MemoNeet-NCERT Line By Line-Brahmastra Test Series

ANSWER KEY

1- 2 41- 4 81- 3 121- 2 161- 1

2- 2 42- 3 82- 3 122- 4 162- 1
3- 4 43- 1 83- 3 123- 3 163- 3
4- 4 44- 3 84- 3 124- 4 164- 4
5- 1 45- 4 85- 4 125- 1 165- 1
6- 4 46- 4 86- 3 126- 4 166- 2
7- 2 47- 2 87- 4 127- 4 167- 2
8- 1 48- 4 88- 4 128- 2 168- 4
9- 2 49- 4 89- 3 129- 4 169- 1
10- 4 50- 1 90- 2 130- 2 170- 2
11- 4 51- 4 91- 4 131- 2 171- 4
12- 3 52- 1 92- 4 132- 4 172- 2
13- 3 53- 3 93- 4 133- 1 173- 1
14- 4 54- 3 94- 1 134- 3 174- 1
15- 4 55- 1 95- 4 135- 1 175- 1
16- 4 56- 2 96- 1 136- 2 176- 4
17- 1 57- 4 97- 1 137- 1 177- 3
18- 1 58- 4 98- 2 138- 4 178- 1
19- 2 59- 2 99- 4 139- 2 179- 1
20- 4 60- 2 100- 3 140- 1 180- 3
21- 3 61- 2 101- 2 141- 2 181- 4
22- 1 62- 2 102- 3 142- 2 182- 1
23- 4 63- 1 103- 4 143- 2 183- 1
24- 2 64- 4 104- 1 144- 1 184- 1
25- 2 65- 1 105- 1 145- 4 185- 2

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

26- 4 66- 4 106- 1 146- 4 186- 1

27- 1 67- 4 107- 1 147- 4 187- 1
28- 3 68- 2 108- 2 148- 3 188- 1
29- 2 69- 4 109- 2 149- 4 189- 3
30- 1 70- 4 110- 2 150- 4 190- 3
31- 3 71- 4 111- 4 151- 3 191- 4
32- 1 72- 2 112- 1 152- 3 192- 2
33- 3 73- 2 113- 4 153- 4 193- 1
34- 3 74- 4 114- 3 154- 3 194- 1
35- 4 75- 4 115- 1 155- 1 195- 2
36- 2 76- 4 116- 4 156- 4 196- 2
37- 1 77- 1 117- 1 157- 4 197- 4
38- 4 78- 1 118- 4 158- 4 198- 2
39- 3 79- 3 119- 4 159- 4 199- 2
40- 4 80- 1 120- 1 160- 4 200- 1

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

PHYSICS Surface energy of bubble = 2 ×

SECTION-A change in surface area × surface
1. (2) tension
Radius of gyration of a solid sphere, = 8πr2×T = 8 × 3.142 × 4 × 10-4 ×
MKs2 =
2
MR2 3 × 10-2 J = 3.01 × 10-4 J.
5

2
(Mechanical properties of
Ks = R
5 fluids, Surface tension)
Radius of gyration of hollow sphere, 4. (4)
2 2 2
MK H = 3
MR R = 22 × 103 ± 5%
2 First band = Red
KH = 3
R
2nd band = Red
*In actual neet paper the answer
3rd band = Orange (Multiplier)
was incorrect so bonus was given
4th band = Gold (Tolerance)
to all who attempted
(Current electricity, Resistance
(System of particles and
bands)
rotational motion)
5. (1)
2. (2)
For resonance frequency
Incident energy = 2.20 eV
XL = Xc
If (work function) ϕ < 2.20 eV 1
⇒ωL =
electron will emit. ω𝐶
1 1
ϕ > 2.20 eV No electron emission ω= = =
𝐿𝐶 −3
10 × 10 × 1 × 10
−6

Only caesium will emit electron. 1

= 104 rad/s
(Dual nature of matter and
−8
10
4
radiation, Einstein’s ω
f = ( 2π ) =
10
= 1.59 kHz.
2π
photoelectric equation) (Alternating current,
3. (4) resonance frequency)
According to question, surface 6. (4)
-1
tension = T = 0.03 Nm 𝐸
As c = 𝐵
Radius of soap bubble = r = 2cm =
Here, E is the amplitude of electric
2 × 10-2
field and B is the amplitude of
magnetic field, c is the speed of

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

𝐸 48
light. So, B = = = 16 ×
𝐶 3×10
8
through a closed surface. If ∮𝐸.𝑑𝑆 =
-8 -7
10 = 1.6 × 10 T. 𝑠

0, then it signifies that the number

(Electromagnetic waves and its
of electric flux lines entering the
characteristics)
surface must be equal to the
7. (2)
number of flux lines leaving the
Photovoltaic devices can convert
surface,
optical radiation into electricity.
(Electric charges and fields,
The basic example of such a device
Gauss’s Law)
is solar photovoltaic system which
10. (4)
converts solar energy directly into
No current through ‘G’
electrical energy.
So, potential difference across R is
Zener diode is heavily doped p-n
2V,
junction diode operating in reverse
8
biased condition in breakdown So, current i = 400
A
2
region. Now Resistance (R) = ( 8 ×400) =
(Semiconductor electronics, 100 Ω.
devices) (Current Electricity) (Basic
8. (1) concept)
As the factors controlling 11. (4)
temperature and voltage supply are Capacitive reactance = XC =
1
ω𝐶
beyond prediction and control so
(say)
the error occurred due to
on decreasing the operating
unpredictable fluctuations of
frequency ω reduces
temperature and voltage would be
As Xc is inversely proportional to
random errors.
ω the value of Xc increase
(Units and measurements)
∴ IC = ID (displacement current)
(Theoretical) 𝑉𝑂
9. (2) = 𝑋𝐶

Thus, as XC increases, displacement

According to Gauss’s law, ∮𝐸.𝑑𝑆
𝑠 current decreases.
represents total electric flux passing

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

(Alternating current, (∆ρ/ρ)×100 = (∆M/M)×100 + 2×(∆

displacement current) r/r)×100+(∆L/L)×100
12. (3) ⇒
0.002 0.001
×100 + 2× 0.3 ×100 +
0.4
eV = Energy of electron 0.02
5
×100 = 0.5 + 0.67 + 0.4 =
for minimum wavelength, maximum
1.57% or 1.6%.
loss of energy
ℎ𝑐
(Units and measurement, error
eV = λ in measurement)
1
Thus, λα 𝑉
. 16. (4)
(Atoms) (Conceptual) As angular separation of fringes ∆θ
13. (3) =
λ
𝑑
Venturi-meter is a device used to So, angular separation does not
measure the flow speed of depend on the distance between
incompressible fluid, It works on screen and plane. Thus, statement I
Bernoulli's principle. is correct.
(Mechanical properties of As, θαλ
fluids) (Theoretical) If a monochromatic source is
14. (4) replaced by another
Capacitor in parallel removes the ac monochromatic source of larger
ripple from the rectified output. wavelength, then angular separation
(Semiconductor electronics) of fringes increases. Hence,
(Theoretical) statement II is incorrect.
15. (4) (Wave optics, Young’s double
We have mass M = (0.4 ± 0.002) g, slit experiment)
radius R = (0.3 ± 0.001) mm, length 17. (1)
L = (5 ± 0.02) cm Potential energy stored in the
Now, we know that density of the 1
spring = 2
kx2
2
wire is calculated as ρ = (M)/(πr L) 1
Now k(2)2 = U
Maximum percentage error in the 2
2𝑈 𝑈
measurement of density of wire is So, k = 4
= 2
found as; When x = 8 cm, let potential
energy = U’

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

=
1
×
𝑈
(8)2 = 16U 20. (4)
2 2

(Work, energy and power) Initial velocity of the football player

(Basic concept) = -v𝑗

18. (1) Final velocity of the football player
Speed of light in air is = v𝑖
𝑥
C= 𝑡1

Speed of light in another denser

medium
10𝑥
C2 = 𝑡2
𝐶
Now refractive index μ = 𝐶2
=

𝑥 𝑡 𝑡2
𝑡1
× 10𝑥
= 10𝑡1
So, the change in velocity = v 𝑖 - (-v
Since for total internal reflection,
10𝑡1
𝑗 ) = v( 𝑖 + 𝑗 )
1
sinic = =
μ 𝑡2 Momentum gain is along 𝑖 + 𝑗
−1 10𝑡
Critical angle ic = 𝑠𝑖𝑛 ( 𝑡 1 ). So, force experienced is along 𝑖 + 𝑗
2
That is the North-East direction.
(Ray optics and optical
(Laws of motion, Conservation
instruments, refraction)
of momentum)
19. (2)
21. (3)
According to question,
The circuit can be redrawn as an
VS = 12 V
equivalent circuit given below:
Now, for a transformer
𝑖𝑝 𝑉𝑠 𝑁𝑝
𝑖𝑠
= 𝑉𝑝
= 𝑁𝑠
- (a)

iS = 60/12 = 5 A
Putting this in equation a and VP =
220 V, we get,
𝑖𝑝 12 3
= = = 0.27 A.
5 220 11
Now, according to Ohm’s Law,
(Alternating current,
Transformer)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

V = iR {where V is the voltage, i is equal to the number of field lines

the current and R is the resistance
entering the surface or, ∮𝐵.𝑑𝐴 = 0.
in the circuit} 𝑆
5 = i × 10 (Magnetism and matter,
⇒i=
5
= 0.5 A from B to A Gauss’s law in magnetism)
10

through E. 25. (2)

(Current electricity, Ohm’s In the above figure, two 3 μF are in
law) parallel,
22. (1) ⇒ Ceq = 3 + 3 = 6 μF
The angular acceleration direction Now, this will be in series with the
is given along angular velocity or 3 μF capacitor,
opposite to angular velocity
depending upon whether angular
velocity magnitude is increasing or 1 1
So, Cfinal = + 6 = 2 μF.
decreasing and this direction 3

(Electrostatics potential and

remains along the axis of circular
capacitance, arrangement of
motion.
capacitors)
(Motion in a plane)
26. (4)
(Conceptual)
Time taken for vehicle to cover first
23. (4)
𝑠/2 𝑠
Maximum height attained by the half, t1 = 𝑣
= 2𝑣
2 2
𝑢 𝑠𝑖𝑛 θ
2 2
(280) 𝑠𝑖𝑛 30
0
Time taken by vehicle to cover
bullet: hmax = 2𝑔
= 2×9.8 𝑠/2 𝑠
second half, t2 = =
= 1000 m. 2𝑣 4𝑣

(Motion in a plane) (Basic Therefore, Average speed = vavg =

𝑇𝑜𝑡𝑎𝑙 𝑑𝑖𝑠𝑡𝑎𝑛𝑐𝑒 𝑐𝑜𝑣𝑒𝑟𝑒𝑑 𝑠/2+𝑠/2
concept) 𝑡𝑜𝑡𝑎𝑙 𝑡𝑖𝑚𝑒 𝑡𝑎𝑘𝑒𝑛
= 𝑡1+𝑡2
=
24. (2) 𝑠 4𝑣
𝑠/2𝑣+𝑠/4𝑣
= 3
.
Net magnetic flux through a closed
(Motion in a straight line,
surface is zero because the number
average speed)
of field lines leaving the surface are
27. (1)
As T1/2 = 20 minutes,

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

According to question,
𝑁
=
1
= Magnetic energy stored in an
𝑁𝑂 16
1
1 1/T1/2 inductor = LI2
( 2
) 2

Here, L is the inductance and I is

t = 4T1/2 = 20 × 4 = 80 minutes.
the current
(Nuclei, half life) −6 2
1
28. (3) = 2
× 4 × 10 × (2) = 8 μJ.

