Dietary methionine hydroxy analogue

supplementation benefits on growth,

intestinal antioxidant status and
microbiota in juvenile largemouth bass
Micropterus salmoides Ye Zhao
Visit to download the full and correct content document:
https://ebookmass.com/product/dietary-methionine-hydroxy-analogue-supplementatio
n-benefits-on-growth-intestinal-antioxidant-status-and-microbiota-in-juvenile-largemou
th-bass-micropterus-salmoides-ye-zhao/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...

Dietary vitamin C affects growth, antioxidant status

and serum immune parameter of juvenile hybrid grouper (
Epinephelus fuscoguttatus ■ × Epinephelus lanceolatus
■) fed low fishmeal diets Qinxiao Cai
https://ebookmass.com/product/dietary-vitamin-c-affects-growth-
antioxidant-status-and-serum-immune-parameter-of-juvenile-hybrid-
grouper-epinephelus-fuscoguttatus-%e2%99%80-x-epinephelus-
lanceolatus-%e2%99%82-fed-low-fish/

Gum Arabic-enriched diet modulates growth, antioxidant

defenses, innate immune response, intestinal microbiota
and immune related genes expression in tilapia fish
Mohammed A.E. Naiel
https://ebookmass.com/product/gum-arabic-enriched-diet-modulates-
growth-antioxidant-defenses-innate-immune-response-intestinal-
microbiota-and-immune-related-genes-expression-in-tilapia-fish-
mohammed-a-e-naiel/

Effects of dietary different canthaxanthin levels on

growth performance, antioxidant capacity, biochemical
and immune-physiological parameters of white shrimp (
Litopenaeus Vannamei ) Samia Fawzy
https://ebookmass.com/product/effects-of-dietary-different-
canthaxanthin-levels-on-growth-performance-antioxidant-capacity-
biochemical-and-immune-physiological-parameters-of-white-shrimp-
litopenaeus-vannamei-samia-fawzy/

Dietary Interventions in Gastrointestinal Diseases:

Foods, Nutrients, and Dietary Supplements Ronald Ross
Watson

https://ebookmass.com/product/dietary-interventions-in-
gastrointestinal-diseases-foods-nutrients-and-dietary-
supplements-ronald-ross-watson/
Human Microbiota in Health and Disease: From
Pathogenesis to Therapy Tungland

https://ebookmass.com/product/human-microbiota-in-health-and-
disease-from-pathogenesis-to-therapy-tungland/

Advances in Dietary Lipids and Human Health Duo Li

https://ebookmass.com/product/advances-in-dietary-lipids-and-
human-health-duo-li/

Pulse Crop Effects on Gut Microbial Populations,

Intestinal Function, and Adiposity in a Mouse Model of
Diet-Induced Obesity John N. Mcginley

https://ebookmass.com/product/pulse-crop-effects-on-gut-
microbial-populations-intestinal-function-and-adiposity-in-a-
mouse-model-of-diet-induced-obesity-john-n-mcginley/

Vicarious Identity in International Relations: Self,

Security, and Status on the Global Stage 1st Edition
Christopher S. Browning

https://ebookmass.com/product/vicarious-identity-in-
international-relations-self-security-and-status-on-the-global-
stage-1st-edition-christopher-s-browning/

Juvenile Justice In America (8th Edition ) 8th Edition

https://ebookmass.com/product/juvenile-justice-in-america-8th-
edition-8th-edition/
 Aquaculture 556 (2022) 738279

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Dietary methionine hydroxy analogue supplementation benefits on growth,

intestinal antioxidant status and microbiota in juvenile largemouth bass
Micropterus salmoides
Ye Zhao a, 1, Chao Yang a, 1, Xiao-Xiao Zhu a, 1, Lin Feng b, c, Yang Liu b, c, Wei-Dan Jiang b, c,
Pei Wu b, c, Xiao-Li Huang a, De-Fang Chen a, Shi-Yong Yang a, Wei Luo a, Jin-Xiu Zhang d, e,
Shu-Wei Li d, e, Hui Diao d, e, Xiao-Lan Wei d, e, Meng-Jia Zhou d, e, Xiao-Qiu Zhou b, c, *,
Jun Jiang a, c, *
a
College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
b
Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, China
c
Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Ya’an 625014, China
d
Animal Nutrition Institute, Sichuan Academy of Animal Science, Chengdu 610066, China
e
Animal Breeding and Genetics Key Laboratory of Sichuan Province, Sichuan Academy of Animal Science, Chengdu 610066, China

A R T I C L E I N F O A B S T R A C T

Keywords: To study the possible impacts of dietary methionine hydroxy analogue (MHA) on growth, intestinal antioxidant
Methionine hydroxy analogue status, and intestinal microbiota in juvenile largemouth bass (LMB) Micropterus salmoides (14.49–14.58 g), we
Growth conducted a feeding trial for 84-days. Four hundred and eighty fish were randomized into four dietary MHA
Antioxidant
treatments (0.0, 3.0, 6.0, and 9.0 g/kg diet). Results revealed that dietary MHA supplementation: (1) dramati­
Intestinal microbiota
cally improved growth of juvenile LMB; (2) markedly decreased intestinal protein and lipid peroxidation, and
increased intestinal antioxidant activities via Keap1/Nrf2 axis; (3) increased the richness and diversity of in­
testinal microbial community; (4) changed intestinal microbiota composition, increased the abundances of
Proteobacteria, Bacteroidetes, and Actinobacteria, and decreased the abundances of Firmicutes and Cyanobacteria at
the phylum level; increased the abundances of Bifidobacterium and Bacillus and decreased the abundance of
Bacteroides at the genus level. Collectively, dietary MHA supplementation has potential benefits in growth, in­
testinal antioxidant capacity, and intestinal microbiota in LMB. The dietary optimal Met level of LMB
(14.49–131.06 g) was recommended to be 14.49 g/kg diet, corresponding to 8.30 g/kg diet sourcing from basic
diet and 4.19 g Met/kg diet sourcing from MHA based on specific growth rate.

1. Introduction response (AAR) signaling pathway to increase the nutrient metabolic

Largemouth bass Micropterus salmoides (LMB), a commercially
important carnivorous species, has been widely farmed in China due to
its fast growth and excellent flesh quality (Yuan et al., 2019), which
production increasing by 18.9% per year over the past 15 years, from
161,176 tons in 2005 to about 619,519 tons in 2020 (Ministry of Agri­
culture, 2005; Ministry of Agriculture and Rural Affairs, 2021). Methi­
onine (Met) has been demonstrated to be an essential amino acid by up-
regulating target of rapamycin (TOR) and down-regulating amino acid
level and growth (Wang et al., 2021) and the optimum dietary Met
requirement for LMB growth is 12.20 g/kg diet (Chen et al., 2010).
Methionine hydroxy analogue (2-hydroxy-4-(methylthio) butanoic acid,
MHA), as a functional and economical source of Met, has been the pri­
mary focus for Met supplementation in the aquaculture industry (Guo
et al., 2020). Though meta-analysis demonstrates MHA has a significant
positive effect on the growth performance and feed utilization for fish
rather than shrimp, results vary among fish species (Guo et al., 2020).
The relative bioefficacy of MHA is lower than DL-Met across different

* Corresponding authors at: Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Ya’an 625014,
China.
E-mail addresses: zhouxq@sicau.edu.cn (X.-Q. Zhou), jjun@sicau.edu.cn (J. Jiang).
1
These three authors contributed equally to this project.

https://doi.org/10.1016/j.aquaculture.2022.738279
Received 3 June 2021; Received in revised form 18 April 2022; Accepted 19 April 2022
Available online 27 April 2022
0044-8486/© 2022 Published by Elsevier B.V.
Y. Zhao et al. Aquaculture 556 (2022) 738279

fish species (Pan et al., 2017; To et al., 2020; Keembiyehetty and Gatlin, isolipidic diets (crude protein, 42.0%; crude lipid, 12.5%) is listed in
1995). Whether MHA could be used as a source of Met to promote LMB Table 1. The MHA (purity 88%, Sumitomo-chemical, Tokyo, Japan) was
growth is no report, it is worthy to explore. added to the experimental diets at levels of 0.0 (control), 3.0, 6.0, and
Fish growth is associated with the integrity of intestine, which is 9.0 g/kg. The amount of MHA supplementation was compensated by
associated with its antioxidant status (Jiang et al., 2015). Reactive ox­ wheat flour. The Met concentrations in four experimental diets were 8.3,
ygen species (ROS) are generated during normal digestive and absorp­ 11.0, 13.6 and 16.3 g/kg of dry diet (Table 2). The feed materials were
tive progress (Zhang et al., 2013), which excessive production will result crushed and thoroughly mixed with soybean oil and water in a blender
in oxidative damage and disturb integrity and function in fish intestine and then the diets were prepared using a twin-screw extruder (MY-165)
(Jiang et al., 2010). Recent studies indicate Met in grass carp Cteno­ equipped with a 3-mm diameter mold. All diets were air-dried in a cool
pharyngodon idella (Wu et al., 2017) and rohu Labeo rohita (Noor et al., place, and stored at 4 ◦ C until used.
2021) and MHA in Jian carp Cyprinus carpio var. Jian (Feng et al., 2011)
and grass carp (Pan et al., 2017) improve intestinal antioxidant status 2.2. Fish management and feeding
and depress lipid and protein oxidation via increasing antioxidant en­
zymes activities and non-enzymatic antioxidant contents. The expres­ The feeding trial was performed at Ya’an Experiment Station
sion of the antioxidant enzyme genes is regulated by Keap1 (Kelch-like (Sichuan, China). Fish were provided by a local farm (Sichuan, China)
ECH-associated protein 1) - Nrf2 (nuclear factor erythroid 2-related and acclimated to the basal diet and culture conditions for 28 days.
factor 2) axis in fish (Giuliani and Regoli, 2014). The latest data Before the feeding experiment, all the fish were fasted for 24 h. The 480
shows that Met enhances antioxidant capacity in the kidney and liver of juvenile LMB with a similar size (14.49–14.58 g) were randomized into
blunt snout bream Megalobrama amblycephala by regulating Nrf2 and 12 concrete tanks (200 × 100 × 105 cm3) with 40 fish each replicate.
Keap1 mRNA expressions (Ji et al., 2020). Dietary Met also improves Twelve experimental tanks were randomly distributed into four groups,
hepatic antioxidant capability of large yellow croaker Larimichthys cro­ each group corresponding to one experimental diet. The fish were hand-
cea fed with high lipids diets (Li et al., 2021). In addition, study in grass fed for 84 days under natural photoperiod, twice a day (8:00 am and
carp indicates that dietary MHA improves intestinal antioxidant status 18:00 pm) until apparent satiety. The uneaten diets were collected thirty
by modulating Keap1-Nrf2 axis to up-regulate antioxidant enzyme genes minutes after the feeding, then oven-dried at 65 ◦ C to determine feed
mRNA levels, which contributes to alleviate oxidative damage (Pan intake (FI). The water quality parameters were measured as follows:
et al., 2017). Dietary supplementation with MHA improves the hepatic water temperature ranged from 23 to 27 ◦ C, water pH was 7.0 to 7.5, and
antioxidative capacity in turbot Scophthalmus maximus (Hu et al., 2015). the dissolved oxygen content was about 6.0 mg/L.
However, whether MHA can improve the antioxidant status by regu­
lating Keap1-Nrf2 axis in LMB are poorly known. 2.3. Sample collection
The intestinal microbiota plays a vital role in optimal growth (Meng
et al., 2021; Tao et al., 2019; Zhao et al., 2014). Diet is an important The LMB from each tank were starved for 1 day, then weighted and
factor that affects the establishment and composition of intestinal counted. Twenty-one fish of every tank were randomly collected for
microbiota (Jang et al., 2019; Tan and Sun, 2020). Dietary Met increases sampling and anesthetized with benzocaine in dose of 50 mg/L. Three
intestinal Lactobacillus and Bacillus counts and decreases Escherichia coli fish per tank were randomly selected and kept at − 20 ◦ C to determine
and Aeromonas counts in Jian carp (Tang et al., 2009). Study in mice the whole-body composition. The intestines of eighteen fish from each
(Wallis et al., 2020) also shows that dietary Met restriction alters the
intestinal microbiome (Bacteroidaceae, Verrucoccaceae, and Rummino­
Table 1
coccaceae). Dietary Met deficiency increases the proportion of beneficial Composition and nutrients content of diets (g/kg).
bacteria, and decreases the proportion of pathogenic bacteria in colonic
MHA levels 0.0 3.0 6.0 9.0
contents of mice (Yang et al., 2019). Meanwhile, dietary MHA in dairy
cows increases the abundance of Fibrobacter succinogenes and Rumino­ Fish meal 250.0 250.0 250.0 250.0
Soybean meal 220.0 220.0 220.0 220.0
coccus flavefaciens and depresses the abundance of bacteria that were
Corn protein meal 100.0 100.0 100.0 100.0
involved in trans-10 isomer production (Martin et al., 2013; Pitta et al., Gelatin 60.0 60.0 60.0 60.0
2020). A report in broilers indicates that MHA suppresses proliferation Soybean oil 100.0 100.0 100.0 100.0
of acid-producing bacteria including Roseburia and Collinsella (Wu et al., Wheat flour 165.0 162.0 159.0 156.0
2020). In swine, MHA inhibits ileal bacterial growth and metabolism CaH2PO4 40.0 40.0 40.0 40.0
MHA 0.0 3.0 6.0 9.0
effectively under in vitro conditions, but this effect was not detected in Vitamin premix1 10.0 10.0 10.0 10.0
vivo (Apajalahti et al., 2009). These results suggest that the effect Met Mineral premix2 20.0 20.0 20.0 20.0
and MHA on intestinal microbiota remains inconclusive under different Amino acid premix3 11.8 11.8 11.8 11.8
animal species and different experimental conditions. Whether they Choline chloride (50%) 10.0 10.0 10.0 10.0
Ethoxyquin (30%) 0.5 0.5 0.5 0.5
could be used as available modulators for intestinal microbial system
Microcrystalline cellulose 12.7 12.7 12.7 12.7
needs a further study. Moreover, a lack of research has been done about Nutrients content4
the impacts of dietary MHA on the intestinal microbiota in LMB, it is Crude protein 419.6 417.8 417.7 416.7
worthy to study. Crude lipid 124.6 126.8 127.0 125.2
That all, there is no study examines the effects of dietary MHA on the Crude ash 105.8 106.2 105.7 106.4
Moisture 96.2 94.1 93.7 94.9
intestinal antioxidant status and microbiota of LMB. Therefore, the
current work was undertaken to evaluate the influences of dietary MHA MAH = Methionine hydroxy analogue.
1
as Met source on growth, intestinal antioxidant status and intestinal Vitamin premix (IU or mg/kg diet): biosterol, 18,000 IU; vitamin D3 9000
microflora in LMB. The results might provide partial theoretical evi­ IU, 0.001; vitamin K3, 16.56; thiamine, 20.03; riboflavin, 54; vitamin B6, 33.21;
dence to the application of MHA in LMB. cyanocobalamin, 0.27; α-tocopherol, 28.00; ascorbic acid, 150.00; niacinamide,
26.00; calcium pantothenate, 25.00; folic acid, 1.00; biotin, 0.06; inositol,
400.00.
2. Materials and methods 2
Mineral premix (mg/kg diet): Cu, 5.00; Zn, 37.00; Mn, 7.00; Fe, 30.00; I,
1.10; Se, 0.25; Co, 0.20; Mg, 600.00.
2.1. Experimental design and diets 3
Amino acid premix (g/kg diet): His, 0.95; Ile, 1.97; Lys, 1.67; Val, 1.69; Cys,
2.08; Tyr, 2.88;Thr, 2.69.
The formulation and composition of four isonitrogenous and 4
Crude protein, crude fat and ash was measured by using the AOAC Methods.

