The interaction of RNA G-quadruplexes from the influenza A virus genome with TMPyP4

and BRACO-19 ligands

ed
Maria Nalewaj1, Joanna Sliwiak1, Karolina Zielinska1, Pawel Zmora1, Elzbieta Kierzek1 and
Marta Szabat1,*
1Institute of Bioorganic Chemistry, Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan,

iew
Poland;
* Correspondence: szabat@ibch.poznan.pl (M.S.); Tel.: +48 61 852 85 03

ABSTRACT

Influenza virus is an interesting research subject due to its serious threat to global public

v
health. To date, various structural motifs from the influenza A virus (IAV) genome have been
studied. Recently, RNA G-quadruplexes (G4s) noncanonical structures formed within the G-

re
rich sequences of the IAV genome were reported. These motifs are suggested as promising
antiviral targets, and the study of the G4 binding ligands has attracted increasing research
interest. Therefore, we hypothesized that RNA G4s can play an important role in IAV
replication. In this study, we focused on the RNA G4s-ligand interactions, which have not been
studied so far. Herein, commonly used G4-specific ligands, TMPyP4 and BRACO-19, were
er
selected. First, we performed a reverse transcription stop assay to study the effect of both
ligands on the inhibition of cDNA synthesis. Our results showed that this process was hindered
by both compounds for all wild-type G4 variants. However, the most noticeable effect was
pe
observed for one of them after TMPyP4 addition. We also examined the binding affinity of
TMPyP4 and BRACO-19 to IAV RNA G4s using isothermal titration calorimetry, circular
dichroism, and fluorescence spectroscopy. Some differences in the binding properties of three
selected G4s were found. Finally, the influence of TMPyP4 on replication within the IAV
minireplicon was investigated. Our analysis revealed the significant inhibition of IAV
ot

replication upon ligand addition. Overall, for the first time, we showed that G4-specific ligands
can bind to IAV RNA G4s and suggested that G4s can be potential novel anti-influenza drug
targets.
tn

Keywords

RNA G-quadruplex, influenza A virus, ligand, binding affinity, minireplicon

rin

1 Introduction

Influenza, also known as the flu, is a highly contagious disease that occurs seasonally as
ep

epidemics and occasionally as pandemics. The pandemic potential of the influenza virus is a
result of the high variability of its genome and is correlated with its pathogenicity, replication,
and growth kinetics. It is known that the above processes are controlled by viral RNA secondary
and tertiary structures. Different RNA structural motifs are used at the various stages of the
viral replication cycle, highlighting their fundamental role in influenza virus biology.
Pr

Interestingly, the secondary structure of viral RNA (vRNA), including the one of influenza
A virus (IAV), is highly conserved among different viral strains, which suggests its importance
during RNA replication. Furthermore, it has been shown that G-rich regions are present within
the genome of many viruses, for example, SARS-CoV-2 or HIV-1.1,2 These RNA regions can

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 fold into noncanonical structures called G-quadruplexes (G4s) that are stabilized by Hoogsteen
hydrogen bonds. It is assumed that they can have various important biological functions.

ed
Therefore, the knowledge of the vRNA structure-function relationship is essential and the
research on this topic should be continued.
Very recently, investigations concerning G-quadruplex binders as effective inhibitors of
virus infections were published. For instance, Zou et al. used five G4s ligands Ber, BRACO-
19, 360A, PDS, and NiL to study their interactions with ZIKV RNA G4 structure.3 Obtained

iew
results revealed that PDS shows a high G4 binding affinity and thermal stability, as well as
higher anti-ZIKV activity compared to the other G4s ligands. Another report concerning G-
quadruplexes as therapeutic targets was proposed by Lv and colleagues in 2022.4 The authors
confirmed G4 structure formation within the chikungunya virus (CHIKV) genome using
different biophysical techniques. Importantly, they determined the inhibition of CHIKV
genome replication by BRACO-19 and TMPyP4 ligands showing that these compounds inhibit

v
the production of infectious virions.
To date, a significant number of ligands binding G-quadruplexes have been studied. Some

re
of them are considered potential therapeutic agents.3,5–7 Progress in the design and synthesis of
new G4-interacting compounds allows for testing them as antiviral agents. Although some G4
ligands were identified and investigated (mainly in vitro) as potential inhibitors of viral
replication, there is still a need to study the biological potential of ligands targeting viral G-
quadruplexes. er
Recently, we identified G-rich regions within the IAV A/California/4/2009 (H1N1) genome
and examined their propensity to fold into G4s by various biophysical methods.8 Additionally,
we showed that they are present within segments encoding polymerase complex proteins
indicating their possible role in the virus biology. In the current study, we assessed whether G4-
pe
specific ligands affect the vRNA G-quadruplex formation using reverse transcription stop
assay. Next, we studied the interaction between the viral G4s and selected ligands by isothermal
titration calorimetry (ITC), circular dichroism (CD), and fluorescence spectroscopy. Finally,
we investigated the effect of specific G4 ligands on virus replication using a minireplicon
system.
ot

To sum up, here we reported studies concerning the interaction of RNA G-quaduplexes and
TMPyP4 and BRACO-19 ligands. By analyzing the results of various spectroscopic techniques,
molecular biology, and biological assays, we were able to demonstrate that selected G4-specific
compounds differ in their binding properties. Moreover, our investigation provides useful data
tn

to design G4 stabilizers targeting viral genomes.

2 Results
rin

In our previous studies, we identified 12 potential quadruplex-forming sequences (PQSs)

within the IAV A/California/4/2009 (H1N1) genome and determined their propensity to fold
into RNA G-quadruplex structures.8 By a combination of bioinformatics tools and biophysical
methods, we revealed that several PQS motifs form stable G4s and are located within PB1,
ep

PB2, and HA genome segments. These findings and the fact that RNA G-quadruplexes within
the protein-coding regions may contribute to biological processes encouraged us to investigate
their potential biological function(s). We hypothesize that G-quadruplex structures are formed
in the IAV genome and can regulate viral replication.
Herein, we examined the G-quadruplex formation and its stabilization by G4-specific
Pr

ligands using RT stop assay and ITC method. Additionally, in the limited range, we tested the
influence of the TMPyP4 and the TMPyP2 compounds on viral replication within the IAV
minireplicon system. The G-rich sequence characteristics are summarized in Table 1, whereas

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 the oligomer sequences used in this study and their applications are presented in Table S1
(Supplementary Materials).

ed
Table 1. Characterization of selected G-rich sequences from the IAV genome.