Initial temperature of gas, Ti = (Electromagnetic induction)

-50oC (Basic concept)
= -50+273 = 223 K 31. (3)
We know that vrms ∝ 𝑇 Longitudinal stress = F/A = T/A =
𝑊
As vrms is increased by 3 times, Weight/Area = 𝐴
.
So, (vrms)f = 4(vrms)initial (Mechanical properties of solid,
= Tf = 16 Ti Longitudinal stress)
= 16 × 223 = 3568 K 32. (1)
o
To convert in C, 3568-273 = The dipole moment and electric
3295oC field have an angle of 300 between
(Kinetic theory of gases, RMS each other,
velocity)
29. (2)
as efficiency of carnot engine = η =
𝑇𝑠𝑖𝑛𝑘
1- 𝑇𝑠𝑜𝑢𝑟𝑐𝑒
= 0.5 (Given)
𝑇𝑠𝑖𝑛𝑘
So, 0.5 = Torque = τ = 𝑃×𝐸
𝑇𝑠𝑜𝑢𝑟𝑐𝑒
1
Where P is the dipole moment and
⇒Tsink = ×(327+273)K
2 E is the electric field
1
= 2
×600 = 300K |τ| = PESinθ
Or 300-273 = 27°C {as K = °C + ⇒ 4 = q × 2a × E sin 30o {2a is the
273} length of the dipole}
(Thermodynamics, Carnot’s Charge (q) = −2
4
5 1
=2
(2×10 )×2×10 × 2
engine)
× 10-3 C = 2mC.
30. (1)
(Electric charges and fields,
Electric dipole)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

33. (3)
In hydrogen spectrum,
1 1 1
λ
= R( 2
− 2
)
𝑛2 𝑛1

For shortest wavelength in the Let the gravitational field is zero at

Balmer series, a distance x from the mass m.
n1 = 2, n2 = ∞ 𝐺𝑚 𝐺9𝑚
2 = 2
1 1 1 𝑥 (𝑅−𝑥)
So, = R( − )
λ 2
2 ∞
2
⇒R - x = 3x or x = R/4
⇒λ =
4 Now, Gravitational potential at R/4
𝑅
is:
Now for the shortest wavelength of
𝐺𝑚 𝐺9𝑚 4𝐺𝑚 12𝐺𝑚
Brackett series, n1 = 4, n2 = ∞ =- 𝑅 - 3𝑅 =- 𝑅
- 𝑅
=-
4 4
1 1 1
λ𝐵
= R( 2
− 2
) 16𝐺𝑚
.
4 ∞ 𝑅

16 (Gravitation, Gravitational
Thus, λB = = 4λ.
𝑅
potential)
(Atoms, Hydrogen spectra)
SECTION-B
34. (3)
36. (2)
Fundamental harmonic frequency
Using work energy theorem,
open pipe
Kf - Ki = W
𝑣
= = fo 1 𝑢 1
2𝐿 = 2
m( 3 )2 - 2
mu2 = -FR × 24
Fundamental harmonic frequency of 1
Also, 0 - mu2 = -FR × d
closed pipe 2

𝑣 Now, we divide both equations,

= 4𝐿
= fc 1 2
𝑚𝑢 𝑑
𝑣 2
2 = 24
So, the required ratio = fo/fc = =
2𝐿 1 8
2
𝑚𝑢 × 9
𝑣
4𝐿 9
d = 24 × = 27 cm.
2:1. 8

(Waves) (Basic concept) (Work, energy and power)

35. (4) (Conceptual)

The given information is shown 37. (1)

below: Radius of innermost orbit of

H-atom
ro = 5.3 × 10-11 m

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

So, radius of third allowed orbit of In terms of series combination Req

H-atom, (equivalent) = R/10
r3 = ron2 = ro(3)2 = 9ro So, IP =
10𝐸
𝑅
𝑜
= 9×5.3 × 10-11 = 4.77 𝐴 As, IP = n × IS
(Atoms) (Basic concept) ⇒
10𝐸
=n×
𝐸
𝑅 10𝑅
38. (4)
⇒ n = 100.
(Current electricity,
Combination of resistors)
40. (4)
Let height of bridge = h
Displacement of ball, S = –h
Using newton’s equation of motion
As N = mg for free fall,
And f = ma S = ut + (½)at2
So, if f ≤ friction force then only car -h = 4 × 4 + (½)(-10)(4)2 {a = g =
will remain stationary 9.8 m/s2}
f ≤ µN So, -h = 16 - 80
I.e., a≤µg h = 64 m.
-2
⇒ a≤1.5 ms (Motion in a straight line, free
-2
Or amax = 1.5 ms . fall)
(Motion in a straight line) 41. (4)
(Conceptual) as angular frequency ω = 2πf
39. (3) Here, f is the frequency = 50 Hz
When 10 resistors each of So, ω = 2π×50 = 100π
resistance R is connected in series, Now, impedance of a L-C-R circuit
then equivalent resistance, Rt = is found as: Z =
R+R+R+.... 10 times 2 2
𝑅 + (𝑋𝐿 − 𝑋𝐶)
= 10 R
Now, current drawn from battery = = 10
2
+ (ω𝐿 −
1 2
)
ω𝐶
𝐸
IS = 10𝑅 50 −3 1 2
100 + (100 × π
× 10 − 10
3
−6
)
100π× π
×10

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

2
= 100 + (5 − 10)
= Z = 5 5Ω.
(Alternating current) (Basic
concept)
42. (3)
Time period of satellite T = 2π
𝑅
3 y=
𝐺𝑀 =A+B
Here, M is the mass of the earth
and R is radius of earth,
3
𝑅
= 2π 4 3
𝐺𝑑 3 π𝑅

3π
⇒T= 𝐺𝑑
3π
So, 𝐺𝑑
= T2 (Semiconductor electronics,
(Gravitation, Motion of logic gates)
satellite) 45. (4)
43. (1) The magnetic field at P point would
Focal length of convex lens = fconvex be due to upper wire, semi-circle
= +f wire and lower wire,
Focal length of concave lens = fconcave
𝐵P = 𝐵upper-wire⊗ + 𝐵semi-circle +𝐵
= -f
lower-wire⊗
When both lenses are in contact µ𝑖 µ𝑜𝑖 µ𝑜𝑖
= - 4π𝑅
𝑜
+ -
then equivalent focal length (F)is: 4𝑅 4π𝑅
µ𝑜𝑖 2
1
𝐹
=
1
𝑓𝑐𝑜𝑛𝑣𝑒𝑥
+
1
𝑓𝑐𝑜𝑛𝑐𝑎𝑣𝑒
=
1
𝑓
-
1
𝑓
=0 = 4𝑅
[1- π ] pointing away from the

So, F = ∞. page.
(Ray optics and optical (Moving charges and
instruments, Lenses) magnetism) (Conceptual)
44. (3-c) 46. (4)
The output of the logic circuit is: R = Ro(1 + α∆𝑇)
Where Ro is the resistance at 0oC
and α is the temperature coefficient

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

and ∆𝑇 is the change in (Ray optics and optical

temperature instruments, Lens maker’s
⇒ 6.8 = 2(1 + α(80 − 0) formula)
⇒α=
3.4−1
= 0.03 = 3 × 10-2 oC-1 49. (4)
80

(Current electricity) (Basic Magnetic force on a wire is the

concept) cross product of Length of wire and

47. (2) magnetic field B multiplied by

The electric potential at P is due to current I,

+q and -q charges, |𝐹| = | I(𝐿×𝐵) |

So, VP = Vq + V-q = | I[L 𝑖 × (2 𝑖 +3 𝑗 -4𝑘)] |
=(
𝐾𝑞
+
−𝐾𝑞
)×102 = 5IL.
5−3 5+3
𝑘𝑞 𝑘𝑞 (Moving charges and
=( 2
− 8
)×102
magnetism, Magnetic force on
= (3/8)Kq×102
charged particle in magnetic
(Electrostatics potential and
field)
capacitance, Electrostatic
50. (1)
potential)
From x-t graph,
48. (4)
Amplitude (A) = 1m, Time period =
For a plano-convex lens, the focal
8 sec
length is calculated as: 2π π
1 1 1 Angular frequency = ω = =
𝑓
= (µ-1)( ∞
- )
𝑅
𝑇 4

Now, at t = 2, x = 1
So, for lens L1, Acceleration a = -ω2x
1 1 1 −3
= (1. 6-1)( - )= π
2
π
2
𝑓1 ∞ 20 100 ⇒ a = - 16 ×1 = - 16 ms-2
For lens L2, (Oscillations, Simple harmonic
1
𝑓2
= (1.5-1)( 20 - −20 ) =
1 1 1
20
motion)
CHEMISTRY
Now, focal length F of the
SECTION-A
combination is,
51. (2)
1 1 1 1 −3 1 3
𝐹
= 𝑓1
+ 𝑓2
+ 𝑓3
= 100
+ 20
- 100
−1 The stability of Cu2+(aq) is more than
= 100 Cu+(aq) is due to the much more
Or F = -100 cm. negative ΔhydH° of Cu2+(aq) than

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

Cu+(aq), which more than (States of Matter)

compensates for second ionization
enthalpy of Cu.
2+
ΔhydH°of Cu (aq) = –2121 kJ mol
54. (3)
● Few reactions can have zero
–1
activation energy for example

ΔHo1 of Cu = +745 kJ mol–1 radical reactions.