2
Y. Zhao et al. Aquaculture 556 (2022) 738279

Table 2 Table 3
Amino acid composition of experimental diets (as DM-basis, g/kg). Primer sequences and OAT (◦ C) of genes selected for analysis by real-time PCR.
MHA levels 0.0 3.0 6.0 9.0 Name Sequences OAT Accession number

Thr 16.6 16.4 17.1 16.8 CuZnSOD-QF CATTTCAATCCCCACAACAAGA 63.3 MK614711.1

Val 18.5 18.7 17.9 19.2 CuZnSOD-QR CTTTGCGACATTATCTGCTCCT
Met 8.3 11.0 13.6 16.3 CAT-QF ATGCCGCTGGCGAATGT 63.3 MK614708.1
Cys 6.5 6.2 6.7 6.4 CAT-QR GCATAATCTGGGTTGGTGGAA
Ile 15.5 16.4 16.0 16.7 GPX-QF GCAATCAGTTTGGACATCAGG 63.3 MK614713.1
Leu 31.0 30.5 31.3 31.6 GPX-QR TTCCATTCACATCCACCTTCT
Phe 15.7 16.2 15.8 16.4 GST-QF AATGGAGCACAAGTCACAGGA 63.3 AY335905.1
Tyr 12.9 12.7 12.1 12.5 GST-QR ACAAGCAGGCAGCATAGGA
His 10.6 10.2 10.8 10.3 GR-QF TTATGTCGGTCACCTAAATCG 62.2 MW465392
Lys 20.1 20.6 20.8 19.9 GR-QR CCTGGAACTTCAGCATCACTC
Arg 22.5 22.7 22.2 22.6 GCLC-QF TACGGTGGCACGATGTCAGA 62.7 AY307950.1
Trp 3.4 3.6 3.3 3.1 GCLC-QR GGCAACCTAACCTTGGAAATG
Nrf2-QF TCCCCAGAGCAGACAGTTCC 62.7 MW465398
MAH = Methionine hydroxy analogue. Nrf2-QR CTCCATTTGCATGTTCAGGC
Keap1-QF GATAGACAGCGTGGTCAAGGC 62.7 MW465394
tank were dissected respectively. Three intestines were used to measure Keap1-QR TGAAGAACTCCTCCTGGGTCG
CCCCATCCACCATGAAGA 55.7 AF253319.1
intestinal length for calculating the intestosomatic index (ISI) and
β-actin-QF
β-actin-QR CCTGCTTGCTGATCCACAT
relative gut length (RGL). Nine intestines were frozen in liquid nitrogen 18S-QF TGAATACCGCAGCTAGGAATAATG 59.0 MH018569.1
and kept at − 80 ◦ C to analyse enzymatic activity, gene and protein ex­ 18S-QR CCTCCGACTTTCGTTCTTGATT
pressions. Six intestines were dissected under sterile conditions and
OAT = optimal annealing temperatures; MAH = Methionine hydroxy analogue;
collected the gut content samples (three intestines as a replicate) ac­ CuZnSOD = Cu Zn superoxide dismutase; CAT = catalase; GPX = glutathione
cording to previous methods (Gao et al., 2017). Briefly, three fish from peroxidase; GST = glutathione-S-transferase; GR = glutathione reductase; GCLC
each replicate were aseptically dissected and intestines were excised = glutamate-cysteine ligase catalytic subunit; Nrf2 = nuclear factor erythroid
carefully. The contents of intestine were squeezed out, and placed into 2–related factor 2; Keap1 = Kelch-like ECH-associated protein 1.
2.0 mL cryopreservation tube, then frozen in liquid nitrogen until DNA
extraction. mRNA abundances of target genes were computed by the 2− ΔΔCT

method as described by Livak and Schmittgen (2001).

2.4. Biochemical analysis

2.6. Western blotting

Chemical composition of diets and whole-body LMB were deter­
mined according to the standard method (AOAC, 2016). The protein and
lipid concentrations were determined by the Kjeldahl and Soxhlet
methods, respectively. The ash was measured through combustion at
550 ◦ C for 8 h. The amino acids concentrations of diets were detected by
an amino acid auto-analyzer (L-8800, Hitachi, Japan). Briefly, the
samples were hydrolyzed in 6 N HCl (110 ◦ C, 24 h) for amino acids
(except for trytophan) analysis and 5 N NaOH (110 ◦ C, 20 h) for tryp­
tophan analysis under a nitrogen atmosphere. The hydrolysates were
dried with nitrogen gas to remove HCl, diluted in 0.02 N HCl, and loaded
on an automatic amino acid analyzer. Intestine tissues were minced and
homogenized in pre-cooled 0.9% saline at a ratio of 1:10 (w:v). The
homogenate was centrifuged (4 ◦ C, 3000 rpm, 20 min) and the resultant
supernatant was used to measure anti-superoxide anion (ASA), anti-
hydroxyl radical (AHR), glutathione peroxidase (GPX), glutathione
reductase (GR), glutathione-S-transferase (GST), total superoxide dis­
mutase (T-SOD), and catalase (CAT) activities, and malondialdehyde
(MDA), protein carbonyl (PC), and glutathione (GSH) contents. The
assays were conducted spectrophotometrically by the commercial
detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing,
China).
2.5. Quantitative real-time PCR (qRT-PCR)
The qRT-PCR were performed in accordance with our previous study
(Jiang et al., 2016a). The total RNA from the intestine was isolated from
50 to 100 mg frozen intestine samples using TRIzol reagent (Invitrogen).
The integrity and purity of the obtained RNA were determined using
denaturing gel electrophoresis and a Nano Drop® 2000 spectropho­
tometer. The reverse transcription of mRNAs was performed by the
PrimeScript® RT reagent Kit with gDNA Eraser (TaKaRa). RT-qPCR
experiment was conducted in a CFX96 RT-PCR Detection System (Bio-
Rad, Hercules, CA, USA). The primer sequences used for CuZnSOD, CAT,
GPX, GST, GR, GCLC (glutamate-cysteine ligase catalytic subunit),
Keap1, and Nrf2 were described in Table 3. All data were normalized
with the β-actin and 18S rRNA genes in the same samples. The relative
The total protein from intestine samples were isolated using RIPA
lysis with 1 mM phenylmethanesulfonyl fluoride (Amresco, Ohio, USA)
and proteinase inhibitors (Beyotime, Shanghai, China) on ice. The pro­
tein quantification kit (Beyotime, Shanghai, China) was used to deter­
mine total protein concentration. Then, the supernatant (20 μg of total
protein) was loaded onto the polyacrylamide gel and run 125 V for 2 h
and transferred to PVDF membrane. The target protein was probed at
4 ◦ C for overnight with the desired primary antibodies (anti-Nrf2 and
anti-Keap1, Cell Signaling Technology, MA, USA). Next, the membranes
were washed with TBS/T buffer for three times, and followed by incu­
bation with the corresponding secondary antibodies. After washing in
TBS/T buffer for another three times, protein was visualized by
enhanced chemi-luminescence and exposure to X-ray film. The relative
density of band was quantified and normalized to the β-actin using the
Image software.
2.7. DNA extraction and sequencing
Total genomic DNA from intestinal contents was immediately
extracted by a DNA isolation kit. The DNA content and quality were
evaluated by NanoDrop One spectroscopy. According to the concen­
tration, DNA samples were diluted with sterile water to a final concen­
tration of 1 ng/μL. The V4-V5 region of the bacterial 16S rRNA gene was
then performed using a bacterial 16S rDNA primer (515F: 5′ -
GTGCCAGCMGCCGCGGTAA-3′ and 926R: 5′ -CCGYCAATTYMTT­
TRAGTTT-3′ ) with the barcode. The PCR reaction system was as follows:
15 μL of PCR master mix, 1.5 μL of each primer, 3 μL of template DNA,
and 9 μL of ddH2O. Reaction programs were as follows: 1 min 98 ◦ C, 30
cycles of 10 s at 98 ◦ C, 30 s at 50 ◦ C, 30 s at 72 ◦ C, and finally extension 5
min at 72 ◦ C. The amplicons were pooled into equimolar concentrations
according to the standard method and sequenced on an Illumina MiSeq
platform.
Cutadapt (V1.9.1) was used to shear the barcode sequence and the
primer sequence. Reads showing more than three consecutive low-

3
Y. Zhao et al. Aquaculture 556 (2022) 738279

quality base calls were removed, and the clean reads were obtained. (14.49–131.06 g) was recommended to be 12.49 g/kg diet based on
Sequences were clustered to the same operational taxonomic units SGR, corresponding to 8.30 g Met /kg diet sourcing from basic diet and
(OTUs) using Uparse (V7.0.1001) at ≥97% identity. The OTU repre­ 4.19 g Met/kg diet sourcing from MHA (Fig. 1).
sentation sequence was compared with the GreenGene database using Data on body composition of LMB fed different MHA diets are listed
RDP classifier (V2.2), and then annotate taxonomic information. The in Table 5. Dietary supplementation of MHA at 3.0, 6.0, and 9.0 g/kg
abundance information of OTUs were normalized using a standard dramatically enhanced whole-body protein, lipid content, PPV, and LPV
sequence number corresponding to the sample with the fewest se­ (P < 0.05). The LMB fed diets added with 3.0 and 6.0 g/kg MHA had
quences, which was used to alpha diversity analysis. Alpha diversity was markedly higher ash and APV than these fish fed control and 9.0 g MHA/
calculated by QIIME (V1.7.0) by the species richness estimator (Chao1 kg diet (P < 0.05). Dietary MHA had no significant effects on moisture
and ACE) and diversity indices (Shannon and Simpson). Rarefaction (P > 0.05).
analysis and Venn diagrams were performed using Mothur (V1.30.1)
and R program package. A principal coordinate analysis (PCoA) was
carried out by the WGCNA package and ggplot2 package in R software 3.2. Morphological index
(V2.15.3).
There was no significant difference in intestinal weight (IW) and
2.8. Statistical analysis intestosomatic index (ISI) among different MHA levels (Table 6, P >
0.05). The LMB fed diet with 3.0 g/kg MHA had higher intestinal length
The values were presented as means ± stand error (mean ± SEM). (IL) and relative gut length (RGL) than these fish fed the control diet
The experimental data were done by IBM SPSS Statistics 27.0 and P- (Table 6, P > 0.05).
value<0.05 was considered significant. Differences of the obtained data
among different dietary MHA treatment were determined using ANOVA
and Duncan’s multiple-range test. The Pearson correlation analysis and 3.3. Biochemical parameters in intestine
regression analysis were conducted. The quadratic regression model was
used to estimate the optimal MHA level for LMB. With daily feed con­ Results of the biochemical parameters in intestine of LMB are given
sumption (DFC) as a covariate, one-way ANCOVA was used to compare in Table 7. Fish in 3.0 g/kg diet group presented the lowest MDA and PC
final body weight (FBW). concentrations (P < 0.05). Meanwhile, the ASA, AHR, CAT, GPX, GST,
and GR activities of fish fed 3.0 g MHA/kg diet were markedly higher
3. Results than that of fish fed control, 6.0, and 9.0 g MHA/kg diets (P < 0.05). The
higher GSH content and T-SOD activity in intestine were recorded in fish
3.1. Growth parameters and body composition fed diet with 3.0, 6.0 and 9.0 g MHA/kg diets (P < 0.05). The expression
pattern of antioxidant-related genes in intestine of LMB are displayed in
Table 4 provides growth parameters of LMB fed four different diets Figs. 2 and 3. The SOD, CAT, and GCLC mRNA expressions were
for 84 days. Dietary MHA level did not affect the survival rate (SR). The remarkably upregulated in LMB fed 3.0 g MHA/kg diet (P < 0.05). The
higher growth parameters including final body weight (FBW), specific higher relative GPX, GST, and GR mRNA expressions were found in 3.0
growth rate (SGR), and feed intake (FI) were observed in 3 and 6 g/kg and 6.0 g/kg MHA groups compared to the control group (P < 0.05).
MHA levels in diet (P < 0.05). But daily feed consumption (DFC) was no Dietary MHA levels at 3.0, 6.0, and 9.0 g/kg dramatically enhanced Nrf2
significant difference (P > 0.05). The LMB receiving 3.0 and 6.0 g/kg gene expression. Besides, the lowest value of Keap1 gene expression was
dietary MHA reflected higher feed efficiency (FE) than these fish fed the recorded in fish fed the 3.0 g MHA/kg diet (P < 0.05).
control diet (P < 0.05). The dietary optimal Met level of juvenile LMB Fig. 4 displays nuclear Nrf2 and cytosolic Keap1 protein levels. Diets
containing 3.0, 6.0, and 9.0 g MHA/kg diet significantly increased nu­
Table 4 clear Nrf2 protein level, while no statistical difference was observed
The IBW, FBW, SR, PWG, SGR, FI, and FE of LMB fed diets with different level of among other three diet groups. The lowest level of Keap1 protein was
MHA for 84 d1. detected in fish fed 3.0 g/kg MHA diet.
MHA (g/ 0.0 3.0 6.0 9.0
kg) 
Y = -0.004X2 + 0.0999X + 1.96
SR2 100 ± 0.00 99.17 ± 1.44 100 ± 0.00 100 ± 0.00  R2 = 0.7563, P<0.05
IBW 14.54 ± 0.04 14.50 ± 0.01 14.55 ± 0.03 14.49 ± 0.02
119.11 ± 127.96 ± 123.88 ± 120.61 ± 
FBW
0.82a 0.94c 0.74b 0.82a
3
SGR 2.48 ± 0.03a 2.62 ± 0.04c 2.55 ± 0.01b 2.50 ± 0.01a 

4 111.48 ± 118.18 ± 115.10 ± 112.90 ±

FI 
0.57a 0.40c 0.37b 0.96a
95.73 ± 92.47 ±
FE5 91.58 ± 0.27a 98.64 ± 2.28c 
0.18bc 0.31ab
SGR

6
DFC 2.02 ± 0.02 1.93 ± 0.06 1.97 ± 0.00 2.00 ± 0.02 

LMB = largemouth bass; MAH = methionine hydroxy analogue; IBW = initial 
body weight, FBW = final body weight with DFC as a covariate; SR = survival
rate; PWG = percent weight gain; SGR = specific growth rate; FI = food intake;


FE = food efficiency; DFC = daily feed consumption. 