Sequence
Sequence Segment Segment location
Sequence (5′-3′)

iew
name (Protein) length (nt) within
segment
1Q CUGGUGGGGCAGCAGCAAAGGGGAG 1 (PB2) 2341 436-460
7Q GGUAGUGGUCCAUCAAUCGGGUUGAGCUGGGG 2 (PB1) 2341 2097-2128
11Q GGAUGUAUAUUCUGAAAUGGGAGGCUGG 4 (HA) 1779 807-834

v
2.1 G4-specific ligands inhibit the proceeding of reverse transcription by interacting with
G4-forming sequences

re
Overall, a native polyacrylamide gel electrophoresis (PAGE) can offer valuable
information about the binding affinity of ligands to G-quadruplex structures and their
conformational preferences. Therefore, given the findings that the presence of G-quadruplex
can induce reverse transcription pausing,9,10 we applied an RNA-dependent DNA polymerase
er
stop assay, called a reverse transcription stop assay.
In the RT stop assay, the enzyme proceeds along the RNA template until it encounters a
stable, ligand-interacting RNA G4 structure. Thus, we assumed that the cDNA synthesis
catalyzed by reverse transcriptase will be inhibited after the addition of G4-specific ligand to
pe
the reaction. Moreover, we postulated that the full-length product synthesis will be more
significantly arrested with an increasing ligand concentration. However, in the case of G4
variants mutated within the G-rich regions, the inhibition of cDNA synthesis is supposed to be
less remarkable during the PAGE analysis. In our investigations, we used two commercially
available ligands TMPyP4 and BRACO-19.
ot

Based on our results we reported that the reverse transcription process was hindered by both
G4-specific compounds for all wild-type G4 variants (1q, 7q, and 11q). However, below we
showed representative data only for 1q/1qm and 7q/7qm variants (Figure 1). The results
obtained for 11q/11qm variants are presented in Supplementary Materials (Figures S1 and S2).
tn

Overall, the gel analysis revealed differences in the reverse transcription pausing between wild-
type and mutant sequences. According to the resultant gels in Figure 1, cDNA synthesis
catalyzed by SuperScript II reverse transcriptase in both cases (1q and 7q) was inhibited after
the addition of TMPyP4. As expected, we observed that the full-length product synthesis was
rin

more significantly arrested for the 1q variant with an increasing TMPyP4 concentration in
comparison with the mutated variant 1qm (Figure 1A). Similar results were observed for the 7q
vs. 7qm variants (Figure 1B). Interestingly, when comparing the results for 1q/1qm vs. 7q/7qm,
remarkable differences in the level of RT inhibition were displayed. More specifically, a
ep

significant change in band intensity between 1q and 7q variants is already noticeable at 6.25
µM TMPyP4 concentration (Figure 1A vs. 1B). It is worth mentioning that slightly higher band
intensity in a few cases compared to the control bands (RNA template without the ligand)
results from differences in product concentration after the purification on the columns. The
Pr

obtained results indicate the specific interactions between G4s variants and the TMPyP4
compound. However, the different intensity patterns for 1q vs. 7q in the gels may result from
different stability of the RNA G-quadruplexes.

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot
tn
rin
ep

Figure 1. The results of the inhibition of cDNA synthesis catalyzed by the reverse transcriptase
in the presence of TMPyP4; the resultant gels (upper) and the plots of band intensity vs. ligand
concentration (bottom) for 1q/1qm and 7q/7qm variants (panel A and panel B, respectively).
Pr

Taking into consideration the RT stop assay with the BRACO-19 compound, the resulting
gels showed a slightly different pattern of bands (Figure 2) than after the addition of TMPyP4.
We observed that BRACO-19 can influence RT processing, however, the effect was less

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 noticeable. Nevertheless, the band intensity for 1q differs from the 1qm variant (Figure 2A),
which indicates more effective reverse transcription inhibition by BRACO-19 for the wild-type

ed
variant (1q) (Figure 2A). Moreover, we noticed less remarkable changes in the band intensity
for the 7q/7qm variants (Figure 2B).

v iew
re
er
pe
ot
tn
rin
ep
Pr

Figure 2. The results of the inhibition of cDNA synthesis catalyzed by the reverse transcriptase
in the presence of BRACO-19; the resultant gels (upper) and the plots of band intensity vs.

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ligand concentration (bottom) for 1q/1qm and 7q/7qm variants (panel A and panel B,
respectively).

ed
Generally, based on the resultant gels, it is possible to conclude that tested G4 ligands
(TMPyP4 and BRACO-19) can specifically bind the IAV RNA G-quadruplexes. The
differences we observed in the gel analysis may result from several reasons, including G4
structure stability, folding topology, molecularity, or mechanism of ligand binding.

iew
2.2 Characterization of the interaction between the IAV RNA G-quadruplexes and ligands
by isothermal titration calorimetry (ITC)

Isothermal titration calorimetry (ITC) is a method used to determine thermodynamic

features of biomolecular interactions. It has been proven useful in studying the folding kinetics,

v
ligand binding specificity, and energetic aspects of G-quadruplex structure-ligand
interactions.3,11,12 Several examples of the ITC applications in studies of the binding properties

re
of ligands to G4s have been reported. 11–13 Hence, in our investigations, we employed the ITC
method to examine TMPyP4 and BRACO-19 interactions with the IAV RNA G4s.
Among all studied RNA G-quadruplexes, 1Q, 7Q, and 11Q, we can distinguish two sets of
TMPyP4 ligand binding sites. At the first set, the stoichiometry of TMPyP4 ligand binding can
be approximated to ~ 3, while the second set of binding sites binds the TMPyP4 with a
er
stoichiometry of ~ 2 (Figure 3 (upper panel), Table 2). The first type of binding site showed a
lower affinity for TMPyP4 with KD in the mid-nanomolar range (from ~ 200 to ~390 nM),
where the binding of a ligand is entirely enthalpy-dependent. The second type of TMPyP4
pe
binding site binds the ligand with almost 170-fold higher affinity in the case of 1Q and 7Q (KD
of ~1.2 nM and ~1.8 nM, respectively, Table 2) and ~880-fold higher in the case of 11Q (KD ~
0.4 nM, Table 2). The binding at these sites is driven mainly by the change of entropy. BRACO-
19 ligand is bound similarly by both 1Q and 11Q molecules (Figure 3, bottom panel), as fitting
titration curves of both resulted in the determination of one set of binding sites with the KD of
~165 and 100 nM, respectively, and stoichiometry of ~ 9 and ~8 (Table 2). Interactions of both
ot

