methods for the methods
in this section.]
• MICROBIAL ENUMERATION TESTS á2021ñ: The total
combined molds and yeasts count does not exceed 102 cfu/
g.
• NON-LACTIC ACID BACTERIA: ISO international standard
number 13559 (IDF 153), available from the International
Organization for Standardization (www.iso.org). The total
non-lactic acid bacteria count is less than 5 × 103 cfu/g.
• ABSENCE OF SPECIFIED MICROORGANISMS á2022ñ, Test
Procedures,Test for Absence of Escherichia coli andTest for
Absence of Salmonella Species: It meets the requirements of
the tests for absence of Escherichia coli. It meets the
requirements of the tests for absence of Salmonella species
in 40 g.
• Listeria: (See Food Chemicals Codex, Appendix XV.) It meets
the requirements of the tests for absence of Listeria in 25 g.
ADDITIONAL REQUIREMENTS
• PACKAGING AND STORAGE: Preserve in high barrier foil
laminate bags and store at or below 4°.
• LABELING: This ingredient should be labeled with the genus,
species, and strain names and with the formulated
enumeration in cfu/g (or similar units). This monograph
applies only to Lactobacillus acidophilus La-14, and no other
strains of Lactobacillus acidophilus cultures.
11 Suitable anaerobic systems are available from BD GasPak™ EZ Container
System, www.bd.com.
2/2