1
Values are mean ± SE (n = 3), while quadratic regression was run with the
triplicate data points. Mean values with the different superscripts in the same 

row are significantly different (P < 0.05). 

2
SR (%) = 100 × final amount of fish / initial amount of fish.      
3
SGR (%/d) = 100 × [ln (FBW) - ln (IBW)]/d. DietaryMet Levels (g/kg
4
FI (g/fish) = (food offered in dry basis - uneaten food as DM-basis)/amount
of fish. Fig. 1. Quadratic regression analysis of SGR for LMB fed diets with different
5
FE (%) = 100 × (FBW - IBW)/FI. level of MHA for 84 d. SGR = specific growth rate; LMB = largemouth bass;
6
DFC (%) = 100 × FI/ {(IBW + FBW)/2} × rearing period (d)]. MAH = Methionine hydroxy analogue.

4
Y. Zhao et al. Aquaculture 556 (2022) 738279

Table 5 Table 7
Body composition (as wet-basis, %), PPV, LPV, and APV of LMB fed diets with The MDA, PC, and GSH contents (nmol mg-1 protein), ASA, AHR, T-SOD, CAT,
different level of MHA for 84 d1. GPx, GST, and GR activities (U mg-1 protein) in intestine of LMB fed diets with
MHA (g/kg) 0.0 3.0 6.0 9.0
different level of MHA for 84 d1.
MHA (g/ 0.0 3.0 6.0 9.0
Moisture 68.21 ± 0.59 67.76 ± 0.07 67.92 ± 0.43 68.23 ± 0.17
kg)
Protein 16.90 ± 0.24a 17.39 ± 0.18b 17.33 ± 0.23b 17.51 ± 0.01b
Lipid 8.51 ± 0.12a 8.82 ± 0.06b 9.05 ± 0.09b 9.81 ± 0.06c MDA 1.38 ± 0.01d 0.41 ± 0.02a 0.51 ± 0.01b 0.97 ± 0.02c
Ash 3.84 ± 0.02a 3.89 ± 0.05b 3.89 ± 0.02b 3.81 ± 0.01a PC 1.43 ± 0.03c 1.07 ± 0.01a 1.10 ± 0.01ab 1.14 ± 0.01b
PPV2 38.47 ± 0.33a 42.52 ± 0.63c 40.30 ± 0.08b 40.20 ± 0.03b 303.61 ± 348.39 ± 343.14 ±
ASA 376.12 ± 3.00c
LPV3 67.37 ± 0.27a 70.00 ± 1.24b 72.37 ± 0.35b 76.76 ± 0.75c 3.36a 3.21b 4.09b
APV4 34.13 ± 0.03a 37.61 ± 0.55c 35.85 ± 0.17b 34.50 ± 0.17a 187.01 ± 449.50 ± 357.53 ± 295.58 ±
AHR
3.23a 13.11d 2.56c 3.04b
GSH 3.46 ± 0.23a 6.34 ± 0.60b 5.67 ± 0.18b 6.20 ± 0.24b
Regressions
T-SOD 64.29 ± 1.12a 71.22 ± 0.62b 69.56 ± 0.62b 69.34 ± 0.72b
YPPV = − 0.12X2 + 1.14× + 2
X = 4.94 R = 0.5520 P < 0.05 CAT 8.47 ± 0.08a 13.04 ± 0.12d 11.31 ± 0.30c 10.71 ± 0.22b
38.89
GPX 45.42 ± 1.35a 61.59 ± 1.15c 53.62 ± 1.09b 52.76 ± 0.60b
YAPV = − 0.11X2 + 0.92× + 2
X = 4.06 R = 0.7534 P < 0.05 141.44 ± 212.28 ± 187.36 ± 170.38 ±
35.14 GST
6.52a 7.71d 2.12c 3.47b
YLPV = 1.02× + 67.05 R2 = 0.8911 P < 0.05
GR 9.11 ± 0.56a 14.10 ± 0.33c 12.63 ± 0.59b 11.53 ± 0.36b
LMB = largemouth bass; MAH = methionine hydroxy analogue; PPV = Protein
production value; LPV = Lipid production value; APV = Ash production value. Regressions
1
Values are means ± SE (n = 3 × 6). Values within the same rows having YMDA = 0.04 × 2–0.40× +
X = 4.96 R2 = 0.94 P < 0.05
different superscripts are significantly different (P < 0.05). 1.35
2
PPV (%) = 100 × fish protein gain/total protein intake. YPC = 0.01 × 2–0.13× + 1.41 X = 5.81 R2 = 0.81 P < 0.05
3
LPV (%) = 100 × fish lipid gain/total lipid intake. YASA = − 2.16 × 2 + 22.47× 2
X = 5.20 R = 0.63 P < 0.05
4
APV (%) = 100 × fish ash gain/total ash intake. + 309.74
YAHR = − 9.01 × 2 + 88.90× 2
X = 4.93 R = 0.76 P < 0.05
+ 206.23
YGSH = − 0.07 × 2 + 0.84× + 2
Table 6 3.70
X = 6.44 R = 0.54 P < 0.05
The IW, ISI, IL, and RGL of LMB fed diets with different level of MHA for 84 d1. YT-SOD = − 0.20 × 2 + 2.24×
X = 5.63 R2 = 0.46 P < 0.05
MHA (g/ 0.0 3.0 6.0 9.0 + 64.79
kg) YCAT = − 0.14 × 2 + 1.46× +
X = 5.11 R2 = 0.66 P < 0.05
8.84
IW 1.22 ± 0.07 1.26 ± 0.07 1.24 ± 0.04 1.23 ± 0.11 YGPX = − 0.47 × 2 + 4.73× + 2
ISI2 0.90 ± 0.02 0.91 ± 0.06 0.91 ± 0.08 0.93 ± 0.01 X = 4.99 R = 0.53 P < 0.05
46.98
13.73 ± 14.50 ± 13.83 ± 13.87 ± YGST = − 2.44 × 2 + 24.02×
IL X = 4.92 R2 = 0.59 P < 0.05
0.36a 0.70b 0.79ab 0.84ab + 146.63
3 76.77 ± 80.33 ± 79.62 ± 78.24 ± YGR = − 0.17 × 2 + 1.72× +
RGL X = 5.07 R2 = 0.53 P < 0.05
2.14a 3.63b 2.48ab 4.66ab 9.45
LMB = largemouth bass; MAH = methionine hydroxy analogue; IW = wet in­ LMB = largemouth bass; MAH = methionine hydroxy analogue; MDA =
testinal weight (g fish− 1); IL = intestinal length (cm fish− 1); ISI = intestosomatic malondialdehyde; PC = protein carbonyl; ASA = anti-superoxide anion; AHR =
index; RGL = relative gut length. anti-hydroxyl radical; GSH = glutathione (mmol g− 1 tissue); T-SOD = total su­
1
Values are mean ± SE (n = 3 × 9). Mean values with the different super­ peroxide dismutase; CAT = catalase; GPX = glutathione peroxidase; GST =
scripts in the same row are significantly different (P < 0.05). glutathione-S-transferase; GR = glutathione reductase.
2
ISI (%) = 100 × wet intestine weight/wet body weight. 1
Values are means ± SE (n = 3 × 6). Values within the same rows having
3
RGL (%) = 100 × intestine length/body length. different superscripts are significantly different (P < 0.05).

3.4. Intestinal microbiota

Dietary MHA levels (g/kg)
4
A total of 921,647 effective sequences were obtained from 12 se­ 0.0 3.0 6.0 9.0
c
quences samples. The average lengths of the sequences were 407 bp c
Relative mRNA expression in intestine

b
(Table S1). The effective sequences of all samples were clustered into
b
OTUs with 97% identity. As shown in Fig. 5A and Table 8, the rarefac­ 3
b
tion curve tended to reach a plateau and the Goods’ coverage of each
c b
b
group reached >98%, which indicated that the sequencing depth was bc
enough in this study. The 105 shared OTUs were detected in all groups, 2 ab

and the number of unique OTUs for the control, 3.0, 6.0, and 9.0 g MHA/ a a
c bc
kg diet groups were 76, 583, 502, and 310, respectively (Fig. 5B). The b b ab a a
a ab
alpha diversity indices of intestinal microbiota were presented in 1
a a a

Table 8. The Chao1 and ACE indices in 3.0 g/kg MHA group showed the
highest values, and fish fed control diet showed the lowest values.
Higher Shannon and Simpson indexes occurred in 3.0 and 6.0 g/kg MHA
0
groups compared to the control group (P < 0.05). Principal coordinates SOD CAT GPx GST GR GCLC
analysis (PCoA) revealed that the bacterial communities of 3.0 and 6.0
g/kg MHA groups clustered together in the third quadrant, while control Fig. 2. Effects of dietary MHA on SOD, CAT, GPX, GST, GR, and GCLC mRNA
expressions in intestine of LMB. Values are means ± SEM (n = 3 × 6), different
and 9.0 g/kg MHA groups clustered in the second and fourth quadrant,
letter denotes significant difference (P < 0.05). MAH = Methionine hydroxy
respectively (Fig. 5C).
analogue; SOD = superoxide dismutase; CAT = catalase; GPX = glutathione
The microbial composition and abundance in intestine of LMB at the
peroxidase; GST = glutathione-S-transferase; GR = glutathione reductase;
phylum level are shown in Fig. 6A and Table S2. The Firmicutes, Bac­ GCLC = glutamate-cysteine ligase catalytic subunit; LMB = largemouth bass.
teroidetes, Proteobacteria, Cyanobacteria, and Actinobacteria were the

5
Y. Zhao et al. Aquaculture 556 (2022) 738279

Dietary MHA levels (g/kg) abundance of Gemmatimonadetes were significantly increased in 6.0 and
2.0 9.0 g MHA/kg diet groups (P < 0.05).
0.0 3.0 6.0 9.0
At the genus level, the dominant bacterial genera were Unidenti­
c fied_Clostridiales, Faecalibacterium, Bifidobacterium, Mangrovibacter,
Relative mRNA expression in intestine

b c Unidentified_Cyanobacteria, Bacillus, Bacteroides, Lactobacillus, and

c Cupriavidus (Fig. 6C and Table S3). The abundance of Bifidobacterium
1.5
b was significantly increased in 3.0 g/kg MHA group (P < 0.05). Fish fed
diets with 3.0 g/kg MHA had significantly higher abundance of Bacillus
a
and lower abundance of Bacteroides than those fish fed the other diets (P
b
< 0.05).
1.0
4. Discussion

4.1. Dietary MHA improves growth performance and intestinal growth

0.5
0.0
Nrf2
Fig. 3. The mRNA expressions of Nrf2 and Keap1 in intestine of LMB fed diets
with different level of MHA for 84 d. Values are means ± SEM (n = 3 × 6),
different letter denotes significant difference (P < 0.05). Nrf2 = nuclear factor
erythroid 2–related factor 2; Keap1 = Kelch-like ECH-associated protein 1;
LMB = largemouth bass; MAH = Methionine hydroxy analogue.
dominant bacterial phyla. These five bacterial phyla accounted for
92.00%, 89.95%, 80.16%, and 86.56% of the entire microbiota in the
control, 3.0, 6.0, and 9.0 g/kg MHA groups, respectively. The abun­
dance of Firmicutes in 6.0 and 9.0 g/kg MHA groups was markedly lower
than that in other diet groups (P < 0.05). The abundance of Bacteroidetes
was highest in 3.0 g MHA/kg diet group and lowest in control group (P
< 0.05). The ratio of Firmicutes to Bacteroidetes was significantly
decreased in 6.0 and 9.0 g/kg MHA diet groups (Fig. 6B). The abundance
of Proteobacteria was significantly higher in 3.0, 6.0, and 9.0 g/kg MHA
group than that in control group (P < 0.05). Fish fed diets containing 3.0
g/kg MHA had lower abundance of Cyanobacteria and higher abundance
of Actinobacteria than these fish fed the other diets (P < 0.05). The
a
This study shows that dietary MHA supplementation enhances
growth of LMB, which suggests that MHA could be used by LMB. The
Met is an indispensable amino acid and dietary Met supplementation can
improve growth and feed efficiency, as reported for LMB (Wang et al.,
Keap1
2021), juvenile Jian carp (Tang et al., 2009), grass carp (Wu et al.,
2017), and rohu (Noor et al., 2021). It has been reported that MHA can
be used as a source of Met in common carp Cyprinus carpio (Zhou et al.,
2021a), turbot (Ma et al., 2013), rainbow trout Oncorhynchus mykiss
(Powell et al., 2017), Jian carp (Xiao et al., 2011), hybrid striped bass
Morone chrysops ♀ × M. saxatilis ♂ (Li et al., 2009), and red drum
Sciaenops ocellatus (Goff and Gatlin, 2004). Studies in fish have
demonstrated that the bioefficacy of MHA is lower compared to Met
(Pan et al., 2017; To et al., 2020; Keembiyehetty and Gatlin, 1995) and
about 75% to 80% that of Met on an equimolar basis through available
experimental evidence (NRC, 2011). In this study, on the premise of the
basal diet containing 8.30 g/kg Met, the optimal dietary Met level in
LMB is recommended to be 12.49 g/kg diet based on the quadratic
regression analysis of SGR, corresponding to 4.19 g/kg Met sourcing
from MHA. The optimal dietary Met level in LMB is recommended to be
12.49 g/kg diet, which is similar previous reported 12.20 g/kg diet
(Chen et al., 2010). Wang et al. (2021) demonstrates that dietary Met
(12.10 g/kg) promotes growth performance and metabolism by acti­
vating nutrient sensing signaling pathways in LMB. All above results

Fig. 4. Effects of dietary MHA on the Keap1 - Nrf2 axis in intestine of LMB. The Nrf2 and Keap1 protein levels were determined by western blot analysis. Equal
loading was monitored with anti-β-actin antibody. Values are means ± SEM (n = 3 × 3), different letter denotes significant difference (P < 0.05). MAH = Methionine
hydroxy analogue; Keap1 = Kelch-like ECH-associated protein 1; Nrf2 = nuclear factor erythroid 2–related factor 2; LMB = largemouth bass.