G-quadruplexes, 1Q, and 11Q, with BRACO-19, are driven by enthalpy, although the entropy
contribution is still significant. The BRACO-19 binding by the 7Q molecule is different because
we can distinguish two sets of binding sites, the first of stoichiometry ~7 and the second of N
tn

~ 4 (Table 2). However, both sets have lower affinity to BRACO-19 than the 1Q and 11Q, as
their KD is 425 nM and 4.76 µM, respectively (Table 2). The binding at the first set is driven
entirely by entropy and enthalpy at the second. In general, we noticed the differences in the
binding properties between TMPyP4 and BRACO-19 compounds toward three RNA G4s. It
rin

can be concluded that the cationic porphyrin is characterized by higher binding affinity
compared to the acridine derivative. This finding may result from different mechanisms of
interaction for these ligands that are still unclear.
ep

Table 2. The binding parameters were obtained from the calorimetric titration of 1Q, 7Q, and
11Q molecules with TMPyP4 and BRACO-19 ligands.

Parameters 1Q 7Q 11Q
Pr

N1 3.28 ± 0.01 3.00 ± 0.03 2.99 ± 0.01

TMP
yP4

Kd1 [nM] 199 ± 2 306 ± 26 388 ± 12

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ΔH1 [kcal/mol] -14.6 ± 0.1 -13.7 ± 0.4 -13.4 ± 0.3
-TΔS1 [kcal/mol] 5.4 4.8 4.6

ed
N2 2.12 ± 0.01 1.59 ± 0.01 1.94 ± 0.01
Kd2 [nM] 1.18 ± 0.06 1.79 ± 1.25 0.44 ± 0.05
ΔH2 [kcal/mol] -3.78 ± 0.07 -1.99 ± 0.44 -4.33 ± 0.27

iew
-TΔS2 [kcal/mol] -8.4 -10.0 -8.4
N1 9.16 ± 0.08 6.83 ± 0.07 7.60 ± 0.04
Kd1 [nM] 165 ± 57 425 ± 21 100 ± 24
ΔH1 [kcal/mol] -5.19 ± 0.13 20.1 ± 0.3 -7.0 ± 0.1
BRACO-19

v
-TΔS1 [kcal/mol] -4.1 -28.8 -2.5
N2 - 4.0 ± 0.1 -

re
Kd2 [nM] 4760 ± 48
ΔH2 [kcal/mol] -31.6 ± 1.42
-TΔS2 [kcal/mol] er 24.3
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot

Figure 3. Representative raw data (upper panel) and integration of the peaks with the best fit
of ‘One Set of Sites’ or ‘Two Set of Sites’ model (bottom panel) obtained after titrations of 1Q,
tn

7Q, and 11Q G-quadruplexes with TMPyP4 or BRACO-19 ligands.

2.3 Circular dichroism measurements of the IAV RNA G-quadruplexes upon ligand
rin

titration

Circular dichroism (CD) spectroscopy provides information on the geometry of nucleic acid
structures and various types of tertiary interactions. It is a simple and relatively fast technique
for evaluating the G4s folding topology and assessing its structural features. The unique CD
ep

spectral signatures are useful for monitoring conformational changes in G4s under experimental
conditions. Overall, CD spectroscopy is commonly used to determine G4s topology, cation
effect, G4/ligand interactions, and ligand-induced stabilization, being a low-resolution
complement to high-resolution techniques.6,7,14,15 Therefore, we applied CD spectroscopy as a
Pr

complementary technique to check the effect of TMPyP4 and BRACO-19 ligands on the RNA
G4 structure.
The CD analysis was conducted for three RNA G4s with the addition of increasing
concentrations of TMPyP4 and BRACO-19 compounds. As a result, the CD spectra of 1Q, 7Q,

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 and 11Q are presented in Figures 4 and 5. They are dominated by a strong positive band near
265 nm and a smaller negative band at 240 nm, typical for the parallel G-quadruplex structure.

ed
In general, the cationic porphyrin under tested conditions did not affect the positions of peaks,
indicating that the 1Q, 7Q, and 11Q structures retained the parallel topology (Figure 4). A
similar trend was noticed upon the addition of the BRACO-19 compound (Figure 5).
Importantly, we found little changes in the CD spectrum intensity that reflect the increase
in the concentration of both ligands. However, no differences in global RNA G-quadruplex

iew
structure were detected (Figures 4 and 5). We revealed that the G4-specific ligands present in
the solution slightly reduce the intensity of the CD spectra at 265 nm upon titration for 1Q, 7Q,
and 11Q variants. The abovementioned findings suggest that the TMPyP4 and BRACO-19
compounds were not able to disturb the RNA G-quadruplex structure under experimental
conditions.

v
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 Figure 4. Circular dichroism spectra for pre-folded RNA G4s oligomers: 1Q (A), 7Q (B), and
11Q (C) with TMPyP4 increasing concentration.

ed
v iew
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 Figure 5. Circular dichroism spectra for pre-folded RNA G4s oligomers: 1Q (A), 7Q (B), and
11Q (C) with increasing concentration of BRACO-19.

ed
2.4 Fluorescence spectroscopy analysis of the IAV RNA G-quadruplex-ligand interactions

