Comparative study of Chronic

Ulcerative Dermatopathy in cultured

meagre, Argyrosomus regius M.I.
Tsertou
Visit to download the full and correct content document:
https://ebookmass.com/product/comparative-study-of-chronic-ulcerative-dermatopath
y-in-cultured-meagre-argyrosomus-regius-m-i-tsertou/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...

Lubkin’s Chronic Illness (Lubkin, Chronic Illness) 9th

Edition, (Ebook PDF)

https://ebookmass.com/product/lubkins-chronic-illness-lubkin-
chronic-illness-9th-edition-ebook-pdf/

Romanian Folklore and its Archaic Heritage. A cultural

and Linguistic Comparative Study Ana R. Chelariu

https://ebookmass.com/product/romanian-folklore-and-its-archaic-
heritage-a-cultural-and-linguistic-comparative-study-ana-r-
chelariu/

Finance Capitalism and Income Inequality in the

Contemporary Global Economy: A Comparative Study of the
USA, South Korea, Argentina and Sweden Kuat B.
Akizhanov
https://ebookmass.com/product/finance-capitalism-and-income-
inequality-in-the-contemporary-global-economy-a-comparative-
study-of-the-usa-south-korea-argentina-and-sweden-kuat-b-
akizhanov/

Entrepreneurial Responses to Chronic Adversity Dean A.

Shepherd

https://ebookmass.com/product/entrepreneurial-responses-to-
chronic-adversity-dean-a-shepherd/
Essentials of Comparative Politics (Sixth Edition)

https://ebookmass.com/product/essentials-of-comparative-politics-
sixth-edition/

LGBTQ+ People with Chronic Illness: Chroniqueers in

Southern Europe Mara Pieri

https://ebookmass.com/product/lgbtq-people-with-chronic-illness-
chroniqueers-in-southern-europe-mara-pieri/

Key Concepts in the Study of Antisemitism Sol Goldberg

https://ebookmass.com/product/key-concepts-in-the-study-of-
antisemitism-sol-goldberg/

A Dynamic Theory of Populism in Power: The Andes in

Comparative Perspective Julio F. Carrion

https://ebookmass.com/product/a-dynamic-theory-of-populism-in-
power-the-andes-in-comparative-perspective-julio-f-carrion/

Medical and Psychosocial Aspects of Chronic Illness and

Disability (Ebook PDF)

https://ebookmass.com/product/medical-and-psychosocial-aspects-
of-chronic-illness-and-disability-ebook-pdf/
 Aquaculture 556 (2022) 738301

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Comparative study of Chronic Ulcerative Dermatopathy in cultured

meagre, Argyrosomus regius
M.I. Tsertou a, b, N. Papandroulakis b, K. Keklikoglou b, c, I. Kalantzi d, M. Tsapakis d,
A. Tsalafouta e, M. Pavlidis e, E. Antonopoulou a, P. Katharios b, *
a
Laboratory of Animal Physiology, Department of Zoology, School of Biology, Faculty of Sciences, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
b
Institute of Marine Biology, Biotechnology and Aquaculture, Hellenic Centre for Marine Research, Former American Base of Gournes, Heraklion 71003, Crete, Greece
c
Biology Department, University of Crete, 70013 Heraklion, Crete, Greece
d
Institute of Oceanography, Hellenic Centre for Marine Research, Former American Base of Gournes, 71500 Heraklion, Crete, Greece
e
Laboratory of Fish Physiology, Department of Biology, University of Crete, Heraklion, Greece

A R T I C L E I N F O A B S T R A C T

Keywords: Chronic Ulcerative Dermatopathy (CUD) is a disease that affects all cultured meagre when reared in facilities
Lateral line supplied with borehole water, resulting in ulceration of the skin overlying the lateral line canals. The aims of this
erosion study were (i) to describe the morphogenesis of the cephalic lateral line, (ii) to investigate the effect of the use of
Ulcer
borehole water vs natural seawater in the development of the disease, (iii) to assess the recovery of the lesions
micro-CT
Histopathology
and (iv) to evaluate the effect of CO2 and pH on the development of CUD. The development of the lateral line
Heavy metals canals in the head was completed by day 28 post hatching when fish were 19.3 mm in total length, while the
Water quality source of the water did not affect the developmental process. The characteristic lesions of CUD were induced
Meagre when meagre were reared in borehole water, while the lesions were resolved when fish were transferred to
natural seawater. Lesions were macroscopically visible by day 56 post hatching. Moreover, significant differences
in the expression of genes regulating osteoclast’s activity were observed between healthy and CUD-affected fish,
while neither pH nor CO2 were involved in the development of the disease. Finally, higher concentrations of
heavy metals were found in the heads of CUD-affected meagres reared in borehole water compared to healthy
fish reared in natural seawater.

1. Introduction
The lateral line is a mechanosensory system found in all fishes and in
the larvae of aquatic amphibians, which is used for the detection of
water movements and/or pressure fluctuations (Bleckmann and Zelick,
2009; Mogdans et al., 2004). The receptors of the lateral line that detect
water flow are called neuromasts and they are distributed on the head,
the trunk and the tail of the fish. Neuromasts can be either superficial on
the skin or enclosed in the fluid-filled canals of the lateral line that open
to the environment through a series of pores (Bleckmann and Zelick,
2009; Webb, 1989). The development and maintenance of the lateral
line canals is achieved through a bone remodeling process which in­
cludes the participation of both osteoclasts (bone-resorption cells) and
osteoblasts (bone-forming cells) (Wada et al., 2014; Webb, 2013).
Several conditions affecting the lateral line organ of the head and the
trunk of various marine and freshwater fish have been reported under
the terms, hole-in-the-head, Head and Lateral Line Erosion syndrome
(HLLE) and Lateral Line Depigmentation (LLD) (Corrales et al., 2009;
Morrison et al., 2007; Noga, 2010). Apart from these, Chronic Ulcerative
Dermatopathy (CUD) is a pathological condition affecting the lateral
line canals of freshwater and marine cultured fish species. It was first
described in the Australian freshwater fish Murray cod (Maccullochella
peelii peelii (Mitchell)), when reared in sites supplied by groundwater
(Baily et al., 2005; Ingram et al., 2004; Schultz et al., 2011; Schultz et al.,
2008). The clinical signs of this first report included focal erosion, ul­
ceration and loss of epidermis around the lateral line canals of the head
and the trunk and fin erosion. It has been associated with reduced
growth rates, increased mortalities and significant reduction of
marketability due to the severe disfigurement of the affected fish (Baily
et al., 2005; Ingram et al., 2004; Schultz et al., 2008). Due to the
localization of the lesions exclusively on the lateral line canals, it was
hypothesized that the disease mechanism involved the binding of an

* Corresponding author.
E-mail address: katharios@hcmr.gr (P. Katharios).

https://doi.org/10.1016/j.aquaculture.2022.738301
Received 29 September 2021; Received in revised form 13 April 2022; Accepted 25 April 2022
Available online 27 April 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Table 1 et al., 2011). In this scenario, there would be an environmentally

Specific primers used for the expression of genes encoding for tartrate-resistant induced imbalance between osteoclasts and osteoblasts that would
acid phosphatase (TRAP), cathepsin K (CathK,) and vATPase, as well as, for the cause the lesions seen in the fish, located exclusively in the lateral line
reference gene β-actin. canals which are in direct contact with the water.
Gene Forward Reverse A range of marine fishes have been reported as CUD-sensitive
b-actin 5’ TGTCCCTGTATGCCTCTGGT 3’ 5’ AAGTCCAGACGGAGGATGG including one of the most important marine aquaculture species, Euro­
3’ pean seabass (Dicentrachus labrax). The lesions in the seabass become
TRAP 5’ TGCGGAAGTCACAAAGAACAA 5’ GGAGAGGACAGTGCGATAGA visible when the fish is more than 5 g. Although most of the hatcheries in
3’ 3’ the Mediterranean use borehole water, the disease was undetected until
Cath K 5’ ACGCTCACTCCAAATCCAACTG 5’ CCGTGCCGCTACAATTCATCA
3’ 3’
recently due to the common practice of growing the fish in inland fa­
5’ TGTATGCCTGTTATGCCATTG 5’ TCCTGAGCGATGAAGTTCTT cilities until 2-3 g and then transfer it to sea cages. Many hatcheries
vATPase
3’ 3’ changed their strategy and grew the seabass in larger size before the
transportation to sea cages so the disease became apparent and a bigger
concern for the producers since the damaged epidermis could affect the
unknown waterborne toxin to the mucus content of the sensory canals,
susceptibility of the fish to a wide range of pathogens in the sea (Kath­
resulting in focal hyperplasia and necrosis. Moreover, it was shown that
arios, personal observations).
when CUD-affected Murray cod were transferred to river water, the
Apart from the seabass and sharpsnout seabream, meagre (Argyr­
majority of the fish were structurally recovered after a period of 8–10
osomus regius) which is an emerging species for the Mediterranean
weeks. Based on these results and in the absence of viral or bacterial
aquaculture was found also to be sensitive to CUD when reared in fa­
agents, it was suggested that some component of the groundwater was
cilities supplied with borehole water. The disease affects 100% of the
the driving force for the development of CUD. However, after analysis of
population and results in ulceration of the skin overlying the lateral line
basic water quality parameters as well as heavy metal and pesticide/
canals, however, it is not associated with mortalities (Rigos and Kath­
insecticide content of the groundwater, the exact component of the
arios, 2010; Soares et al., 2018). The aim of this study is to describe the
water that could have resulted in the development of the disease could
morphogenesis of the lateral line organ in the head of meagre as it is the
not be identified. Following the association of groundwater with the
organ affected from CUD and to describe the disease using histology,
disease, several water treatment methods were evaluated in order to
scanning electron microscopy (SEM) and microcomputed tomography
reduce the severity of the lesions on Murray cod, including electrolyte
(μ-CT). In addition, the osteoclast activity was investigated in CUD-
enrichment, pre-treatment with UV irradiation and pre-conditioning of
affected fish using molecular markers while the CO2 in the water was
groundwater either in a vegetated earthen pond or in tanks containing
examined as the aetiological factor of the disease.
artificial macrophytes (Schultz et al., 2011). Among them, pre-
conditioning of the water for 72 h into a vegetated earthen pond or a
2. Materials and methods
tank containing biofilms growing on an artificial macrophyte, was found
to be an effective method for the reduction of both the incidence and the
2.1. Ethics
severity of CUD in juvenile Murray cod (Schultz et al., 2011).
Regarding marine fish species, CUD was described in sharpsnout
All animal experimental procedures and handling in this study were
seabream (Diplodus puntazzo) when cultured in saline borehole water
conducted in the HCMR’s licensed facility (EL91-BIOexp-04) under the
(Katharios et al., 2011). The CUD-affected fish exhibited bilateral lesions
protocol 255,332 (29/11/2017) approved by the regional veterinary
in the head canals of the lateral line and eroded fins and recovery of the
authority, which is the competent agency according to the Directive
lesions was also observed following transfer of the fish to natural sea
2010/63/EU.
water. Вy excluding an infectious agent for the onset of the disease and
in an attempt to determine the causative agent of CUD in sharpsnout
seabream it was hypothesized that borehole water, which was rich in 2.2. Rearing trial for the description of the disease
CO2, as indicated also by the lower pH compared to the pH of natural
seawater, increases the enzymatic activity of the osteoclasts (Katharios Two parallel rearing trials of meagre in borehole and natural
seawater, respectively, were conducted in order to study the

Fig. 1. A: Superficial neuromast on the head of 1 dph meagre (Argyrosomus regius). B: Superficial neuromast on the body of 6 dph meagre (TL: 4.05 ± 0.08 mm). C:
Higher magnification of superficial neuromast on the body of 11 dph meagre (TL: 6.03 ± 0.39 mm) where is visible the sensory cells, the mantle cells and the
supporting cells. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the references to colour in this figure legend, the reader is referred to the
web version of this article.)

