Am. J. Trop. Med. Hyg., 107(2), 2022, pp.

416–419
doi:10.4269/ajtmh.21-0783
Copyright © 2022 The American Society of Tropical Medicine and Hygiene

Molecular Detection of Rickettsia felis in Fleas of Companion Animals in East Texas

Lixin Wang,1 Ammie Rupani,2 Luis A. Grado,1 Luis M. Lopez Salazara,1 LaReyna A. Trinidad,1 Jerry L. Cook,1
and Jeremy Bechelli1*
1
Department of Biological Sciences, College of Science and Engineering Technology, Sam Houston State University, Huntsville, Texas;
2
College of Osteopathic Medicine, Sam Houston State University, Conroe, Texas

Abstract. Flea-borne spotted fever is an emerging insect-borne rickettsial infection caused by Rickettsia felis and
has been identified worldwide. This study sought to explore the prevalence of rickettsiae associated with fleas on com-
panion dogs and cats from Walker and Montgomery Counties in East Texas. Fleas were collected from animals entering
local veterinary clinics for routine checkups. Collected fleas were identified as Ctenocephalides felis or Pulex irritans and
analyzed by polymerase chain reaction for the presence of rickettsiae and subsequent sequencing. An estimation of the
bcMLE (bias-corrected maximum likelihood estimation) of pooled samples was calculated. Four hundred eighty-eight
fleas (comprising C. felis and P. irritans) were collected from 16 cats and 77 dogs. Our results demonstrate R. felis in 21
pools of fleas from dogs (bcMLE 15.28%) and a bcMLE of 7.25% from flea samples collected from cats. Sequence anal-
ysis revealed R. felis as the only Rickettsia that could be amplified in our samples using the rickettsial citrate synthase
gene and subsequent sequencing. In this study, the presence of R. felis in fleas from companion cats and dogs suggests
a potential risk of flea-borne spotted fever in humans who encounter flea-infested animals.

INTRODUCTION spotted fever,7 as well as other infections with clinical mani-

Arthropod-transmitted diseases represent 17% of infec-
tious diseases worldwide (WHO, 2014). Ectoparasite-borne
infections are emerging or reemerging worldwide, likely due
to changes in geographic and host ranges of disease vectors
and the pathogens they transmit.1 Although tick-borne infec-
tions of rickettsiae are common throughout the world,
insect-borne rickettsiae are serious zoonotic pathogens that
should not be ignored. Louse-borne epidemic typhus caused
by Rickettsia prowazekii, flea-borne (murine) endemic typhus
caused by R. typhi, and the more recent flea-borne spotted
fever caused by R. felis have become serious health risks.2
Specifically, flea-borne spotted fever is an emergent global
threat to human health.2,3 Symptoms of R. felis infection
include flulike illness characterized by fever, myalgia, and
headache that may progress to more severe illness, including
fever, rash, and neurological symptoms.4,5
Rickettsia felis was first described in 1990 in the midgut epi-
thelium of cat fleas (Ctenocephalides felis)6 and subsequently
confirmed as a human pathogen in 1991.7 Rickettsia felis has
been found in several arthropods, including ticks, mites, mos-
quitoes, and booklice, but is most frequently associated with
cat fleas (C. felis).8,9 Both serological and molecular analyses
have implicated cat fleas and Virginia opossums (Didelphis vir-
ginians) as primary vectors and hosts of R. felis in Califor-
nia10,11 and Texas.12–14 However, dogs are also considered
mammalian reservoir hosts for R. felis.15,16
Because of the nonselective feeding habits of cat fleas
and the persistent low-level exposure of these parasites to
humans and companion animals, rickettsiosis by R. felis is
likely an underreported flea-borne spotted fever across the
globe, especially in regions where pest management pro-
grams for ectoparasites are not heavily used. Additionally,
the misdiagnosis of R. felis is likely common as the disease
can be confused with murine typhus and Mediterranean
* Address correspondence to Jeremy Bechelli, Department of
Biological Sciences, College of Science and Engineering Technology,
Sam Houston State University, 2000 Ave I, Life Sciences Building,
Huntsville, TX 77341-2116. E-mail: jrb138@shsu.edu
festations of fever, fatigue, headache, and rash.17
The objective of this study is to explore the role of compan-
ion animals (dogs and cats) as a vehicle for rickettsiae-infected
fleas in a small region of East Texas. We hypothesized that
both cats and dogs play a role in the transmission of R. felis by
harboring infected fleas. To investigate this hypothesis, we
determined the prevalence of rickettsiae within fleas collected
from healthy dogs and cats in the East Texas counties of Mont-
gomery and Walker Counties using molecular amplification of
the gltA gene and sequencing of sca5 genes.