To get more insight into the interaction between RNA G4s and selected ligands, we
applied fluorescence spectroscopy. We expected a change in fluorescence spectrum and

iew
intensity when a selected ligand binds to a G-quadruplex structure. Herein, the fluorescence
titration spectra of pre-folded 1Q, 7Q, and 11Q G4s (keeping RNA concentration constant) with
increasing concentrations of TMPyP4 and BRACO-19 ligands were recorded. The fluorescence
emission spectra for the TMPyP4 compound at wavelengths ranging from 600 nm to 800 nm
with excitation set at 433 nm are presented in Figure 6. Overall, the measurements were
conducted until the changes in TMPyP4 fluorescence intensity were insignificantly small. We

v
noticed a decrease in the distance between peaks at emission maxima with increasing
concentration of TMPyP4 up to six- or seven-fold excess to the RNA G4s. As a result, the

re
fluorescence spectrum of TMPyP4 alone is characterized by a single broad emission peak
centered near 700 nm Figure 6 (light green dashed line). In contrast, the fluorescence spectra
changed after the addition of RNA G4s oligomers, and two emission maxima at 660 nm and
near 730 nm appeared (Figure 6). The same trend was observed in all cases (1Q, 7Q, and 11Q),
which suggests the TMPyP4 compound interactions with the G-quadruplexes present in the
er
solution. In other words, different shapes of recorded spectra confirm that RNA G4s can bind
with the cationic porphyrin under experimental conditions.
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 Figure 6. The fluorescence titration spectra of TMPyP4 ligand in the absence and presence of
pre-folded RNA G4s oligomers: 1Q (A), 7Q (B), and 11Q (C). The spectrum of TMPyP4 alone

ed
in the buffer is indicated as a light green dashed line.
As mentioned before, we also investigated the effects of the three G4s on the BRACO-
19 fluorescence spectrum. The fluorescence spectra of the BRACO-19 compound with 1Q, 7Q,
and 11Q G4s were recorded in the range from 500 to 650 nm with excitation set at 285 nm.

iew
Similarly to the TMPyP4 ligand, the measurements were conducted until the changes in
BRACO-19 fluorescence intensity were insignificantly small. The results for all RNA G4s
variants with increasing concentrations of acridine compound are presented in Figure 7. We
found a different trend for BRACO-19 upon the addition of 1Q, 7Q, and 11Q G4s in comparison
to the TMPyP4 ligand. The overall shape of the recorded spectra did not change when RNA
G4s were present in the solution. In all cases, the spectral profile of BRACO-19 fluorescence

v
is characterized by one positive peak with a maximum near 570 nm (Figure 7). However,
comparing the fluorescence intensity of the BRACO-19 ligand vs. the addition of G-

re
quadruplexes, one can notice its decrease after the addition of RNA G4s (Figure 7).
Surprisingly, the largest change in fluorescence intensity was found in the case of the 11Q
variant (BRACO-19 alone vs. 11Q with 6 eq of BRACO-19, Figure 7C), whereas the smallest
was for the 1Q variant (BRACO-19 alone vs. 1Q with 6 eq of BRACO-19, Figure 7A), which
is difficult to interpret at this moment. Additionally, the fluorescence intensity changes from
er
varying concentrations of BRACO-19 were relatively small (Figure 7). This observation may
suggest that the presence of RNA G4s in the solution did not affect significantly the
fluorescence of the acridine derivative.
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 ed
v iew
re
er
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 Figure 7. The fluorescence titration spectra of TMPyP4 ligand in the absence and presence of
pre-folded RNA G4s oligomers: 1Q (A), 7Q (B), and 11Q (C). The spectrum of BRACO-19

ed
alone in the buffer is indicated as a purple dashed line.

2.5 Biological studies of the influence of G4-specific ligand on replication within the IAV
minireplicon system

iew
Our previous studies showed that identified G-rich motifs (1Q, 7Q, and 11Q) are located
within the protein-coding regions of the IAV genome. Moreover, 1Q and 7Q sequences are
present in the segments encoding polymerase complex proteins (PB1 and PB2), whereas the
11Q motif is found within the hemagglutinin (HA) segment.8 Considering the G4s localization
within the vRNA segments, it can be assumed that these structures can play important roles in
the regulation of different steps of the viral life cycle. Recently, a non-infectious life cycle

v
modeling system has been developed using reverse genetic methods.16,17 This minireplicon
system (called also minigenome) has been used in studies concerning the chemical targeting of

re
a G-quadruplex RNA in the Ebola virus L gene. Therefore, in our research, we postulated to
examine the influence of G4-specific ligand binding on luciferase expression using the genomic
vRNA analog system. This system relies on a viral mini-genome, which controls the expression
of firefly luciferase (Luc). Within this minireplicon system, the expression of the viral proteins
(PB2, PB1, PA, and NP) and vRNA-like transcript results in the in vitro reconstitution of active
er
vRNP complexes. Those vRNP complexes generate the corresponding mRNA, which controls
the firefly luciferase expression with chemiluminescence activity. In our study, we used the
IAV minireplicon system which enables an accurate and rapid test of the activity of the vRNP
pe
complex based on its ability to replicate a virus-like RNA encoding the luciferase protein.
Moreover, we assumed that the TMPyP4 ligand addition should to some extent inhibit the
minireplicon replication in the cells. Additionally, we decided to use another ligand, that is less
specific towards G-quadruplexes, TMPyP2, as an additional control in biological experiments.
Importantly, based on our previous studies we found the difference in nucleotide
composition of G-rich sequences (1Q and 7Q) between A/California/04/2009 (Cal2009) and
ot

A/Puerto Rico/8/34 (PR8) genomes. We reported that PQS regions from segment 1 and segment
2 of PR8 differ from the corresponding PQS regions from the Cal2009 genome. The 1Q
sequence from PR8 (5′-UUGGUGGAGCGGCUGCGAAGGGAAG) contains the A residues
instead of G residue in the G-rich region of Cal2009 (5′-
tn

CUGGUGGGGCAGCAGCAAAGGGGAG), while the 7Q sequence from PR8 (5′-

GGCAGUGGCCCAUCAAUCGGGUUGAGUUGCGG) contains the C residue instead of G
residue in the G-rich region, in comparison with sequence from Cal2009 (5′-
GGUAGUGGUCCAUCAAUCGGGUUGAGCUGGGG). This finding can suggest G-quadruplex
rin

structure disruption in the PR8 strain genome.