6
Y. Zhao et al. Aquaculture 556 (2022) 738279

Fig. 5. (A) The rarefaction curve plot of OTUs for the intestinal bacterial samples of LMB fed diets with different level of MHA. M.0.1, M.0.2, M.0.3 are the three
replicates of control group; M.3.1, M.3.2, M.3.3 are the three replicates of 3.0 g/kg group; M.6.1, M.6.2, M.6.3 are the three replicates of 6.0 g/kg group; M.9.1,
M.9.2, M.9.3 are the three replicates of 9.0 g/kg group. (B) Venn diagram demonstrating the distribution of OTUs in LMB fed diets with different level of MHA. M.0,
M.3, M.6, M.9 represents diets containing MHA 0.0, 3.0, 6.0, 9.0 g/kg, respectively. (C) Principal coordinates analysis (PCoA) based on weighted unifrac distances.
M.0, M.3, M.6, M.9 represents diets containing MHA 0.0, 3.0, 6.0, 9.0 g/kg, respectively. OTUs = operational taxonomic units; LMB = largemouth bass; MAH =
Methionine hydroxy analogue.

that the improvement in growth might be related to FI and FE. Similar

Table 8
findings are also seen in common carp (Zhou et al., 2021b), rainbow
The Alpha-diversity indices of the bacterial communities in intestine of LMB fed
turbot O. mykiss (Powell et al., 2017), red drum (Goff and Gatlin, 2004),
diets with different level of MHA for 84 d1.
and sunshine bass M. chrysops♀ x Morone saxatilis♂ (Keembiyehetty and
MHA (g/kg) 0.0 3.0 6.0 9.0 Gatlin, 1995). The longer intestinal length would promote digestion
Chao1
378.53 ± 1164.10 ± 929.79 ± 883.91 ± through increasing contact time of the digestive enzymes with the di­
11.74a 108.88c 64.18b 44.76b etary components, resulting in increased absorption (Elrayeh and Yildiz,
391.31 ± 1186.53 ± 949.16 ± 918.80 ±
ACE 2012; Odedeyi et al., 2014). Here, this study shows that MHA signifi­
5.29a 113.21c 59.37b 37.68b
5.16 ± cantly increases RGL in LMB as the same in Jian carp (Xiao et al., 2011).
Shannon 4.31 ± 0.73a 6.73 ± 0.67bc 7.50 ± 0.21c
0.75ab The SGR is positively correlated with the RGL (r = 0.931, P = 0.069),
a b
Simpson 0.91 ± 0.03 0.97 ± 0.01 0.98 ± 0.01b 0.89 ± 0.02a which suggesting that the enhanced fish growth by MHA is partly due to
Goods
0.99 ± 0.01 0.98 ± 0.01 0.99 ± 0.01 0.98 ± 0.01 improving intestinal development.
Coverage

LMB = largemouth bass; MAH = methionine hydroxy analogue.

1 4.2. Dietary MHA enhances intestinal antioxidant status via Keap1/Nrf2
Values are mean ± SE (n = 3). Mean values with the different superscripts in
the same row are significantly different (P < 0.05). axis

Intestinal antioxidant status plays a key role in maintaining intestine

demonstrates that dietary MHA as an effective Met source benefits on
structural integrity, which is the main foundation of nutrient uptake and
growth in LMB. In order to further explain how MHA affect growth, we
piscine growth (Zhao et al., 2014). The intestine easily suffers oxidative
conducted the following investigations.
damage due to overproduction of reactive oxygen species such as H2O2,
Fish weight gain is mainly owing to the deposition of protein and fat
O•–
2 , and OH during nutrient assimilation in fish (Jiang et al., 2010;
•
(Bureau, 2000). Here, dietary supplement with MHA enhances PPV and
Zhang et al., 2013). Excess ROS can cause intestinal lipid oxidation and
LPV. The SGR is found to be positively related to PPV (r = 0.862, P =
proteins peroxidation injury, which can be reflect by MDA and PC
0.000). Moreover, we also find that the SGR is positively associated with
concentrations respectively (Jiang et al., 2016b). In this study, dietary
FI (r = 0.893, P = 0.000) and FE (r = 0.995, P = 0.005), which suggested
MHA supplementation decreases intestinal MDA and PC concentrations,

Fig. 6. Intestinal microbiota composition of LMB fed diets with different level of MHA for 84 d. (A) Relative abundance of intestinal bacteria at the phylum level. (B)
Firmicutes to Bacteroidetes ratio of LMB fed diets with different level of MHA. Values are means ± SEM (n = 3 × 3), different letter denotes significant difference (P <
0.05). (C) Relative abundance of intestinal bacteria at the genus level. Only the top 10 most abundant (based on relative abundance) bacterial phyla and genera were
shown. Other phyla and genera were all assigned as ‘Others’. LMB = largemouth bass; MAH = Methionine hydroxy analogue.

7
Y. Zhao et al. Aquaculture 556 (2022) 738279

being in consistent with the results of Jian carp (Feng et al., 2011). The (Feng et al., 2017). This result shows that dietary MHA increases Nrf2
ASA and AHR activities are two important indicators to assess the total mRNA expression and nuclear protein level, whereas down-regulates
scavenging capacities of O•–2 and OH respectively (Kohen and Nyska,
•
Keap1 mRNA expression and cytosolic protein level in fish intestine.
2016). This study finds that dietary MHA supplementation enhances These results demonstrate that dietary MHA improves intestinal anti­
intestinal ASA and AHR activities. Feng et al. also has reported dietary oxidant enzyme-related genes transcription via Keap1/Nrf2 axis. Similar
MHA increased ASA activity in intestine of grass carp (Feng et al., 2011). results have been found in the intestine of grass carp (Pan et al., 2017).
The above results are in agreement with the finding in grass carp in­ The above results are same to finding in blunt snout bream kidney and
testine by Met (Wu et al., 2017), indicating that MHA plays the similar liver by Met (Ji et al., 2020). Therefore, MHA maybe play the similar
function as Met. Dietary MHA supplementation decreases fish intestinal role as Met in regulating antioxidant enzyme-related genes transcription
lipid oxidation and proteins peroxidation injury via increasing total via Keap1/Nrf2 axis. The Met may regulate the Keap1/Nrf2 axis via the
scavenging capacities of O•–
2 and OH . The scavenging capacities of O2
• •–
PI3K/Akt pathway in blunt snout bream (Ji et al., 2020). However,
and OH• attributes to nonenzymatic compounds content and antioxidant whether MHA regulates the expression of antioxidant enzyme genes via
enzymes activities in fish (Jiang et al., 2016a; Wu et al., 2017), which the PI3K/Akt pathway still needs more research.
are closely associated with the corresponding gene mRNA expressions.
This study finds that dietary MHA supplementation improves the anti­ 4.3. Dietary MHA regulates intestinal microbiota
oxidant enzymes activities and GSH content. Moreover, T-SOD, CAT,
GPX, GST, and GR activities are positively associated with their corre­ Intestinal microbiota is one of critical factors to affect nutrient
sponding gene mRNA expressions (Table 9). These results indicate that metabolism and animal growth (Gao et al., 2017; Munaeni et al., 2020;
dietary MHA supplementation could enhance antioxidant enzymes ac­ Zeng et al., 2017). Less diversity of intestinal microbiota could result in
tivities by up-regulating antioxidant enzymes related gene expressions. the disorder of physiological function, and then cause diseases (Boland
The similar results have been found in blunt snout bream kidney and et al., 2021). The Chao1 and ACE indices and Shannon and Simpson
liver by Met (Ji et al., 2020). These results show that MHA plays the indices are used to characterize microbiota species richness and di­
similar function as Met in regulating antioxidant enzymes related gene versity respectively (Peter et al., 2020; Tao et al., 2019; Zheng et al.,
expressions of fish. In addition, the improved GSH content by MHA 2021). The present study shows that dietary MHA supplementation in­
might related to GSH de novo synthesis. The MHA could produce creases the microbiota richness and diversity. Study in sow shows that
cysteine, a precursor of GSH, which could then be converted into taurine dietary supplementation with 0.48% Met reduces the bacteria richness
and GSH (Martín-Venegas et al., 2006). The present study also found (Chao1 and ACE) and diversity (Shannon) (Bin et al., 2018). The
that MHA increased GCLC mRNA expressions in LMB. The previous observed differences might contribute to the lower intestinal pH pro­
study in piglets showed that Met could be converted to cysteine via duced by MHA. The MHA has a low pH due to its monocarboxylic acid
methylation reactions (Zeitz et al., 2017). But Met decreased GCLC with a hydroxyl group on α carbon. The PCoA is conducted to evaluate
mRNA expressions in rainbow trout O. mykiss (Fontagné-Dicharry et al., differences in microbiota composition (Meng et al., 2021; Tao et al.,
2017). These results indicate that the mechanism of MAH in regulating 2019). In the present study, the PCoA plots show that bacterial com­
GCLC gene expression might different from Met in fish. Therefore, the munity form three distinct clusters (control group; 3.0 and 6.0 g MHA/
underlying reason needs further studies. kg diet groups; 9.0 g MHA/kg diet group). This result indicates that MHA
The Nrf2 is a critical transcription factor to regulate antioxidant alters the composition of fish intestinal microbiota. In addition, the
enzyme-related genes transcription (Ji et al., 2020; Suzuki and Yama­ present study shows that dominant bacterial phyla in intestine are Fir­
moto, 2015). The Keap1 represses the translocation of Nrf2 into the micutes, Bacteroidetes, Proteobacteria, Cyanobacteria, and Actinobacteria,
nucleus and Nrf2 mediates gene expression via interacting with Nrf2 which are in accordance with previous studies in LMB (Zhou et al., 2018;
Zhou et al., 2021a), golden pompano Trachinotus ovatus (Tan and Sun,
Table 9 2020), olive flounder Paralichthys olivaceus (Jang et al., 2019), and
Correlation coefficient of some parameters. common carp (Zhang et al., 2021). Nevertheless, these results are
inconsistent with a previous report in Met, which found that Firmicutes,
Independent Dependent Correlation P
parameters parameters coefficients Bacteroidetes and Euryarchaeota were the predominate phyla in sow fed
Met diet (Bin et al., 2018). The differences might be due to the different
PPV 0.862 0.000
FI 0.893 0.000
species or the lower intestinal pH produced by MHA. These dominant
FE 0.995 0.005 bacterial phyla in fish intestine play an important role in nutrient
RGL 0.931 0.069 digestion, absorption, and immune response (Ghanbari et al., 2015; He
MAD − 0.693 0.013 et al., 2021). The Firmicutes/Bacteroidetes ratio is widely used as the
PC − 0.739 0.261
standard of justifying intestinal health (Armougom and Raoult, 2008).
Chao1 0.686 0.014
SGR
ACE 0.684 0.014 This study shows that dietary MHA decreases the Firmicutes/Bacter­
Shannon 0.586 0.045 oidetes ratio in intestine of fish. The Proteobacteria is one of the main
Simpson 0.657 0.020 bacteria in the water environment and fish intestines, and it has been
Actinobacteria 0.855 0.145 proved to be strongly correlated with digestion (Kittle et al., 2018; Song
Bifidobacterium 0.988 0.012
Bacillus 0.897 0.103
et al., 2020; Zhou et al., 2018). Some of the beneficial bacteria that
Bacteroides − 0.996 0.004 belong to Proteobacteria can produce polyhydroxy butyrate, which serve
T-SOD SOD mRNA 0.934 0.066 as an energy source for intestine and improve growth of fish (Enomoto
CAT CAT mRNA 0.989 0.011 et al., 2012; Yamazaki et al., 2016). In this study, dietary MHA sup­
GPX GPX mRNA 0.882 0.118
plementation increases the abundances of Proteobacteria in intestine of
GR GR mRNA 0.949 0.051
GST GST mRNA 0.959 0.041 fish. Similar results have been reported in sow, where dietary supple­
GSH GCLC mRNA 0.649 0.351 mentation with 0.60% Met increases the abundances of Proteobacteria
(Bin et al., 2018). The Actinobacteria, being abundant in fish intestine,
SGR = specific growth rate; T-SOD = total superoxide dismutase; CAT = cata­
lase; GPX = glutathione peroxidase; GR = glutathione reductase; GST = gluta­ produce secondary metabolites, such as alkaloids, lactones, phenazines,
thione-S-transferase; GSH = glutathione; PPV = Protein production value; FI = cyclic peptide compounds, which play a significant role in inhibiting the
food intake; FE = food efficiency; RGL = relative gut length; MDA = malon­ pathogenic bacteria activity (Wu et al., 2012). In this study, dietary
dialdehyde; PC = protein carbonyl; ACE = abundance-based coverage estimator; MHA increases the abundance of Actinobacteria in the intestine of fish.
GCLC = glutamate-cysteine ligase catalytic subunit. The Cyanobacteria is distributed in a variety of water environment,