MATERIALS AND METHODS
Specimen collection. Fleas were collected from clinically
healthy dogs and cats entering local veterinary clinics in
Walker or Montgomery County, Texas, for routine checkup
appointments including vaccinations and sterilization. The
Sam Houston State University Institutional Animal Care and
Use Committee deemed the study exempt and did not
require committee approval. The location of collection of
each veterinary clinic was recorded, along with companion
animal type (dog or cat). Fleas were collected with a flea
comb as part of the regular physical examination; all col-
lected fleas from one animal were placed in 70% ethanol for
storage and transport.
Flea identification and museum preparation. Fleas were
identified using morphological characters before sequenc-
ing. Taxonomic identifications were determined using keys
provided by Fox.18 Further verification between cat fleas,
Ctenocephalides felis, and dog fleas, Ctenocephalides canis,
used the methods of Me
nier and Beaucournu19 and Linardi
20
and Santos. Voucher specimens were deposited in the
Sam Houston State Natural History Collections.
DNA extraction and amplification. To eliminate exoge-
nous DNA on the outside of the fleas, they were surface
decontaminated by washing them in 5% bleach solution for
5 minutes, then in 70% ethanol for 5 minutes, and finally
washed three times with phosphate-buffered saline. The
washed fleas were pooled by host animal and flea species.
Flea pools were placed in microcentrifuge tubes with 100 mL

416
 RICKETTSIA FELIS IN FLEAS OF COMPANION ANIMALS
of PBS and homogenized using sterile disposable pellet pes-
tles for microcentrifuge tubes (Fisher Scientific, Pittsburg,
PA). DNA was extracted from homogenates using the
E.Z.N.A. Tissue DNA Kit (Omega Bio-tek, Norcross, GA) fol-
lowing the manufacturer’s guidelines.
Initial screening to detect rickettsial DNA in flea samples was
completed using CS-5 and CS-6 primers to amplify a con-
served region of the rickettsial citrate synthase gene by quanti-
tative real-time PCR (qPCR) and fluorogenic probe [5' 6-FAM
d(CATTGTGCCATCCAGCCTACGGT) BHQ-1 3'] (Integrated
DNA Technologies, Coralville, IA).21 qPCR-positive samples
were subsequently screened using conventional PCR to
amplify a portion of the outer membrane protein B gene (sca5)
using primers 120.2788 and 120.3599.22 Positive controls con-
sisted of genomic DNA of R. parkeri, R. montanensis, and
R. typhi. DNA from uninfected Vero cells and sterile molecular
grade water was used as a negative control in all PCRs. The
resulting amplicons for all flea samples and positive controls
were sequenced by Eurofins Genomics (Louisville, KY). The
sca5 sequences were assembled using Geneious Prime (Auck-
land, New Zealand) and searched in the GenBank database.
The resulting sequences were submitted to the GenBank
database.
Data analysis. An estimation of the bias-corrected maxi-
mum likelihood estimation (bcMLE) of the infection rate of
pooled flea samples was performed using the Excel Poole-
dInfRate add-in developed and described by Brad Bigger-
staff.23 The downloadable software is freely available for
Microsoft Excel 2010 (Redmond, WA) (CDC, 2015).
RESULTS
Fleas were collected from 16 cats and 77 dogs. The ani-
mals came from Walker County (13 cats and 63 dogs) and
Montgomery County (3 cats and 14 dogs). A total of 488
fleas were collected from these animals. The median number
of fleas collected per animal was 5 (min–max: 1–17). The
fleas were identified as Ctenocephalides felis and Pulex irri-
tans. Infestations with a single species of flea (Ctenocepha-
lides felis) was identified on 44 dogs (57.14%) and 15 cats
(93.75%), and single-species infestations of P. irritans was
identified on 16 dogs (20.78%) and 0 cats (0%). A mixed
infestation of C. felis and P. irritans was identified on 17
dogs (22.08%) and 1 cat (6.25%).