● Activation energy is defined
o –1
ΔH of Cu = +1960 kJ mol
2
as the minimum amount of
(The d-and f-Block Elements)
52. ( 3) extra energy absorbed by

Combination of N2 and H2 to form NH3 in reactants to achieve threshold

presence of finely divided Fe is an example energy.
of heterogeneous catalysis.
(Chemical Kinetics)
55. (1)

Other examples of homogeneous catalysis.
(Surface Chemistry)
In case, nitrogen and sulfur both are
present in organic compounds,
sodium thiocyanate is formed. It gives
blood red color and no Prussian blue
since there are no free cyanide ions.

53. (3) Na + C + N + S ——→ NaSCN

According to Boyle’s law
Fe3+ + SCN– ——→[Fe(SCN)]2+ (Blood Red)
PV=nRT
P=nRT(1/V) (Organic Chemistry-Some Basic
P versus 1/V gives a straight line graph with Principles and Techniques)
slope nRT
56. (2)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

● Graphite is very soft and

slippery. Hence, it is used as a
dry lubricant in machines
running at high temperature.
(The p-Block Elements)
59. (2)
➔ All enzymes that utilize ATP in
(Haloalkanes and Haloarenes)
phosphate transfer require Mg as
57. (4)
the cofactor.
➔ Bone in the human body is not
Rate (r) = k[A]2[B]
an inert and unchanging
When concentration of A is tripled tripled
[A’] =[3A] substance but is continuously
New rate r’ = k[A’]2[B] = k[3A]2[B] = being solubilised and
9k[A]2[B]
redeposited.
r’ =9r
➔ Ca plays an important role in
(Chemical Kinetics)
58. ( 4) neuromuscular function,

● Coke is largely used as a reducing
agent in metallurgy.
● In diamond, each carbon atom
undergoes sp3 hybridisation and
linked to four other carbon atoms
by using hybridized orbitals in
tetrahedral fashion
● Buckminsterfullerene contains
interneuronal transmission,
cell membrane integrity and
blood coagulation.
➔ The daily requirement of Mg
and Ca in the human body is
estimated to be 200 - 300 mg
(0.2 - 0.3 g).

six membered and five (The s-Block Elements)

membered rings and hence is 60. ( 2)
a cage-like molecule.

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

Number of atoms of element B = N As we move down the group, due to poor

Number of atoms of element A =⅓ x 2N shielding effect of intervening d and f
The formula of the compound = A ⅔ N B N orbitals, the increased effective nuclear
=A2B3 charge holds ns electrons tightly and
So, x = 2 therefore restricts their participation in
y=3 bonding. So, the relative stability of +1 O.S
x+y=5 increases for heavier elements.
E° for In3+ |In+ 0.16 V
(The Solid State)
E° for Tl3+|Tl + = +1.6 V
61. (2)
Hence, TII is more stable than TII3
(The p-Block Elements)
➔ Complexes in which a metal is bound 64. (4)
to only one kind of donor groups are
Helium is used as a diluent for oxygen in
called as homoleptic complexes
modern diving apparatus because of its
➔ Potassium trioxalatoaluminate very low solubility in blood.
(III) K3[Al(ox)3].It is a Gases diffuse easily with each other.
homoleptic complex (Solutions)
65. (1)
(Coordination Compounds)
Atoms consist of three fundamental
62. ( 2) particles : Electrons, protons and neutrons
For molecules like B2, C2, N2 etc. the The mass of the electron is 9.10939 ×
increasing order of energies of various 10–31 kg
molecular orbitals is
All the isotopes of a given element show
σ1s < σ*1s < σ2s < σ*2s < (π2px = π2py) the same chemical properties.
< σ2pz < (π*2px = π*2py) < σ*2pz
Protons and neutrons present in the
(Chemical Bonding and Molecular nucleus are collectively called nucleons.
Structure)
63. ( 1) Dalton’s atomic theory, regarded the atom
as the ultimate particle of matter .

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

So, the correct statements are B, C, E only

(Structure of Atom) Conductivity = conductance × cell constant

66. (4) k = G G*

Statement A, B, C are correct K =(1/R) G*

G* = k × R = 0.0210 × 60 = 1.26 cm–1

(D) H – H bond dissociation energy
is maximum as compared to a single (Electrochemistry)
70. (4)
bond between two atoms of any
Lewis acids are the one which accepts lone
element. pairs of electrons due to presence of
(E) Hydrogen reduces oxides of metal that vacant orbital in outermost shell.
are less active than iron.
(Hydrogen)
67. ( 4)

α-carbon is sp3 carbon which is right next

to =C=C=
This α-position is known as allylic position
.Hence the above mentioned compound is
allylic halide
(Haloalkanes and Haloarenes)
68. (2)
This reaction is Clemmensen reduction
(The p-Block Elements (Group 15 to
18))
71. (4)
A unit formed by the attachment of a base
to 1’ position of sugar is known as
nucleoside. In nucleosides, the sugar
carbons are numbered as 1’, 2’, 3’, etc. in
order to distinguish these from the bases
(Fig a). When nucleoside is linked to
phosphoric acid at 5 -position of sugar
moiety, we get a nucleotide (Fig b).

(Aldehydes, Ketones and Carboxylic

Acids)
69. (4)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

Fig : Structure of (a) a nucleoside and (b) a Intermolecular forces are the forces
nucleotide
of attraction and repulsion between
(Biomolecules)
interacting molecules. This term does
72. ( 2)
not include covalent bonds as
nm = 2L + 1
covalent bonds hold atoms of a
L=(nm-1)/2
molecule together.
As there are (2L + 1) number of
Hence, dipole - dipole forces, dipole -
permissible values of magnetic quantum
induced dipole forces, hydrogen
number.
bonding and dispersion forces are
(Structure of Atom)
intermolecular forces.
73. (2)
(Chemical Bonding and

Molecular Structure)
AlCl3, BeCl2 and PCl5 do not obey octet
rule. 75. (4)
AlCl3 and BeCl2 both are electron-deficient
On dissolving alkali metal (sodium) in
species having six electrons in the valence
liquid ammonia, a deep blue solution
shell of the central atom whereas PCl5 has is developed due to an ammoniated
ten electrons in the valence shell of electron which absorbs energy in
phosphorus. visible regions of light and imparts
The structures are : blue color. Due to unpaired
electrons, the solution is
paramagnetic.
M + (x + y)NH3 → [M(NH3)x]+ +
[e(NH3)y]–

So, the assertion statement is correct but

the reason is incorrect.

(The s-Block Elements)

76. (4)
(Chemical Bonding and Molecular
Structure) Among isoelectronic monoatomic species,
74. (4) size is inversely proportional to atomic
number.

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

Hence among isoelectronic species Na+,

O2–, N3–, F– (having
nearest noble gas configuration); (Polymers)
Order of size is Na+ < F– < O2– < N3– 80. (1)
N3– has the least atomic number hence
largest size.
(Classification of Elements and
Periodicity in Properties)
77. (1)

The value of rG depends on n value as per

the equation (Aldehydes, Ketones and Carboxylic
ΔrG = –nFEcell Acids)
Where E is the emf of the cell 81. ( 3)
nF is the amount of charge passed.
So, assertion statement is correct This reaction is called soda lime
Ecell is an intensive property while rG is an decarboxylation
extensive thermodynamic property
So, reason is correct but not explaining the
assertion
(Electrochemistry)
Molar mass of CH4 = 16 g/mol Weight of 2
78. ( 1) moles of CH4 = 16 × 2 =32
Veronal is the derivative of Barbituric acid (Hydrocarbons)
and considered as barbiturate.
82. ( 3)
Meprobamate, valium and chlordiazepoxide
are other tranquilizers.
79. (3)

Chloroprene is the monomer of

neoprene.Neoprene is formed by free
radical polymerisation of chloroprene.

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

(Amines) Correct relation between change in

83. (3) enthalpy and change in internal energy is

ΔH = ΔU + ΔngRT
20 g of 20% CaCO3 = 20*20/100 = 4g
CaCO3 (Thermodynamics)
87. (4)
Reaction follows SN1 pathway involving
According to the reaction Benzylic carbocation
100 g of CaCO3 → 44 g of CO2
4g CaCO3 →( 4*44)/100 g of CO2
=1.76 g of CO2
(Some Basic Concepts of Chemistry)
84. ( 3) Mechanism

(Amines) (Alcohols, Phenols and Ethers)

85. (4) 88. ( 4)
The highest oxidation number
corresponding to the group number in
transition metal oxides is attained in Sc2O3
to Mn2O7.
No of σ bonds =11 CrO is basic but Cr2O3 is amphoteric.
No of π bonds =3 Note:
No of lone pair of e-=1
All the transition metals except scandium
(Chemical Bonding and form MO oxides which are ionic (Only for
Molecular Structure) 3d series, this statement is true)
Hence, (A), (C) and (D) are incorrect. But
SECTION-B not given in the options.
86. ( 3) (The d-and f-Block Elements)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
89. (3)
Formation of Conjugated diene in option 3
makes the given reactant most reactive
towards dehydration in acidic conditions.
Mechanism
(Alcohols, Phenols and Ethers)
90. (2)
At 900-1500K (higher temperature range
in the blast furnace)
Reaction which take place:-
C+CO2 → 2CO
FeO +CO → Fe + CO2
CaO +SiO2 →CaSiO3 (Slag formation)
Fe2O3 + CO →2FeO + CO2 [This takes
place at 500-800 K]
(General Principles and Processes of
Isolation of Elements)
91. ( 4)
Tollen’s reagent oxidize aldehydes into
carboxylate ion whereas ketone is not
oxidized by tollen’s reagent
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Ammoniacal silver nitrate solution is
Tollens’ reagent. Tollens’ reagent can be
used to distinguish aldehyde & ketone as
aldehyde upon warming with Tollens’
reagent produces a silver mirror due to
formation of silver metal in alkaline
medium. Aldehyde is oxidized to
corresponding carboxylate anion
(Aldehydes, Ketones and Carboxylic
Acids)
92. (4)
One edge of a cube is common to four
unit cells. Hence One edge center
octahedral void contributes ¼ to one
unit cell.
The total number of octahedral voids in
FCC are four Octahedral voids in FCC =
Edge centers + Body center
The contribution of edge center = 1/4
Fraction of one edge centered octahedral
void in one unit cell of FCC = ¼
(The Solid State)
93. ( 4)
Keq =[A] [B]/[C][D]
Keq = (10 x6 )/ (2x 3)
ΔG0 = –2.303 R T log Keq. =
–2.303(2)(300)(log10)
= –1381.8 cal (⸪ R = 2 cal/mol k)
(Equilibrium)
MemoNeet-NCERT Line By Line-Brahmastra Test Series

94. (1) (Redox Reactions)