2
M.I. Tsertou et al.
Fig. 2. SEM micrographs of meagre’s (Argyrosomus regius) head. A: Diamond shaped superficial neuromast on the head (3 dph – TL:3.54 ± 0.00 mm). B: Round
shaped superficial neuromast on the head (5 dph – TL: 3.68 ± 0.00 mm). C: Diamond shaped superficial neuromast on the head (17 dph – TL: 9.48 ± 0.7 mm). D:
Higher magnification of picture C with the stereocilium and the kinocilium of the hair cells. Double-headed arrows show hair cell orientation. S: stereocilia,
K: kinocilium.
development of CUD. The eggs used in this study were obtained from a
broodstock maintained at the facilities of the Institute of Marine Biology,
Biotechnology and Aquaculture, HCMR, Crete, Greece. Specifically,
100,000 eggs were placed in each of the 2 tanks (40m3), the first of
which was supplied with natural seawater and the second with borehole
water. Eggs were incubated under natural photoperiod, at 19.5 ◦ C and
36 and 38 ppt salinity for borehole and natural sea water, respectively.
The trial lasted 56 days after hatching (dph) with the same rearing
protocols applied in both tanks. The feeding protocol included the
addition of the microalgae Chlorella sp. in the rearing water from 4 to 15
dph, feeding with enriched rotifers (Вrachionus sp.) from 4 to 18 dph,
enriched Artemia spp. nauplii from 12 to 36 dph and artificial food (INVE
SA, Belgium) from 19 dph. Measurements of pH, O2 (HQ40D Portable
Multi Meter, Hach), CO2 (CO2 Portable Carbon Dioxide Analyzer, Oxy­
Guard) and water temperature were performed daily in the two water
sources. Random samples of larvae and juvenile fish from both tanks
were euthanized with an overdose of tricaine (MS222) and sampled for
histology, scanning electron microscopy (SEM), micro-CT analysis,
Quantitative Real-Time PCR (qPCR) and SDS-PAGE and immunoblot
analysis.
2.3. Histology
Three fish from each tank were sampled daily from day 1 to 7, every
two days from day 9 to 21 and every five days until day 56 post hatching.
The samples were preserved in buffered 4F:1G, containing 4% formal­
dehyde: 1% gluteraldehyde for at least 24 h (McDowell and Trump,
1976). Subsequently they were dehydrated in gradually increased
ethanol solutions (70–96%) and then embedded in glycol methacrylate
3
Aquaculture 556 (2022) 738301
resin (Technovit 7100, Heraeus Kulzer). Sections of 4 μm were obtained
with a microtome (RM 2035, Leica, Germany). After drying, slides were
stained with methylene blue/azure II/basic fuchsin according to Bennett
et al. (1976) and examined under a light microscope.
2.4. Scanning electron microscopy (SEM)
Three fish from each tank were sampled at 1, 2, 3, 4, 5, 6, 7, 9, 11, 13,
15, 17, 19, 21, 26, 31, 36, 41, 46 and 56 dph fixed in 2.5% glutaralde­
hyde in 0.1 M sodium cacodylate buffer (pH 7.4) for 1 or 2 days
(depending on the size of the fish) and then stored in sodium cacodylate
buffer at 4 ◦ C. The samples were then dehydrated through a graded
acetone series, critical point dried and sputter-coated with gold. Samples
were viewed using a JEOL JSM-6390LV scanning electronic microscope
at 15 kV at the Electron Microscopy Laboratory of the University of
Crete.
2.5. Micro-CT
One fish from each tank was sampled at 56 dph, fixed in 10%
phosphate-buffered formalin and dehydrated to 70% ethanol for 3 days
before scanning. Subsequently, the samples were stained with 0.3%
phosphotungstic acid (PTA) in 70% ethanol in order to enhance the
contrast between the soft tissues. The micro-CT scans of the samples
were performed at the Hellenic Centre for Marine Research (HCMR)
using the SkyScan 1172 micro-CT scanner (SkyScan, Bruker, Belgium).
This scanner uses a tungsten X-ray source with an anode voltage ranging
from 20 to 100 kV, 11 MP CCD camera (4000 × 2672 pixel) and a
maximal resolution of <0.8 μm/pixel. Samples were scanned at a
 M.I. Tsertou et al.
4

Fig. 3. Development of the subraobrital canal of meagre (Argyrosomus regius). A: Longitudinal section of a presumptive canal neuromast sitting on the epithelial surface (5 dph – TL: 3.68 ± 0.00 mm) (red arrow). B:
Cross section of the neuromast in canal groove (11 dph – TL: 6.03 ± 0.39 mm). C: Cross section of the development of the epithelial canal roof with the enclosed neuromast (19 dph – TL: 9.75 ± 1.21 mm). D-H: Cross
sections of the fully formed supraorbital canal as it is distributed from the anterior to the posterior part of the head (46 dph – TL: 41.78 ± 0.87 mm). b: brain, cr: canal roof, cw: canal walls, e: eye, er: epithelial roof, nm:
neuromast. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Aquaculture 556 (2022) 738301

M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Fig. 4. SEM micrographs with the development of the supraorbital canal of meagre (Argyrosomus regius). A: Superficial neuromasts over the eye of meagre (5 dph –
TL: 3.68 ± 0.00 mm) (red arrows). B: Neuromasts in epithelial depressions (red arrows) over the eye of meagre (17 dph – TL: 9.48 ± 0.7 mm). C: Grooves of partially
enclosed supraorbital canals with one formed pore (red arrow) (21 dph – TL: 11.75 ± 0.83 mm). D: 31dph meagre (ΤL: 19.30 ± 1.27 mm) with enclosed canals on the
head. N: nostril. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

voltage of 80 kV and a current of 124 μA with an aluminum filter of 0.5
mm while the images were acquired at a pixel size of 13.78 μm and
exposure time 1435 ms. To minimize the scanning duration, scans were
performed for a half rotation of 180o. The projection images acquired
during the scanning procedure were reconstructed into cross-section
images using the SkyScan’s NRecon software (NRecon, Skyscan,
Bruker, Belgium) which implements a modified Feldkamp’s back-
projection algorithm.
2.6. Gene expression of Cathk, TRAP and vATPase
Ten fish of similar weight (1.62 ± 0.33 g and 1.69 ± 0.40 g from
borehole water and natural seawater respectively) from each tank was
sampled at 56 dph, frozen in liquid nitrogen and stored at 80 ◦ C until
analyzed. All fish reared in borehole water had visible signs of the dis­
ease as opposed to the fish reared in natural seawater which appeared
normal. Head samples were homogenized in 600 μL RLT plus buffer
(RNeasy Plus Mini Kit Qiagen, Valencia, USA) using the TissueRuptor
(Qiagen, Hilden, Germany). Total RNA was extracted using RNA isola­
tion nucleospin RNA plus (Macherey-Nagel) according to the in­
structions of the manufacturer. In order to determine RNA yield and
purity, measurement of the absorbance at 260 and 280 nm was con­
ducted using the Nanodrop® ND-1000 UV–Vis spectrophotometer
(Peqlab, Erlangen, Germany) while the integrity of RNA was tested by
electrophoresis in 1% agarose gels. The cDNA was synthesized by
reverse transcription of 1 μg RNA using the QuantiTect Reverse Tran­
scription kit (Qiagen Inc., CA, USA) according to the manufacturer’s
instructions. The mRNA expression of genes encoding for tartrate-
resistant acid phosphatase (ΤRAP), Cathepsin K (CathK) and vATPase
(primers in Table 1) was determined in healthy and CUD-affected head
samples with quantitative polymerase chain reaction (qPCR) which was
performed on the CFX ConnectTM Real-Time PCR Detection System
(Bio-Rad) using the KAPA SYBRR FAST qPCR Kits (KAPA Biosystems,
USA). Cycling parameters were as follows: 95 ◦ C for 3 min (HotStarTaq
DNA Polymerase activation step) followed by 36 cycles at 95 ◦ C for 15 s
(denaturation step) and 60 ◦ C for 30 s (annealing step). Dissociation
curve analysis was performed at the end of the cycles to ensure that
single amplifications were obtained. A standard curve was constructed
for each gene, using four serial dilutions (1:5) of a pool of all cDNA
samples by plotting the negative log of the dilution factor against the
relative cycle threshold value. Еach primer pair was required to have a
linear standard curve with an R2 value above 0.98 and primer amplifi­
cation efficiency between 95 and 105% in order to be considered suit­
able for analysis,. Results were evaluated with the Bio-Rad CFX Manager
2.1 software while the data were calculated by the comparative method
using Ct values of β-actin as the reference control.
2.7. SDS-PAGE and immunoblot analysis
Six fish of similar weight (1.68 ± 0.31 g and 1.65 ± 0.36 g from
borehole water and natural seawater respectively) from each tank were
sampled at 56 dph, frozen in liquid nitrogen and stored at − 80 ◦ C until
analyzed. Hsps (Hsp70, Hsp90) and MAPK (p38 MAPK, ERK1/2)
members were determined in homogenized head samples according to
well established protocols, as described in Antonopoulou et al., 2020,
Antonopoulou et al., 2014. Briefly, healthy and CUD-affected heads (45-
50 mg) were homogenized in 3 mL g-1 of cold lysis buffer (20 mM Hepes
pH 7.5, 20 mM β-glycerophosphate, 50 mM NaF, 2 mM EDTA, 10 mM

5
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Fig. 5. Development of the mandibular canal of meagre (Argyrosomus regius). A: Longitudinal section of a presumptive canal neuromast sitting on the epithelial
surface (7 dph – TL: 4.08 ± 0.03 mm) (red arrow). B: Cross section of the neuromast in canal groove (17 dph – TL: 9.48 ± 0.70 mm). C: Cross section of the epithelial
canal roof with the enclosed neuromast (21 dph – TL: 11.75 ± 0.83 mm). D: Cross sections of the fully formed mandibular canal (56 dph – TL: 46.8 ± 0.18 mm). cr:
canal roof, cw: canal walls, e: eye, er: epithelial roof, nm: neuromast. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the references to colour
in this figure legend, the reader is referred to the web version of this article.)

benzamidine, 0.2 mM Na3VO4, in pH 7, containing 200 μM leupeptin, stored at − 80 ◦ C until analysis. Τhe concentrations of 22 metals and
300 μМ phenyl methyl sulfonyl fluoride (PMSF), 10 μМ trans-epoxy elements were determined in the whole head by Inductively Coupled
succinyl-L-leucylamido-(4- guanidino) butane, 5 mM DTT (dithio­ Plasma – Mass Spectrometer (ICP–MS NexION300, PerkinElmer, Shel­
threitol) and 1% v/v Triton X-100). Protein concentration was deter­ ton, CT, U.S.) following the protocols described in detail by Kalantzi
mined using the BioRad protein assay, a dye-binding assay based on the et al. (2013).
differential colour change of a dye (Coomansie Brilliant Blue G-250) in
response to various protein concentrations. Equivalent amounts of
2.9. Recovery trial
protein (50 μg) were separated on 10% (w/v) acrylamide, 0.275% (w/v)
bisacrylamide slab gels, and transferred electrophoretically onto nitro­
For the recovery trial, a group of 4-month-old meagre (n = 500) with
cellulose membranes (0.45 μm, Schleicher and Schuell, Keene N.H.
visible lesions associated with CUD were transferred from the inland
03431, USA). All nitrocellulose membranes were dyed with Ponceau
facilities of HCMR in Heraklion to sea cages in the Bay of Souda, Chania.
stain to assure a good transfer quality and equal protein loading. The
For the next 5 months (once per month), 10 fish were randomly
antibodies used were as follows: monoclonal mouse anti-heat shock
sampled, anesthetized with MS222 and visually examined for external
protein, 70 kDa (Cat. No. H5147, Sigma, Darmstadt, Germany); mono­
lesions. Τhe farm is certified as an aquaculture facility from the national
clonal mouse anti-heat shock protein, 90 kDa (Cat. No. H1775, Sigma,
veterinary authority (code GR94FISH0001). A group of the same pop­
Darmstadt, Germany); monoclonal rabbit anti-phospho p44/42 MAPK
ulation (n = 500) was kept in the inland facilities of HCMR in Heraklion
(Thr202/Tyr204) (Cat. No. 4376, Cell Signaling, Beverly, MA, USA);
and was reared in borehole water for the same period and fish were
polyclonal rabbit anti-phospho-p38 MAP kinase (Thr180- Tyr182) (Cat.
monitored with the same procedure as with the fish transferred to sea
No. 9211, Cell Signaling, Beverly, MA, USA). Finally, bands were
cages.
detected by enhanced chemiluminescence (Cell Signaling, Beverly, MA,
USA) with exposure to Fuji Medical X-ray films. Films were quantified
by laser- scanning densitometry (GelPro Analyzer Software, Media 2.10. Investigation of the effect of CO2 and pH in the development of
Cybernetics). CUD

A second rearing trial was performed, in order to investigate whether

2.8. Metal and element analysis increased CO2 in borehole water is the aetiological agent responsible for
the development of CUD lesions. The eggs used in this trial were ob­
Nine fish from each tank were sampled at 56 dph, the whole head tained by a broodstock maintained at the facilities of the Institute of
was dissected from each sample, snap frozen on liquid nitrogen and Marine Biology, Biotechnology and Aquaculture, HCMR, Crete, Greece.

6
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Fig. 6. Development of the infraorbital canal of meagre (Argyrosomus regius). A: Horizontal section of a presumptive canal neuromast sitting on the epithelial surface
(4 dph – TL: 3.53 ± 0.00 mm) (red arrow). B: Cross section of the neuromast in canal groove (21 dph – TL: 11.75 ± 0.83 mm). C: Cross section of the epithelial canal
roof with the enclosed neuromast (26 dph – TL: 18.04 ± 0.69 mm). D: Cross sections of the fully formed infraorbital canal (46 dph – TL: 41.78 ± 0.87 mm). cr: canal
roof, cw: canal walls, e: eye, er: epithelial roof, nm: neuromast. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the references to colour in this
figure legend, the reader is referred to the web version of this article.)

Fig. 7. Average weight (g) and length (cm) of meagre (Argyrosomus regius) reared in borehole (black) and natural seawater (grey). The values are mean ± SD and
asterisk indicate the statistically significant differences between the two water sources as indicated after independent t-test analysis (p < 0.05). (For interpretation of
the references to colour in this figure legend, the reader is referred to the web version of this article.)