Cats. The one cat with a mixed species infestation had 0
Rickettsia-positive pools in either species of flea. Eighty-four
C. felis fleas were collected from the other 15 cats with the
median number of 4 (min–max: 1–12). Sequencing the sca5
products demonstrated R. felis as the only rickettsial agent
in all samples (estimated bcMLE 7.25%; 95% confidence
interval: 2.81–15.95%).
Dogs. Of the 77 dog samples in our study, C. felis was
identified on 44 dogs (57.14%), P. irritans was identified on
16 dogs (20.78%), and a mixed infestation of C. felis and
P. irritans was identified on 17 dogs (22.08%). A total of 204
fleas were collected from dogs infested with C. felis or P. irri-
tans and then grouped into 44 pools (Table 1). The median
number of fleas collected per animal was 4 (min–max: 1–11).
The result shows C. felis in 21 pools (bcMLE 15.28%)
(Table 1).
Dogs with P. irritans only. Of the 77 dogs sampled in our
study, 16 (20.78%) were infested with P. irritans. We
417
TABLE 1
Molecular evidence of Rickettsia felis infecting fleas collected
from dogs with single species infestation
No. of pools (total fleas) No. of positive pools bcMLE % (95% CI)
12 (12) 2 16.67 (3.12–44.33)
4 (8) 0 0
2 (6) 1 16.22 (1.10–68.06)
7 (28) 3 12.18 (3.41–31.14)
6 (36) 6 16.66*
2 (14) 1 6.66 (0.47–38.68)
5 (40) 3 9.36 (2.67–26.94)
3 (27) 3 11.11*
3 (33) 2 7.01 (1.48–29.69)
Total: 44 (204) 21 15.28 (9.91–22.82)
bcMLE 5 bias-corrected maximum likelihood estimation (of the infection rate); CI 5
confidence interval.
* When all pools are positive, the likelihood methods for the bcMLE fail. In this case, the
calculation was performed assuming one infected flea per positive pool.
collected a total of 66 P. irritans fleas from these 16 dogs,
with a median of five fleas collected per animal five (min–
max: one–eight). The number of positive pools is 0, and the
calculated infection rate is 0%.
Dogs with both C. felis and P. irritans. Of the 77 dogs
sampled in our study, 17 (22.08%) were infested with both
C. felis and P. irritans (Table 2). We collected a total of 131
fleas with a median number of six (min–max: 4–17).
Sixty-seven fleas were identified as C. felis (bcMLE 14.68%).
The median number of C. felis collected from these dogs was
three (min–max: 1–7). Sixty-four fleas were identified as P. irri-
tans (bcMLE 6.62%). The median number of P. irritans col-
lected from these dogs was three (min–max: 1–12). Thirty-three
(33) pools (35.11%) were qPCR positive for rickettsial DNA by
amplifying a portion of the citrate synthase gene. Conventional
PCR for sca5 successfully amplified 27 pools (28.72%).
Sequences for the sca5 products demonstrated Rickettsia felis
(Accession: MW928537.1, MW934367.1, MW960295.1, and
MW960296.1), and the presence of only one rickettsial agent in
the pools. Ctenocephalides felis positive for R. felis was identi-
fied on 29 dogs (47.54%) and five cats (31.25%), whereas
P. irritans fleas positive for R. felis was identified on four dogs
(12.12%) and zero cats (0%).
DISCUSSION
R. felis, an intracellular Gram-negative bacterium of the
spotted fever group, was first identified 3 decades ago in the
cat flea, Ctenocephalides felis.6 Four years later, R. felis was
first found in Texas as a misdiagnosed case of murine typhus,
caused by Rickettsia typhi. Flea-borne spotted fever caused
by R. felis has become a global challenge due to similarities in
the manifestation of symptoms to other illnesses leading to
misdiagnoses and lack of diagnostic testing. Murine typhus
can be challenging to distinguish from the disease caused by
TABLE 2
Molecular evidence of Rickettsia felis infecting both fleas collected
from dogs with mixed flea infestation
No. of No. of positive
Species pools pools bcMLE % (95% CI)
Ctenocephalides felis 17 8 14.68 (7.40–26.43)
Pulex irritans 17 4 6.62 (2.29–15.11)
bcMLE 5 bias-corrected maximum likelihood estimation (of the infection rate); CI 5
confidence interval.
* When all pools are positive, the likelihood methods for the bcMLE fail.