Acc. to Huckel rule, A compound/molecule
97. (1 )
is said to be aromatic if it have cyclic
conjugate and [4n + 2]p electron system Eutrophication occurs when the water
Molecule must be sp2 hybridised body becomes overly enriched with
Molecule must be planar nutrients.
Eutrophication leads to decrease in the
level of dissolved oxygen (DO) in water
bodies
All these are aromatic species acc. to
(Environmental Chemistry)
Huckel rule.
98. (2)
(Hydrocarbons)
95. ( 4)

Ethylene diamine, en is bidentate, chelating

ligand.
Chelating ligands increase stability due to
higher entropy stability LiAlH4 used for reduction of carbonyl
(Coordination Compounds) group into alcohol
96. (1 ) H2SO4 used for dehydration of alcohol.
Alkenes react with hydrogen bromide in
Reduction half reaction. the cold. The double bond breaks and a
Cr2 O72- +14H+ + 6e- → 2Cr+3 + 7H2 O hydrogen atom ends up attached to one of
Oxidation half reaction the carbons and a bromine atom to the
2- 2- -
SO + H2O → SO 4 + 2e ]x 3 other. In the case of ethene, bromoethane
Oxygen is balanced by adding water and is formed.
hydrogen is balanced by adding H+ and the
99. (4)
charge is balanced by electrons.
Pumice stone is an example of solid sol. In
Add(eq. (i)) + (3 × eq. (ii))
this type of colloid, the dispersion
Cr2O72- + 3SO32- + 8H+ → 2Cr+3 + 3SO2- + medium is solid and the dispersion phase
4H2O is gas.
a=1 b=3 c=8 (Surface Chemistry)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
100. (3)
(The p-Block Elements (Group 15 to
18))
BIOLOGY
SECTION-A
101. (2)
Ethylene is a plant hormone that
plays a significant role in promoting
internode and petiole elongation,
especially in deep water rice. When
rice plants sense flooding or
submergence, they produce
increased levels of ethylene, which
stimulates elongation growth to
help the plant reach the water's
surface for gas exchange.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Plant growth and
development, Plant Hormone
Ethylene)
102. (3)
Sol. Movement and accumulation of
ions across a membrane against
their concentration gradient can be
explained by active transport. It
uses energy to transport molecules
from lower concentration to a
higher concentration.
Osmosis (option 4) is the
movement of water across a
selectively permeable membrane
from an area of lower solute
concentration to an area of higher
solute concentration. Facilitated
diffusion (option 1) and passive
transport (option 2) involve the
movement of substances down
their concentration gradient
without the input of energy.
(Transport in Plant, Movement
of water, gases and nutrient)
103. (4)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Large, colourful, fragrant flowers
with nectar attract biotic
pollinators (insects), thus, they are
seen in insect pollinated plants.
These characteristics serve to
attract insects such as bees,
butterflies, and beetles, which play a
key role in pollinating the flowers
while seeking nectar as a food
source. Bird-pollinated plants
(option 1) may have brightly
colored flowers but typically lack
strong fragrances, as birds have a
less acute sense of smell.
Bat-pollinated plants (option 2) may
have large, showy flowers, but they
are often nocturnal and produce
strong odors rather than colorful
displays. Wind-pollinated plants
(option 3) usually have
inconspicuous flowers without
colorful petals or strong fragrances,
as they rely on the wind to carry
pollen from one flower to another.
(Sexual reproduction in
flowering plants, Pollination
type)
104. (1)
Sol. In tissue culture experiments,
leaf mesophyll cells are put in a
culture medium to form callus. This
MemoNeet-NCERT Line By Line-Brahmastra Test Series
phenomenon may be called as
dedifferentiation.
Dedifferentiation is a phenomenon
by which the living differentiated
plant cells, that by now have lost
the capacity to divide, can regain
the capacity of division under
certain conditions.
Senescence is the process of aging
or deterioration in cells, tissues, or
whole organisms. Differentiation
is the process by which cells
become specialized into distinct cell
types with specific functions.
(Plant growth and
development,
Dedifferentiation)
105. (1)
Sol. The Convention on Biological
Diversity (CBD), established during
the Earth Summit in Rio de Janeiro
in 1992, urged all nations to adopt
measures for the conservation of
biodiversity and the sustainable use
of its resources.
(Biodiversity and conservation,
Conventions on Biological
Diversity)
106. (1)
Sol. Option (1) is the correct
answer as, during isolation of the
genetic material, purified DNA
MemoNeet-NCERT Line By Line-Brahmastra Test Series

ultimately precipitates out after the

addition of chilled ethanol. RNA is
less soluble in cold ethanol
compared to DNA, histones, and
polysaccharides, allowing it to
separate and form a visible pellet,
leaving the desired DNA intact in
solution.
Option (2) is not the answer as
proteins can be removed by
treatment with proteases. Option (Respiration, Calvin cycle)

(4) is not the answer as RNA can 108. (2)

be removed by treatment with Sol. In the equation where GPP

ribonuclease. represents Gross Primary

(Principles and process of Productivity and NPP stands for

biotechnology, Isolation of Net Primary Productivity, R

DNA) typically represents (2) Respiratory

107. (1) loss. This term accounts for the

Sol. For every CO2 molecule energy lost by plants through

entering the Calvin cycle, 3 respiration during the process of

molecules of ATP and 2 of converting the fixed carbon into

NADPH2 are required. energy for cellular activities.

To make one molecule of glucose, 6 (Ecosystem, productivity and

turns of the cycle are required. decomposition)

Thus, ATP and NADPH2 molecules 109. (2)

required for synthesis of one Option 2 is the correct answer

molecule of Glucose during because the gene gun method

Calvin cycle will be involves the utilization of

6 * 3 ATP = 18 ATP and microparticles made of tungsten or

6 * 2 NADPH = 12 NADPH gold. These materials are chosen

because of their inert nature,
ensuring they do not change the

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

chemical composition of cells. production of cells with smaller

Therefore, they serve as suitable diameters.
carriers for delivering genetic
material into target cells without The reason given (R) explains why
causing any unwanted alterations. late wood has fewer xylary
(Principles and process of elements with narrow vessels. The
biotechnology, Genetic decrease in cambium activity during
engineering) winters leads to the formation of
110. (2) narrower vessels and fewer xylary
Sol. The phenomenon of elements during late wood
pleiotropism refers to (2) A single formation in the subsequent
gene affecting multiple phenotypic summer season.
expressions. This occurs when a
(Anatomy of flowering plants,
single gene has multiple effects on
Cambium activity)
the phenotype of an organism.
112. (1)
These effects can manifest in
Sol. Replication of DNA takes place
various traits or characteristics,
in S-phase of cell cycle in
sometimes seemingly unrelated to
eukaryotes.
each other, due to the complex
G1 phase (Gap 1 phase): In this
interactions within biological
phase, the cell grows in size,
systems.
synthesizes proteins, and carries
(Heredity and variation,
out its normal metabolic functions.
Pleiotropy)
It is a period of preparation for
111. (4)
DNA replication.
Sol. Late wood, also known as
G2 phase (Gap 2 phase): During
autumn wood, typically has fewer
the G2 phase, the cell continues to
xylary elements with narrower
grow and prepare for cell division. It
vessels compared to early wood
synthesizes additional proteins and
(springwood). This is because
organelles necessary for mitosis and
during the summer, when late wood
cytokinesis.
is formed, the cambium activity
decreases, resulting in the

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
M phase (Mitotic phase): The M
phase is where cell division occurs
and consists of two main stages:
mitosis and cytokinesis.
(Cell division, Cell cycle)
113. (4)
Sol. The characteristic specific to family
Fabaceae but not found in Solanaceae or
Liliaceae is (4) Diadelphous and
Dithecous anthers.
In the Fabaceae family, the stamens are
often arranged in two groups
(diadelphous), with nine stamens fused
together to form a tube, while one stamen
is separate. Additionally, the anthers
typically have two locules (dithecous),
meaning they consist of two pollen sacs.
These characteristics are unique to
Fabaceae and distinguish it from Solanaceae
and Liliaceae.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Morphology of flowering plant, floral
diagram)
114. (3)
Sol. In axile placentation, the ovules are
attached to a central column or axis within
the ovary. China rose, Tomato, Petunia and
Lemon show axile placentation.
In free central the ovules are attached
directly to the central axis, and they
develop freely without any partitions.
Dianthus and Primrose show free central
placentation. In marginal placentation, the
placenta is located along the margin or
edge of the ovary. Pea, Lupin and Beans
show marginal placentation.
In parietal placentation, the ovules are
attached to the inner wall or periphery of
the ovary. Cucumber and mustard show
parietal placentation.
MemoNeet-NCERT Line By Line-Brahmastra Test Series

(Morphology of flowering Sol. The tassels on the corn cob represent

plant,Placentation) the stigma and style, which sway in the
wind to capture pollen grains.
115. (1)
Sol. In heterosporous pteridophytes, there
are two types of spores produced:
microspores and megaspores. Selaginella
and Salvinia are heterosporous
pteridophytes.
In homosporous pteridophytes, a single
type of spore is produced.Psilotum,
Lycopodium and Equisetum are
homosporous pteridophytes.

(Sexual reproduction in flowering

plants, Pollination)

(Plant kingdom, Pteridophytes) 118. (4)

116. (4)
Sol. The thickness of the ozone in a
column of air from the ground to the top
of the atmosphere is measured in terms of
Dobson units (DU). Noise is measured in
decibels.
(Environmental issues, Ozone
depletion)
Sol. The predominant stage of the life cycle
of a moss is the gametophyte which
consists of two stages. The first stage is the
protonema stage, which develops directly
from a spore. Capsule of the sporophyte
contains spore which gives rise to
protonema. Thus, reason correctly explains
the assertion.