In total, 125,000 eggs were placed in each of the 2 tanks (40m3) supplied
with natural seawater. In one of the tanks, CO2 was injected into the
seawater before entering the larvae tank, maintaining the pH value at a
mean of 7.4, lower to the natural value of pH that had a mean of 8.0, in
order to simulate the pH/CO2 conditions of the borehole water. The trial
lasted 60 days dph with the same rearing protocols applied in both
tanks. The feeding protocol included the addition of the microalgae
Chlorella sp in the rearing water from 3 to 15 dph, feeding with enriched
rotifers Вrachionus sp from 3 to 16 dph, enriched Artemia spp. nauplii
from 11 to 26 dph and artificial food (INVE SA, Belgium) from 18 dph.
Measurements of pH, O2 (HQ40D Portable Multi Meter, Hach), CO2 (CO2
Portable Carbon Dioxide Analyzer, OxyGuard) and water temperature
were performed daily in the two water sources. Random samples of
larvae (n = 10) from both tanks were sampled every 7 days and

7
M.I. Tsertou et al.
Fig. 8. Physicochemical parameters of the two water sources during the rearing trial with borehole water (black) and natural seawater (grey). (For interpretation of
the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 9. Meagre (Argyrosomus regius) reared in natural seawater (left) and
borehole water (right) for 56 dph. All fish reared in borehole water had visible
lesions on the head associated with CUD at the end of the rearing trial.
preserved in buffered 4F:1G for histology as described above.
3. Results
3.1. Development of the lateral line canals
The first superficial neuromasts appear from the 1 dph both on the
head and the trunk of meagre, consisting of the sensory hair cells, the
mantle cells and the supporting cells (Fig. 1). Scanning electron micro­
scopy revealed the presence of two morphological types of superficial
8
Aquaculture 556 (2022) 738301
neuromasts, round or diamond-shaped, with the latter being larger in
size (Fig. 2).
The morphogenesis of the lateral line canals in the head of meagre is
not a synchronized process, however all the canals are completely
formed by the 31st dph. The supraorbital is the first canal that begins to
form as the first grooves with the submerged neuromasts appear at 9 dph
(TL: 5.40 ± 0.27 mm). The ossified canal walls on either side of the
neuromast are formed from the 17 dph (TL: 9.48 ± 0.7 mm) while the
first neuromasts, enclosed by soft tissue canal roof are observed from the
21 dph (TL: 11.75 ± 0.83 mm) (Figs. 3 & 4).
The first grooves of the mandibular canal appear at 11 dph (TL: 6.03
± 0.39 mm) while the walls of the canal begin to rise on each side of the
neuromast at 19 dph (TL: 9.75 ± 1.21 mm) and the first epithelial canal
roofs have formed at 21 dph (Fig. 5). The formation of infraorbital canal
starts with the appearance of the first grooves at the 19 dph, the walls of
which begin to rise at 21 dph while the first enclosed neuromasts are
observed at 26 dph (TL: 18.04 ± 0.69 mm) (Fig. 6).
3.2. The effect of the borehole water in the development of CUD
The growth of fish in terms of total length and wet weight, reared
with different water sources is presented in Fig. 7. The growth perfor­
mance of the fish was not affected by the different source of water until
41 dph. On the 44th and 56th dph the weight and the length of the fish
reared in the natural seawater was significantly higher than the fish
reared in the borehole water.
The temperature of the borehole water remained relatively constant
during the rearing trial with a mean value of 20.4 ± 0.5 ◦ C (range
19–21 ◦ C) while in natural seawater the temperature increased from the
35th dph onwards with a mean value of 21.6 ± 1.0 ◦ C (range 20–23 ◦ C).
The dissolved O2 in natural seawater was 7.27 ± 0.98 mgL− 1 (range
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Fig. 10. Cross sections of a supraorbital, an infraorbital and a mandibular canal of healthy (A, C, E) and CUD-affected meagre (Argyrosomus regius) (B, D, F). The
canal roofs of the CUD-affected meagre showed hyperplasia and loss of the basal membrane while the neuromasts were exposed to the external environment. cr: canal
roof, nm: neuromast. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the references to colour in this figure legend, the reader is referred to
the web version of this article.)

4.60–9.0 mgL− 1) and the corresponding value in borehole water was
7.16 ± 1.04 mgL− 1 (range 5.70–9.13 mgL− 1).
The average pH value in natural seawater was 7.82 ± 0.14 (range
7.54–8.01) and in borehole water 7.62 ± 0.15 (range 7.40–7.92) while
CO2 was consistently lower in natural seawater with a mean value of
1.56 ± 0.66 mgL− 1 (range 1.00–4.00 mgL− 1) compared to borehole
water where the mean value was 3.88 ± 0.63 mgL− 1 (range 3.00–5.00
mgL− 1) (Fig. 8).
At the end of the rearing trial (56dph) all fish reared in the tanks
supplied with borehole water had visible lesions associated with CUD in
comparison with the fish reared in natural sea water (Fig. 9).
From the comparative histological analysis of meagre reared in
borehole and natural seawater no differences were observed until 31
dph. Fig. 10 shows a supraorbital, an infraorbital and a mandibular
canal of meagre reared in natural seawater (Fig. 10 A, C, E) and in
borehole water (Fig. 10 B, D, F) on 56 dph. In meagre reared in natural
seawater, the canals were completely developed. Instead, in meagre
from borehole water erosion, ulceration and loss of the basal membrane
was observed while the neuromasts were exposed to the external envi­
ronment. The lesions were initially manifested as hydropic swelling and
hyperplasia of the epidermis before becoming ulcerative.
The micro-CT scans from the CUD-affected head samples of meagre
that was reared in borehole water, revealed that the supraorbital and the
infraorbital were the main affected canals while the mandibular had
lesions in a smaller extent at least until the 56 dph (Fig. 12), whereas, in
the samples from the healthy fish that was reared in natural seawater
fully formed canals were observed (Fig. 11).
Scanning electron microscopy of CUD-affected fish revealed the

9
M.I. Tsertou et al.
Fig. 11. μCT slices of healthy meagre’s (Argyrosomus regius) head showing the cephalic canals from anterior (A) to posterior (F). Red asterisk: supraorbital canal, blue
asterisk: infraorbital canal, green asterisk: mandibular canal. (For interpretation of the references to colour in this figure legend, the reader is referred to the web
version of this article.)
presence of lesions mainly in the nasal cavity and around it where they
are normally located the pores of the supraorbital and infraorbital canals
while in affected individuals the pore openings have been widened,
leaving the canal neuromasts exposed. Moreover, the opening of the
nasal cavity in CUD-affected meagre was larger than in healthy in­
dividuals however, the olfactory rosette appeared normal. In both
healthy and affected individuals, superficial neuromasts located around
the opening of the nasal cavity were normal. In addition, the roof of the
canal at the area of the supraorbital commissure (SOCom) where the left
and right supraorbital canals join and the roof of the supraorbital canal
posterior to SOCom, were absent in the CUD-affected individual, while
the exposed canal neuromasts did not appear to be affected at least until
56 dph (Figs. 13, 14).
3.3. Recovery trial
The transfer of 4-month meagre with lesions associated with CUD
from borehole water to natural seawater showed that CUD is a reversible
condition as after 5 months in natural sea water the meagre showed
almost 100% healing of the lesions as assessed by macroscopic obser­
vations. On the other hand, the group of fish that was kept in the inland
facilities of HCMR and was reared in borehole water for the same period
showed deterioration of the condition with severe ulceration in the head
area. (Fig. 15).
3.4. Expression of genes and proteins in healthy and CUD-affected meagre
The expression profile of CathK, TRAP and vATPase in the head
tissues of the fish reared in different water sources was significantly
different at the end of the rearing trial (56 dph) (Fig. 16). In particular,
cathepsin K and TRAP expression was 2.7 and 2.1 times higher,
10
Aquaculture 556 (2022) 738301
respectively, in the CUD-affected fish of the borehole water group
compared to the healthy fish of the natural seawater group (t(17) =
2.26, p = 0.037 for cathepsin K and t(17) = 2.41, p = 0.028 for TRAP).
The expression of vATPase did not exhibit significant differences be­
tween the fish from the two water sources (t(17) = − 0.219, p = 0.830).
The relative protein expression of Hsp90, Hsp70, phospho p38 MAPK
and phospho p44/42 MAPK in the head tissues of healthy and CUD-
affected fish which were reared in natural seawater and borehole
water respectively, was significantly different at the end of the rearing
trial (56 dph) (Fig. 17). In particular, the Hsp70 and Hsp90 was 4 and
4.9 times higher, respectively, in the CUD-affected fish of the borehole
water compared to the healthy fish of the seawater (t(10) = 51.14, p =
0.000 for Hsp70 and t(10) = 21.01, p = 0.000 for Hsp90). Moreover,
CUD-affected fish exhibited increased phosphorylation of p38 MAPK
(3.2 times higher, t(10) = 30.03, p = 0.000) and p44/42 MAPK (2.5
times higher, t(10) = 26.36, p = 0.000) compared to the healthy meagre.
3.5. Metal and element concentrations in healthy and CUD-affected
meagre
Mean elemental concentrations in the heads of healthy and CUD-
affected meagre reared in natural seawater and borehole water respec­
tively are summarized in Table 2 The CUD-affected meagre were found
to have significantly higher concentrations of Lithium (Li), Chromium
(Cr), Cobalt (Co), Copper (Cu) and Barium (Ba) compared to healthy fish
(p < 0.05). Moreover, Aluminum (Al), Vanadium (V), Cadmium (Cd),
Caesium (Cs) and Lead (Pb) were detected only in fish reared in borehole
water.
M.I. Tsertou et al.
Fig. 12. μCT slices of CUD-affected meagre (Argyrosomus regius) head showing the cephalic canals from anterior (A) to posterior (F). The canal roofs of the affected
fish were open with the neuromasts exposed to the external environment. Red asterisk: supraorbital canal, blue asterisk: infraorbital canal, green asterisk: mandibular
canal. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.6. The effect of the CO2 and pH in the development of CUD
At the end of the second rearing trial (60 dph) no statistically sig­
nificant differences were observed on the average weight and length of
the fish that were reared in natural seawater and natural seawater + CO2
(t(118) = 1.02, p = 0.309 for the weight and t(118) = 1.89, p = 0.062 for
the length). Specifically, the fish reared in natural seawater had an
average weight of 2.00 ± 0.65 g and an average length of 5.37 ± 0.61
cm, while those reared in natural seawater+CO2 had a mean final
weight 2.10 ± 0.50 g and mean final length 5.55 ± 0.39 cm.
The temperature in both tanks showed a similar upward trend during
the experiment with the mean value of 24.1 ± 1.32 ◦ C (range
20.4–26.9 ◦ C) in the tank that was supplied with natural seawater and
23.95 ± 1.39 ◦ C (range 20.3–26.7 ◦ C) in the tank that was supplied with
natural seawater+CO2.
The dissolved O2 in the tank with the natural seawater was 7.79 ±
1.34 mgL− 1 (range 5.03–9.94 mgL− 1) and the corresponding value in the
natural seawater+CO2 water was 7.85 ± 1.49 mgL− 1 (range 4.90–11.00
mgL− 1).
The mean pH value in natural seawater was 7.98 ± 0.13 (range
7.75–8.66) and in natural seawater+CO2 7.36 ± 0.19 (range 6.72–7.83)
while CO2 was consistently lower in natural seawater tank with a mean
value of 1.32 ± 0.74 mgL− 1 (range 0.00–3.00 mgL− 1) compared to
natural seawater+CO2 tank where the mean value was 4.43 ± 0.65
mgL− 1 (range 3.00–6.00 mgL− 1) (Fig. 18).
Although the CO2 and pH in the tank with the natural seawater +
CO2 were adjusted to replicate the conditions of the borehole water, at
the end of the rearing trial (60 dph) none of the fish that reared in this
water had visible lesions associated with CUD as shown in Fig. 19.
Histological analysis of head samples from meagre reared in natural
seawater+CO2 confirmed the non-development of CUD-related lesions,
11
Aquaculture 556 (2022) 738301
as the lateral canal were found to be fully formed and normal (Fig. 20).
4. Discussion
The aim of this study was to investigate the development of CUD in
meagre by a comparative study of two populations reared parallelly in
tanks supplied with natural seawater or borehole seawater. From the
specific comparative rearing trial, it was confirmed that the use of
borehole water leads to the development of lesions related to CUD in the
entire farmed meagre population. The ulcerative lesions in the head
became visible macroscopically in fish at 56 dph (TL: 4.37 ± 0.11 cm),
while CUD was found to be a reversible pathological condition as the
transport of affected individuals in natural sea water led to complete
healing of the lesions within a period of 5 months. These results are in
accordance with other reported cases of CUD, both in freshwater and
marine fish species. In the Australian freshwater fish Murray cod,
M. peelii peelii the first gross signs appeared approximately three weeks
after exposure to groundwater as enlargement of the pores of the head
and trunk canals. Progressively, the elongated pores began to coalesce,
resulting in exposure of the bed of the canal and finally all the canal beds
were exposed while ulceration on the head started to extend into sur­
rounding areas. Similar to meagre, it was shown that when CUD-affected
Murray cod were transferred to river water, the majority of the fish were
structurally recovered after a period of 8–10 weeks (Baily et al., 2005).
Concerning marine fish species, the first lesions of CUD in sharpsnout
seabream were observed at 70 dph while at 130 dph all fish that were
reared in borehole water had bilateral grooves at the area of the lateral
line canals. The transportation of the affected fish in natural sea water
led to the recovery of the lesions over a period of about 4 months
(Katharios et al., 2011).
In contrast to Murray cod, in which CUD led to reduced growth rate
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