418 WANG AND OTHERS
R. felis.24 The symptoms may vary in severity and are nonspe-
cific to either disease.25 Furthermore, the differentiation is
difficult due to cross-reactivity to R. felis and R. typhi with
serological testing.26
The flea-borne spotted fever disease has become wide-
spread in sub-Saharan Africa, with 3% to 15% of patients
with nonmalarial fever diagnosed with R. felis flea-borne
spotted fever.2 Fatality has been rarely linked to R. felis in
sub-Saharan Africa, but recent cases in Indonesia, Laos,
Sweden, and Mexico show patients dying of progressive
meningoencephalitis with R. felis present in their cerebrospi-
nal fluid.27 These reports call into question the mortality of
R. felis infections. R. felis.27 The prevalence of the bacteria in
sub-Saharan Africa is a warning sign to areas such as Texas
and California, which have the potential to become the next
location of widespread disease from R. felis.
Texas reports the highest numbers of flea-borne typhus
cases per year.28 Cases were located mainly in the lower Rio
Grande Valley and the Coastal Bend area from the 1940s to
the 2000s but have become more prevalent in Bexar, Travis,
and Harris Counties.28 In a study conducted in Galveston,
TX, on a total of 314 C. felis fleas found on feral cats, 17 of
the 87 pools had rickettsial DNA with R. typhi present in one
pool and R. felis present in four pools.14 The same group in
Galveston County also analyzed rickettsial species in 250
C. felis fleas found on 13 opossums. Of the positive pools,
13 had R. typhi, 11 had R. felis, and three pools were coin-
fected with both species.13 In Corpus Christi, TX, a study of
fleas from opossums and cats found R. typhi and R. felis.12
Due to their similar disease processes and difficulty distin-
guishing, it is prudent to study R. typhi and R. felis together,
especially in the geographic location of Texas.
Our current study collected C. felis and P. irritans from
healthy household cats and dogs in Walker and Montgomery
County in Texas during routine checkup visits. Rickettsia felis
was not detected in dogs only infested with P. irritans but
was detected with the presence of both fleas on the dog,
suggesting the transmission of R. felis from C. felis to P. irri-
tans. In Columbia, a study found P. irritans to have a higher
minimum infection rate of R. felis than C. felis fleas.29 Infec-
tion rate (IR) estimates calculated using the Mosquito Surveil-
lance Software developed by Dr. Brad Biggarstaff,23 have
been used in recent papers studying rickettsial species prev-
alence amongst fleas.13,14 Bias-corrected maximum likeli-
hood estimation (bcMLE) is calculated as the estimate of IR.
Unlike the widely used minimum infection rate (MIR), bcMLE
does not assume that a positive pool contains only one
infected flea. This method is more accurate to use consider-
ing the pervasive nature of these bacterial species in fleas.
Additional studies should investigate the minimum infection
rate comparisons between P. irritans and C. felis in Texas
because C. felis is currently believed to be the primary host of
R. felis. A study of dogs with prolonged rickettsemia discussed
the mammalian transmission of R. felis from infected dogs to
uninfected cat fleas, suggesting that dogs may be a natural
reservoir of R. felis.30 Further investigation is necessary to con-
firm this theory, but cats have not been shown in the literature
to pass rickettsial species to their fleas. In a study conducted
on domesticated cats in California, one of the 17 was found to
carry R. felis, with the presence of R. felis containing cat
fleas.11 Dual infection of R. felis and R. typhi was shown in a
study that fed R. felis–containing cat fleas R. typhi–infected
blood, but infection rates were lower overall.8
It is essential to note the study’s limitations, which may bias
our findings. We focused our analysis on two counties in East
Texas, Montgomery County, and Walker County. This limited
geographic region likely does not represent the entire state of
Texas. Although the animals came from veterinarian offices
and animal shelters, we only collected fleas from healthy ani-
mals. Future studies would benefit from blood collection and
serology for rickettsial diseases and flea collection from ani-
mals showing apparent signs of illness relating to infection.
Our study discusses the presence of R. felis in fleas found
on domesticated animals in Texas with proximity to humans.