117. (1)

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Plant kingdom, Life cycle of Mosses)
119. (4)
Sol. Statement I is correct as
measurements reveal that the forces
generated by transpiration can create
pressures sufficient to lift a xylem sized
column of water up to 130 meters high.
Statement II is also correct as transpiration
cools leaf surfaces, sometimes 10 to 15
degrees, by evaporative cooling.
(Transport in plants, Transpiration)
120. (1)
Sol. Gibberellic acid is a plant hormone
that promotes growth and development.
When sprayed on juvenile conifers, it can
hasten the maturity period, leading to early
seed production. Gibberellic acid stimulates
cell elongation and division, which can
accelerate the growth and reproductive
processes in plants.
(Plant growth and development,
Gibberellin)
121. (2)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Alfred Sturtevant used the frequency
of recombination between gene pairs on
the same chromosome as a measure of the
distance between genes and ‘mapped’ their
position on the chromosome.
Sutton and Boveri proposed chromosomal
theory of inheritance which suggests that
genes, which carry hereditary information,
are located on chromosomes and are
transmitted through the process of
chromosome segregation and assortment
during cell division. Henking discovered
X-chromosome.
Thomas Hunt Morgan proved
chromosomal theory of inheritance and
proposed the concept of linkage.
(Heredity and variation,
Chromosome theory of inheritance)
122. (4)
Sol. All the genes that are expressed as
RNA are referred to as Expressed
Sequence Tags (ESTs). Expressed Sequence
Tags (ESTs) are short, single-pass
sequences generated from the expressed
regions of a genome, particularly from the
messenger RNA (mRNA) transcripts.
(Molecular basis of inheritance, DNA
Fingerprinting)
123. (3)
MemoNeet-NCERT Line By Line-Brahmastra Test Series

Sol. Option (3) is the correct answer

because in recombinant DNA technology
the separated DNA fragments can be
visualised only after staining the DNA with
a substance known as ethidium bromide
followed by exposure to U.V. radiation.
Bright orange coloured bands of DNA can
be seen in an ethidium bromide stained gel
exposed to U.V. light.
(Principles and process of
biotechnology, Genetic engineering)
(Respiration, Glycolysis)
124. (4)
Sol. Assertion A states that ATP is used at 125. (1)
two steps in glycolysis, which is true. Sol. The unequivocal proof that DNA is the
genetic material came from the experiment
Reason R provides the correct explanation
of Alfred Hershey and Martha Chase. They
for Assertion A by detailing the two steps
conducted the famous Hershey-Chase
where ATP is used: the conversion of
experiment in 1952, which further
glucose to glucose-6-phosphate and the
supported the idea that DNA, not protein,
conversion of fructose-6-phosphate to
was the genetic material
fructose-1,6-diphosphate.The reason of the
Avery, Macleoid and McCarty gave the
utilisation of ATP is for phosphorylation
biochemical characterisation of
the substrates.
Transforming Principle. They conducted
experiments in 1944 demonstrating that
Both statements are true and Reason R
DNA extracted from a pathogenic strain of
appropriately explains Assertion A.
bacteria could transform a non-pathogenic
strain into a pathogenic one.The
transformation experiments by using
Pneumococcus was conducted by
Frederick Griffith. Wilkins and Franklin
produced X-ray diffraction data of DNA.

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Molecular basis of inheritance,
Search for genetic material and DNA
as genetic material)
126. (4)
Sol. Humus is a dark, organic material that
forms as a result of the decomposition of
plant and animal matter by detritivores and
decomposers.During mineralization, the
microbes break down the humus into
simpler inorganic compounds, releasing
nutrients such as nitrogen, phosphorus, and
potassium back into the soil. The detritus
food chain begins with detritus that is dead
organic matter.
Leaching is a process by which
water-soluble inorganic nutrients, such as
nitrates and phosphates, are washed down
from the topsoil into deeper layers of the
soil or even into groundwater. This can
occur due to excessive rainfall or irrigation,
which carries the nutrients downward.
The saprotrophic bacteria and fungi
breakdown detritus into simpler inorganic
substances by a process called catabolism.
(Ecosystem, Decomposition)
127. (4)
Sol. In PS-I, the reaction centre chlorophyll
a has an absorption peak at 700 nm, while
in PS-II, reaction centre has an absorption
maxima at 680 nm.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Photosynthesis, Pigments involved in
Photosynthesis)
128. (2)
Sol. Synergids are the cells of gametophyte
and hence these are haploid.
The zygote is formed by the fusion of the
other sperm cell with the egg cell in the
embryo sac. The zygote is diploid (2n) and
develops into the embryo, which eventually
forms the new plant.
After fertilization, the primary endosperm
nucleus, which is triploid (3n), is formed by
the fusion of one sperm cell with two polar
nuclei in the central cell of the embryo sac.
This triploid nucleus gives rise to the
endosperm, which provides nourishment
to the developing embryo.
(Sexual reproduction in flowering
plants, Development of endosperm
and embryo)
129. (4)
MemoNeet-NCERT Line By Line-Brahmastra Test Series

Sol. Manganese plays a major role in the
splitting of water to liberate oxygen during
photosynthesis.
Copper is essential for the overall
metabolism in plants. Molybdenum is
included in nitrogen metabolism.
Magnesium activates several enzymes
involved in photosynthesis and respiration.
(Mineral Nutrition, Role of minerals)
doesn't form the complex helices required
to interact with iodine molecules, unlike
starch which does form such helices and
reacts with iodine to produce a blue color.
Therefore, cellulose does not exhibit a blue
color when treated with iodine.Option (1),
(3) and (4) are not correct as cellulose is a
polysaccharide.

130. (2)
Sol. During Anaphase II of meiosis, the
centromeres split, and the sister
chromatids are pulled apart towards
opposite poles of the cell. This is when the
division of the centromere occurs, leading
to the separation of chromatids. During
Metaphase I and II, chromosomes align at (Biomolecules, Polysaccharide)
the equator. During telophase,
chromosomes reach the respective poles. 132. (4)
Sol. Habitat loss and fragmentation is the
most important cause driving animals and
plants to extinction.
Habitat Loss: This refers to the process by
which natural habitats are destroyed or
(Cell Cycle and Cell Division, Stages
significantly altered, leading to a decrease in
of meiosis)
the overall quality and quantity of suitable
habitat for various species. Habitat loss can
131. (2)
occur due to a variety of human activities,
Sol. Option (2) is the correct answer.
including urbanization, deforestation,
Cellulose is a polysaccharide composed of
agriculture, mining, and infrastructure
glucose monomers, and its structure
development.

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
Habitat Fragmentation: Habitat
fragmentation occurs when large,
continuous areas of habitat are divided into
smaller, isolated patches or fragments,
often as a result of human activities such as
road construction, agriculture, and urban
expansion.
(Biodiversity and Conservation, Loss
of biodiversity)
133. (1)
Sol. In eukaryotes there are three major
types of RNA polymerases.
RNA polymerase I transcribes : 5.8S, 18S,
28S rRNAs
RNA polymerase II transcribes : hnRNAs
(precurssor of mRNA)
RNA polymerase III transcribes : tRNAs,
ScRNA, 5S rRNA and snRNA
RNA polymerase III is responsible for
transcribing small, specialized RNAs
including transfer RNA (tRNA), 5S
ribosomal RNA (rRNA), and some small
nuclear RNAs (snRNA) in eukaryotic cells.
These RNAs are essential for various
cellular processes such as protein synthesis
and RNA processing.
(Molecular basis of inheritance,
Transcription)
134. (3)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Endarch and exarch are the terms
often used for describing the position of
primary xylem in the plant body.
Primary xylem is of two types protoxylem
and metaxylem. On the basis of relative
position of protoxylem and metaxylem in
the organ the arrangement of primary
xylem can be endarch or exarch.
Exarch type of primary xylem is seen in
roots. Therefore, Statement I is false and
Statement II is true.
(Anatomy of plants, Xylem)
135. (1)
Sol. The process of recombination occurs
at Pachytene stage of prophase I. This stage
is characterised by the appearance of
recombination nodules. Zygoteneis
characterized by the pairing of homologous
chromosomes, a process known as
synapsis. The synaptonemal complex begins
to disassemble, although chiasmata remain
visible, marking sites of genetic exchange
during diplotene.
MemoNeet-NCERT Line By Line-Brahmastra Test Series

aquatic ecosystems. Therefore, they do not

improve water quality and can have
detrimental effects on fisheries.
The other statements are correct.
(Environmental issues, Water
pollution)

138. (4)

(Cell Cycle and Cell Division, Sol. Chemiosmosis is a process that occurs

Prophase 1) in both cellular respiration and

SECTION-B photosynthesis. It involves the movement

of protons (H⁺ ions) across a membrane,

136. (2) typically the inner mitochondrial

Sol. Assertion is correct but reason is false membrane in cellular respiration or the

as in gymnosperms the pollen grains are thylakoid membrane in photosynthesis.

released from the microsporangium and This movement of protons creates a

they are carried in air currents. They come proton gradient, which is then utilized by

in contact with the opening of the ovules ATP synthase to produce ATP. Therefore, a

borne on megasporophylls. The pollen tube membrane, proton pump (to pump

carrying the male gametes grows towards protons across the membrane), proton

archegonia in the ovules and discharge gradient (formed by the accumulation of

their contents near the mouth of the protons on one side of the membrane),

archegonia. and ATP synthase (to utilize the proton

(Plant kingdom, Gymnosperm) gradient to produce ATP) are all necessary

components for chemiosmosis.

137. (1)
Sol. Algal blooms caused by an excess of
organic matter in water can lead to
eutrophication, which often results in a
decrease in water quality due to the
depletion of oxygen in the water, leading to
fish kills and other negative impacts on