By analyzing the luciferase luminescence signals, we could observe the significant
inhibitory effect of the TMPyP4 ligand on minireplicon replication (Figure 8). With the
increasing ligand concentration, luciferase luminescence was at an increasingly lower level.
Additionally, the inhibitory effect of the TMPyP2 ligand was less remarkable, which is
ep

consistent with our hypothesis. We had to use twice the concentration of this ligand to observe
the same inhibitory effect as for TMPyP4. Moreover, our findings suggest the strain-dependent
inhibitory effect of the ligands. As one can notice, in the case of PR8 minireplicon, ligands do
not show such a strong repressive effect but rather seem to have no significant influence on
Pr

minireplicon replication (Figure 8, bottom panel). Interestingly, TMPyP2 has a slightly greater
inhibitory effect on minireplicon system inhibition than TMPyP4. Interestingly, the TMPyP4
ligand in low concentration appears to have a stimulatory effect on the PR8 minireplicon as its
addition increased the luminescence signal. At this moment, this mechanism is unknown and

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 would require further structural and bioinformatic investigation starting from RNA sequence
analysis and its interaction with the ligand, and the possible function of RNA G4s.

ed
v iew
re
er
pe
ot
tn
rin
ep

Figure 8. The inhibition of Cal2009 minireplicon (upper panel) and PR8 minireplicon (bottom
panel) replication in HEK293T cells after TMPyP4 or TMPyP2 treatment. All the data are
presented as the means from three independent experiments. Error bars reflect the SD.
Pr

We decided to confirm our results using another method, reverse-transcription quantitative

polymerase chain reaction (RT-qPCR). In this experiment, instead of luminescence

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 examination, we isolated total RNA from the cells and investigated, whether the luminescence
expression level was altered after the G4-specific ligand addition. Figure 9 presents the results

ed
that we obtained from the luciferase expression analysis.

v iew
re
er
pe
ot
tn
rin
ep
Pr

Figure 9. The luciferase expression in HEK293T cells transfected with Cal2009 minireplicon
(upper panel) and PR8 minireplicon (bottom panel) after TMPyP4 or TMPyP2 treatment. The

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 graphs show the most representative data obtained by RT-qPCR assays. The values were
normalized to β-actin.

ed
We can state that the obtained RT-qPCR results are mostly consistent with luminescence
signal data. In the case of Cal2009 minireplicon the luciferase expression was at a significantly
lower level after the TMPyP4 addition compared to the control (the minireplicon-transfected

iew
cells not treated with the ligand). Moreover, the addition of the TMPyP2 compound in the
higher concentration resulted in a less significant reduction of luciferase expression. The
difference between results obtained from both methods can be caused by the fact that
luminescence signal data are dependent on the cell count in the well, while in the RT-qPCR
there is an internal control, the actin expression, so the results are not cell count-dependent.
Interestingly, when comparing luminescence signal data and RT-qPCR results obtained for

v
PR8 minireplicon, we could observe some differences. The TMPyP4 addition in the lowest
concentration increased the luminescence signal, indicating the virus replication stimulation,

re
while RT-qPCR results showed the reduction of luciferase expression. Similar dependence was
observed for the twice higher concentration. For the highest TMPyP4 concentration and
TMPyP2, the RT-qPCR results are consistent with the luminescence signal data.

3 Discussion
er
The influenza virus causing the common flu has a high epidemic and pandemic potential,
which is a result of its high genome variability. It is known that the viral biological processes,
pe
such as replication and pathogenicity, are controlled by viral RNA secondary and tertiary
structure. RNA is used throughout the replication cycle, highlighting its fundamental role in
IAV biology.
The secondary structure of vRNA, including IAV vRNA, is highly conserved among the
strains suggesting its importance for the viral life cycle. Moreover, it has been shown that RNA
structural motifs, G-quadruplexes, are present within the viral genomes and can have important
ot

biological functions.5,18–20 Therefore, we suggest that more research on vRNA structure-

function correlation should be performed. In our previous paper, we identified and described
structural aspects of G-quadruplexes from the IAV genome.8
tn

A significant number of ligands specific to G4s have been studied and some of them are
potential antiviral therapeutic agents.21,22 For instance, TMPyP4 and BRACO-19 compounds
stabilize G-quadruplex formation and are potential inhibitors of viral replication.7,15 Given the
findings that the presence of G-quadruplex can induce reverse transcription pausing 9,10, herein,
we tested both TMPyP4 and BRACO-19 ligands towards the RNA G4s from the IAV genome.
rin

In our current work, we first determined the effect of TMPyP4 and BRACO-19 ligands on
the inhibition of cDNA synthesis. The obtained results revealed some differences between the
reverse transcription pausing after the addition of both tested compounds. The changes in the
intensity patterns for 1q vs. 7q in the gels may result from different stability of the RNA G-
ep

quadruplexes. Previously we reported that the melting temperature for the 1q variant was
50.4°C, while in the case of the 7q variant, this parameter was 44.6°C.8 Therefore, the different
thermal stability of both variants may explain the observed changes in the results of the RT stop
assay.
Pr

Furthermore, a combination of the ITC technique, CD measurements, and fluorescence

spectroscopy allowed us to characterize the RNA G-quadruplex-ligand interactions. Our
biophysical analyses provided information about the binding properties of TMPyP4 and
BRACO-19 ligands to three RNA G4s. They revealed some interaction changes that may be

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 caused by different binding mechanisms of the given ligand. Structural features of the ligand
and its target (in this case G-quadruplexes) can explain changes in the affinity and specificity

ed
among TMPyP4 and BRACO-19 compounds binding to the same RNA G4s. Many
investigations concerning the characterization of the ligand-G4 interactions were reported.23–25
For instance, Zhang and co-workers analyzed the binding ability of ligands, including BRACO-
19 and TMPyP4, to G4s from the enterovirus A71 (EV-A71) genome.23 The authors found that

iew
G4-specific ligands stabilize EV-A71 G-quadruplex structures with high affinity. However,
they observed different affinity and selectivity of such interactions.23 Our results are consistent
with literature reports, suggesting that various ligand and their structural rigidity can affect the
behavior of G-quadruplex structures. Furthermore, the folding topology and molecularity of
1Q, 7Q, and 11Q structures may also influence their interaction with G4-specific compounds.
Although the binding mechanism of these compounds to RNA G4s is still unclear, the

v
interactions detected by various biophysical methods described above indicate that the TMPyP4
and BRACO-19 bind to 1Q, 7Q, and 11Q G4s.