8
Y. Zhao et al.
which is hard to be digested for many fish (Tan and Sun, 2020). Some
Cyanobacteria can produce a variety of toxins, such as microcystins and
cyclic lipopeptides, which would lead to damage of digestive organs
(Amado and Monserrat, 2010; Kang et al., 2012). This study finds that
dietary MHA decreases the abundance of Cyanobacteria in the intestine
of fish. The decreased Cyanobacteria abundance might be attributed to
low pH in intestine. Study on piglet showed that intestine pH was low­
ered by dietary MHA supplementation (Kaewtapee et al., 2016). Lower
intestinal pH could inhibit Cyanobacteria colonization (Tan and Sun,
2020; Zhou et al., 2018). Recent information on the effect of Met on the
phylum and genus composition of fish intestinal flora is limited. All
above results suggest that dietary MHA supplementation brings a huge
alternation to the intestinal microbial community structure in fish,
which potential mechanism requires further studies.
At the genus level, the Bacillus is one of the members of Firmicutes,
which has been frequently used as probiotics in aquatic animals (Mujeeb
Rahiman et al., 2010; Verschuere et al., 2000). The Bacillus secrets many
exoenzymes to aid in the nutritional enhancement of the host (Amoah
et al., 2019; Han et al., 2015). The Bifidobacterium is one of the members
of Actinobacteria, which can improve the integrity of intestinal barrier,
then enhances the resistance to pathogens (Mokkala et al., 2016). The
Bifidobacterium also has extracellular enzymes that promote digestion of
complex polysaccharides (Sgorbati et al., 1995). In this study, dietary
MHA increases abundances of Bacillus and Bifidobacterium in the intes­
tine of fish. These results are similar to the finding in Jian carp, which
indicates dietary Met increases intestinal Lactobacillus and Bacillus
counts (Tang et al., 2009). Moreover, SGR is positively related to the
abundance of Bifidobacterium (r = +0.998 P = 0.012), indicating that
elevated growth by MHA partly ascribes to increased abundance of
Bifidobacterium. Study on broilers also shows that the increases abun­
dance of Bifidobacterium in intestine may be the reason for the
improvement of growth performance of broilers (Huang et al., 2021).
The Bacteroides (a member of Bacteroidetes) is a common opportunistic
pathogen in intestine of aquatic animal (Wei et al., 2021; Zhang et al.,
2021). Bacteroides can produce enterotoxins, which promote intestinal
mucosal permeability and bacterial absorption (Tao et al., 2017). This
study shows that dietary MHA decreases the abundance of Bacteroides.
These results is in accordance with previous report in Jian carp (Tang
et al., 2009). Therefore, MHA may play the similar role as Met in
regulating fish intestinal microbiota at the genus level. However, the
specific mechanism of dietary MHA in changing abundances of Bacillus,
Bifidobacterium, and Bacteroides needs a further characterization.
5. Conclusion
The present work firstly reveals that dietary MHA improves growth
and the intestinal antioxidant capacity by regulating Keap1-Nrf2 axis in
LMB. Moreover, dietary MHA also modifies the intestinal microbiota
diversity and composition, and enhances the relative abundances of
beneficial microbiota (the Bifidobacterium and Bacillus) and lowers the
relative abundances of opportunistic pathogen (the Bacteroides). Finally,
dietary optimal Met level of juvenile LMB (14.49–122.89 g) is recom­
mended to be 14.49 g/kg diet, corresponding to 8.30 g/kg diet sourcing
from basic diet and 4.19 g Met/kg diet sourcing from MHA based on
SGR.
CRediT authorship contribution statement
Ye Zhao: Investigation, Methodology, Data curation, Writing –
original draft. Chao Yang: Investigation, Methodology, Data curation.
Xiao-Xiao Zhu: Investigation, Methodology, Data curation. Lin Feng:
Investigation, Methodology. Yang Liu: Investigation, Methodology.
Wei-Dan Jiang: Investigation, Methodology. Pei Wu: Investigation,
Methodology. Xiao-Li Huang: Investigation. De-Fang Chen: Investi­
gation. Shi-Yong Yang: Investigation. Wei Luo: Investigation. Jin-Xiu
Zhang: Methodology, Funding acquisition. Shu-Wei Li: Methodology,
9
Aquaculture 556 (2022) 738279
Funding acquisition. Hui Diao: Methodology, Funding acquisition.
Xiao-Lan Wei: Methodology, Funding acquisition. Meng-Jia Zhou:
Methodology, Funding acquisition. Xiao-Qiu Zhou: Conceptualization,
Supervision, Funding acquisition. Jun Jiang: Conceptualization, Su­
pervision, Funding acquisition, Writing – review & editing.
Declaration of Competing Interest
The authors declare that no conflict of interest exist.
Acknowledgements
This research has received funding from National Key R&D Program
of China (2019YFD0900200) and National Natural Science Foundation
of China (32172987).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aquaculture.2022.738279.
References
Amado, L.L., Monserrat, J.M., 2010. Oxidative stress generation by microcystins in
aquatic animals: why and how. Environ. Int. 36, 226–235. https://doi.org/10.1016/
j.envint.2009.10.010.
Amoah, K., Huang, Q., Tan, B., Zhang, S., Chi, S., Yang, Q., Dong, X., 2019. Dietary
supplementation of probiotic Bacillus coagulans ATCC 7050, improves the growth
performance, intestinal morphology, microflora, immune response, and disease
confrontation of pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immun.
87, 796–808. https://doi.org/10.1016/j.fsi.2019.02.029.
AOAC, 2016. Official Methods of Analysis, 20th ed. Association of Official and Analytical
Chemistry (AOAC) International, Rockville, MD.
Apajalahti, J., Rademacher, M., Htoo, J.K., Redshaw, M., Kettunen, A., 2009. Divergent
modulation of swine ileal microbiota by formic acid and methionine hydroxy
analogue-free acid. Animal 3, 817–825. https://doi.org/10.1017/
S1751731109004431.
Armougom, F., Raoult, D., 2008. Use of pyrosequencing and DNA barcodes to monitor
variations in firmicutes and bacteroidetes communities in the gut microbiota of
obese humans. BMC Genomics 9, 576. https://doi.org/10.1186/1471-2164-9-576.
Bin, P., Azad, M.A.K., Liu, G., Zhu, D., Kim, S.W., Yin, Y., 2018. Effects of different levels
of methionine on sow health and plasma metabolomics during late gestation. Food
Funct. 9, 4979–4988. https://doi.org/10.1039/c8fo01477a.
Boland, K., Bedrani, L., Turpin, W., Kabakchiev, B., Stempak, J., Borowski, K.,
Silverberg, M.S., 2021. Persistent diarrhea in patients with crohn’s disease after
mucosal healing is associated with lower diversity of the intestinal microbiome and
increased dysbiosis. Clin. Gastroenterol. H. 19, 296–304. https://doi.org/10.1016/j.
cgh.2020.03.044.
Bureau, 2000. Pattern and cost of growth and nutrient deposition in fish and shrimp:
potential implications and applications. Avances en Nutrición Acuícola V. Memorias
del V Simposium Internacional de Nutrición Acuícola 19, 111–140.
Chen, N.S., Jian-Zhong, M.A., Zhou, H.Y., Zhou, J., Qiu, X.J., Jin, L.N., Lin, L.F., 2010.
Assessment of dietary methionine requirement in largemouth bass, Micropterus
salmoides. J. Fish. China 34, 1244–1253. https://doi.org/10.3724/SP.
J.1231.2010.06781.
Elrayeh, A.S., Yildiz, G., 2012. Effects of inulin and β-glucan supplementation in broiler
diets on growth performance, serum cholesterol, intestinal length, and immune
system. Turk. J. Vet. Anim. Sci. 36 (4), 388–394. https://doi.org/10.3906/vet-1010-
504.
Enomoto, M., Nakagawa, S., Sawabe, T., 2012. Microbial communities associated with
holothurians: presence of unique bacteria in the coelomic fluid. Microbes Environ.
27, 300–305. https://doi.org/10.1264/jsme2.ME12020.
Feng, L., Xiao, W.W., Liu, Y., Jiang, J., Hu, K., Jiang, W.D., Zhou, X.Q., 2011. Methionine
hydroxy analogue prevents oxidative damage and improves antioxidant status of
intestine and hepatopancreas for juvenile Jian carp (Cyprinus carpio var. Jian).
Aquac. Nutr. 17, 595–604. https://doi.org/10.1111/j.1365-2095.2011.00853.x.
Feng, X., Yu, W., Li, X., Zhou, F., Zhang, W., Shen, Q., Shen, P., 2017. Apigenin, a
modulator of PPARγ, attenuates HFD-induced NALFD by regulating hepatocyte lipid
metabolism and oxidative stress via Nrf2 activation. Biochem. Pharmacol. 136,
136–149. https://doi.org/10.1016/j.bcp.2017.04.014.
Fontagné-Dicharry, S., Alami-Durante, H., Aragão, C., Kaushik, S.J., Geurden, I., 2017.
Parental and early-feeding effects of dietary methionine in rainbow trout
(Oncorhynchus mykiss). Aquaculture 469, 16–27. https://doi.org/10.1016/j.
aquaculture.2016.11.039.
Gao, Y., He, J., He, Z., Li, Z., Zhao, B., Mu, Y., Chu, Z., 2017. Effects of fulvic acid on
growth performance and intestinal health of juvenile loach Paramisgurnus dabryanus
(Sauvage). Fish Shellfish Immun. 62, 47–56. https://doi.org/10.1016/j.
fsi.2017.01.008.
Y. Zhao et al.
Ghanbari, M., Kneifel, W., Domig, K.J., 2015. A new view of the fish gut microbiome:
advances from next-generation sequencing. Aquaculture 448, 464–475. https://doi.
org/10.1016/j.aquaculture.2015.06.033.
Giuliani, M.E., Regoli, F., 2014. Identification of the Nrf2-Keap1 pathway in the
European eel Anguilla anguilla: role for a transcriptional regulation of antioxidant
genes in aquatic organisms. Aquat. Toxicol. 150, 117–123. https://doi.org/10.1016/
j.aquatox.2014.03.003.
Goff, J.B., Gatlin, D.M., 2004. Evaluation of different sulfur amino acid compounds in the
diet of red drum, Sciaenops ocellatus, and sparing value of cystine for methionine.
Aquaculture 241, 465–477. https://doi.org/10.1016/j.aquaculture.2004.08.002.
Guo, J., Bao, Y., Davis, R., Abebe, A., Wilson, A.E., Davis, D.A., 2020. Application of
meta-analysis towards understanding the effect of adding a methionine hydroxy
analogue in the diet on growth performance and feed utilization of fish and shrimp.
Rev. Aquac. 12, 2316–2332. https://doi.org/10.1111/raq.12436.
Han, B., Long, W., He, J., Liu, Y., Si, Y., Tian, L., 2015. Effects of dietary Bacillus
licheniformis on growth performance, immunological parameters, intestinal
morphology and resistance of juvenile nile tilapia (Oreochromis niloticus) to challenge
infections. Fish Shellfish Immun. 46, 225–231. https://doi.org/10.1016/j.
fsi.2015.06.018.
He, Y., Guo, X., Tan, B., Dong, X., Yang, Q., Liu, H., Chi, S., 2021. Replacing fish meal
with fermented rice protein in diets for hybrid groupers (Epinephelus fuscoguttatus♀×
Epinephelus lanceolatus♂): effects on growth, digestive and absorption capacities,
inflammatory-related gene expression, and intestinal microbiota. Aquaculture
Reports 19, 100603. https://doi.org/10.1016/j.aqrep.2021.100603.
Hu, H., Ma, R., Zhang, Y., Zhou, H., Xu, W., Hou, H., Mai, K., 2015. Safety level
evaluation of dietary 2-hydroxy-4-(methylthio) butanoic acid (HMTBa) for turbot
Scophthalmus maximus based on growth performances, anti-oxidative responses, and
liver and intestine conditions. Aquaculture 444, 13–20. https://doi.org/10.1016/j.
aquaculture.2015.03.008.
Huang, P., Wang, P., Xu, J., Sun, M., Liu, X., Lin, Q., Zeng, J., 2021. Fermented
traditional chinese medicine alters the intestinal microbiota composition of broiler
chickens. Res. Vet. Sci. 135, 8–14. https://doi.org/10.1016/j.rvsc.2020.12.021.
Jang, W.J., Lee, J.M., Hasan, M.T., Lee, B., Lim, S.G., Kong, I., 2019. Effects of probiotic
supplementation of a plant-based protein diet on intestinal microbial diversity,
digestive enzyme activity, intestinal structure, and immunity in olive flounder
(Paralichthys olivaceus). Fish Shellfish Immun. 92, 719–727. https://doi.org/
10.1016/j.fsi.2019.06.056.
Ji, K., Liang, H., Ren, M., Ge, X., Mi, H., Pan, L., Yu, H., 2020. The immunoreaction and
antioxidant capacity of juvenile blunt snout bream (Megalobrama amblycephala)
involves the PI3K/AKT/Nrf2 and NF-κB signal pathways in response to dietary
methionine levels. Fish Shellfish Immun. 105, 126–134. https://doi.org/10.1016/j.
fsi.2020.07.005.
Jiang, W., Feng, L., Liu, Y., Jiang, J., Hu, K., Li, S., Zhou, X., 2010. Lipid peroxidation,
protein oxidant and antioxidant status of muscle, intestine and hepatopancreas for
juvenile Jian carp (Cyprinus carpio var. Jian) fed graded levels of myo-inositol. Food
Chem. 120, 692–697. https://doi.org/10.1016/j.foodchem.2009.10.062.
Jiang, J., Shi, D., Zhou, X., Yin, L., Feng, L., Liu, Y., Zhao, Y., 2015. Effects of glutamate
on growth, antioxidant capacity, and antioxidant-related signaling molecule
expression in primary cultures of fish enterocytes. Fish Physiol. Biochem. 41,
1143–1153. https://doi.org/10.1007/s10695-015-0076-3.
Jiang, J., Wu, X., Zhou, X., Feng, L., Liu, Y., Jiang, W., Zhao, Y., 2016a. Effects of dietary
curcumin supplementation on growth performance, intestinal digestive enzyme
activities and antioxidant capacity of crucian carp Carassius auratus. Aquaculture
463, 174–180. https://doi.org/10.1016/j.aquaculture.2016.05.040.
Jiang, J., Wu, X., Zhou, X., Feng, L., Liu, Y., Jiang, W., Zhao, Y., 2016b. Glutamate
ameliorates copper-induced oxidative injury by regulating antioxidant defences in
fish intestine. Brit. J. Nutr. 116, 70–79. https://doi.org/10.1017/
S0007114516001732.
Kaewtapee, C., Krutthai, N., Bunchasak, C., 2016. Effects of supplemental liquid DL-
methionine hydroxy analog free acid in diet on growth performance and
gastrointestinal functions of piglets. Asian Austral. J. Anim. 29, 1166–1172. https://
doi.org/10.5713/ajas.15.0579.
Kang, H., Sturdy, M., Krunic, A., Kim, H., Shen, Q., Swanson, S.M., Orjala, J., 2012.
Minutissamides E-L, antiproliferative cyclic lipodecapeptides from the cultured
freshwater cyanobacterium cf. Anabaena sp. Bioorg. Med. Chem. 20, 6134–6143.
https://doi.org/10.1016/j.bmc.2012.08.017.
Keembiyehetty, C.N., Gatlin, D.M., 1995. Evaluation of different sulfur compounds in the
diet of juvenile sunshine bass (Morone chrysops ♀ × M. Saxatilis ♂). Comp. Biochem.
Physiol. A Physiol. 112, 155–159. https://doi.org/10.1016/0300-9629(95)00075-I.
Kittle, R.P., McDermid, K.J., Muehlstein, L., Balazs, G.H., 2018. Effects of glyphosate
herbicide on the gastrointestinal microflora of hawaiian green turtles (Chelonia
mydas) linnaeus. Mar. Pollut. Bull. 127, 170–174. https://doi.org/10.1016/j.
marpolbul.2017.11.030.