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Respiration, Chemiosmosis)
139. (2)
Sol. M phase or mitosis is the phase where
the actual cell division occurs. Mitosis is
also called equational division.
During G2 phase DNA synthesis stops but
cell synthesis RNA, proteins, etc. for next
phase. Quiescent stage is inactive phase in
which non-dividing cells enters.
G1 phase is the interval between mitosis
and initiation of DNA replication.
Therefore, option (2) is correct.
( Cell cycle and division, Stages of cell
cycle)
140. (1)
Sol. (+, +) Mutualism : Mutualism is a type
of symbiotic relationship in which both
species involved benefit from the
interaction. Both organisms receive some
form of advantage, such as food,
protection, or other resources.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
(+, 0) Commensalism : Commensalism is a
type of symbiotic relationship in which one
species benefits while the other species is
neither harmed nor benefited.
(–, 0) Amensalism : Neither species is
benefitted. One remains unharmed and the
other is harmed.
(+, –) Parasitism : Parasitism is a type of
symbiotic relationship in which one
organism, the parasite, benefits at the
expense of the other organism, the host.
(Organisms and environment,
Population Interaction)
141. (2)
Sol. Statement I refers to Gause's
Competitive Exclusion Principle, which
indeed states that two species competing
for the same resources cannot coexist
indefinitely, and eventually, one will
outcompete the other leading to
elimination.
Statement II is incorrect as in general,
herbivores and plants appear to be more
adversely affected by competition than
carnivores.
(Organisms and environment,
Gause's Competitive Exclusion
Principle)
142. (2)
Sol. Iron activates catalase enzyme.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Zinc plays a crucial role in the production
of auxin.
Boron is essential for both cell elongation
and cell differentiation.
Molybdenum is component of nitrogenase
and nitrate reductase enzyme. Therefore,
option (2) is correct.
(Mineral Nutrition, Role of minerals)
143. (2)
Sol. Klinefelter's syndrome is caused due to
the presence of an additional copy of
X-chromosome resulting into a karyotype
of 47, XXY. Such an individual has overall
masculine development, however, the
feminine development is also expressed.
Such individuals are sterile. Thus,
statement B and E are correct regarding
Klinefelter's syndrome.
Statement A, C and D are incorrect w.r.t.
Klinefelter’s syndrome as they are
associated with Down’s syndrome. Down
syndrome, also known as trisomy 21, is a
genetic condition caused by the presence
of an extra copy of chromosome 21.
(Principles of Inheritance and
Variation, Chromosomal disorders in
humans)
144. (1)
Sol. Lenticels are the lens-shaped openings
permitting the exchange of gases. Lenticels
MemoNeet-NCERT Line By Line-Brahmastra Test Series
are specialized pores or openings in the
bark of woody plants, particularly in stems
and branches, that allow for the exchange
of gases.
Bark refers to periderm and secondary
phloem. Bark is a technical term that
encompasses all tissues exterior to the
vascular cambium in woody plants. This
includes the periderm, which is the outer
protective tissue formed by the cork
cambium (phellogen), as well as the
secondary phloem, which is the tissue
responsible for transporting sugars and
other nutrients produced by the leaves to
other parts of the plant.
Bark that is formed early in the season is
called early or soft bark. Towards the end
of the season late or hard bark is formed.
Phellogen is couple of layers thick
Therefore, only statement A and D are
correct.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Anatomy of plants, Secondary
growth)
145. (4)
Sol. The ribosome, which is the cellular
machinery responsible for protein
synthesis, is composed of both ribosomal
RNA (rRNA) and proteins.The ribosome
consists of structural RNAs and about 80
different proteins.
(Molecular basis of inheritance,
Translation)
146. (4)
Sol. Option (4) is the correct answer to
this question because malonate is a
competitive inhibitor of enzyme succinate
dehydrogenase.
Succinic dehydrogenase is an enzyme
involved in the citric acid cycle (also known
as the Krebs cycle or tricarboxylic acid
cycle) which occurs in the mitochondria of
cells. This enzyme plays a crucial role in the
oxidation of succinate to fumarate, while
simultaneously reducing ubiquinone to
ubiquinol. This step is important for the
generation of energy in the form of
adenosine triphosphate (ATP) through
oxidative phosphorylation.
Inhibition of succinic dehydrogenase by
malonate occurs due to close resemblance
of malonate with substrate succinate in
MemoNeet-NCERT Line By Line-Brahmastra Test Series
structure. Competitive inhibitors are often
used in the control of bacterial pathogens.
(Respiration, TCA cycle)
147. (4)
Sol. Cohesion involves the mutual
attraction among water molecules.
Adhesion involves the attraction of water
molecules to other substances, particularly
polar surfaces.
Surface tension is the property of liquids
resulting from the cohesive forces between
molecules at the surface.
Guttation is the process of water loss from
the leaves of plants in liquid form.
Thus, option (4) is correct.
(Transport in plants, Long distance
transport of water)
148. (3)
Sol. Pyruvate, which is formed by the
glycolytic catabolism of carbohydrates in
the cytosol, after it enters mitochondrial
matrix undergoes oxidative
decarboxylation by a complex set of
reactions catalyzed by pyruvate
dehydrogenase.
The scheme of glycolysis was given by
Gustav Embden, Otto Meyrhof and J.
Parnas, and is often referred to as the EMP
pathway.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
In electron transport system, the energy of
oxidation-reduction is utilized for the
production of proton gradient required for
phosphorylation, thus, this process is also
called oxidative phosphorylation.
The TCA (tricarboxylic acid cycle) starts
with the condensation of acetyl group with
oxaloacetic acid (OAA) and water to yield
citric acid. The reaction is catalysed by the
enzyme citrate synthase. Thus, option (3) is
correct.
(Respiration, TCA cycle and ETS)
149. (4)
Sol. A flower is a modified shoot wherein
the shoot apical meristem changes to floral
meristem. Internodes do not elongate and
the axis gets condensed. The apex
produces different kinds of floral
appendages laterally at the successive
nodes instead of leaves.
Therefore, both A and R are true and R is
correct explanation of A.
(Morphology of plant, Flower)
150. (4)
Sol. The correct answer is option (4)
because
Cutting of DNA at specific location by
restriction enzyme (Step B):
● In this step, the DNA containing the
gene of interest and a vector (often
MemoNeet-NCERT Line By Line-Brahmastra Test Series
a plasmid) are both cut with the
same restriction enzyme.
Restriction enzymes are proteins
that cut DNA at specific
recognition sequences.
Isolation of desired DNA fragment (C)
● Following the enzymatic digestion,
the desired DNA fragment
containing the gene of interest is
isolated from the mixture. This is
often done using techniques such as
gel electrophoresis, which separates
DNA fragments based on size,
allowing the specific fragment to be
identified and extracted.
Amplification of gene of interest using PCR
(Step D):
● Polymerase Chain Reaction (PCR)
is a technique used to amplify
specific DNA sequences.
Insertion of recombinant DNA into the
host cell (Step A):
● Once the gene of interest has been
amplified and isolated, it is inserted
into the host cell. This is typically
achieved by ligating (joining) the
gene of interest into a vector, such
as a plasmid, that has been cut with
the same restriction enzyme.
Hence, transferring the recombinant DNA
into the host, culturing the host cells in a
MemoNeet-NCERT Line By Line-Brahmastra Test Series

medium at large scale and extraction of the technique in India and is not a strategy of
desired product. RCH.
(Principles and process of
biotechnology, Steps involved in (Reproductive health, RCH and
recombinant DNA technology) Amniocentesis)
SECTION-A
153. (4)
151. (3)
Sol. A leopard and a lion in a
Sol. The correct answer is option (3) as
forest/grassland exemplify competition
first menstrual cycle that begins at puberty
where both the species are competing for
is called menarche.
the same resources.
Cyclic menstruation is an indicator of
A cuckoo laying egg in a crow’s nest is
normal reproductive phase and extends
brood parasitism where cuckoo is the
between menarche and menopause.
parasitic bird that lays its egg in the nest of
In primates, cyclical changes during
crow (host bird).
reproduction are called menstrual cycle.
Fungi and root of a higher plant in
(Human reproduction, Menstrual
mycorrhizae exemplify mutualism where
Cycle)
both the species are benefitted. The fungi
help the plant in the absorption of essential
152. (3)
nutrients from the soil while the plant in
Sol. The correct choice is option (3)
turn provides the fungi with energy yielding
because the 'Reproductive and Child
carbohydrates.
Health Care (RCH) programme' primarily
A cattle egret and a cattle in a field
focuses on educating individuals about
exemplify commensalism where one
various aspects related to reproduction
species benefits and the other remains
and providing resources and assistance to
unaffected.
promote a healthy reproductive society.
The egrets always forage close to where
Amniocentesis is a medical procedure cattle are grazing because the cattle, as
utilized to detect certain genetic disorders, they move, stir up and flush out insects
such as Down syndrome and hemophilia, from the vegetation that otherwise might
to assess the viability of the fetus. be difficult for the egrets to find and catch.
Amniocentesis is not a sex determination

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
(Organisms and environment,
Population Interaction)
154. (3)
Sol. Option (3) is the correct answer
because vital capacity is the maximum
volume of air a person can breathe in after
forced expiration.
​ Inspiratory Reserve Volume (IRV):
● Inspiratory reserve volume
is the additional volume of
air that can be inhaled
forcefully after a normal
inhalation.
● It represents the maximum
amount of air that can be
inspired beyond the tidal
volume.
​ Expiratory Reserve Volume (ERV):
● Expiratory reserve volume
is the additional volume of
air that can be exhaled
forcefully after a normal
exhalation.
● It represents the maximum
amount of air that can be
expired beyond the tidal
volume.
​ Tidal Volume (TV):
● Tidal volume is the volume
of air inspired or expired
MemoNeet-NCERT Line By Line-Brahmastra Test Series
during normal breathing,
without any extra effort.
● It represents the typical
amount of air moved in and
out of the lungs with each
breath.
This includes ERV, TV and IRV.
(Respiration in Human, Respiratory
volumes)
155. (1)
Sol. The correct answer is option (1)
because except for hepatitis-B, genital
herpes and HIV infection other STIs are
completely curable if detected early and
treated properly.
Gonorrhoea is caused by the bacterium
Neisseria gonorrhoeae and can be
effectively treated with antibiotics. Early
detection and prompt treatment can lead
to a complete cure of the infection. Other
diseases mentioned are viral diseases.
(Reproductive health, STDs)
156. (4)
Sol. The correct answer is option (4) as
• Cholecystokinin (CCK) acts on
both gall bladder and pancreas and
stimulates the secretion of bile juice and
pancreatic enzymes respectively.
MemoNeet-NCERT Line By Line-Brahmastra Test Series

• GIP inhibits gastric secretion and inflammatory condition of the lung

motility.
• Atrial Natriuretic Factor (ANF) is
released from the atrial wall of our heart.
• Anti-diuretic hormone (ADH) acts
mainly on the kidney and stimulates
resorption of water and electrolytes by the
distal tubules.
(Human physiology, Hormones and
their role)
157. (4)
Sol. Option (4) is the correct answer
because:
(i) Ringworm is caused by
Trichophyton. Ringworm is a common
fungal infection of the skin, hair, or nails,
caused by various species of fungi known as
dermatophytes.
(ii) Filariasis is caused by Wuchereria
bancrofti. Wuchereria bancrofti is one of
the major causative agents of lymphatic
filariasis, a condition characterized by the
obstruction of lymphatic vessels, leading to
swelling and inflammation.
i(iii) Malaria is caused by Plasmodium
species. Malaria is a mosquito-borne
infectious disease caused by protozoan
parasites of the genus Plasmodium.
(iv) Pneumonia is caused by
Haemophilus influenzae. Pneumonia is an
primarily caused by bacteria.
(Human health and disease, Diseases
in humans and their causative
organism)
158. (4)
Sol. The correct answer is option (4) as in
a standard ECG, P-wave represents the
electrical excitation (or depolarisation) of
the atria which leads to the contraction of
both the atria.
• QRS complex represents the
depolarisation of ventricles which initiates
the ventricular contraction.
• T-wave represents the return of the
ventricles from excited to normal state.
(Body fluids and circulation, ECG)
159. (4)
Sol. The human immunodeficiency virus
(HIV) primarily targets and replicates