re
Investigations concerning G-quadruplex binders as effective inhibitors of virus infections
were recently published, e.g. a paper concerning G-quadruplex as a therapeutic target was
described by Lv and colleagues in 2022.4 The authors confirmed G4 structure formation within
the chikungunya virus (CHIKV) genome using different biophysical techniques. Importantly,
they determined the inhibition of CHIKV genome replication by BRACO-19 and TMPyP4
er
ligands. They also showed that the infectious virus production was inhibited by these
compounds.4 Our previous studies showed that 1Q, 7Q, and 11Q are located within the protein-
coding regions of the IAV genome. Moreover, 1Q and 7Q sequences are present in the segments
pe
encoding polymerase complex proteins, whereas 11Q is found within the hemagglutinin (HA)
segment.8 Considering the above findings we examined the effect of TMPyP4 compound on
replication within the IAV minireplicon system. This non-infectious life cycle modeling system
has been developed using reverse genetic methods.16,17 It was employed, for example, in the
chemical targeting of a G4 RNA in the Ebola virus L gene.6
ot

Herein, we assumed that G-quadruplex structures can play an important role in the
regulation of the viral replication cycle, thus, we used the minireplicon system. Importantly,
the IAV A/California/04/2009 strain causes dangerous pandemic outbreaks in contrast to the
tn

IAV A/Puerto Rico/8/34 which is a lab-adapted strain, that serves as a model for seasonal
influenza viruses. What seems important, is the fact that we found a difference in nucleotide
composition of G-rich sequences between these two strains within the G-quadruplex-forming
regions. Therefore, the minireplicon system usage based on Cal2009 and PR8 for in vitro
studies is justified. We found out that TMPyP4 binds to G-quadruplexes formed within the
rin

polymerase complex proteins preventing the minireplicon replication. Additionally, we

observed differences in IAV replication inhibition between IAV strains as the inhibitory effect
was more significant for the Cal2009 strain. Therefore, whether this naturally occurring subtle
difference (the single nucleotide substitution in the G-rich region) within the IAV genome can
ep

be related to viral pathogenicity remains an open question.

In summary, in our paper, we demonstrate the molecular and structural basis of the binding
of TMPyP4 and BRACO-19 to selected IAV RNA G4s. Our investigation has proven that both
compounds bind to RNA G-quadruplexes under experimental conditions, however, their
Pr

binding modes differ. Moreover, the findings reported here show that TMPyP4 and BRACO-
19 inhibit reverse transcription reactions in vitro. Finally, we revealed that TMPyP4 effectively
inhibits IAV minireplicon replication in the cellular environment. Based on this observation,

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 we suggest the potentially important role of RNA G4s in viral replication, which could be novel
targets for the development of an anti-influenza strategy.

ed
4 Materials and Methods

4.1 Oligonucleotides and chemical compounds

iew
Synthetic oligonucleotides were purchased from Genomed (Poland). Table 1 provides
specific information about oligomer sequences and applications. The G4-specific ligands:
TMPyP4 and BRACO-19 were bought from Sigma Aldrich (Germany).

4.2 Reverse transcription stop assay

v
Reverse transcription stop assay was performed using SuperScript™ II Reverse

re
Transcriptase (Thermo Fisher Scientific, USA). RNA oligonucleotides (2 pmol) and
appropriate primers (2 pmol) were dissolved in a 10 mM potassium phosphate buffer (pH 6.8)
containing 50 mM KCl and 0.1 mM EDTA to obtain a final volume of 10 µl. Samples were
denatured at 85°C for 5 minutes and then cooled down to room temperature overnight. After
folding, the sample solutions were mixed with ligands (TMPyP4 or BRACO-19) at increasing
er
concentrations (0, 6.25, 12.5, 25, 50, and 100 µM) and incubated at room temperature for 15
min. Next, the reaction mixture without RT enzyme was added to the sample solutions, mixed
gently, and incubated at 42°C for 2 min. After that, the SuperScript™ II RT enzyme was added
pe
(200 units), mixed by pipetting gently up and down and incubated at 42°C for 50 min. The
reaction was inactivated by heating at 70°C for 15 min. The products of reactions were cleaned
using the RNA Clean & Concentrator kit according to the manufacturer’s protocol (Zymo
Research, Germany). Finally, the electrophoresis of products was performed using 12%
polyacrylamide gels at 140 V for 40 min in a cold room using the XCell SureLock Mini-Cell
Electrophoresis System (Thermo Fisher Scientific, USA). The resultant gels were visualized
ot

with the help of an Amersham Typhoon Biomolecular Imager and analyzed using
ImageQuant™ TL 10.2 analysis software. The graphs were prepared using the Origin Pro 2021
software.
tn

4.3 Circular dichroism spectroscopy

CD spectra were recorded on a Jasco J-815 spectropolarimeter (Jasco Deutschland GmbH,

Pfungstadt, Germany) using 850 µl quartz cuvettes with a 5 mm path length and a sample
rin

volume of 600 µl. RNA oligonucleotides were dissolved in the same buffer as used for RT stop
assay, to achieve a sample concentration of 14.5 µM. All samples were denatured for 5 min at
90°C and then slowly cooled to room temperature overnight before data collection. The titration
of the pre-folded RNA oligonucleotides was carried out by adding a solution of tested ligands
(TMPyP4 and BRACO-19) in 12 aliquots of 2.4 µl (0.5 equivalent) in the concentration range
ep

from 0.56 µM to 6.5 µM. Measurements were collected at 20°C in the 210–350 nm wavelength
range with a 1 nm data interval. CD curves were established as an average of three CD
measurements. The buffer spectrum was subtracted from the sample spectra. CD spectra were
expressed as the difference in the molar absorption (Δɛ, in units of cm2 mmol-1) of the right-
Pr

handed and left-handed circularly polarized light and normalized for plotting and comparative
purposes using the Origin Pro 2021 software.