R. felis infection has become endemic in many areas within
the 3 decades since it was discovered. This infection should
be approached with the one world, one health lens. “One
world, one health” is a call for an interdisciplinary approach
to science due to the interconnected nature of human
actions, animals, and ecological health.31 Using the One
Health approach, we can reframe the rise of new pathogens
causing human disease as a product of ecological changes
(i.e., deforestation) and animal behavior changes, leading to
a more complete picture of the human–animal–pathogen
relationship.32 Questions remain unanswered about the role
of P. irritans in R. felis spread across the United States. The
widespread prevalence of R. felis and R. typhi indicates a
greater need for research into these pathogens concerning
pathogenicity, identification, and epidemiology to differenti-
ate the two flea-borne bacteria.
Received July 12, 2021. Accepted for publication March 7, 2022.
Published online July 5, 2022.
Acknowledgments: We thank the Sam Houston State University new
faculty startup funds for funding this study and Dr. Rong Fang at the
University of Texas Medical Branch for R. typhi DNA. We also appre-
ciate the veterinary clinics and the Rita B. Huff Humane Society of
Walker County that assisted with sample collection.
Authors’ addresses: Lixin Wang, Luis A. Grado, Luis. M. Lopez Sala-
zara, LaReyna A. Trinidad, Jerry L. Cook, and Jeremy Bechelli,
Department of Biological Sciences, College of Science and Engi-
neering Technology, Sam Houston State University, Huntsville, TX,
E-mails: lxw024@shsu.edu, lag042@shsu.edu, lml060@shsu.edu,
lat042@shsu.edu, bio_jlc@shsu.edu, and jrb138@shsu.edu. Ammie
Rupani, College of Osteopathic Medicine, Sam Houston State
University, Conroe, TX, E-mail: aar105@shsu.edu.
REFERENCES
1. Caminade C, McIntyre KM, Jones AE, 2019. Impact of recent
and future climate change on vector-borne diseases. Ann N Y
Acad Sci 1436: 157–172.
2. Brown LD, Macaluso KR, 2016. Rickettsia felis, an emerging
flea-borne rickettsiosis. Curr Trop Med Rep 3: 27–39.
3. Angelakis E, Mediannikov O, Parola P, Raoult D, 2016. Rickett-
sia felis: the complex journey of an emergent human patho-
gen. Trends Parasitol 32: 554–564.
4. Socolovschi C, Mediannikov O, Sokhna C, Tall A, Diatta G,
Bassene H, Trape JF, Raoult D, 2010. Rickettsia felis-associ-
ated uneruptive fever, Senegal. Emerg Infect Dis 16: 554–564.
5. Maina AN et al., 2012. Rickettsia felis infection in febrile
patients, western Kenya, 2007–2010. Emerg Infect Dis 18:
328–331.
6. Adams JR, Schmidtmann ET, Azad AF, 1990. Infection of colo-
nized cat fleas, Ctenocephalides felis (Bouche), with a Rickett-
sia-like microorganism. Am J Trop Med Hyg 43: 400–409.
 RICKETTSIA FELIS IN FLEAS OF COMPANION ANIMALS
7. Schriefer ME, Sacci JB, Dumler JS, Bullen MG, Azad AF, 1994.
Identification of a novel rickettsial infection in a patient diag-
nosed with murine typhus. J Clin Microbiol 32: 949–954.
8. Reif KE, Macaluso KR, 2009. Ecology of Rickettsia felis: a
review. J Med Entomol 46: 723–736.
9. Danchenko M, Laukaitis HJ, MacAluso KR, 2021. Dynamic
gene expression in salivary glands of the cat flea during Rick-
ettsia felis infection. Pathog Dis 79: ftab020.
10. Williams SG, Sacci JB, Schriefer ME, Andersen EM, Fujioka
KK, Sorvillo FJ, Barr AR, Azad AF, 1992. Typhus and
typhus-like rickettsiae associated with opossums and their
fleas in Los Angeles County, California. J Clin Microbiol 30:
1758–1762.
11. Mullins KE, Maina AN, Krueger L, Jiang J, Cummings R, Drusys
A, Williams G, Dhillon M, Richards AL, 2018. Rickettsial infec-
tions among cats and cat fleas in Riverside County, California.
Am J Trop Med Hyg 99: 291–296.
12. Boostrom A, Beier MS, Macaluso JA, Macaluso KR, Hayes DS,
Radulovic S, Azad AF, 2002. Geographic association of Rick-
ettsia felis-infected opossums with human murine typhus,
Texas. Emerg Infect Dis 8: 549–554.