Fig. 13. SEM micrographs of healthy and CUD-affected juvenile meagre (Argyrosomus regius) (56 dph). Dorsal view showing the supraorbital canal (SO), the
infraorbital canal (IO) and supraorbital commissure (SOCom) of healthy (A) and CUD-affected meagre (B). Lateral view of healthy (C) and CUD-affected meagre (D)
showing the infraorbital canal, the nostril (R) and the mandibular canal (MD). Higher magnification of the nostril (N) with the supraorbital and the infraorbital canal
(IO) of healthy (E) and CUD-affected meagre (F). Red arrows indicate the superficial neuromasts around the nostril. (For interpretation of the references to colour in
this figure legend, the reader is referred to the web version of this article.)

and increased mortality, no mortality was observed in CUD-affected
meagre. The relatively reduced growth that was observed in CUD-
affected meagre is probably related to the lower temperature of the
borehole water in comparison to the natural sea water (20.4 ± 0.5 ◦ C
and 21.6 ± 1.0 ◦ C, respectively) as it is known that increasing the
temperature up to 26 ◦ C has a beneficial effect on the growth of the
meagre (Antonopoulou et al., 2020; Chatzifotis et al., 2018).
The results from histology, SEM and μ-CT confirmed that the lesions
in meagre were limited to the lateral line organ in the head and in the
nasal cavity which is in agreement with the conclusions of Baily et al.
(2005) for Murray cod and of Katharios et al. (2011) for sharpsnout
seabream.
From the histological comparative analysis, no differences were
observed up to 36 dph between the groups reared in natural seawater
and in borehole water respectively, with the development of the lateral
line canals in the head occurring normally in both groups. The cranial
lateral line canals of meagre like most teleost bony fish (Webb, 2014;
Webb, 2013) are narrow and well-ossified. The development of the
lateral line canals is an asynchronous process both within the same canal
and between the different canals, with the supraorbital and the
mandibular canals being the first to begin forming, followed by the
infraorbital (Webb, 2014). This was also confirmed in the case of
meagre, as the supraorbital and the mandibular canals starts to form
when the fish are 5.40 ± 0.27 mm and 6.03 ± 0.39 mm, respectively
while the infraorbital canal starts to develop when the fish are 9.75 ±
1.21 mm and all canals are fully formed when the fish are 19.3 ± 1.27

12
 M.I. Tsertou et al.
13

Fig. 14. SEM micrographs of CUD-affected meagre (Argyrosomus regius – 56 dph). A: Lateral view of the head with the ulcerative nostril, supraorbital (red arrow) and infraorbital canal (green frame). The olfactory
rosette was not affected. B: Higher magnification of the nostril with the opened infraorbital canal (red arrow). Framed area indicates normal superficial neuromasts around the nostril. C-D: Higher magnification of the
superficial neuromasts around the nostril. E: Higher magnification of the infraorbital canal with the exposed canal neuromast. F: Higher magnification of the exposed canal neuromast showing the normal sensory hair
cells. G: Dorsal view of the opened supraorbital canal with the exposed neuromasts (red arrows, red frame). H: Higher magnification of the exposed neuromast from the framed area of picture G. (For interpretation of the
references to colour in this figure legend, the reader is referred to the web version of this article.)

Aquaculture 556 (2022) 738301

M.I. Tsertou et al.
Fig. 15. Nine-month-old meagre (Argyrosomus regius) reared А: exclusively in borehole seawater B: in borehole water for 4 months and transferred to natural
seawater for 5 months, with partial resolution of the lesions. C: in borehole water for 4 months and transferred to natural seawater for 5 months, with complete
resolution of the lesions.
Fig. 16. Relative expression of CathK, TRAP and vATPase in heads of healthy
and CUD-affected meagre (Argyrosomus regius) at the end of the rearing trial (56
dph). Values are means+SD while (*) indicates statistically significant differ­
ences between the two groups (p < 0.05).
Fig. 17. Relative expression of Нsp70, Hsp90, phospho p38 MAPK και phospho
p44/42 MAPK in heads of healthy and CUD-affected meagre (Argyrosomus
regius) at the end of the rearing trial (56 dph). Values are means+SD while
asterisk (*) indicates statistically significant differences between the two groups
(p < 0.05).
mm. Τhe development of the lateral cranial canals has been studied
mainly in various species of cichlids (Amatitlania nigrofasciata, Labeo­
tropheus fuelleborni, Maylandia zebra, Aulonocara baenschi, Aulonocara
stuartgranti and Tramitichromis sp) and does not differ significantly
compared to meagre. In all cases the onset of canal formation is observed
when the fish are 5–8 mm in length while the completion of the for­
mation is observed when the fish are 16–22 mm (Becker et al., 2016;
Tarby and Webb, 2003; Webb, 2014). In contrast to both meagre and the
14
Aquaculture 556 (2022) 738301
various species of cichlids, the development of lateral canal canals in
zebrafish (Danio rerio) appears to be delayed as the first submerged
neuromasts of the supraorbital and the mandibular canals appear when
the fish are 10 mm and 11.5 mm respectively, however, their closure is
observed when the fish is 22 mm in length (Webb and Shirey, 2003).
Histologically, the first lesions related to CUD in meagre were
observed from 36 dph onwards. The lesions were initially manifested as
hydropic swelling and hyperplasia of the epidermis before becoming
ulcerative leaving the canal neuromasts exposed. The neuromasts did
not appear to be affected by CUD at least until the age of 56 dph. In
murray cod, the first lesions of CUD were observed histologically 3
weeks after exposure of the fish to borehole water, as marked hyper­
plasia and necrosis. Two weeks later, the tissue above the canals was
completely necrotic, however as in the case of meagre, no degeneration
of the exposed neuromasts was observed (Baily et al., 2005). In CUD-
affected sharpsnout seabream, the histological examination revealed
the presence of ulcers in the cranial lateral line canals while the roof of
the canals was always absent leaving the canal neuromasts exposed. In
contrast to meagre and to murray cod the exposed neuromasts of
sharpsnout seabream appeared either normal or degenerated and
necrotic (Katharios et al., 2011). In the case of sharpsnout seabream the
nasal cavity was affected from CUD which was also observed and in
meagre. However, in the sharpsnout seabream the olfactory rosette was
also damaged (Katharios et al., 2011) which was not observed in
meagre.
In either cases of meagre, murray cod and sharpsnout seabream there
is evidence that the development of CUD is directly linked with the use
of groundwater, which is reinforced by the fact that the condition is
reversed by transporting the fish in natural sea or fresh water. However,
the actual causative agent of CUD is unknown in all cases. It is note­
worthy that the pH was lower and CO2 higher in borehole water in
comparison with natural seawater. High levels of CO2 in rearing water of
fish leads to a decrease in pH of their extracellular environment. The
decrease of pH in the extracellular environment is one of the factors that
can lead to the activation of osteoclasts (Arnett, 2008; Yuan et al., 2016),
which in collaboration with osteoblasts, participate in the remodeling of
the bones that contain the lateral line canals as the fish grows in size
(Wada et al., 2014; Webb, 2013). An imbalance between osteoclasts and
osteoblasts could lead to the lesions seen in the fish, located exclusively
in the lateral line canals. The tartate-resistant acid phosphatase (TRAP)
is the most widely used marker enzyme for the identification of osteo­
clasts and with the cysteine proteinase cathepsin K (CathK) are being
used as molecular markers of bone resorption (Azuma et al., 2007; Costa
et al., 2011; Minkin, 1982). Moreover, the vacuolar-type proton
pumping ATPases (V-ATPase) are important for the normal function of
these enzymes as they are responsible for the acidic pH of the bone
resorption lacunae which is formed between the osteoclast plasma
membrane and the bone surface through secretion of protons (Futai
et al., 2019). Gene expression of TRAP, cathK, and v-ATPase showed
that the CUD-affected meagre had significantly higher levels of TRAP
and cathK compared to healthy meagre while v-ATPase levels were
M.I. Tsertou et al.
Fig. 18. Physicochemical parameters of the two water sources during the rearing trial with natural seawater (grey) and natural seawater+CO2 (black). (For
interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 19. Meagre (Argyrosomus regius) reared in natural seawater (left) and
natural seawater+CO2 (right) at the end of the rearing trial (60dph). None of
the fish reared in natural seawater+CO2 had visible lesions associated
with CUD.
higher but not statistically significant compared to healthy individuals.
These results indicate that there is an increased osteoclastic activity in
the head of the CUD-affected meagre. In mammals it has been shown
that increased osteoclastic activity could lead to an imbalance in bone
remodeling which promotes resorption resulting to skeletal diseases
such as osteoporosis, rheumatoid arthritis, periodontal disease, multiple
myeloma and metastatic cancers (Boyle et al., 2003; Rodan and Martin,
2000). Moreover, in accordance with the results from meagre, pre­
liminary results from CUD-affected sharpsnout seabream using enzyme
histochemistry has shown increased TRAP activity at the area of the
lesions compared to normal samples (Katharios et al., 2011). The
increased osteoclastic activity in the head area of CUD-affected meagre
reared in borehole water compared to those reared in natural seawater
was also confirmed by the comparative expression of phospho p38
MAPKs and phospho p44/42, since in healthy fish reared in natural
15
Aquaculture 556 (2022) 738301
seawater their levels were significantly lower. The higher expression of
MAPKs in CUD-affected fish can be explained by the fact that both p38
MAPKs and p44/42 are activated by the binding of RANKL to the RANK
receptor of osteoclasts, which in turn leads to the downstream activation
of transcription factors controlling the expression of the genes encoding
for TRAP and CathK, in areas where bone resorption occurs (Boyle et al.,
2003; Lee et al., 2018). Hsp70 and Hsp90 were also overexpressed in the
CUD-affected individuals compared to the healthy fish, which enhances
the increased osteoclastic activity as Hsp70 induces osteoclastic bone
resorption via the RANKL / RANK pathway, while even though the role
of Hsp90 in osteoclastogenesis is controversial it has been shown that it
can induce the expression of osteoclast-associated genes (Hang et al.,
2018).
Based on the results from the comparative rearing of meagre in
natural seawater and borehole water, the second larval rearing trial was
performed in order aiming to test whether increased CO2 concentration
is the aetiological agent for the development of CUD lesions. This trial
was designed in order to replicate the pH and CO2 conditions of the
borehole water without including any other chemical or environmental
factor. After macroscopic examination and histological analysis, it was
revealed that none of the fish reared in the natural seawater where CO2
was added showed any lesions related to CUD. The lack of the lesions in
the head of the fish suggests that neither the increased CO2 nor the
consequently reduced pH are the factors affecting the development of
CUD.
The results from the metal analysis of healthy meagre reared in
natural seawater and CUD-affected meagre reared in borehole water
showed that fish with lesions had significantly higher levels of Li, Cr, Co,
Cu and Ba in relation to healthy individuals. In addition, Al, V, Cd, Cs
and Pb were detected only in CUD-affected fish while in healthy in­
dividuals they were below detectable limits. Metals can be categorized
as biologically essential and nonessential. The nonessential metals (e.g.,
M.I. Tsertou et al. Aquaculture 556 (2022) 738301