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 4.4 Fluorescence measurements

ed
Fluorescence spectra were recorded using a JASCO J-815 CD/fluorescence
spectropolarimeter (Jasco Deutschland GmbH, Pfungstadt, Germany) using 850 µl quartz
cuvettes with a 5 mm path length and a sample volume of 600 µl. RNA oligonucleotides were
dissolved in the same buffer as used for RT stop assay, to achieve a sample concentration of
14.5 µM. All samples were denatured for 5 min at 90°C and then slowly cooled to room

iew
temperature overnight before data collection. The titration of the pre-folded RNA
oligonucleotides was carried out by adding a solution of tested ligands (TMPyP4 and BRACO-
19) in 12 aliquots of 2.4 µl (0.5 equivalent) in the concentration range from 0.56 µM to 6.5 µM.
Fluorescence spectra were measured at 20°C from 600 to 800 nm with a 2 nm step, 900 V
detector sensitivity using 433 nm excitation for the TMPyP4 ligand, and from 500 to 650 nm
with a 2 nm step, 900 V detector sensitivity using 285 nm excitation for the BRACO-19 ligand.

v
The graphs were prepared using the Origin Pro 2021 software.

re
4.5 Isothermal titration calorimetry (ITC)

Microcalorimetric experiments were carried out with MicroCal PEAQ-ITC equipment at

20°C in phosphate buffer (10 mM KH2PO4 pH 6.8, 50 mM KCl). Titration of the ligand (kept
at 500-1200 µM concentration in the syringe) against RNA 1Q, 7Q, and 11Q oligomers in the
er
cell (kept at 8-30 µM concentration determined at 260 nM) was performed. Ligand solution
was injected in 19-38 aliquots of 2 µl until the saturation was observed. Raw data were analyzed
by MicroCal PEAQ-ITC Analysis Software with One Set of Sites (in case of 1Q and 11Q
interactions with BRACO-19) or Two Sets of Sites model (in case of 7Q interaction with
pe
BRACO-19 and all G-quadruplex interactions with TMPyP4) to obtain thermodynamic
parameters, such as binding stoichiometry (N), dissociation constant (Kd), and the changes in
the enthalpy (ΔH) and entropy (ΔS).

4.6 Cell line culture

ot

The human embryonic kidney cell line HEK293T was bought from LGC Standards, Poland.
The cell line was maintained in high-glucose Dulbecco’s modified Eagle’s medium (DMEM;
Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (FBS; Thermo
tn

Fisher Scientific, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were
incubated at 37 °C in a humidified incubator containing 5% CO2.

4.7 Luminescent cell viability assay

rin

The cytotoxicity of ligands was tested using Cell Titter-Glo® cell viability reagent
according to the manufacturer’s protocol (Promega, USA). Briefly, HEK293T cells were
seeded at 1x105 cells/ml in 96-well plates along with the tested compounds (TMPyP4, TMPyP2,
and BRACO-19 ligands). Cells were grown for 48 hours. Cell Titter-Glo® reagent was added
ep

to cell supernatant at a 96-well plate, and after 2 minutes of mixing and 10 minutes of
incubation, the solution was transferred to white plates. Finally, the measurements of
luminescence were conducted on the HIDEX microplate reader.
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 4.8 Preparation of IAV plasmids and the minireplicon construct

ed
The minireplicon system that we used consists of pCAGGS (A/IvPR/8/34) plasmids
encoding PB1, PB2, PA, and NP proteins from influenza A virus (strain A/Puerto Rico/8/1934
H1N1) and pPolI-LucRT plasmid encoding firefly luciferase gene under the influenza A
segment 8 5´end promoter (kind gift of Prof. Stefan Poehlmann, German Primate Center –
Leibniz Institute for Primate Research, Goettingen, Germany). To create the California 2009

iew
minireplicon the protein-coding regions of pCAGGS plasmids were replaced with the
sequences encoding the same proteins in the influenza A virus strain
A/California/07/2009(H1N1). The cloning method used to create new plasmids is called Gibson
assembly. To this end, we designed starters (see Table 1) in the SnapGene program and used
GeneArt™ Gibson Assembly HiFi Master Mix (Invitrogen) for plasmids preparation. The
procedure was according to the manufacturer’s protocol with minor modifications.

v
4.9 IAV minireplicon assay

re
This assay was performed as previously described with minor modifications.6 HEK293T
cells were seeded into each well of a 24-well plate at a density of 4x105 cells/ml and incubated
overnight at 37°C. Cultured cells were co-transfected with pCAGGS plasmids prepared as
described above at various concentrations (California 2009: 150 ng of PB1, PB2, PA, and Luc
er
and 300 ng of NP; Puerto Rico 8: 50 ng of PB1, PB2, PA, and Luc and 100 ng of NP) using
Lipofectamine™ 2000 reagent at 80% confluency according to the manufacturer’s protocol
(Thermo Fisher Scientific, USA). Two plasmids containing GFP (1 µg) or pCMV-Luc Firefly
pe
Luciferase mammalian expression reporter vector (pCMV-Luc, 200 ng) (Origene) were used
as control probes. Next, the TMPyP4 or TMPyP2 compounds at the various concentrations (20,
50, 100 or 50, 100, 200 µM, respectively) were added to the co-transfected cells. After 18-
hours of incubation at 37°C, the cell medium was replaced with a fresh DMEM medium
containing FBS and antibiotics, and cells were incubated for 29 hours at 37°C. Next, the cells
ot

were collected into Eppendorf tubes and centrifuged at 3000 rpm for 3 minutes. Then the cell
pellet was resuspended in 250 µl ONE-Glo™ luciferase reagent (Promega, USA) and incubated
at room temperature for 15 minutes to allow complete cell lysis. Finally, 50 µl of each sample
tn

lysate was transferred to a 96-well white polystyrene plate in triplicate and the luminescence of
the resultant reactions was determined using the HIDEX microplate reader. Mean luciferase
expression and SDs were obtained by measuring luminescence level in six separate wells. The
data analysis was performed using the Origin Pro 2021 software.
rin

4.10 Total RNA isolation

Total RNA from the HEK 293T cell monolayer was extracted using the NucleoSpin RNA
Plus kit according to the manufacturer’s protocol (Macherey-Nagel, Germany). The quality of
ep

the isolated RNA was checked after enzymatic DNA degradation by separation in 1% agarose
gel.