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series
within T-helper cells (also known as CD4+
T cells or TH cells). The progeny viruses
released into blood attack other helper
lymphocytes.
Therefore, the correct answer is: (4) TH
cells
( Human health and disease, HIV)
160. (4)
Sol. The correct answer is option (4) as
low temperature preserves the enzyme in
a temporarily inactive state whereas high
temperature destroys enzymatic activity
because proteins are denatured by heat.
Competitive inhibitor due to its close
structural similarity with the substrate,
competes with the substrate for the
substrate-binding site of the enzyme.
(Biomolecules, Enzymes)
161. (1)
Sol. Option (1) is the correct answer
because Ligaments are fibrous bands of
tissue that connect bones to other bones,
providing stability and strength to joints.
Ligament is an example of dense regular
connective tissue so Statement I is
incorrect and Cartilage is not composed of
dense regular tissue. Cartilage is a
specialized type of connective tissue that is
characterized by a firm, flexible matrix
containing collagen and elastic fibers. It is
MemoNeet-NCERT Line By Line-Brahmastra Test Series
not classified as dense regular tissue.
Therefore Statement II is also incorrect.
(Structural Organisation in Animals,
Ligaments)
162. (1)
The endomembrane system includes
various membrane-bound organelles
involved in the synthesis, processing, and
transport of proteins and lipids within the
cell. These organelles include the
endoplasmic reticulum (ER), Golgi
complex, lysosomes, and vesicles.
Mitochondria and chloroplasts, on the
other hand, are not part of the
endomembrane system as they are
semi-autonomous organelles involved in
energy production (mitochondria) and
photosynthesis (chloroplasts), respectively.
Peroxisomes, although involved in various
metabolic processes, are also not
considered part of the endomembrane
system.
Therefore, the organelles NOT considered
as part of the endomembrane system are:
A. Mitochondria
C. Chloroplasts
E. Peroxisomes
(Cell, Endomembrane system)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
163. (3)
Sol. The correct answer is option (3) as a
protein is imagined as a line, the left end
represented by the first amino acid and the
right end is represented by the last amino
acid. The first amino acid is also called
N-terminal amino acid. The last amino acid
is called the C-terminal amino acid.
The correct composition of adult human
hemoglobin is two α-globin chains and two
β-globin chains.
(Biomolecules, Protein)
164. (4)
Sol. Down’s syndrome is caused by an
additional copy of chromosome number
21. Its symptoms include–
a. Broad palm with characteristic palm
crease
b. Short statured with small round
head
c. Furrowed tongue and partially open
mouth, etc.
Turner's syndrome is a genetic condition
that occurs in females when one of the X
chromosomes is missing. Klinefelter's
syndrome is a genetic condition in males
that results from an extra X chromosome,
leading to XXY chromosome configuration
instead of the typical XY configuration. The
physical features associated with
MemoNeet-NCERT Line By Line-Brahmastra Test Series
thalassemia primarily involve symptoms
related to anaemia, such as pale skin,
fatigue, and shortness of breath.
(Principles of Inheritance and
Variation, Chromosomal disorders in
humans)
165. (1)
Sol. Increase in the concentration of the
toxicant at successive trophic levels is
called biomagnification.
Large amount of nutrients in water
promotes the growth of algal blooms. Algal
bloom increases fish mortality.
Eutrophication refers to the natural ageing
of a lake by nutrient enrichment of its
water.
(Environmental issues,
Eutrophication)
166. (2)
Sol. Option (2) is the correct answer
because protonephridia or flame cells are
the excretory structures in
platyhelminthes. Nephridia are the tubular
excretory structures of earthworms
(Pheretima) and other annelids. Single
celled organisms like Paramoecium have
contractile vacuoles for excretion. Urecose
glands are present in cockroach.
(Excretory products and their
elimination, Modes of excretion)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
167. (2)
Sol. Electrostatic precipitator is most
widely used in thermal power plants. They
are commonly employed to remove
particulate matter (such as dust and ash)
from the flue gas emitted by combustion
processes in power plants. This helps to
reduce air pollution and comply with
environmental regulations. However,
electrostatic precipitators do not remove
ionizing radiation. Instead, they are
designed to remove solid particles from gas
streams using electrostatic forces.
It can remove over 99 percent particulate
matter present in the exhaust from a
thermal power plant.
(Environmental issues, Electrostatic
precipitator)
168. (4)
Sol. Both Statement I and Statement II are
true.
Explanation:
● Statement I: Vas deferens does
indeed receive a duct from the
seminal vesicle and opens into the
urethra as the ejaculatory duct.
This is part of the male
reproductive system.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
● Statement II: The cavity of the
cervix is indeed called the cervical
canal, and along with the vagina, it
forms the birth canal. This is part of
the female reproductive system.
(Human reproduction, Reproductive
organs of males and females)
169. (1)
Sol. Option (1) is accurate because
hemichordates exhibit bilateral symmetry.
Option (2) is incorrect since coelenterates
demonstrate radial symmetry.
Option (3) is also incorrect as adult
echinoderms typically display radial
symmetry.
Option (4) is likewise incorrect because
ctenophores are known for their radial
symmetry.
( Animal Kingdom, Types of
Symmetry)
170. (2)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Option (2) is the correct answer
because gastric glands contain three main
types of cells:
(i) Mucus neck cells, responsible for
secreting mucus.
(ii) Peptic or chief cells, which secrete the
proenzyme pepsinogen.
(iii) Parietal or oxyntic cells, which secrete
hydrochloric acid (HCl) and intrinsic factor
for the absorption of vitamin B12.
(Digestion and absorption, Alimentary
canal and digestive glands)
171. (4)
Sol. Option (4) is the correct answer
because
(i) Fovea is the point of greatest visual
acuity or resolution.
(ii) Iris is the visible coloured portion
of the eye that regulates diameter of pupil.
(iii) Blind Spot: The blind spot, also
known as the optic disc, is the point on the
retina where the optic nerve exits the eye
and where photoreceptor cells (rods and
cones) are absent. This area lacks
photoreceptor cells because it's where the
optic nerve fibers converge to form the
optic nerve, which carries visual
information from the retina to the brain.
(iv) The sclera is the tough, fibrous,
white outer layer of the eye. It forms the
structural framework of the eyeball and
MemoNeet-NCERT Line By Line-Brahmastra Test Series
helps maintain the shape of the eye.
Composed primarily of dense connective
tissue, the sclera provides protection for
the delicate internal structures of the eye.
(Neural control and coordination,
Eye)
172. (2)
Sol. The complex system of filamentous
protein structures made up of
microtubules, microfilaments, and
intermediate filaments found within the
cytoplasm is known as the cytoskeleton. It
plays various roles including providing
mechanical support, enabling cellular
movement, and maintaining cell shape.
( Cell, Cytoskeleton)
173. (1)
Sol. Option (1) is the correct answer
because the undigested food (faeces)
enters into caecum of the large intestine
through ileo-caecal valve, which prevents
the backflow of the faecal matter.
Option (2) is not the answer because a
muscular sphincter i.e., the
gastro-oesophageal sphincter regulates the
opening of oesophagus into the stomach.
Option (3) is not the answer because
pyloric sphincter regulates the opening in
between stomach and duodenum.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Option (4) is not the answer because the
opening of common hepato-pancreatic
duct is guarded by sphincter of Oddi.
(Digestion and absorption;
Alimentary canal and digestive
glands)
174. (1)
Sol. (i) Vasectomy is indeed a surgical
method of contraception involving the
cutting or blocking of the vas deferens to
prevent the passage of sperm.
(ii) Coitus interruptus, also known as the
withdrawal method, is indeed a natural
method of contraception where ejaculation
is intentionally interrupted before
ejaculation to prevent sperm from entering
the vagina.
(iii) The cervical cap is indeed a barrier
method of contraception, consisting of a
small, thimble-shaped device made of
silicone that fits over the cervix to prevent
sperm from entering the uterus.
(iv) Saheli is indeed an oral method of
contraception, specifically a non-steroidal
pill designed to prevent pregnancy.
( Reproductive health, Birth
control-Need and Methods)
175. (1)
Sol. Option (1) is the correct answer
because cartilaginous joint is present in
MemoNeet-NCERT Line By Line-Brahmastra Test Series
between the adjacent vertebrae in the
vertebral column.
Option (2) is incorrect because
cartilaginous joint is not present between
flat skull bones.
Option (3) is incorrect because fibrous
joint is absent in between the carpal and
metacarpal of thumb.
Option (4) is not the answer because
saddle joint is not present in between
humerus and pectoral girdle.
(Locomotion and Movement, Types
of Joints)
176. (4)
Sol. RNA, being less stable than DNA,
undergoes mutations at a faster rate.
Viruses with RNA genomes have shorter
life spans and mutate more rapidly as a
result. This rapid mutation allows RNA
viruses to evolve quickly, leading to the
emergence of new strains with altered
characteristics, which can impact human
health and necessitate continuous
monitoring and adaptation of control
strategies.
(Molecular basis of inheritance, RNA)
177. (3)
Sol. In prokaryotes, such as bacteria, the
genetic material consists of a single circular
chromosome located in the nucleoid
MemoNeet-NCERT Line By Line-Brahmastra Test Series
region. This DNA molecule, which carries
the organism's genetic information, is
negatively charged due to the phosphate
groups in its backbone. Within the
nucleoid, the negatively charged DNA is
bound by various positively charged
proteins, though it lacks a true
membrane-bound nucleus.
In eukaryotes, the negatively charged DNA
is wrapped around the positively charged
histone octamer to form a structure called
nucleosome. The DNA wraps around the
histone octamer in approximately 1.65
turns, forming a "bead on a string"
structure. This packaging not only
condenses the DNA to fit within the
confines of the nucleus but also provides a
mechanism for regulating gene expression
and accessing the genetic information
stored within the DNA.
(Molecular basis of inheritance, DNA
Packaging)
178. (1)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. The symbol representing mating
between relatives (consanguineous mating)
in human pedigree analysis is
(Heredity and variation, Pedigree
analysis)
179. (1)
Sol. Option (1) is the correct answer
because numbat, spotted cuscus and flying
phalanger are Australian marsupials
exhibiting adaptive radiation. Adaptive
radiation is a process in evolutionary
biology where a single ancestral species
rapidly diversifies into a wide variety of
forms, each adapted to a specific
environment or niche.
Option (2) is incorrect because mole and
flying squirrel are placental mammals.
Option (3) is incorrect because lemur and
wolf are placental mammals. Placental
mammals are a diverse group of mammals
characterized by the presence of a
placenta, a specialized organ that allows for
the exchange of nutrients and waste
between the mother and the developing
offspring.
Option (4) is incorrect because bobcat is a
placental mammal.
( Evolution, Adaptive radiation)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
180. (3)
Sol. Option (3) is correct answer because a
single stranded DNA or RNA tagged with
a radioactive molecule is called a probe and
it helps in the detection of mutated gene.
Option (1), (2) and (4) are not correct
because YAC, BAC, pBR322 are vectors.
YAC (Yeast Artificial Chromosome): YACs
are vectors derived from the DNA of yeast
cells, typically Saccharomyces cerevisiae.
BAC (Bacterial Artificial Chromosome):
BACs are vectors derived from bacterial
plasmids, such as the F plasmid of
Escherichia coli.
pBR322 is one of the earliest and most
well-known plasmid vectors used in
molecular biology.
(Biotechnology: Principles and
Processes, Types of vector)
181. (4)
Sol. The correct answer is option (4) as
• Heroin derived from opium poppy
plant belongs to the category of opioids
and it is a depressant that slows down
body functions.
• Marijuana derived from the
Cannabis plant is known for its effect on
the cardiovascular system of the body.
• Cocaine derived from the coca
plant interferes with the transport of the
neurotransmitter dopamine.
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Morphine which is also derived from the
opium poppy plant is used is a sedative and
painkiller.
(Human Health and Disease, Drugs
and their sources)
182. (1)
Sol. The correct answer is option (1)
because using conventional methods of
diagnosis like serum and urine analysis, etc,
do not help in early diagnosis. Recombinant
DNA technology, Polymerase Chain
Reaction [PCR] and Enzyme Linked
Immuno-Sorbent Assay (ELISA) are some
of the techniques that serve the purpose of
early diagnosis. PCR relies on the repeated
cycles of DNA denaturation, annealing of
primers, and extension by DNA
polymerase to exponentially replicate a
target DNA sequence. ELISA involves the
binding of target proteins or antibodies to
a solid surface (e.g., microplate wells)
followed by the addition of
enzyme-conjugated detection reagents. The
enzymatic reaction generates a measurable
signal, typically colorimetric or fluorescent,
which indicates the presence and quantity
of the target molecule.
(Biotechnology and Its Applications,
ELISA)
183. (1)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Option (1) is the correct answer
because both Assertion and Reason are
true.
Implantation is embedding of the blastocyst
into endometrium of uterus. Correct
explanation of reason is
Corpus luteum secretes a large amount of
progesterone which is essential for
maintenance of endometrium of uterus. In
absence of fertilisation, the corpus luteum
degenerates hence the decrease in the
level of progesterone hormone will cause
disintegration of endometrium leading to
menstruation.
(Human Reproduction, Menstrual
Cycle)
184. (1)
Sol. In a lac operon,
Gene a codes for enzyme transacetylase.
Gene y codes for enzyme permease.
Gene i codes for repressor protein
Gene z codes for enzyme -galactosidase.
(Molecular Basis of Inheritance, Lac
Operon)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
185. (2)
Sol. The accurate response is choice (2)
due to the fact that the Assertion is valid,
given the existence of two distinct types of
nephrons—cortical nephrons and
juxtamedullary nephrons—distinguished by
their locations within the cortex and
medulla. However, the Reason is incorrect,
as the loop of Henle in juxtamedullary
nephrons is notably elongated and extends
deeply into the medulla. Hence, while the
Assertion is correct, the Reason is
inaccurate.
(Excretory Products and Their
Elimination, distinct types of
nephrons)
SECTION-B
186. (1)
Sol. Option (1) is the correct answer
because anal styles are present in male
cockroaches and absent in female
cockroaches.
Option (2), (3) and (4) are not the correct
answers because sclerites, anal cerci and
dark brown body colour are common
features of both male and female
cockroaches.
(Structural Organisation in Animals,
Difference between male and female
cockroaches)
187. (1)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Tetrad formation occurs during the
zygotene stage.
During anaphase, the centromeres divide,
leading to the separation of chromatids.
The terminalization of chiasmata occurs
during diakinesis.
During telophase, the nucleolus, Golgi
complex, and endoplasmic reticulum are
reassembled.
Crossing over occurs between non-sister
chromatids of homologous chromosomes.
(Cell cycle and division, Prophase 1)
188. (1)
Sol. Option (1) is the correct answer
because statements B, C and D are true
statements. ADH facilitates water
reabsorption from DCT of nephron to
prevent diuresis, which causes increase in
blood pressure. ANF which is secreted by
the heart is a vasodilator.
Options (2), (3) and (4) are not correct
because statements A and E are false.
Excessive loss of body fluid from the body
switches on the osmoreceptors.
(Excretory Products and Their
Elimination, Role of hormones in
excretion)
189. (3)
Sol. Cells in the G0 stage remain
metabolically active but no longer
MemoNeet-NCERT Line By Line-Brahmastra Test Series
proliferate unless called on to do so
depending on the requirement of the
organism.
In animal cells, during the S-phase, DNA
replication begins in the nucleus, and the
centriole duplicates in the cytoplasm.
(Cell cycle and division, S-phase)
190. (3)
Sol. Option (3) is the correct answer
because decreasing the productivity of
inbred population is not an advantage of
inbreeding.
Options (1) and (2) are not the answers
because they are the advantages of
inbreeding.
Option (4) is an incorrect statement.
(Strategies for Enhancement in Food
Production, advantage of inbreeding)
191. (4)
Sol. Logistic growth occurs when there is
limited resource availability condition.
Exponential growth occurs when there is
unlimited resource availability condition.
Expanding age pyramid reflects growing
population where the percent individuals of
pre-reproductive age is largest followed by
reproductive and post-reproductive age
groups.
Stable age pyramid shows stable population
where the percent individuals of
MemoNeet-NCERT Line By Line-Brahmastra Test Series
pre-reproductive and reproductive age
group are same.
(Organisms and Populations, Pyramid
of age)
192. (2)
Sol. Option (2) is the correct answer
because thyroid hormones play an
important role in the regulation of basal
metabolic rate, maintenance of water and
electrolyte balance and support the
process of RBCs formation, whereas this
hormone is not involved in regulating
normal rhythm of sleep-wake cycle and
development of immune system.
193. (1)
Sol. Option (1) is correct answer because
presence of hairs, pinna and mammary
glands are unique features of mammals.
Options (2), (3) and (4) are not correct
because, monocondylic skull is present in
reptiles and aves whereas mammals have
dicondylic skull. Tympanic membrane is
present in amphibians also, so it is not
considered as unique feature.
Indirect development is not seen in
mammals.
(Animal Kingdom, Features of
Mammals)
194. (1)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. Option (1) is the correct answer
because statements B and C are only
correct statements while A and D are
incorrect statements.
Muscle bundles are held together by
collagenous connective tissue layer called
fascia. Muscle bundles are called fascicles.
The portion of the myofibril between two
successive ‘Z’ lines is considered as
functional unit of contraction called
sarcomere.
(Locomotion and Movement, Muscle
bundles)
195. (2)
Sol. Option (2) is the answer because,
basophils secrete histamine, serotonin,
heparin etc. and are involved in
inflammatory response.
Option (1) is not the answer because,
basophils are granulocytes.
Option (3) is not the answer because,
neutrophils are the most abundant cells
(60–65 %) of the total WBCs whereas
basophils are least (0.5–1%) abundant of all
WBCs.
Option (4) is not the answer because,
monocytes have a kidney-shaped nucleus.
(Body Fluids and Circulation, Various
Blood cells and their functions)
196. (2)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
Sol. The sequence of coding strand is same
as RNA except thymine at the place of
uracil. Template strand
3’-TAGCTAGCTAGCTAGCTAGCTAGCT
AGC-5’
Coding strand 5’-ATCGATCGATCG
ATCGATCGATCGATCG-3’
Transcription mRNA 5’
AUCGAUCGAUCGAUCGAUCGAUCG
AUCG 3’
(Molecular Basis of Inheritance,
Transcription)
197. (4)
Sol. Option (4) is the correct answer
because limbic system along with
hypothalamus regulate the sexual
behaviour, expression of excitement,
pleasure, rage, fear, etc.
Option (1), (2) and (3) are not correct
because corpora quadrigemina is a part of
the midbrain and consists of four round
swellings. Corpus callosum is a tract of
nerve fibres that connects right and left
cerebral hemispheres. Thalamus is a major
coordinating centre in the forebrain for
sensory and motor signalling. Midbrain,
pons and medulla oblongata together form
the brain stem.
(Neural Control and Coordination,
Parts of Brain)
MemoNeet-NCERT Line By Line-Brahmastra Test Series
198. (2)
Sol. Option (2) is the correct answer
because,
● Areolar connective tissue
comprises fibroblasts (which generate and
discharge fibers), macrophages, and mast
cells.
● The interior lining of bronchioles
consists of ciliated epithelium.
● Blood is a specialized type of
connective tissue.
● The tubular segments of the
nephron are covered by cuboidal
epithelium.
(Structural Organisation in Animals,
Connective Tissue)
199. (2)
Sol. Option (2) is the answer because,
In cockroach, excretion is brought about
by Malpighian tubules, fat body,
nephrocytes and urecose glands.
Urecose glands are present in male
cockroach of some species. They
synthesise uric acid. Nephrocytes are large,
colourless, ovoid, binucleate cells attached
to the dorsal diaphragm in the body cavity.
Fat body accumulates, produces and stores
uric acid.
Phallic gland is the structure of male
reproductive system of cockroach and it
MemoNeet-NCERT Line By Line-Brahmastra Test Series