deficiencies or at high concentrations (Kennedy, 2011). In general,

metals can affect multiple physiological systems of fish while toxicity
depends on metal form, bioavailability, toxicokinetics and toxicody­
namics (Kennedy, 2011; Sfakianakis et al., 2015). Heavy metals in the
water can cause reduction of the survival and the growth of fish larvae,
behavioral anomalies or structural damages (Stominska and Jezierska,
2000). More specifically, metals can reduce calcium uptake and bone
calcium accumulation leading to changes in bone properties and can
induce disturbances of neuro-muscular transmission leading to skeletal
deformities (Hassanain et al., 2012). It was reported that exposure of
freshwater fish to Hg and Cd leads to a disturbed calcium metabolism,
resulting in hypocalcemia and anomaly of the bone. Both metals, first
influence osteoclastic activities under acute exposure and then inhibit
osteoblastic activities under long-time exposure (Suzuki et al., 2004).
Moreover, carp larvae exposed to Pb, developed scoliosis, while Cu
caused inhibition of skeletal ossification which might have resulted from
impaired ionic regulation. In addition, both metals caused reduction of
the fish survival and the growth rates (Stominska and Jezierska, 2000).
Disturbance of bone ossification was also reported in Nile tilapia after
exposure to Pb (Hassanain et al., 2012). In addition to fish, it was re­
ported that exposure of chick femur culture to Zn and Cd led to
decreased mineralization of bone, with or without suppression of matrix
formation while exposure to Zn and Cu caused decreased mineralization
and matrix formation (Toshiyuki et al., 1991). Moreover, it was found
that Zn is an extremely potent inhibitor of rat osteoclasts in vitro, since
significant inhibition of resorption was reported at concentrations as low
Fig. 20. Cross sections of the fully formed lateral line canals on the head of
meagre (Argyrosomus regius) reared in natural seawater+CO2 (60 dph, TL: 5,65 as 10− 14 M (Moonga and Dempster, 1995). In the case of meagre, despite
± 0,49 cm). A: Supraorbital canal (magnification: x1). B: Mandibular canal the differences between healthy and CUD affected fish, the values
(magnification: x3). C: Infraorbital canal (magnification: x3). No lesions asso­ observed are within the range of values reported for other fish species,
ciated with CUD were observed in any of the canals. b: brain, cr: canal roof, e: including gilthead seabream and European seabass when lesions are
eye. Stain with methylene blue/azure II/basic fuchsin. (For interpretation of the absent (El-Moselhy et al., 2014; Kalantzi et al., 2016; Kalantzi et al.,
references to colour in this figure legend, the reader is referred to the web 2013). On the other hand, it has been reported that Cu concentrations
version of this article.) above 1 mg L− 1 can cause damage to the epithelium of the lateral canal
of Fundulus hereroclitus while in some cases canal neuromasts were also
affected (Eisler and Gardner, 1973). It has been shown that metals such
Table 2 as Cu are toxic to the peripheral sensory systems of fish and other
Metal and element concentrations in the head of healthy and CUD- affected aquatic organisms by reducing the physiological response or at higher
meagre individuals (Argyrosomus regius). The values are mean ± SD while
concentrations by cell death of the olfactory and mechanosensory neu­
different superscript letters indicate statistically significant differences (p <
rons (Linbo et al., 2009). Moreover, lateral line dysfunction was re­
0.05) between the two water groups (bdl: below detection limit).
ported after exposure of zebrafish embryos to Cu (68 and 244 μg Cu L1).
CUD-affected fish Healthy fish The copper-exposed larvae showed fewer functional neuromasts which
Calcium (Ca) (mg/g) 92.44 ± 10.61 85.40 ± 2.53 was associated with a reduced ability of orientation in a current
Phosphorus (P) (mg/g) 49.26 ± 4.95 39.27 ± 6.83 (Johnson et al., 2007). Neuromasts cellular damage, apoptosis, and loss
Zinc (Zn) (mg/kg) 65.72 ± 9.67 55.69 ± 1.82
of hair cell markers were also reported in zebrafish after exposure to sub-
Sodium (Na) (mg/g) 16.25 ± 1.05 14.57 ± 2.48
Copper (Cu) (mg/kg) 1.70 ± 0.51a 0.85 ± 0.25b lethal concentrations of waterborne copper while other metals such as
Magnesium (Mg) (mg/kg) 1.33 ± 0.53 0.86 ± 0.03 Zn, Fe, Ag, Mn, Co, Cd and Sn, did not show the same effects (Hernández
Chromium (Cr) (mg/kg) 0.89 ± 0.20a 0.52 ± 0.09b et al., 2006).The concentration of Cu in the head of CUD-affected
Potassium (K) (mg/g) 0.75 ± 0.11 0.83 ± 0.13 meagre was 1.70 ± 0.51 mg/kg, while in healthy fish it was signifi­
Selenium (Se) (mg/kg) 0.65 ± 0.02 0.61 ± 0.07
Lithium (Li) (mg/kg) 0.16 ± 0.04a 0.07 ± 0.00b
cantly lower (0.85 ± 0.25 mg/kg) suggesting that Cu could be one of the
Cobalt (Co) (mg/kg) 0.15 ± 0.05a 0.08 ± 0.01b factors leading to the development of CUD. Moreover, in the study of
Molybdenum (Mo) (mg/kg) 0.10 ± 0.03 0.08 ± 0.04 CUD in the sharpsnout seabream the concentrations of Ni, Pb, Zn and Cu
Manganese (Mn) (mg/g) 0.03 ± 0.01 0.02 ± 0.00 were higher in the borehole water than in the natural seawater, however
Aluminum (Al) (mg/kg) 2.41 ± 0.57 bdl
these levels were within the acceptable limits for marine aquaculture
Barium (Ba) (mg/kg) 2.14 ± 0.28a 1.12 ± 0.13b
Cadmium (Cd) (mg/kg) 0.01 ± 0.00 bdl and much lower than the toxic limits (Katharios et al., 2011). Never­
Lead (Pb) (mg/kg) 0.62 ± 0.10 bdl theless, metal toxicity as a causative factor for the development of CUD
Vanadium (V) (mg/kg) 0.22 ± 0.03 bdl cannot be ruled out because of the lower pH of the borehole water and
Nickel (Ni) (mg/kg) 3.44 ± 0.57 2.82 ± 0.14 the longer exposure times of the fish and therefore it should be further
Mercury (Hg) (mg/kg) 0.07 ± 0.01 0.07 ± 0.01
Caesium (Cs) (mg/kg) 9.15 ± 1.46 bdl
studied in the future as environmental parameters and interactions
Rubidium (Rb) (mg/kg) 0.15 ± 0.02 0.12 ± 0.03 among various metals may affect their toxicity to fish (Sfakianakis et al.,
2015).
Although the disease is directly associated with the use of borehole
Al, V, Cd, Pb, Ba) which have no proven biological function can become water, the causative agent is still unknown for meagre, as well as for
extremely toxic for organisms due to their persistence and their ten­ Murray cod and sharpsnout seabream. For all species the lesions resolve
dency to bioaccumulate (Amoussou et al., 2019; Carvalho et al., 2005; when the fish are transferred to natural freshwater or seawater (Baily
Tarley et al., 2001). On the other hand, essential metals (e.g., Cu, Zn, Cr, et al., 2005; Katharios et al., 2011). Furthermore, for Murray cod,
Co), have a known biological role, and they can become toxic either at Schultz et al. (2011) found that the retention of groundwater into a