Kohen, R., Nyska, A., 2016. Invited review: oxidation of biological systems: oxidative
stress phenomena, antioxidants, redox reactions, and methods for their
quantification. Toxicol. Pathol. 30, 620–650. https://doi.org/10.1080/
01926230290166724.
Li, P., Burr, G.S., Wen, Q., Goff, J.B., Murthy, H.S., Gatlin, D.M., 2009. Dietary
sufficiency of sulfur amino acid compounds influences plasma ascorbic acid
concentrations and liver peroxidation of juvenile hybrid striped bass (Morone
chrysops × M. Saxatilis). Aquaculture 287, 414–418. https://doi.org/10.1016/j.
aquaculture.2008.11.004.
Li, J., Xu, W., Lai, W., Kong, A., Zhang, Z., Pang, Y., Ai, Q., 2021. Effect of dietary
methionine on growth performance, lipid metabolism and antioxidant capacity of
large yellow croaker (Larimichthys crocea) fed with high lipid diets. Aquaculture 536,
736388. https://doi.org/10.1016/j.aquaculture.2021.736388.
10
Aquaculture 556 (2022) 738279
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. https://doi.
org/10.1006/meth.2001.1262.
Ma, R., Hou, H., Mai, K., Bharadwaj, A.S., Cao, H., Ji, F., Zhang, W., 2013. Comparative
study on the effects of L-methionine or 2-hydroxy-4-(methylthio) butanoic acid as
dietary methionine source on growth performance and anti-oxidative responses of
turbot (Psetta maxima). Aquaculture 412-413, 136–143. https://doi.org/10.1016/j.
aquaculture.2013.07.021.
Martin, C., Mirande, C., Morgavi, D.P., Forano, E., Devillard, E., Mosoni, P., 2013.
Methionine analogues HMB and HMBi increase the abundance of cellulolytic
bacterial representatives in the rumen of cattle with no direct effects on fibre
degradation. Anim. Feed Sci. Technol. 182, 16–24. https://doi.org/10.1016/j.
anifeedsci.2013.03.008.
Martín-Venegas, R., Geraert, P.A., Ferrer, R., 2006. Conversion of the methionine
hydroxy analogue dl-2-hydroxy-(4-methylthio) butanoic acid to sulfur-containing
amino acids in the chicken small intestine. Poult. Sci. 85, 1932–1938. https://doi.
org/10.1093/ps/85.11.1932.
Meng, X., Wu, S., Hu, W., Zhu, Z., Yang, G., Zhang, Y., Nie, G., 2021. Clostridium
butyricum improves immune responses and remodels the intestinal microbiota of
common carp (Cyprinus carpio L.). Aquaculture 530, 735753. https://doi.org/
10.1016/j.aquaculture.2020.735753.
Ministry of Agriculture, 2005. China Fishery Statistics Yearbook. China Agriculture
Press, Beijing, China.
Ministry of Agriculture and Rural Affairs, 2021. China Fishery Statistics Yearbook. China
Agriculture Press, Beijing, China.
Mokkala, K., Laitinen, K., Röytiö, H., 2016. Bifidobacterium lactis 420 and fish oil enhance
intestinal epithelial integrity in Caco-2 cells. Nutr. Res. 36, 246–252. https://doi.
org/10.1016/j.nutres.2015.11.014.
Mujeeb Rahiman, K.M., Jesmi, Y., Thomas, A.P., Mohamed Hatha, A.A., 2010. Probiotic
effect of Bacillus NL110 and vibrio NE17 on the survival, growth performance and
immune response of Macrobrachium rosenbergii (de man). Aquac. Res. 41, e120–e134.
https://doi.org/10.1111/j.1365-2109.2009.02473.x.
Munaeni, W., Widanarni, Yuhana M., Setiawati, M., Wahyudi, A.T., 2020. Impact of
dietary supplementation with Eleutherine bulbosa (Mill.) Urb. On intestinal
microbiota diversity and growth of white shrimp, Litopenaeus vannamei. Aquaculture
528, 735466. https://doi.org/10.1016/j.aquaculture.2020.735466.
Noor, Z., Noor, M., Khan, S.A., Younas, W., Ualiyeva, D., Hassan, Z., Yousafzai, A.M.,
2021. Dietary supplementations of methionine improve growth performances,
innate immunity, digestive enzymes, and antioxidant activities of rohu (Labeo
rohita). Fish Physiol. Biochem. 47, 451–464. https://doi.org/10.1007/s10695-021-
00924-x.
NRC, 2011. National Research Council. Nutrient Requirements of Fish and Shrimp.
National Academies Press.
Odedeyi, D., Odo, E., Ajisafe, J., 2014. Hepatosomatic index, intestinal length and
condition factor of Clarias gariepinus fed moringa oleifera leaf meal diets. New York
Sci. J. 7 (1), 1–4.
Pan, F., Wu, P., Feng, L., Jiang, W., Kuang, S., Tang, L., Liu, Y., 2017. Methionine
hydroxy analogue improves intestinal immunological and physical barrier function
in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immun. 64, 122–136.
https://doi.org/10.1016/j.fsi.2017.03.012.
Peter, M., Lv, H., Jiang, X., Liu, Y., Hur, J., Esbon, M., Chu, Z., 2020. Effects of starvation
on enzyme activities and intestinal microflora composition in loach (Paramisgurnus
dabryanus). Aquaculture Reports 18, 100467. https://doi.org/10.1016/j.
fsi.2019.06.047.
Pitta, D.W., Indugu, N., Vecchiarelli, B., Hennessy, M., Baldin, M., Harvatine, K.J., 2020.
Effect of 2-hydroxy-4-(methylthio) butanoate (HMTBa) supplementation on rumen
bacterial populations in dairy cows when exposed to diets with risk for milk fat
depression. J. Dairy Sci. 103, 2718–2730. https://doi.org/10.3168/jds.2019-17389.
Powell, C.D., Chowdhury, M.A.K., Bureau, D.P., 2017. Assessing the bioavailability of L-
methionine and a methionine hydroxy analogue (MHA-Ca) compared to DL-
methionine in rainbow trout (Oncorhynchus mykiss). Aquac. Res. 48, 332–346.
https://doi.org/10.1111/are.12885.
Sgorbati, B., Biavati, B., Palenzona, D., 1995. The genus bifidobacterium. In: The Genera
of Lactic Acid Bacteria, pp. 279–306. https://doi.org/10.1007/978-1-4615-5817-0_
10.
Song, Y., Song, X., Wu, M., Pang, Y., Shi, A., Shi, X., Yang, X., 2020. The protective effects
of melatonin on survival, immune response, digestive enzymes activities and
intestinal microbiota diversity in chinese mitten crab (Eriocheir sinensis) exposed to
glyphosate. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 238, 108845 https://
doi.org/10.1016/j.cbpc.2020.108845.
Suzuki, T., Yamamoto, M., 2015. Molecular basis of the keap1-Nrf2 system. Free Radical
Bio. Med. 88, 93–100. https://doi.org/10.1016/j.freeradbiomed.2015.06.006.
Tan, X., Sun, Z., 2020. Dietary dandelion extract improved growth performance,
immunity, intestinal morphology and microbiota composition of golden pompano
Trachinotus ovatus. Aquaculture Reports 18, 100491. https://doi.org/10.1016/j.
aqrep.2020.100491.
Tang, L., Wang, G.X., Jiang, J., Feng, L., Yang, L., Li, S.H., Zhou, X.Q., 2009. Effect of
methionine on intestinal enzymes activities, microflora and humoral immune of
juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 15, 477–483. https://doi.
org/10.1111/j.1365-2095.2008.00613.x.
Tao, J., Duan, J., Jiang, S., Feng, N., Qiu, W., Ling, Y., 2017. Polysaccharides from
Chrysanthemum morifolium ramat ameliorate colitis rats by modulating the intestinal
microbiota community. Oncotarget 8, 80790–80803. https://doi.org/10.18632/
oncotarget.20477.
Y. Zhao et al.
Tao, Z., Xu, W., Zhu, C., Zhang, S., Shi, Z., Song, W., Li, H., 2019. Effects of ammonia on
intestinal microflora and productive performance of laying ducks. Poult. Sci. 98,
1947–1959. https://doi.org/10.3382/ps/pey578.
To, V.P.T.H., Subramaniam, M., Masagounder, K., Loewen, M.E., 2020. Characterization
of the segmental transport mechanisms of DL-methionine hydroxy analogue along
the intestinal tract of rainbow trout with an additional comparison to DLmethionine.
Comp. Biochem. Physiol. Part A 249, 110776. https://doi.org/10.1016/j.
cbpa.2020.110776.
Verschuere, L., Rombaut, G., Sorgeloos, P., Verstraete, W., 2000. Probiotic bacteria as
biological control agents in aquaculture. Microbiol. Mol. Biol. R. 64, 655–671.
https://doi.org/10.1128/MMBR.64.4.655-671.2000.
Wallis, K.F., Melnyk, S.B., Miousse, I.R., 2020. Sex-specific effects of dietary methionine
restriction on the intestinal microbiome. Nutrients 12, 781. https://doi.org/
10.3390/nu12030781.
Wang, W., Yang, P., He, C., Chi, S., Li, S., Mai, K., Song, F., 2021. Effects of dietary
methionine on growth performance and metabolism through modulating nutrient-
related pathways in largemouth bass (Micropterus salmoides). Aquaculture Reports
20, 100642. https://doi.org/10.1016/j.aqrep.2021.100642.
Wei, C., Wang, X., Li, C., Zhou, H., Liu, C., Mai, K., He, G., 2021. Effects of dietary
Shewanella sp. Mr-7 on the growth performance, immunity, and intestinal microbiota
of pacific white shrimp. Aquaculture Reports 19, 100595. https://doi.org/10.1016/
j.aqrep.2021.100595.
Wu, S., Wang, G., Angert, E.R., Wang, W., Li, W., Zou, H., Bereswill, S., 2012.
Composition, diversity, and origin of the bacterial community in grass carp intestine.
PLoS One 7, e30440. https://doi.org/10.1371/journal.pone.0030440.
Wu, P., Tang, L., Jiang, W., Hu, K., Liu, Y., Jiang, J., Feng, L., 2017. The relationship
between dietary methionine and growth, digestion, absorption, and antioxidant
status in intestinal and hepatopancreatic tissues of sub-adult grass carp
(Ctenopharyngodon idella). J. Anim. Sci. Biotechnol. 8, 63. https://doi.org/10.1186/
s40104-017-0194-0.
Wu, Y., Yin, X., Wang, Y., Mahmood, T., Shahid, M., Yin, D., Yuan, J., 2020. Effect of 2-
hydroxy-4-(methylthio) butanoic acid and acidifier on the performance, chyme pH,
and microbiota of broilers. Anim. Sci. J. 91, e13409 https://doi.org/10.1111/
asj.13409.
Xiao, W.W., Feng, L., Liu, Y., Jiang, J., Hu, K., Jiang, W.D., Zhou, X.Q., 2011. Effects of
dietary methionine hydroxy analogue supplement on growth, protein deposition and
intestinal enzymes activities of juvenile jian carp (Cyprinus carpio var. Jian). Aquac.
Nutr. 17, 408–417. https://doi.org/10.1111/j.1365-2095.2010.00818.x.
Yamazaki, Y., Meirelles, P.M., Mino, S., Suda, W., Oshima, K., Hattori, M., Sawabe, T.,
2016. Individual Apostichopus japonicus fecal microbiome reveals a link with
polyhydroxybutyrate producers in host growth gaps. Sci. Rep. 6 https://doi.org/
10.1038/srep21631.
11
Aquaculture 556 (2022) 738279
Yang, Y., Zhang, Y., Xu, Y., Luo, T., Ge, Y., Jiang, Y., Le, G., 2019. Dietary methionine
restriction improves the gut microbiota and reduces intestinal permeability and
inflammation in high-fat-fed mice. Food Funct. 10, 5952–5968. https://doi.org/
10.1039/c9fo00766k.
Yuan, J., Ni, M., Liu, M., Wang, H., Zhang, C., Mi, G., Gu, Z., 2019. Analysis of the growth
performances, muscle quality, blood biochemistry and antioxidant status of
Micropterus salmoides farmed in in-pond raceway systems versus usual-pond systems.
Aquaculture 511, 734241. https://doi.org/10.1016/j.aquaculture.2019.734241.
Zeitz, J.O., Kaltenböck, S., Most, E., Eder, K., 2017. Antioxidant status and expression of
inflammatory genes in gut and liver of piglets fed different dietary methionine
concentrations. J. Anim. Physiol. An. N. 101, 1166–1174. https://doi.org/10.1111/
jpn.12633.
Zeng, S., Huang, Z., Hou, D., Liu, J., Weng, S., He, J., 2017. Composition, diversity and
function of intestinal microbiota in pacific white shrimp (Litopenaeus vannamei) at
different culture stages. Peer J. 5, e3986 https://doi.org/10.7717/peerj.3986.
Zhang, J., Guo, L., Feng, L., Jiang, W., Kuang, S., Liu, Y., Zhou, X., 2013. Soybean
β-conglycinin induces inflammation and oxidation and causes dysfunction of
intestinal digestion and absorption in fish. PLoS One 8, e58115. https://doi.org/
10.1371/journal.pone.0058115.
Zhang, Y., Zhang, P., Shang, X., Lu, Y., Li, Y., 2021. Exposure of lead on intestinal
structural integrity and the diversity of gut microbiota of common carp. Compar.
Biochem. Physiol. C Toxicol. Pharmacol. 239, 108877 https://doi.org/10.1016/j.
cbpc.2020.108877.
Zhao, J., Feng, L., Liu, Y., Jiang, W., Wu, P., Jiang, J., Zhou, X., 2014. Effect of dietary
isoleucine on the immunity, antioxidant status, tight junctions and microflora in the
intestine of juvenile jian carp (Cyprinus carpio var. Jian). Fish Shellfish Immun. 41,
663–673. https://doi.org/10.1016/j.fsi.2014.10.002.
Zheng, L., Xie, S., Zhuang, Z., Liu, Y., Tian, L., Niu, J., 2021. Effects of yeast and yeast
extract on growth performance, antioxidant ability and intestinal microbiota of
juvenile pacific white shrimp (Litopenaeus vannamei). Aquaculture 530, 735941.
https://doi.org/10.1016/j.aquaculture.2020.735941.
Zhou, M., Liang, R., Mo, J., Yang, S., Gu, N., Wu, Z., Lin, L., 2018. Effects of brewer’s
yeast hydrolysate on the growth performance and the intestinal bacterial diversity of
largemouth bass (Micropterus salmoides). Aquaculture 484, 139–144. https://doi.
org/10.1016/j.aquaculture.2017.11.006.
Zhou, Y., He, G., Jin, T., Chen, Y., Dai, F., Luo, L., Lin, S., 2021a. High dietary starch
impairs intestinal health and microbiota of largemouth bass, Micropterus salmoides.
Aquaculture 534, 736261. https://doi.org/10.1016/j.aquaculture.2020.736261.
Zhou, Y., He, J., Su, N., Masagounder, K., Xu, M., Chen, L., Ye, C., 2021b. Effects of DL-
methionine and a methionine hydroxy analogue (MHA-Ca) on growth, amino acid
profiles and the expression of genes related to taurine and protein synthesis in
common carp (Cyprinus carpio). Aquaculture 532, 735962. https://doi.org/10.1016/
j.aquaculture.2020.735962.
Another random document with
no related content on Scribd:
he would, he told himself, have been a bear to prevent her dancing
because himself unable, owing to his wounded leg, to dance at all.
Suddenly his spirits rose. He had caught sight of Hopford ... he
was some way off.... Ah, there he was again! Wandering, he
appeared to be in search of some one. And at that instant Hopford
saw him.
“Charlie, for heaven’s sake—​I have been hunting for you
everywhere,” Hopford exclaimed when at last they came together.
“An awful thing has happened—​it will give you a big shock, but I
implore you not to worry, because I am positive all will come right in
the end. Cora knows about it and is with Yootha now.”
“Yootha? Where is she, Harry? I have been trying to find her for
the last half an hour or more.”
“I can well believe that,” Hopford answered. “Now listen, Charlie,
and don’t get upset. A woman had her pearl necklace stolen to-night,
and the necklace has been found in Yootha’s vanity bag, and so—​
well, of course they had to arrest her.”
“Arrest her! Arrest Yootha?”
“Why yes. You see the pearls were found in her possession. Have
you heard about Levi Schomberg, and—​—”
“Hang Levi Schomberg!” Preston cried out. “What the devil does
Levi Schomberg matter—​forgive me, Harry, here, take me to Yootha
at once and let me see the police myself about this ridiculous
trumped-up charge!”
 CHAPTER XV.