secretes the outer layer of spermatophore. three germ layers: ectoderm, endoderm,
Collaterial gland is the structure of female and mesoderm and coelomate.
reproductive system of cockroach and it (Animal Kingdom, Features of
secretes the hard egg-case or ootheca Chordates)
around fertilised eggs.
(Structural Organisation in Animals,
cockroach)

200. (1)
Sol. Option (1) is the correct answer
because statements B and C only are
correct. Option (2), (3) and (4) are not
correct. The chordate characters are
presence of closed circulatory system and
presence of pharyngeal gill slits. Chordates
typically exhibit paired pharyngeal gill slits,
which are openings in the pharynx (throat
region) that connect the pharynx to the
outside environment. In many chordates,
these gill slits are involved in respiration,
allowing water to flow through them,
enabling gas exchange (oxygen uptake and
carbon dioxide release). While in some
chordates, such as fish, gill slits are retained
throughout life, in others, they may be
present only during embryonic
development before transforming into
other structures. Nerve cord is dorsal,
hollow and single. Heart is ventral.
Chordates are triploblastic organisms,
meaning their bodies are composed of

MemoNeet-NCERT Line By Line-Brahmastra Test Series

MemoNeet-NCERT Line By Line-Brahmastra Test Series

*Install the MemoNeet Mobile App to scan your OMR sheet

*To get the detailed Test Paper Analysis and solution by Top Subject
Matter Experts, Scan this QR and subscribe to the MemoNeet-Official
YouTube channel.
(Analysis will only be available after the test is done).

MemoNeet-NCERT Line By Line-Brahmastra Test Series