16
M.I. Tsertou et al.
vegetated earthen pond or in a tank containing biofilms growing on an
artificial macrophyte for 72 h prevents the development of CUD. Thus, it
is recommended to avoid borehole seawater for the rearing of meagre if
natural sea water sources are available and to pay careful attention to
the water quality of the source of the water used. Alternatively, the
residence time of meagre in borehole water should be reduced to the
minimum necessary, and fish should be moved to natural seawater (e.g.
in sea cages) as soon as possible once the nursery phase is completed, in
order to allow the tissue regeneration process to complete before mar­
keting the fish.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
Funding was provided for this project from The European Union’s
Seventh Framework Programme for research, technological develop­
ment and demonstration (KBBE-2013-07 single stage, GA 603121,
DIVERSIFY).
References
Amoussou, N., Marengo, M., Durieux, E.D.H., Douny, C., Scippo, M.L., Gobert, S., 2019.
Trace elements and fatty acid profile of Argyrosomus regius (Asso, 1801) from
Mediterranean aquaculture. Biol. Trace Elem. Res. https://doi.org/10.1007/s12011-
019-01925-x.
Antonopoulou, E., Kousidou, E., Tserga, E., Feidantsis, K., Chatzifotis, S., 2014. Dietary
lipid levels in meagre (Argyrosomus regius): effects on biochemical and molecular
indicators of liver. Aquaculture 428–429, 265–271. https://doi.org/10.1016/j.
aquaculture.2014.03.024.
Antonopoulou, E., Chatzigiannidou, I., Feidantsis, K., Kounna, C., Chatzifotis, S., 2020.
Effect of water temperature on cellular stress responses in meagre (Argyrosomus
regius). Fish Physiol. Biochem. 46, 1075–1091. https://doi.org/10.1007/s10695-
020-00773-0.
Arnett, T.R., 2008. Extracellular pH Regulates Bone Cell Function. J. Nutr. 138,
415S–418S. https://doi.org/10.1093/jn/138.2.415s.
Azuma, K., Kobayashi, M., Nakamura, M., Suzuki, N., Yashima, S., Iwamuro, S.,
Hattori, A., 2007. Two osteoclastic markers expressed in multinucleate osteoclasts of
goldfish scales. Biochem. Biophys. Res. Commun. 362, 594–600. https://doi.org/
10.1016/j.bbrc.2007.08.010.
Baily, J.E., Bretherton, M.J., Gavine, F.M., Ferguson, H.W., Turnbull, J.F., 2005. The
pathology of chronic erosive dermatopathy in Murray cod, Maccullochella peelii peelii
(Mitchell). J. Fish Dis. 28, 3–12. https://doi.org/10.1111/j.1365-2761.2004.00586.
x.
Becker, E.A., Bird, N.C., Webb, J.F., 2016. Post-embryonic development of canal and
superficial neuromasts and the generation of two cranial lateral line phenotypes.
J. Morphol. 277, 1273–1291. https://doi.org/10.1002/jmor.20574.
Bennett, H.S., Wyrick, A.D., Lee, S.W., McNeil, J.H., 1976. Science and art in preparing
tissues embedded in plastic for light microscopy, with special reference to glycol
methacrylate, glass knives and simple stains. Stain. Technol. 51, 71–97. https://doi.
org/10.3109/10520297609116677.
Bleckmann, H., Zelick, R., 2009. Lateral line system of fish. Integr. Zool. 4, 13–25.
Boyle, W.J., Simonet, W.S., Lacey, D.L., 2003. Osteoclast differentiation and activation.
Nature 423, 337–342. https://doi.org/10.1038/nature01658.
Carvalho, M.L., Santiago, S., Nunes, M.L., 2005. Assessment of the essential element and
heavy metal content of edible fish muscle. Anal. Bioanal. Chem. 382, 426–432.
https://doi.org/10.1007/s00216-004-3005-3.
Chatzifotis, S., Clavero, S., Kounna, C., Soumalevris, A., Feidantsis, K., Antonopoulou, E.,
2018. Effects of long-term feed deprivation on body weight loss, muscle
composition, plasma metabolites, and intermediate metabolism of meagre
(Argyrosomus regius) under different water temperatures. Fish Physiol. Biochem. 44,
527–542. https://doi.org/10.1007/s10695-017-0451-3.
Corrales, J., Ullal, A., Noga, E.J., 2009. Lateral line depigmentation (LLD) in channel
catfish, Ictalurus punctatus (Rafinesque). J. Fish Dis. 32, 705–712. https://doi.org/
10.1111/j.1365-2761.2009.01069.x.
Costa, A.G., Cusano, N.E., Silva, B.C., Cremers, S., Bilezikian, J.P., 2011. Cathepsin K: its
skeletal actions and role as a therapeutic target in osteoporosis. Nat. Rev. Rheumatol.
7, 447–456. https://doi.org/10.1038/nrrheum.2011.77.
Eisler, R., Gardner, G.R., 1973. Acute toxicology to an estuarine teleost of mixtures of
cadmium, copper and zinc salts. J. Fish Biol. 5, 131–142. https://doi.org/10.1111/
j.1095-8649.1973.tb04441.x.
El-Moselhy, K.M., Othman, A.I., Abd El-Azem, H., El-Metwally, M.E.A., 2014.
Bioaccumulation of heavy metals in some tissues of fish in the Red Sea, Egypt. Egypt.
J. Basic Appl. Sci. 1, 97–105. https://doi.org/10.1016/j.ejbas.2014.06.001.
17
Aquaculture 556 (2022) 738301
Futai, M., Sun-Wada, G.-H., Wada, Y., Matsumoto, N., Nakanishi-Matsui, M., 2019.
Vacuolar-type ATPase: a proton pump to lysosomal trafficking. Proc. Japan Acad.
Ser. B 95, 261–277. https://doi.org/10.2183/pjab.95.018.
Hang, K., Ye, C., Chen, E., Zhang, W., Xue, D., Pan, Z., 2018. Role of the heat shock
protein family in bone metabolism. Cell Stress Chaperones 23, 1153–1164. https://
doi.org/10.1007/s12192-018-0932-z.
Hassanain, M.A., Abbas, W.T., Ibrahim, T.B., 2012. Skeletal ossification impairment in
Nile Tilapia (Oreochromis niloticus) after exposure to lead acetate. Pakistan J. Biol.
Sci. 15, 729–735. https://doi.org/10.3923/pjbs.2012.729.735.
Hernández, P.P., Moreno, V., Olivari, F.A., Allende, M.L., 2006. Sub-lethal
concentrations of waterborne copper are toxic to lateral line neuromasts in zebrafish
(Danio rerio). Hear. Res. 213, 1–10. https://doi.org/10.1016/j.heares.2005.10.015.
Ingram, B.A., Gavine, F., Lawson, P., 2004. Diseases and health management in intensive
Murray cod aquaculture. In: Ingram, B.A., De Silva, S.S. (Eds.), Development of
Intensive Commercial Aquaculture Production Technology for Murray cod. Primary
Industries Research Victoria, Marine and Freshwater Systems, Department of
Primary Industries, Queenscliff, Victoria, pp. 129–146.
Johnson, A., Carew, E., Sloman, K.A., 2007. The effects of copper on the morphological
and functional development of zebrafish embryos. Aquat. Toxicol. 84, 431–438.
https://doi.org/10.1016/j.aquatox.2007.07.003.
Kalantzi, I., Black, K.D., Pergantis, S.A., Shimmield, T.M., Papageorgiou, N., Sevastou, K.,
Karakassis, I., 2013. Metals and other elements in tissues of wild fish from fish farms
and comparison with farmed species in sites with oxic and anoxic sediments. Food
Chem. 141, 680–694. https://doi.org/10.1016/j.foodchem.2013.04.049.
Kalantzi, I., Pergantis, S.A., Black, K.D., Shimmield, T.M., Papageorgiou, N.,
Tsapakis, M., Karakassis, I., 2016. Metals in tissues of seabass and seabream reared in
sites with oxic and anoxic substrata and risk assessment for consumers. Food Chem.
194, 659–670. https://doi.org/10.1016/j.foodchem.2015.08.072.
Katharios, P., Papadaki, M., Ternengo, S., Kantham, P.K., Zeri, C., Petraki, P.E.,
Divanach, P., 2011. Chronic ulcerative dermatopathy in cultured marine fishes.
Comparative study in sharpsnout sea bream, Diplodus puntazzo (Walbaum). J. Fish
Dis. 34, 459–474. https://doi.org/10.1111/j.1365-2761.2011.01257.x.
Kennedy, C.J., 2011. TOXICOLOGY | The Toxicology of Metals in Fishes, in:
Encyclopedia of Fish Physiology. Elsevier, pp. 2061–2068. https://doi.org/10.1016/
B978-0-12-374553-8.00236-7.
Lee, K., Seo, I., Choi, M.H., Jeong, D., 2018. Roles of mitogen-activated protein kinases in
osteoclast biology. Int. J. Mol. Sci. 19 https://doi.org/10.3390/ijms19103004.
Linbo, T.L., Baldwin, D.H., McIntyre, J.K., Scholz, N.L., 2009. Effects of water hardness,
alkalinity, and dissolved organic carbon on the toxicity of copper to the lateral line of
developing fish. Environ. Toxicol. Chem. 28, 1455–1461. https://doi.org/10.1897/
08-283.1.
McDowell, E.M., Trump, B.F., 1976. Histologic fixatives suitable for diagnostic light and
electron microscopy. Arch. Pathol. Lab. Med. 100, 405–414.
Minkin, C., 1982. Bone acid phosphatase: tartrate-resistant acid phosphatase as a marker
of osteoclast function. Calcif. Tissue Int. 34, 285–290. https://doi.org/10.1007/
BF02411252.
Mogdans, J., Kröther, S., Engelmann, J., 2004. Neurobiology of the fish lateral line:
adaptations for the detection of hydrodynamic stimuli in running water. Senses Fish
265–287. https://doi.org/10.1007/978-94-007-1060-3_12.
Moonga, B.S., Dempster, D.W., 1995. Zinc is a potent inhibitor of osteoclastic bone
resorption in vitro. J. Bone Miner. Res. 10, 453–457. https://doi.org/10.1002/
jbmr.5650100317.
Morrison, C.M., O’Neil, D., Wright, J.R., 2007. Histopathology of “hole-in-the-head”
disease in the Nile Tilapia, Oreochromis niloticus. Aquaculture 273, 427–433.
Noga, E.J., 2010. Fish Disease: Diagnosis and Treatment, Second edition. Wiley-
Blackwell. https://doi.org/10.1002/9781118786758.
Rigos, G., Katharios, P., 2010. Pathological obstacles of newly-introduced fish species in
Mediterranean mariculture: a review. Rev. Fish Biol. Fish. 20, 47–70.
Rodan, G.A., Martin, T.J., 2000. Therapeutic approaches to bone diseases. Science (80-.)
289, 1508–1514. https://doi.org/10.1126/science.289.5484.1508.
Schultz, A.G., Healy, J.M., Jones, P.L., Toop, T., 2008. Osmoregulatory balance in
Murray cod, Maccullochella peelii peelii (Mitchell), affected with chronic ulcerative
dermatopathy. Aquaculture 280, 45–52. https://doi.org/10.1016/j.
aquaculture.2008.04.011.
Schultz, A.G., Shigdar, S.L., Jones, P.L., Ward, A.C., Toop, T., 2011. Groundwater pre-
treatment prevents the onset of chronic ulcerative dermatopathy in juvenile Murray
cod, Maccullochella peelii peelii (Mitchell). Aquaculture 312, 19–25. https://doi.org/
10.1016/j.aquaculture.2010.12.013.
Sfakianakis, D.G., Renieri, E., Kentouri, M., Tsatsakis, A.M., 2015. Effect of heavy metals
on fish larvae deformities: a review. Environ. Res. 137, 246–255. https://doi.org/
10.1016/j.envres.2014.12.014.
Soares, F., Roque, A., Gavaia, P.J., 2018. Review of the principal diseases affecting
cultured meagre (Argyrosomus regius). Aquac. Res. 49, 1373–1382. https://doi.org/
10.1111/are.13613.
Stominska, I., Jezierska, B., 2000. The effect of heavy metals on postembryonic
development of common carp, Cyprinus carpio L. Arch. Polish Fish. 8, 119–128.
Suzuki, N., Yamamoto, M., Watanabe, K., Kambegawa, A., Hattori, A., 2004. Both
mercury and cadmium directly influence calcium homeostasis resulting from the
suppression of scale bone cells: the scale is a good model for the evaluation of heavy
metals in bone metabolism. J. Bone Miner. Metab. 22, 439–446. https://doi.org/
10.1007/s00774-004-0505-3.
Tarby, M.L., Webb, J.F., 2003. Development of the supraorbital and mandibular lateral
line canals in the cichlid, Archocentrus nigrofasciatus. J. Morphol. 255, 44–57.
https://doi.org/10.1002/jmor.10045.
M.I. Tsertou et al.
Tarley, C.R.T., Coltro, W.K.T., Matsushita, M., De Souza, N.E., 2001. Characteristic levels
of some heavy metals from Brazilian canned sardines (Sardinella brasiliensis). J. Food
Compos. Anal. 14, 611–617. https://doi.org/10.1006/jfca.2001.1028.
Toshiyuki, K., Masakazu, T., Tatsuro, M., Hiroshi, K., Fumitomo, K., 1991. Interaction
between cadmium and copper on ossification of embryonic chick bone in tissue
culture. Toxicol. Lett. 55, 255–262. https://doi.org/10.1016/0378-4274(91)90005-
Q.
Wada, H., Iwasaki, M., Kawakami, K., 2014. Development of the lateral line canal system
through a bone remodeling process in zebrafish. Dev. Biol. 392, 1–14. https://doi.
org/10.1016/j.ydbio.2014.05.004.
Webb, J.F., 1989. Gross morphology and evolution of the mechanoreceptive lateral-line
system in teleost fishes. Brain Behav. Evol. https://doi.org/10.1159/000115896.
Webb, J.F., 2013. Morphological diversity, development, and evolution of the
mechanosensory lateral line system. In: Coombs, S., Bleckmann, H., Fay, R.,
18
Aquaculture 556 (2022) 738301
Popper, A. (Eds.), The Lateral Line System, pp. 17–72. https://doi.org/10.1007/
2506_2013_12.
Webb, J.F., 2014. Lateral Line Morphology and Development and Implications for the
Ontogeny of Flow Sensing in Fishes, in: Flow Sensing in Air and Water. Springer,
Berlin Heidelberg, Berlin, Heidelberg, pp. 247–270. https://doi.org/10.1007/978-3-
642-41446-6_10.
Webb, J.F., Shirey, J.E., 2003. Postembryonic development of the cranial lateral line
canals and neuromasts in zebrafish. Dev. Dyn. 228, 370–385. https://doi.org/
10.1002/dvdy.10385.
Yuan, F.L., Xu, M.H., Li, X., Xinlong, H., Fang, W., Dong, J., 2016. The roles of acidosis in
osteoclast biology. Front. Physiol. 7, 1–8. https://doi.org/10.3389/
fphys.2016.00222.
Another random document with
no related content on Scribd:
Cobenzel, the Austrian Minister; and his Imperial Majesty has
besides withdrawn his Russians in our pay. The high pay may
however tempt him to relent.[94] About a month ago he sent to Mr.
Pitt, Ld. Grenville, and Mr. Huskisson, 3 crosses of the Order of
Malta, of which order he has constituted himself the head, altho’ one
of the fundamental rules requires that every knight should be a
Catholic and a bachelor. He is of the Greek Church, and husband to
a prolific Empress. The great source of his wrath is about the island
of Malta, which he wants to possess, and which we will not agree to
his having.
Mr. Grey made his annual motion for reform last Friday.[95] He
made it so moderate by softening down the rough edges that
Wilberforce and Dr. Laurence voted with him. Sheridan, Sir F.
Burdett, Jones,[96] etc., were deterred from attending, as he was
what they called too moderate. After the debate he came and
supped, and slept here. He lamented his own precipitation and bad
judgment in urging the measure of secession, and very distinctly
declared that whatever blame might attach to it, he was responsible
for, as it was pressed upon Mr. Fox against his opinion and
inclination. I conveyed to him very cautiously, that his attendance,
unless he had an explicit and a sort of public declaration from Mr.
Fox that he wished himself to be considered as null, would not be
looked upon as fair; he assured me that Fox had oftentimes urged
him to attend.[97] I implied that such an assurance was of course all
his conscience could require, yet that public opinion demanded more
publicity to be given to the wish of Mr. F. than the report of a private
conversation; to which he said he never could ask Mr. Fox to declare
himself for ever withdrawn from public affairs.
I dined on Saturday, 26th, at L. H. In the morning Ld. Wycombe
called upon me; we were standing in the porch just as Ld. Lansdown
drove into the iron gate, upon which this dutiful son flew off in a
tangent, and exhibited a scene before my servants and his father’s.
The following verses are written by Lewis, a pretty address from
Friendship to Youth:—
 Turn, Wanderer, turn, and rest with me,
Let not yon glittering fane allure you:
My temple shall your shelter be,
My sacred fire from cold secure you.
Nor scorn it, though your dazzled sight
No burst of lustrous flame surprises
As with mild warmth and lambent light
It gently from the altar rises.
More vivid fires gild yonder shrine,
More heat and radiance round them casting,
But trust me, Youth, though bright they shine,
Their rage is fierce, their power is blasting.
Ah! pilgrim, shun the fatal blaze,
Thy forward steps forbear to number;
The blaze which on my altar plays
Gives genial warmth and gentle slumber.
Here Reason as the priestess stands,
Here Tranquil Pleasure often lingers;
At Friendship’s fire then warm thy hands,
At Love’s thou’lt surely burn thy fingers!
‘Friendship,’

I showed them to Tierney, who parodied them

A PARODY
almost offhand as an address from a Warming-Pan
to Old Age:—
 Turn, dotard, turn, and rest with me,
Let not yon glittering fane allure you:
My presence shall your comfort be,
My sacred fire from cold secure you.
Nor scorn it, though your dazzled sight
No burst of lustrous splendour meets,
As with mild warmth each chilly night
It gently glides between the sheets.
More vivid fires gild yonder shrine,
Their blaze, ’tis true, more fiercely rages,
But, know, they give, unlike to mine,
More smoke than heat at certain ages.
Ah! shun then their delusive blaze,
Thy forward steps forbear to number,
The flame which on my altar plays
Gives genial warmth and gentle slumber.
Turn, turn, from love and such repose,
Nurse what of life within thee lingers,
With me at least thou’lt warm thy toes,
With Love thou’lt only burn thy fingers.
‘Warmingpan.’