SOME CROOKED QUESTIONS.

During the week which followed the papers gave special
prominence to two items of news which interested their readers
greatly. One was the strange death of Levi Schomberg, with an
account of events which had immediately preceded it, and a record
of his past career; the other was the arrest of Yootha Hagerston on a
charge of stealing a pearl necklace owned by a woman named
Marietta Stringborg, wife of Julius Stringborg, described as “formerly
of Shanghai, spirit merchant, but now of Upper Bruton Street,
London, and The Retreat, Maidenhead.”
Schomberg’s death, it seemed, was of rather a mysterious
character, and the inquest lasted a considerable time. In the opinion
of the coroner it had been due to natural causes, but Doctor Johnson
strongly opposed that theory and advanced several significant points
in his endeavor to disprove it.
First, there was the peculiarity of de rigor mortis having set in so
soon; then the fact that all the organs were obviously healthy; then
the singular appearance of the eyes, which, the doctor declared, had
not resembled the eyes of a dead man when first he had examined
the body; and, lastly, the condition of the blood. Very emphatically he
maintained that the blood had an unusual tint. This might, he
admitted, easily have been overlooked; yet it undoubtedly existed,
and he was at a loss to account for it. He admitted that the condition
of the blood seemed healthy.
The coroner was one of those rather pig-headed men, who,
having expressed an opinion, are loth in any circumstances to alter
it. In any case, it was obvious to Preston and Blenkiron from the first
that the coroner was not favorably disposed towards Doctor
Johnson, and that every suggestion the latter made he endeavored
to controvert.
“I confess,” he observed pompously, when Johnson had pointed
out very clearly why in his opinion death had not been due to natural
causes, “that I completely fail to follow your line of argument.
Furthermore, what possible reason could any person or persons
have had for wishing to hasten the death of so respectable a citizen
as deceased appears to have been, in spite of his unsavory calling?
In my opinion the idea that death was due to other than natural
causes is preposterous. Had the unfortunate man taken poison, or
had poison been administered, traces of it must have been found. As
it is, no trace of any sort of poison has been discovered, and
therefore, if you will forgive my speaking bluntly, Doctor Johnson, I
consider that your speculations are hypercritical—​or let us say
beside the mark.”
Johnson shrugged his shoulders.
“In that case,” he replied, “I have nothing further to say.”
“Quite so. I am glad to hear you say that.”
Johnson opened his mouth as if about to speak again; then
changed his mind and remained silent. “What is the use,” was his
mental comment, “of arguing with such a person?”
And so, after all, a verdict of “death from natural causes” was
returned, and Johnson, feeling extremely dissatisfied, left the Court
accompanied by Blenkiron and Captain Preston.
It was the second of these two incidents, however, which had
interested Preston far more than the first, had, indeed, engrossed
almost the whole of his attention since the night of the ball—​the
arrest of Yootha Hagerston. Though finally acquitted, she had
undergone intense mental suffering during the time she had been
kept under observation. And naturally people had talked. Many, in
fact, had not yet finished talking. Among the latter was Jessica
Mervyn-Robertson.
Perhaps the truth of the old saying that “if you throw mud enough,
some of it is sure to stick,” had never been better illustrated than in
connection with Yootha’s arrest on a charge of theft. Women in
particular discussed the affair, and during such discussions
eyebrows were raised significantly, and there were plenty of little
smiles which implied more than any spoken words could have done.
“Had she been a poor woman, instead of what we call a lady,” the
hackneyed observation was trotted out again, “she would be in
prison now, my dear,” a faded creature who had always toadied to
rich people observed to Jessica during a few moments’ conversation
they had in Bond Street one morning. “Mrs. Stringborg is a friend of
yours, isn’t she?”
Jessica replied that she had known her for some years.
“And what does she think about it?”
Jessica raised her eyebrows. Then, after an instant’s pause, she
said cryptically:
“She doesn’t think.”
The faded woman nodded.
“I understand,” she purred. “She knows.”
Jessica smiled. It was one of the significant smiles referred to,
more deadly than spoken words.
And so they parted, Jessica with a smile upon her lips, and hatred
still in her heart, the other woman reveling in her good fortune at
having had this assurance, as she chose to consider it, direct from a
friend of Marietta Stringborg’s, that though Yootha had been
acquitted she was guilty.
And Yootha?
Already she began to feel the draught in the mental atmosphere.
Plenty of her friends remained true to her, of course, not giving a
second thought to the suggestion that the pearls had been taken by
her, but there were others....
Highly strung and extremely sensitive, she felt the difference in
the “atmosphere” at every turn. The quick glances towards her and
then away from her; the glances followed by whispers, and the
whispers sometimes by smiles; the slight hauteur of folk who up till
then had greeted her always with effusion; the sudden crossing from
her side of the street to the other by acquaintances who noticed her
approaching—​these and similar incidents affected her intensely,
causing acute pain.
“It is too dreadful,” she exclaimed one night on her return with her
friend, Cora Hartsilver, to the latter’s house in Park Crescent after
the Opera. “I have been miserable to-night—​miserable. I felt during
the whole performance as if all the audience was staring at me,
saying one to another: ‘There she is, that is the girl so much talked
about who was charged with the theft of the necklace at the Albert
Hall ball.’ And it was not all imagination, dear, for I distinctly heard
my name whispered twice by people a row or two behind us. And
then, did you see Jessica? She saw me directly we entered the
theater, and I saw her turn in her box and speak to her friends and at
once they all gathered nearer to hear what she had to say—​while we
walked down to our seats they all stared at me as hard as they
could.... I felt like a criminal, Cora. I feel like a criminal still....” and
throwing her arms impetuously about her friend with her head on her
shoulder she began to cry bitterly.
Cora consoled her as best she could, while in her own heart fury
burned. It was fury at the thought, at the conviction she felt, that this
injustice was not the outcome of misfortune, but that the whole thing
had been deliberately planned, and that the person who had planned
it had been none other than Jessica. And why did Jessica hate
Yootha so? There could, she told herself be but one reason—​it was
because Yootha was her friend. Jessica would, no doubt, have liked
to cast suspicion of the robbery on herself, but, unable to do that,
she had stabbed her through her friend. And, so thinking, Cora
ground her teeth. More determined than ever did she become at that
moment to find out everything about Jessica Mervyn-Robertson, and
if possible shame her in the eyes of the world forever.
“Don’t cry, my darling,” she said, as she gently stroked Yootha’s
hair; Yootha’s arm still encircled her. “I have had a letter to-night from
the house with the bronze face, and they are leaving no stone
unturned to run the thief to ground. They ask me to call with you as
soon as possible, as there are certain further questions they wish to
put to you. Also, they say, they have something important to show
you.”
“Let us go to-morrow morning,” Yootha exclaimed, looking up, and
mopping her eyes. “And we might take Charlie with us; he will come
if we ask him, I am sure.”
“I was about to suggest that,” Cora answered. “We will ring him up
now. He said he would be back in town to-night, didn’t he? And it
isn’t midnight yet.”
But the telephone remained silent.
Consequently they went alone next morning to the office of the
Metropolitan Secret Agency.
The room into which they were shown was the office where Alix
Stothert and Madame Camille Lenoir had been working late on the
night Lord Froissart had so unexpectedly made his appearance; only
now in the rooms adjoining many clerks were at work, and typing
machines clattered. Only Stothert was in the room, and he looked up
as they entered. Then, as he rose, he removed the eyeshade from
his forehead.
“Good morning,” he said solemnly. “Won’t you sit down?” and he
waved his hand in the direction of two chairs.
“I asked you to call,” he went on at once, coming straight to the
point, “because I wish to put one or two questions to Miss Hagerston
verbally. Will you tell me, please,” he turned to Yootha, “how long you
have been engaged to be married to Captain Preston?”
The girl started.
“Who told you we were engaged?” she exclaimed, coloring. “Our
engagement has not yet been announced in the papers.”
“I am aware of that, but it is our business to know things before
they are made public. How long, Miss Hagerston?”
“Ten days. But has this any bearing on the theft of the pearl
necklace?”
 “Indirectly—​yes. And you made his acquaintance at lunch at the
Ritz on August the ninth of last year, I think?”
“Yes.”
“Since then you have met him frequently, I take it?”
“No, only of late.”
“And for some time you have been friendly with a young man
named Harry Hopwood, a newspaper correspondent?”
“I wouldn’t say ‘friendly.’ I have met him from time to time.”
“Now, there is a well-known Society woman with whom you and
Mrs. Hartsilver are both acquainted—​Mrs. Mervyn-Robertson. A little
while ago you may remember, you and Mrs. Hartsilver came here to
ask us to make private inquiries about Mrs. Mervyn-Robertson’s past
life. Since then Mr. Hopford has called here on a similar mission, and
Captain Preston and a Mr. George Blenkiron have done the same.
We have found out certain things about the lady which we have
reported to you all separately; other things we have found out which
for private reasons we deem it inadvisable to tell you, at any rate for
the moment. We should like to warn you, however, that the lady
referred to has many influential friends, and we would venture to
advise you to attempt as little as possible to pry into her private life.
She is a dangerous woman, a very dangerous woman, though this,
naturally I tell you in strictest confidence.”
“Thank you,” Yootha answered. “And now can you throw any light
at all upon the mystery of the stolen pearls?”
“I am coming to that. You no doubt heard some time ago of a
robbery of jewelry and bank notes from a safe in Mrs. Mervyn-
Robertson’s own house in Cavendish Square, though nothing about
it appeared in the papers?”
“Yes, everybody seemed to know about that at the time.”
“Everything stolen that night was covered by a special insurance.
Now, the pearl necklace with the theft of which you were unjustly
charged was also covered by a special insurance, and the policy
was made out by the Company which insured Mrs. Mervyn-
Robertson’s jewelry. Madame Marietta Stringborg, to whom the
stolen pearl necklace found in your possession belonged, is a friend
of Mrs. Robertson—​they met first in Shanghai some years ago.
These may have been coincidences, of course—​—”
As Yootha did not answer, Cora said:
“Do you mean to imply that there may have been—​—”
“I imply nothing,” Stothert interrupted, “but—​—”
He pressed twice an electric button on the table, and almost at
once a handsome young woman with a Semitic caste of
countenance entered. It was Camille Lenoir.
“My partner,” Stothert said, by way of introduction. “Camille,” he
looked up at her from where he sat, while she remained standing,
“do you remember what Lord Froissart said to you the last time he
came here—​it was the morning of the day on which he took his life—​
concerning recent heavy insurances effected in respect to diamonds
with the insurance company of which he was a director?”
“Yes,” she replied, “he said he believed that some owners of
valuable jewelry were insuring such jewelry and then planning bogus
robberies, that is to say arranging for insured property to be ‘stolen’
by persons who eventually would return the property to the insurer
after the insurance money had been paid.”
“Collusion, in short,” Cora said. “Mr. Stothert says he implies
nothing regarding Mrs. Robertson, yet—​yes, I follow you both.”
“No, come here, please.”
As he spoke, Stothert unlocked and pulled open a drawer in the
roll-top desk at which he sat. From it he took a small sealed packet,
broke the seals, unfolded it, and revealed a splendid pearl necklace.
“This is Madame Stringborg’s necklace,” he said. “The necklace
found in your possession, Miss Hagerston, was made of imitation
pearls.”
 CHAPTER XVI.