13. Blanton LS, Idowu BM, Tatsch TN, Henderson JM, Bouyer DH,
Walker DH, 2016. Opossums and cat fleas: new insights in
the ecology of murine typhus in Galveston, Texas. Am J Trop
Med Hyg 95: 457–461.
14. Blanton LS, Vohra RF, Fistein L, Quade B, Walker DH, Bouyer
DH, 2019. Rickettsiae within the fleas of feral cats in Galves-
ton, Texas. Vector Borne Zoonotic Dis 19: 647–651.
15. Richter J, Fournier PE, Petridou J, Ha €ussinger D, Raoult D, 2002.
Rickettsia felis infection acquired in Europe and documented by
polymerase chain reaction. Emerg Infect Dis 8: 207–208.
16. Oteo JA, Portillo A, Santiba
n
~ez S, Blanco JR, Pe
rez-Mart
ınez L,
Ibarra V, 2006. Cluster of cases of human Rickettsia felis infec-
tion from southern Europe (Spain) diagnosed by PCR. J Clin
Microbiol 44: 2669–2671.
17. Raoult D, La Scola B, Enea M, Fournier PE, Roux V, Fenollar F,
Galvao MAM, De Lamballerie X, 2001. A flea-associated Rick-
ettsia pathogenic for humans. Emerg Infect Dis 7: 73–81.
18. Fox I, 1940. Fleas of Eastern North America. Iowa State College
Press.
19. Me
nier K, Beaucournu JC, 1998. Taxonomic study of the genus
Ctenocephalides Stiles & Collins, 1930 (Insecta: Siphonaptera:
Pulicidae) by using aedeagus characters. J Med Entomol 35:
883–890.
419
20. Linardi PM, Santos JLC, 2012. Ctenocephalides felis felis vs.
Ctenocephalides canis (Siphonaptera: Pulicidae): some issues
in correctly identify these species. Rev Bras Parasitol Vet 21:
345–354.
21. Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW,
Pinter A, Popov V, Gennari SM, Walker DH, 2004. Rickettsia
species infecting Amblyomma cooperi ticks from an area in
the state of Sa ~o Paulo, Brazil, where Brazilian spotted fever is
endemic. J Clin Microbiol 42: 90–98.
22. Roux V, Raoult D, 2000. Phylogenetic analysis of members of
the genus Rickettsia using the gene encoding the outer-
membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 50:
1449–1455.
23. Biggerstaff BJ, 2008. Confidence intervals for the difference of
two proportions estimated from pooled samples. J Agric Biol
Environ Stat 13: 478–496.
24. Legendre KP, Macaluso KR, 2017. Rickettsia felis: a review of
transmission mechanisms of an emerging pathogen. Trop
Med Infect Dis 2: 64.
25. Perez C, Hamouda D, Karnath B, 2018. Murine typhus: a
life-threatening presentation of a case in Galveston, Texas.
Am J Case Rep 19: 1503–1506.
26. Teoh YT, Hii SF, Stevenson MA, Graves S, Rees R, Stenos J,
Traub RJ, 2017. Serological evidence of exposure to Rickett-
sia felis and Rickettsia typhi in Australian veterinarians. Parasit
Vectors 10: 129.
27. Mawuntu AHP et al., 2020. Rickettsia felis identified in two fatal
cases of acute meningoencephalitis. PLoS Negl Trop Dis 14:
e00079893.
28. DHSH, 2021. Flea-Borne Typhus Texas Statistics. Available
at: https://dshs.texas.gov/IDCU/disease/murine_typhus/Flea-
borne-Typhus.aspx. Accessed June 24, 2021.
29. Ram
ırez-Herna
ndez A et al., 2013. Molecular detection of Rick-
ettsia felis in different flea species from Caldas, Colombia. Am
J Trop Med Hyg 89: 453–459.
30. Ng-Nguyen D, Hii SF, Hoang MTT, Nguyen VAT, Rees R,
Stenos J, Traub RJ, 2020. Domestic dogs are mammalian res-
ervoirs for the emerging zoonosis flea-borne spotted fever,
caused by Rickettsia felis. Sci Rep 10: 4151.
31. Jørgensen HJ, das Neves C, 2020. COVID-19: one world, one
health. Tidsskr Nor Laegeforen 140: 328–331.
32. Craddock S, Hinchliffe S, 2015. One world, one health? Social
science engagements with the one health agenda. Soc Sci
Med 129: 328–331.