5th May.—Last week Ld. H. made a motion in the H. of Lords in

favour of the Catholics, to obtain what they call their emancipation.
[98] Lord Lansdown, like a sly old politician, was glad of an
opportunity of saying something on behalf of the Catholics, mingled
with a praise of the Union, so that should the Union fail, he may say,
‘I foresaw that ye measure, without granting the Catholics their
demands, would prove a mischievous one’; and if it should succeed
he may say, ‘I supported Ministers on it.’ In his speech he made
several heartfelt compliments to Ld. H. He said that whenever he
differed in opinion from him he doubted the rectitude of his own
judgment; for of his excellent abilities, he added, the House were
competent to judge, but of the goodness of his heart those only who
had the happiness of knowing him in private could estimate the
value. He went on in this strain for near ten minutes. The whole
debate was flat, none were in spirits; Ld. H. was unwell, and more
than usually chilled by the deadness of his audience. Tierney
declares that accustomed as he is to act singly in the H. of
Commons, yet he could not bear up in the H. of Lords; there is a
palsied indifference in the hearers that checks all spirit.
 It was essential to Ld. Lansdown to preserve the
attachment of —— during his Administration. But LORD
—— confided to Ld. L. that his health was injured LANSDOWN
by an irregularity of life. One should have thought
from the austerity of Ld. L.’s manners and private character that he
was a singular person to select for such a confidence, but so it was.
‘Indeed, I am not surprised, the calamitous state of the country, the
imbecility of Ministers, the augmentation of the debt, and the
increased influence of the Crown is such that I own to you very
frankly for dissipation I plunge myself into the lowest debauchery.’
He then, after this prelude, administered friendly relief. This is very
characteristic of him; the sort of jumble of ideas, and the
overstrained civility of adapting his own conduct to that of the person
he wishes to please, however repugnant it might be to him in reality.
‘Comment, mon ami,’ cried a wife to her drunken husband. ‘Vous
vous perdez, vous laissez toujours votre esprit au cabaret.’ ‘Ne
craignez rien, ma chère, j’irais la chercher dimanche.’
People are very much occupied with this Divorce Bill.[99] Ld. H.
has felt a shyness in attending the progress of it in the H. of Lords. A
Bishop, full of the subject, last week began talking to him; he
expressed his approbation of its becoming a criminal proceeding,
and added, ‘And do you not think, my Lord, that it would diminish the
frequency of the vice, if parties were condemned to imprisonment for
five years?’ Ld. H. was, of course, puzzled how to answer. The
Bishop was B. of Chichester.
8th May.—D. of Bedford, who is just returned to town, dined here;
Ld. H. was detained at the H. of Lds. Fortunately I had Francis, and
the day went off pleasantly. We talked of Mr. Fox’s history, to which
he has written the introduction. It was lamented that instead of taking
the period of which he could say so much from personal knowledge,
he should go to one distant and well known. The Duke said his
reason was extreme indignation against Hume, whom he had been
reading last autumn; who very artfully pleads the cause of the House
of Stuart, and in a way to interest his reader about the private virtues
of Charles I., ‘Who, by-the-bye,’ added he, ‘is a most amiable man
when viewed in his domestic capacity.’ Upon this Francis, with his
usual impetuous vivacity, burst forth against him, denying him every
qualification that constitutes a gentleman or a man of feeling. He
quoted two stories out of Carte’s Life of ye D. of Ormond, a writer
who is allowed to have a strong bias to the Stuarts. One was, that in
the Palace at Whitehall there were etiquettes, ‘similar to those
established by that fop Louis XIV.,’ about certain apartments, which
could only be entered by men of distinguished quality. Hampden, by
accident, and through ignorance of these courtly rules, got into one.
Suddenly a noise announced the entrance of the King; to conceal
himself he sculked behind a screen. His friends with whom he was
conversing were in a bustle; the King upon entering perceived their
disorder, and insisted upon knowing the cause. He explored behind
the screen, and upon finding Hampden, he shook his cane over his
head, and threatened to beat him and worse, if he ever broke
through bounds again. The other was, his receiving a petition on
horseback, which was presented to him by Sir T. Fairfax and a
deputation kneeling; he made his horse curvet, kicked the knight,
and endangered his life. Clarendon’s style, he said, was grave and
slow. He told Dr. Parr here at dinner the other day that Swift’s style
was clear and shallow, perfectly pellucid. The fact is he admires no
style but his own, and that is worthy of admiration, as it is much the
best now.
D. of B. means to go down about this new
Divorce Bill; he is very eager against it. He says it NEW BILLS
will reverse the present system, for if a
circumstance of the sort occurs to a husband who is high-spirited, he
generally fights the lover, whereas the lover will now threaten the
husband by saying, ‘If you make an éclat and get me whipped at the
cart’s tail, by G——, I will kill you.’
A Bill is to be brought forward in the H. of Commons by Sir H.
Mildmay to check the increase of Catholicism, by preventing the
nuns at Winchester from giving the veil. An attempt to make a
proselyte will become penal. Mr. Fox, when he heard of these Bills,
the one against celibacy and the other, said, ‘Aye, the poor women,
they will not let them do one thing or the other.’
 11th May.—Parr entertained us uncommonly; he was in full force.
We gratified him highly by going into the room into which he
retreated to smoke. His vanity is such that the slightest attention
elates him, and more particularly, when it comes from a person
whom he would denominate a woman of quality. Mr. Knight’s love of
pedantry got him too frequently upon verbal criticism, and when they
did fall upon a doubtful Greek word, they pulled at it like hungry curs.
When they returned to the library he talked upon literature. His
praise of Middleton’s style was that a man of strong feelings and
vigorous conceptions ought to study it to abate the ardour and
rigidity of style, and he recommended it to Bobus. He asserted that
Middleton was an unbeliever in Christianity, and read several
passages, which put it out of all doubt, from his Defence of the Free
Enquiry. Of Warburton he expressed the utmost admiration; his
opponents, he said, who had attacked him, were snarling hounds;
‘mine was the froth of a mastiff.’ He said of Burke’s first book upon
the French Revolution that it was ‘the effervescence of rage’; the
second was ‘the bitter sediment of malignity.’
On Tuesday I went to Money Hill; Miss Fox, Drew, and Charles
went with us. I returned on Friday. The two mornings I passed there
we drove about in the sociable to see the country.
We drove through Cassiobury, Lord Essex’s; to The Grove, Ld.
Clarendon’s, and so on to Russell Farm, the Ladies’ Capel. Pretty
ground and fertile country. Ld. H. fished, and caught a few trout.
Beauclerk did not articulate ten words; he seems happy, but it is the
bliss of torpor. She resides reluctantly in the dignified solitude of a
guinguette in the skirts of a petty town. From Beauclerk’s practice
one should think his precept was that conversation spoilt society; he
rarely incurs that risque. It is to be regretted, as he has a most acute
perception, and an uncommon degree of subtilty in his argument. No
person is clearer on the obscure subject of abstract metaphysics; his
definitions are ingenious and brilliant. Finance is also a branch of
political economy he is profound in, and had he entered Parliament
he would have distinguished himself. At present he is lost; shyness,
indolence, and a sort of content deprive society of his exertions and
his friends of his company.
 The papers on Friday announced a singular
accident which happened to the King at the THE KING
Review on Thursday in Hyde Park; a musket ball SHOT AT
wounded a Mr. Ongley standing near him. The
question was whether it was from design or chance—the chance of
an unloaded musket. When I came home, the first question I asked
the porter in getting out of my carriage was whether there was
anything new; he replied with eager alarm that the King had been
shot at from a pistol at the play. I thought this story an exaggeration
of the former one, but to my surprise found that the evening of the
day on which he had escaped the bullet, he was deliberately aimed
at from the pit. The ball lodged in the upper boxes, and the King
escaped unhurt. His behaviour was like that of a hero of antiquity; he
was in full possession of all his faculties, and was cool enough to tell
the Queen, who was not in the box when the pistol was fired, that the
report was from a squib. He remained on during the play with the
utmost sang-froid. He told a person that he observed the fiddlers
expected another shot as they covered their heads with their
cremonas. The enthusiasm was boundless; additional verses were
added by Sheridan to God Save the King.[100] The King was so
delighted with Sheridan’s behaviour to the Princesses, for he
prevented them going into their box by saying that a pickpocket was
taken in the pit which made a riot and his presence was required,
and begged their R.H. to wait in the room. He shall feel gratitude to
the latest hour of his life, he says, to him for this sensibility. Sheridan,
Mrs. S., and Tom are all to go to Court, both to-morrow and
Thursday. Mr. Fawkener[101] dined with us on Friday; he had
attended the examination of the man at the Privy Council, and he
said he was certainly mad. He was dismissed the army for insanity a
few months ago, and he has since worked as a silver-smith; his
name is Hadfield. I was vexed at not being present. I never much
liked Money Hill, but this has disgusted me, for had I been at home I
should have gone in my own box, from where I should have seen the
whole representation, and with safety.
Ld. Morpeth was to have come to Money Hill on Wednesday; he
came to tell me on Saturday that his carriage was at the door at one
o’clock to convey him thither, but that he was at White’s, not returned
from Tuesday evening’s occupation; he owned to losing two
thousand pounds. He will grow a decided gambler.
My old friend and admirer, Ld. Berkeley, gave Lord Chesterfield a
reproving repartee. Ld. B. has killed two or three highwaymen, and it
is known that he is distressed when the occurrence is alluded to. Ld.
C., meaning to annoy him, asked him ‘When he had last killed a
highwayman?’ ‘It was, my Lord, as well as I can recollect, just at the
time when you hung your tutor,’ alluding to the unfeeling and wicked
transaction about Dr. Dodd, who, though deserving of punishment,
should not have met with it from his pupil, who from youth and
gratitude ought to have felt more indulgence for the errors of Dodd.
[102]

The Prince of Wales has notified his Royal pleasure of dining

here. He grew quite angry at not being invited; he even spoke to my
mother about it. He comes on Saturday, and Prince Augustus.[103]
The latter came home to England without the knowledge and against
the consent of their Majesties. He arrived at the house of Lady
Augusta.
I went last night to the Opera. The Princess of
Wales glanced many an inquiring look towards MRS.
Mrs. Fitzherbert’s box, in which the Prince was as FITZHERBERT
usual. This old amour is revived. The opinion of the
world is so whimsical. Every prude, dowager, and maiden visited
Mrs. F. before, and the decline of her favour scarcely reduced her
visitors; but now they all cry out shame for doing that which she did
notoriously five years ago. There is a sort of morality I can never
comprehend.
Ld. H. took a fancy for about a week to write me some verses
every night after he went to undress; I complained of his keeping me
up late, he wrote immediately:—
 That his labours have set you asleep, is allowed
The severest reproach to a bard you can make.
Have not I then great cause to be proud—
Your objection to mine is they keep you awake.

Ld. H. went to the Levée on Wednesday with Ld. Ossory to

congratulate the King upon his escape; he went also on Thursday to
the Drawing Room, and on Friday he went in a cap and gown with
the Oxford Address. Mr. Marsh came to town as a delegate; he
arrived on Thursday and stayed till this morning.
The Ministers have not attempted to convert this mad freak of
Hadfield’s into a Jacobinical plot; they let the affair stand plainly as it
is. When Erskine heard of the shot from a man in the pit, he said, ‘I
thought the Pitt-ites would do the King mischief at last.’ Should the
poor lunatic be condemned, I think the King will feel a qualm at
signing the warrant, as it is proved that the man was only insane in
consequence of a severe wound in his head received while fighting
in the King’s cause.[104] As a confirmation of the opinion of the man’s
acting without any concert with other people, what happened to Mr.
Tierney will acquit the soldier who fired in the Park. On Thursday,
riding from hence through the Park, he went by some soldiers who
were reviewing, and a musket ball whizzed close by his ear. He told
the story to Ford, the justice, and it is clear that the cartridges have
been made improperly, that those which used to be for exercising
with powder only, and in a particular coloured paper, are now loaded
with ball.
The Prince of Wales, Prince Augustus, and a very numerous party
dined here on Saturday; it went off very pleasantly. Prince Augustus
is much altered from what he was at Rome; his mind and body are
thickened.
The Divorce Bill, with the abominable clause, has passed the H.
of Lords, the purport of which is to prevent the woman marrying the
man on whose account the divorce takes place, and in addition to
pecuniary damages to the husband, the offence is to be treated as a
misdemeanour, and the punishment of fine and imprisonment rests
solely with the judge.
 Some persons were boasting before Mr. Fox of the excellence of
the English laws, which he said certainly were excellent, but that
there were objections at present. ‘How?’ replied the other person.
‘The law is equally open to the peasant and the peer.’ ‘Yes,’ said
Fox, ‘so is the London tavern,’ meaning that to benefit by them one
must pay dearly.
The following quotation from Carlyle’s[105]
translation of Arabic poetry has been very happily MR. FOX
applied by General Fitzpatrick to Mr. Fox, who is
the life and soul of the Whig party, both from the opinion entertained
by them of his ability, and the esteem and friendship they bear to his
person:—
With conscious pride I view the band
Of faithful friends that round me stand,
With pride exult that I alone
Can join these scattered gems in one;
For they’re a wreath of pearls, and I
The silken cord on which they lie.
’Tis mine their inmost souls to see,
Unlocked is every heart to me,
To me they cling, on me they rest,
And I’ve a place in every breast;
For they’re a wreath of pearls, and I
The silken cord on which they lie.