GATHERING CLOUDS.
Henley week is said to be fine once in eight years, so presumably
it was an eighth year, for the weather was perfect.
Captain Preston, an old blue, had made a point of attending the
historic regatta ever since he had been at school; then had come a
gap, due to the war, and then the regatta had been once more held.
To celebrate the event, also because he thought Yootha would
like it, Preston had this year rented a houseboat which he kept
moored near Maidenhead. Several times before they were engaged
Yootha had spent a day with him on this boat, though he had not
even then made up his mind to propose to her. But now the boat was
moored at Henley, for the regatta week, and he had asked a few of
his friends to come and lunch on board any day they felt inclined to.
It was his intention then to announce his engagement, and to
present them to his future wife.
None of his friends, however, put in an appearance. Some
telegraphed their inability at the last moment to get out of town;
others stayed away without sending an excuse.
Preston was surprised.
“Curious,” he said thoughtfully, as he shook the ashes out of his
pipe about lunch time on the second day of the regatta. “I thought
some of them would turn up to-day. Cooper and Atherton are down
here, I know, because I saw them in a punt together half an hour
ago.”
Yootha, lying back near him in a deck chair, partly concealed by
the overhead awning, did not reply.
 “You seem silent to-day, my darling,” he said after a pause. “Is
anything the matter?”
He bent down as he stopped speaking, and peered under the
awning.
The troubled look in her eyes disconcerted him.
“Darling, what is it?” he asked anxiously. “Is something worrying
you?”
“Not worrying me, exactly,” she answered, with rather a wan
smile, “only—​—”
“Yes? Only what?”
“I think I can guess why your friends have stayed away. It isn’t
hard to guess.”
“Isn’t it? Well, I wish I knew the reason—​ah—​—”
His expression had suddenly changed.
“So now you know,” she went on. “Personally I am not surprised.
You know how people have cold-shouldered me since that dreadful
affair at the ball. Now it has become known we are engaged, people
want less than ever to meet me. Had you been here alone, your
friends would probably all have come to lunch.”
“‘Friends,’ you call them?” Preston exclaimed with a black look.
“They are no longer friends of mine, I can assure you, if they are that
sort.”
“Oh, I don’t blame them,” Yootha answered with a hard smile.
“One has to pay the penalty of notoriety, even though the notoriety
may have come unsought. I dare say I shall live it down,” and she
gave a little shrug.
A tiny boat was sailing past, and the young man seated in the
stern of it hailed Preston.
“Can I come aboard a moment?” he called out. “I want to speak to
you.”
 “Come along,” Preston answered, though without enthusiasm, for
the young man was Archie La Planta. Half a minute later the little
boat was alongside.
“I hope I am not intruding,” La Planta said, discovering suddenly,
or pretending to discover, that nobody else besides Yootha was
aboard. “I heard you had a luncheon party. By the way,” he added,
“have I to congratulate you? I heard the news only to-day.”
“Thanks,” Preston said, concealing the annoyance the unlooked-
for intrusion caused him. “Who told you we were engaged?”
“Oh, one or two people. That last race was a fine finish—​what?”
“Very. Did you say there was something you wanted to ask me?”
“One or two things. The first is a message from Jessica. She
wants to know if you and Miss Hagerston will come to tea on her
houseboat—​it’s that big boat, The Apex, disguised to look like a
warship, with guns and all complete. They’ve a jolly party aboard and
Jessica says she would love to see you both. I was instructed not on
any account to let you say ‘No,’” and he laughed.
Preston did not answer for a moment.
“What do you say, Yootha?” he said at last, with a significant look
which she understood. “Shall we go, or shan’t we?”
“I should like to go,” she replied, taking her cue from his
expression. “Have you had lunch, Mr. La Planta?”
“In point of fact I have not,” he said carelessly, and lit a cigarette.
“Then you had better stay and lunch,” Preston put in. “Others may
drop in presently.”
“Awfully good of you,” La Planta said quietly. “The second thing I
want to ask is whether you happen to have seen Madame Camille
Lenoir of the Metropolitan Secret Agency anywhere about to-day. I
know she is here, with friends, and I want particularly to catch her.”
“I have not noticed her in any of the boats.”
Archie La Planta made a little gesture of annoyance.
 “How tiresome,” he said. “Several people have caught sight of her
to-day, but nobody can tell me where she is to be found. By the way,
has the house with the bronze face found anything out as yet about
the pearl necklace?”
“Nothing as yet, but they seem hopeful. They think that in a week
or so they may be able to tell me something.”
“Good. Stothert is not an optimist, and would not have told you
that unless he had good reason to.”
He turned to Yootha.
“By the way, I have not seen you since the ball,” he said. “And for
that matter I didn’t see you at the ball, because I couldn’t identify
you. That was a rotten experience you had—​perfectly disgraceful to
treat you as they did. I hear it made you quite ill, and I am not
surprised. I hope that by now you have quite recovered?”
“Thank you,” she answered, and in spite of her effort to speak
naturally she could not prevent a certain coldness from betraying
itself in her voice.
“Yes, I have recovered—​though I don’t think all my friends have!”
“Indeed? I think I don’t follow you.”
“Oh, it’s of no consequence,” she replied, flushing slightly; then
she changed the subject.
Jessica was surprisingly genial and friendly when she greeted
Yootha and Captain Preston on her houseboat a couple of hours
later. Preston had availed himself of her invitation for a reason which
he had not yet confided to Yootha, though, had he known it, the
same reason had prompted Yootha to ask La Planta if he had
lunched.
They knew that in spite of the olive branch now held out by
Jessica, at heart Jessica’s dislike of them both had become, if
anything, intensified since the affair at the ball, and that her hatred of
Cora too had increased. Though not addicted to crediting gossip, so
many little remarks of Jessica’s concerning themselves had been
repeated to them by different people that they could not turn an
entirely deaf ear.
All sorts of well-known people were on Jessica’s houseboat.
Some Yootha had met, and to many of the remainder she and
Preston were introduced. Indeed so friendly did everybody appear to
be that presently she began to feel quite happy and at home—​the
reverse of what she and Preston had anticipated.
And of all aboard, none made himself more agreeable to Yootha
and to Captain Preston than Archie La Planta. If anything, he rather
overdid it, for he took the trouble to present several people whom
they found extremely boring. They had been aboard perhaps half an
hour, when Yootha suddenly heard her name spoken, and, turning,
found herself face to face with a dark, very intelligent-looking man
approaching middle age.
“Let me introduce Doctor Johnson,” Stapleton said. “Johnson—​
Miss Hagerston.”
The doctor looked at her keenly, smiling as he raised his hat.
“Our common friend, Captain Preston, has several times
mentioned your name,” he said. “Is he with you to-day?”
“Why, yes,” Yootha answered. “He was here a minute ago. Have
you only just come aboard?”
“No, I have been here the whole afternoon, but for the last hour I
have been what I suppose is called ‘’tween decks,’ settling the
nation’s affairs with some of my cronies whom I don’t often have an
opportunity of meeting,” and he smiled. “Stapleton tells me, Miss
Hagerston, that you and Preston are engaged. May I be allowed to
offer my congratulations? I should like to congratulate you both very
sincerely.”
Yootha colored as she looked over his shoulder.
“Thank you so much,” she said. “I feel as if we had met before;
Charlie has told me so much about you.”
“Well, though I have known him quite a short time, you will forgive
my saying that I like him immensely. Yet, but for the unfortunate affair
of that man’s death the other night, I suppose I should not have had
the pleasure of meeting him, or possibly you. Ah, here he comes.”
For five minutes or more the three remained in conversation,
though their talk was mostly commonplace. There were subjects all
three would have liked to broach, but to have done so amid that
entourage would have been impolitic.
“Yootha and I are dining tête-à-tête on my houseboat,” Preston
said after a while. “If you are not engaged, couldn’t you join us—​if
you will take potluck? Do say you will, Johnson.”
Johnson reflected for some moments.
“I should like to very much,” he said at last. “It is most kind of
you.”
“Capital! Then that is arranged.”
A diversion was created by the approach of a motor-launch with a
party of masked entertainers, while the string quartette in the bows
played a popular air. As it came near it slowed down, then stopped
alongside.
“Oh, those people are splendid,” Jessica exclaimed. “They were
here yesterday and played for us during lunch. Louie,” she turned to
Stapleton, “make them give us an entertainment now.”
The entertainment lasted a long time, so that Preston and Yootha
were unable to leave the houseboat, as they had been about to do
when the launch came in sight. When at last the entertainment
ended they sought out their hostess.
“But surely you are not going?” Jessica exclaimed, holding
Yootha’s hand. “We are only just beginning to enjoy ourselves! Can’t
you both stay to dinner? We want to drink your health, you know,”
and she laughed in her deep and musical voice.
“So good of you,” Yootha answered, though all the while her
instinct told her that beneath this show of friendship and hospitality
there lurked some sinister motive, “but we have a friend dining with
us on our boat.”
 “Ah, in that case I suppose there is nothing further to be said,”
Jessica replied. “But I am very disappointed. Come to lunch to-
morrow, will you? And you too, Captain Preston, make her bring you
with her.”
But Preston excused himself on the plea that he expected friends
to lunch.
“Sometimes, though, friends don’t turn up,” Jessica said
inconsequently. “If they don’t, mind you come, both of you.”
A few minutes after they had gone a man rowed up rapidly in a
dinghy.
“Can I speak to Captain Preston, please?” he asked. “I am his
servant. I have just come from his house-boat.”
He had addressed La Planta, who, leaning against the rail, had
been watching him approach.
“Is it anything important?” La Planta inquired, eyeing the man
coldly.
“It is.”
“Well, Captain Preston and Miss Hagerston have just left. You
must have passed them.”
“Have they gone back to the boat?”
“I expect so. They went down stream.”
Borne along the water came the strains of a revue waltz played
further down the river by the string quartette.
Preston’s servant pulled the dinghy round, then started to row
back.
And La Planta, blowing rings of cigarette smoke, watched him,
with a look of amusement, growing smaller and smaller in the
distance.
At last he straightened himself. Most of the guests had now left.
Barely a dozen remained. Some one touched his elbow, and he
turned.
 “Well?” Stapleton said.
La Planta nodded.
“Quite satisfactory,” he answered.
“And when will he receive it?”
La Planta glanced down at his wrist-watch.
“He may have got it already. I am glad that fellow missed him,
though I can’t think how he managed to. What fools people like
Preston and that girl of his and Cora Hartsilver and the rest of them
are to pit their wits against ours!”
“Preston is no fool, Archie. Nor, for that matter, is Cora.”
But La Planta made no reply. Instead, he shrugged his shoulders,
then tossed his cigarette into the water with a gesture of contempt.
 CHAPTER XVII.

“NOBODY MUST KNOW!”

Preston’s servant, an ex-soldier who had served under him in
France, returned to the houseboat, but neither Preston nor Yootha
had arrived.
The man looked about him, puzzled. Then, concluding that his
master must have been detained by friends on his way back, he
began to attend to his work.
But when an hour had passed, and still Preston did not return, he
went outside and scanned the river with his master’s field-glasses. It
was past seven, and he had dinner nearly ready. It would be
annoying if his master stayed away for dinner without giving him
warning.
Presently a boat stopped alongside, and its sole occupant got out
and came aboard.
“Captain Preston about?” he inquired breezily. “I am dining with
him.”
“Dining with him, sir?”
“Yes. Hasn’t he told you?”
“He has not been here since four o’clock, sir. He and Miss
Hagerston went out to tea and have not been back since. I have an
important letter for him and wish he would return.”
It was now Johnson’s turn to look puzzled.
“I met him and Miss Hagerston at tea,” he said at last, “and they
invited me to come and dine. I can’t understand it. Anyhow, I had
better wait.”
 “If you would, sir. As he has invited you to dine he is bound to be
back soon.”
Johnson looked again at the man.
“Haven’t I seen you somewhere before?”
“Yes, sir, at Fig Tree Court.”
“Of course. I remember.”
He lay back in the deck-chair which he had taken, lit a cigarette,
and began carelessly to focus the boats on the river through
Preston’s binocular.
At eight o’clock the man came back.
“Hadn’t I better serve your dinner, sir?” he inquired tentatively. “I
am sure the captain would not like you to be kept waiting. Something
important must have detained him, sir, for he is always punctual to
the moment, and of course there being no telephone—​—”
“Thank you, but I will wait a little longer. If he is not back by half-
past eight perhaps I will have something to eat, as I can’t get
anything anywhere else now.”
“Thank you, sir,” and the man retired with noiseless tread.
But at half-past eight neither Preston nor Yootha had returned, nor
had they by half-past nine. Johnson had waited until nine, then had
eaten a light meal and gone away.
The ex-soldier was becoming anxious.
He pulled out of his pocket the long envelope addressed to his
master, which had been brought by a man in flannels who had
appeared to him a gentleman and had assured him the letter was
most urgent and must be delivered at the earliest possible moment.
“I wonder if this would throw some light on it?” he said aloud, as
he eyed the envelope suspiciously. “So help me, I’d like to know.”
It was a gorgeous night, without a breath of air, and as warm as in
the tropics. As the man stood on the deck of the house-boat smoking
a cigar and with his hands in his pockets, his thoughts traveled back
to the many hardships he and his master had endured together in
France during the three years he had served under him; of the tight
corners they had more than once found themselves in; and of his
master’s extraordinary coolness in moments of extreme crisis.
“Ah, if they was all like him,” he said reflectively, “we should have
an army, and no mistake!”
For, like many another British Tommy who had been face to face
with death alongside his officers, the fellow worshiped Preston. In
such high esteem did he hold him, indeed, that sometimes his
friends would grow weary of hearing “Captain Preston’s” many
virtues extolled by the faithful servant, and curtly bid him “shut up.”
It was nearly eleven when the man, half-dozing in a deck-chair,
heard his name called. Instantly he sprang up.
“Yes, sir? That you, sir? Nothing the matter, I hope, sir?”
In the moonlight Preston and Yootha Hagerston could be seen
standing together on the bank.
“Are you alone, Tom?” Preston asked. His voice had a curious
timbre.
“Yes, sir. Doctor Johnson came to dinner, sir, but as you had not
returned by nine o’clock I gave him dinner alone, sir.”
“You did quite right.”
After speaking a few words under his breath to Yootha, Preston
came aboard alone, leaving her standing on the bank.
“Tom,” he said in a low tone; “Miss Hagerston is in rather an
embarrassing position. Things have happened which have prevented
her returning to town with Mrs. Hartsilver, who was to have met her
after leaving her friends, and there isn’t a bed to be had anywhere,
and of course the last train to London has gone. There is nothing for
it but for Miss Hagerston to sleep here, but nobody must know about
it, you understand. Now, what can we arrange?”
Tom rubbed his chin. Then suddenly he looked up.
 “I can sleep on deck, sir, in a deck-chair; very nice on a night like
this. Then if you would sleep in my quarters, Miss Hagerston could
have your quarters and be completely cut off, sir.”
Preston reflected.
“That seems the only solution,” he said at last. “But, as I say—​
nobody must know.”
“Nobody shall know, sir.”
“Right.”
He turned, and called to Yootha to come aboard. Then he told her
of the arrangement.
She was pale, and looked greatly worried. There were dark marks
under her eyes, and a casual acquaintance who had met her in the
afternoon would hardly have believed her now to be the same
woman. She was silent and distraite.
“To-night’s adventure seems like a horrid nightmare,” she
exclaimed a little later, suddenly gripping Preston’s arm. “What is it
makes people so horrible, Charlie? All to-day we were so happy, and
now—​—”
She stopped abruptly, and a sob choked her. Preston put his arms
about her, kissing her at first gently, then passionately, on the lips.
“My little girl mustn’t fret,” he murmured. “I know it is all dreadful,
but it will pass. We think now there is no way of escape, because we
can see none, but we shall find a way. My darling must leave
everything to me and place implicit confidence in me.”
But though he spoke thus his heart was heavy. And on the top of it
all here was Yootha alone with him in his house-boat for the night.
True, nobody need know, but the risk of discovery existed, and so
long as it existed there was danger, especially in view of his and
Yootha’s experience during the past few hours. Blackmailers he had
for years looked upon with loathing, and always he had told himself
that should he by any extraordinary mishap ever render himself open
to blackmail he would then and there face the music, attack his