Lord Wycombe has never passed the threshold of our doors since
the day he saw his father drive into the gates, whilst he was in the
porch. Whether he imagined the rencontre was the effect of design
or that he chooses to have the air of appearing to think so, I cannot
guess; but the effect, from some cause or other, has been his
absence.
The campaign does not advance as swimmingly as was expected
by the allies. Melas, when he took the Bocchetta, expected Genoa
could not hold out long after the loss of that important pass, but
Masséna is determined to maintain himself till the last gasp, and now
he is certain of being relieved, as Bonaparte has taken the command
in person of the army of Italy.[106]
30th May.—The last date of his dispatch was ye 18th of May at
Martigny, but Berthier with the advanced division has crossed the Mt.
of St. Bernard, and has reached Aost. The French have a pied-à-
terre only at Genoa and Savona; Mantua, Milan, etc., are at present
in the possession of the Austrians. Melas has taken Nice, but must
quit it immediately to meet Bonaparte in Piedmont. Moreau has
advanced to within a short distance of Ulm. Knay, the Austrian
commander, is very obstinate, and strongly addicted to the old
system of carrying on war by posts.
The Emperor Paul is grown quite mad. The French have made a
caricature of him with order in one hand, counter-order in the other,
and on his head disorder. Sir Charles Whitworth will feel happy when
fairly off his territory, as he is capable of proceeding to personal
violence against those with whom he is incensed. The English who
inhabit Petersburg are detained as hostages for his 15,000 men in
Jersey and Guernsey. Woronzow,[107] the Russian Minister, who has
resided in this country many years, is suddenly recalled, as his
dispatches have not been sufficiently abusive of this Government to
please the Imperial taste; he is quite wretched, for besides breaking
up all his old habits, he is not without apprehension of some
punishment being inflicted upon him when he returns.
Parr says of the Bishop of Rochester’s sermon, which was quoted
so ludicrously and well by the Duke of Clarence, that it contains ‘the
precepts of the Koran, conveyed in the language of the Stews.’[108]
The sermon was preached at the Magdalen, and Mr. Grey assured
me without any joke that the doctrine and the language are both so
extraordinary that no modest woman would read it, or own to having
done so.
The D. of Bedford has been living here a great
deal; he likes Ld. H. very much, and has grown to LADY
vanquish his prejudice against me, enough almost GEORGINA
to like me. He would be ungrateful if he did not in CAVENDISH
some degree, as he is one of the very few persons
of whom I think thoroughly well: he is honourable, just, and true.
Lady John Russell[109] has been here several times, and is
remarkably gracious. This I owe to the Duke’s frequent visits, as she
is curious to ascertain what object attracts him here, and politic
enough to adapt her taste to his. The probability is that, without her
caution even, he will not marry, unless indeed he should fix upon Ly.
Georgiana Cavendish,[110] an alliance long arranged for him by the
world. Ly. G. is a most charming girl—sensible, pleasing, full of
information and totally without a particle of affectation, and if she
bestows herself upon a man equal to her in situation, I have no
doubt she will make a most delightful wife. Little Lewis is upon the
eve of making himself a great fool about her, and, as he is not
séduisant in person or manner, will not gain her heart, and a bundle
of sonnets in lieu of title deeds will not operate in his favour with the
elders of ye family.
Ld. H. brought Sheridan and Ld. John Russell home from the H.
of Commons to a late dinner here at 8. By some accident Sheridan
happened to be out of the House just at the moment when a division
might have been made with advantage, as Sir Wm. Scott’s[111]
speech made so much impression against the Bill. Sr. Wm. denied
the fact asserted in the preamble to the Bill, as to ye increased
frequency of divorces. He, who is the head of the Ecclesiastical
Court, spoke with weight when he declared that the crime was
diminishing, as there had been fewer suits from ’90 to 1800 than
from ’80 to ’90, or from 1770 to 1780. The whole tenor of his speech
was full of tenderness and right feeling towards women.
I went on Monday evening to Mrs. Walker’s masquerade. I chatted
pleasantly enough with some of my old acquaintances. Mr. Grey
introduced Mrs. Grey to me,[112] as did Mr. Whitbread his wife,
Grey’s sister. Mrs. Grey is pretty and gentle, without looking so; she
is handsome Ponsonby’s sister. Mrs. W. has something pleasing in
her appearance, but ill-health and the hereditary irritability of the
Grey temper gives a certain fractious expression to her
countenance: au reste, she is a very worthy, excellent woman.
 Sheridan entertained us with a circumstantial
account of the whole affair at the theatre on the THE KING
night of the assassination. He was in the Royal box SHOT AT
when the pistol was fired, and saw most plainly the
man take aim. Ld. Chesterfield advised His Majesty to retire to the
back of the box, but the King said, ‘Not an inch, not an inch,’ and
upon the Queen’s entrance he waved his hand to make her keep
behind, upon the pretext of her fear of squibs. S., as soon as the
poor wretch was dragged out of the orchestra, examined him. He
declares his answers were collected and distinct, until Sr. Wm.
Addington[113] questioned him, who was extremely drunk, and
suggested to the man ye plea of insanity by his mode of examining—
a plea the man craftily availed himself of.
When Sheridan went to Court, the King spoke to him upon
indifferent subjects and seemed undecided whether or not he should
notice the occurrence. At length he said how much he was struck
with the behaviour of the audience, which gave S. an opportunity of
saying they only followed His Majesty’s example. After a few such
flourishes the King ended by saying he should despise himself if he
had acted otherwise, for every man ought to feel his duty, and his
was to stay quiet and not add to the alarm.
Mr. Abbot[114] has brought forward a Bill respecting Public
Debtors, which alarmed us until it was explained, but it seems fair in
principle, tho’ ultimately we may be affected to a degree. All who
have balances in hand will hereafter pay interest upon such sums.
The debt from this family now due to Government is 53,000l.; the
assets are near 46, the odd thousands Ld. H. must supply. The
difference of the Bill taking effect will be that the interest must go to
Governt., instead of making an accumulating fund, which in a few
years would pay off the whole. Mr. Moore is afraid from rumour that a
clause is to be moved by Mr. Baker to make the operation of the Bill
retrospective. In that case, to the last shilling of Ld. H.’s property
must go, as the amount would be enormous, but it seems so unjust
that the alarm is, I trust, groundless.
 Early on Wednesday morning last, ye 4th of
June, we were roused by a loud rapping at the SIR G.
bedroom door opening into the drawing-room. My WEBSTER’S
mother cried out that she had brought great news, DEATH
that Sir Godfrey Webster was dead; that he
expired the evening before in a fit. He had been indisposed for some
days, which made the event more natural. I could not hear of his
death without emotion, and was for some time considerably agitated.
But, my God! how was I overcome when Drew showed me a hasty
note written to him by Hodges to apprise me of the manner of his
death. He shot himself, he added, in consequence of heavy losses at
play. With him dies all resentment, and, great as my injuries have
been, willingly would I renounce all that may accrue to me from this
dreadful event to restore him again to existence, with the certainty of
his paying the natural debt of nature. Unhappy man! What must have
been the agony of his mind, to rouse him to commit a deed of such
horror. Peace to his soul, and may he find that mercy I would bestow.
His confidential servant gave the following details: that he had
appeared frequently disordered in his mind in the course of the
winter, and that latterly his spirits were gone, and a physician
attended him for a slow fever. But the malady was deeper; it was on
his mind. Twice within the last weeks he had attempted to destroy
himself by laudanum, but each time his man interposed, once by
wrenching the phial out of his hand, and the other by compelling him
to swallow an emetic. On Saturday he despatched his relation, a Mr.
Whistler, to fetch from Sussex titledeeds of some estates, merely a
device to get him out of the way. On Tuesday he went out at nine
o’clock, and purchased at Egg’s a brace of pistols, and after various
devices and stratagems to get his servants out of the way, he but too
fatally succeeded, and at half past four shot himself in his front
drawing-room in Tenterden Street. Have mercy on him, Oh heaven!
Business compelled me to go to town, and my coachman drove
me to the square; the shock of being almost within sight of those
mangled remains was too much, of him, unhappy man, who now lies
a melancholy proof of feelings too acute for existence. I would not
have the self-reproach of having added one particle to the agony he
endured, and am thankful that this sad catastrophe did not arise two
years ago, altho’ I should have been as guiltless a cause as now; but
the world and my own readiness to upbraid myself would have
assigned my quitting him as the cause. Ld. Egremont,[115] with
whom he had lately lived in habits of social intercourse, called at his
door just after the perpetration of this dreadful act; he was
excessively shocked, and went three times that night in great
agitation to Ld. Ossory’s. He declared his intention of sending for the
boys from school, and is now gone to Petworth with Webby. Henry is
with my mother. The dear girl remains at school. Hitherto no will
subsequent to that of ’86 has been found; perhaps upon a strict
examination one may be discovered. The funeral went down this
morning to Battle, very privately attended. Mr. Plummer was with me,
and told me he was a creditor to the amount of seventeen thousand
pounds.
8th June, 1800.—The average produced by my estates is
estimated at seven thousand pr. anm. We shall not touch a stiver for
these 18 months, and only till then incur trouble and expense. To
recover the money to fulfil the complement dictated by my
grandfather’s will, I must go to the seizure of his personal property.
The sound is at first repugnant, seize the property to which my son is
heir, but, in fact, it is only ascertaining my right, by which I shall
prevent his coming upon the Holland estates after my death.[116]
I have abstained from seeing company since this horrid business,
chiefly from feeling unfit for society; and, besides that, I would not
that any person should say that I exulted in an acquisition so
obtained, and I think, if I did not feel strongly myself, it would be
judicious to do nothing that might be reported to my children as
offensive. The anxiety about their guardianship is great; it does not
yet appear to whom the charge devolves. I wait quietly till the will is
found, or the one of ’86 acted upon. If none is found, the verbal
injunctions laid upon his family to exclude me from the happiness of
seeing my children will operate but slightly. I shall openly seize every
occasion of making them know how near an object it is to my heart
to be loved by them, and opinion will side with me, however the
Chaplins may act to annoy me. If the will of ’86 is to be in force, then
nothing will be done but by the advice of the executors.
There is a curious but violent quarrel carried on
between Lord Carlisle and Lord Kenyon; they ‘LEGAL
abuse each other bitterly in their different courts, RECLUSES’
publicly and separately. On the night of the debate
upon the Divorce Bill, in favour of which the lawyers are very eager,
Lord Carlisle, in adverting to the various arguments, said that
lawyers were from their sedentary occupations and retired habits
incapable of judging the offences and punishments of the upper
classes, and he applied to the corps of lawyers the term of ‘legal
recluses.’ Ld. Eldon, who officiated for the Chancellor, took up the
expression and was indignant at its being applied to the enlightened
body who from their employment in human affairs were generally
supposed to understand mankind. The Bishop of Rochester was
furious, and said many cutting things to Ld. Carlisle, such as, he
supposed that he would have the offence decided upon by those
only who had committed, and in a marked manner showed he
thought Ld. C. in that case entitled to judge. The next day, Ld.
Kenyon, in the Court of King’s Bench, in summing up a charge to the
jury, contrived to introduce the expression of ‘cloistered recluses’ as
having been used in the H. of Lds., and again declared his
knowledge of human life to be equal to his wishes, and thanked his
God he had not the knowledge of it which was acquired by ‘titled
adulterers at Newmarket, in Bond Street, and in the Stews.’ Ld. C.
has taken notice of this reference to his speech in Parliament as
unparliamentary, and means to move some resolution against the
printer. He has been with Ld. Holland this morning, who has advised
him to adopt another mode, and furnished him with the words;
accordingly he will follow his advice.
9th June.—Erskine came unexpectedly to dinner yesterday. He is,
as I could not help telling him, by far the most extraordinary man I
ever met with. An incomprehensible compound of wit, ability,
absurdity, folly, vanity, and sagacity. He repeated to me some lines
he had written in court upon Serjeant Lens,[117] who was examining
a witness with some pertinacity:—
 The Lenses that common opticians have
Are plano convex, or plano concave;
But the Lens of the law being formed to perplex,
At no time is plain, but concave and convex;
Convex his own case to enlarge and expound,
Concave his opponents t’obscure and confound.

He can pun in rhyme, but to harmony of verse he has no pretence.

He wrote the following epigram upon a very parsimonious lady, a
Mrs. Wharton, when at Tunbridge:—
Oft has my soul, puft up with pride,
The truth of sacred writ denied,
And to myself I still have said,
‘Sure mankind ne’er of dust was made;’
Till thou, dear Peg, revers’d my creed
And showed me we were dust indeed.

The clause in Abbot’s Bill was not designed by

him to have a retrospective operation upon those BILL AGAINST
PUBLIC
who have balances in bond due to Governt., but it DEBTORS
was worded with such ambiguity that it threw
persons so circumstanced into the power of the Auditors of the
Exchequer. Ld. H. begged some confidential friends to attend to get
it otherwise worded, and employed Adam as counsel to get Abbot
and Baker to alter it. Tierney promised zeal and attention; Sheridan
undertook it warmly. When the day came I grew afraid of Tierney’s
candour, and thought he might yield to Abbot’s assurance of the
harmlessness of the words; for Tierney would sacrifice the interests
of anybody to obtain the occasional popularity of conciliating an
opponent. I therefore enjoined Mr. Moore to rely solely upon
Sheridan, who tho’ never punctual and not famously steady, yet
would, I was persuaded, exert himself where he thought his services
material. I was right. Tierney acquiesced in all Abbot alleged in
behalf of the clause, and it was just going to pass into the Bill, when
Sheridan arrived breathless from haste, examined the words,
declared the sentence neither grammar, logic, or sense, and
employed near two hours to convince the Committee that the
ambiguous words should be expunged. They were so. The
difference lay between ‘shall have been declared,’ and ‘shall be.’ I
provoked Tierney by telling him before Whitbread, that my
instructions to Moore were to shun the honest, candid man, as he
would never help a friend at a pinch, too timid to essentially serve,
too timid to commit himself by an opinion against any man, were the
grounds not public and popular.
Interest commences from the enacting of this Bill, thus the interest
cannot be reserved as usual to make a fund, and thus pay off the
whole of the debt in a few years without touching us. But the
principle is just, and nothing can be said against it with any decorum:
and as it now stands it is certainly an expense, yet compared to what
it might have been I am satisfied.
11th June.—D. of Bedford dined with us, and gave an account of
the debate last night. Ld. Carlisle was to have made his motion
against Kenyon, but a shuffling sort of compromise made it go off
tamely; he agreed to withdraw it if Grenville desired it. A languid, half
shabby business. The Duke spoke. It is comical how eagerly these
seceding gentlemen embrace every opportunity of speaking; on the
most unimportant subjects unconnected with politics they attend, and
say their say. Last night the Divorce Bill was thrown out in the
Commons: not even admitted into a Committee. The mortification of
its rejection thus will be double to Ld. Auckland; such marked
contempt. Sheridan made an admirable speech, and did not mar the
effect of it by too much wit; his matter was excellent. Ld. H. supplied
him. At his request he wrote a little treatise which is full of sound
reason and practical good sense. I have a copy of it.
Ld. H.’s epigrams on Horsley[118] were lying upon my table; Ld. G.
Leveson, in rummaging over the papers upon it, found them and
took them. Ld. H. being jokingly angry, wrote this:—
Though in private my Muse in a profligate humour
Her nakedness never withheld from your view,
Yet she liked not that all who at tea in the room are
Should have the same privilege too, and would you?
 The following he said would suit ——, an impotent husband, to his
wife:—
As women wish to be who love their lords
You wish to be, and ask why it delayed is.
Because I’m not (what need of many words),
As husbands ought to be that love their ladies!

Louis Gauffier, pinx. Emery Walker Ph.sc.

Henrietta, third Countess of
Bessborough
Dumont mentioned a curious anecdote of
Chirac, the celebrated physician of Louis XIV.,[119] CHIRAC
told to him by Condorcet. At 84 years old he fell
into a violent illness, which was his last. He lay for two days in a
state of insensibility; he suddenly jumped up and sat upright in his
bed, felt the pulse of his left hand with his right, shook his head, and