4.11 Reverse transcription

Pr

Reverse transcription was performed with random hexamer primers (Thermo Fisher
Scientific, USA) and SuperScript IV Reverse Transcriptase (Invitrogen). For this purpose, a
mix of random hexamers (1 µl), 10 mM dNTP (1 µl), and nuclease-free water (6 µl) was

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 prepared. To each sample 5 μl of RNA isolate was added and incubated for 5 min at 65°C, and
then the samples were placed on ice for 1 min. After that, the following components: 4 µl of 5

ed
x SSIV Buffer, 1 µl of 100 mM DTT, 0.25 µl of RNasin Plus (Promega), 0.5 µl of Super Script
IV Reverse Transcriptase, and 1.25 µl of nuclease-free water were mixed and added to the
annealed RNA. The samples were incubated for 10 min at 23°C, then 10 min at 55°C, and
finally reaction was stopped by incubation for 10 min at 80°C.

iew
4.12 RT-qPCR quantification

Real-time PCR was conducted according to the TaqMan Gene Expression Assay
protocol. First, PCR reaction mix was prepared: 9.5 μl of TaqMan™ Fast Advanced Master
Mix (Thermo Fisher Scientific, USA), 1 μl of TaqMan assay for luciferase expression (FAM)
(Thermo Fisher Scientific, USA), 1 μl of TaqMan assay for actin expression (VIC) (Thermo

v
Fisher Scientific, USA), and 6.5 μl of nuclease-free water were mixed. Then, the PCR reaction
mix was transferred to the 96-well plate and the 2 μl of cDNA template was added to each well.

re
The PCR reaction was performed at the CFX96 Real-Time System (Biorad, USA). The program
of the reaction was as follows: UNG incubation at 50°C for 2 min, polymerase activation at
95°C for 20 sec, then 40 cycles of denaturation at 95°C for 1 sec, and annealing at 60°C for 20
sec. The experiment was performed in triplicate. The obtained results were analyzed in the Bio-
Rad CFX Maestro program and visualized using Origin Pro 2021 software.
er
Supplementary Materials
Table S1. List of RNA and DNA oligomers used in this work.
pe
Figure S1. The results of the inhibition of cDNA synthesis catalyzed by the reverse
transcriptase in the presence of TMPyP4; the resultant gels (upper) and the plots of band
intensity vs. ligand concentration (bottom) for 11q/11qm.
Figure S2. The results of the inhibition of cDNA synthesis catalyzed by the reverse
ot

transcriptase in the presence of BRACO-19; the resultant gels (upper) and the plots of band
intensity vs. ligand concentration (bottom) for 11q/11qm.
Author Contributions: Conceptualization, M.N., P.Z., and M.S.; methodology, M.N., M.S.,
tn

J.S., K.Z., and P.Z., investigation, M.N., M.S., J.S., and K.Z.; data curation, M.N. and M.S.;
writing—original draft preparation, M.N., M.S.; J.S., and K.Z.; writing—review and editing,
M.N. and M.S., supervision, M.S. and E.K.; funding acquisition, M.S. All authors have read
and agreed to the published version of the manuscript.
Funding: This research was funded by the National Science Centre, grant number: UMO-
rin

2019/35/D/NZ6/01479 (M.S.)
Data Availability Statement: The data used to support the findings of this study are available
upon request to the authors.
Acknowledgments: We would like to thank Dagny Lorent for her scientific support and helpful
ep

suggestions.
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in
the design of the study; in the collection, analyses, or interpretation of data; in the writing of
the manuscript, or in the decision to publish the results.
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 5 References

ed
1. Qin, G. et al. RNA G-quadruplex formed in SARS-CoV-2 used for COVID-19 treatment
in animal models. Cell Discov. 8, (2022).
2. Perrone, R. et al. Anti-HIV-1 activity of the G-quadruplex ligand BRACO-19. J.
Antimicrob. Chemother. 69, 3248–3258 (2014).

iew
3. Zou, M. et al. G-quadruplex binder pyridostatin as an effective multi-target ZIKV
inhibitor. Int. J. Biol. Macromol. 190, 178–188 (2021).
4. Lv, L., Cui, H., Chen, Z., Zhou, Y. & Zhang, L. G-quadruplex ligands inhibit
chikungunya virus replication. J. Med. Virol. 94, 2519–2527 (2022).
5. Qin, G. et al. RNA G-quadruplex formed in SARS-CoV-2 used for COVID-19 treatment

v
in animal models. Cell Discov. 8, (2022).

re
6. Wang, S. R. et al. Chemical Targeting of a G-Quadruplex RNA in the Ebola Virus L
Gene. Cell Chem. Biol. 23, 1113–1122 (2016).
7. Majee, P. et al. Inhibition of Zika virus replication by G-quadruplex-binding ligands.
Mol. Ther. - Nucleic Acids 23, 691–701 (2021).
er
8. Tomaszewska, M., Szabat, M., Zielińska, K. & Kierzek, R. Identification and structural
aspects of g‐quadruplex‐forming sequences from the influenza a virus genome. Int. J.
Mol. Sci. 22, 1–19 (2021).
pe
9. Butovskaya, E., Soldà, P., Scalabrin, M., Nadai, M. & Richter, S. N. HIV-1 Nucleocapsid
Protein Unfolds Stable RNA G-Quadruplexes in the Viral Genome and Is Inhibited by
G-Quadruplex Ligands. ACS Infect. Dis. 2127–2135 (2019)
doi:10.1021/acsinfecdis.9b00272.
10. Katsuda, Y. et al. Small molecule-based detection of non-canonical RNA G-quadruplex
ot

structures that modulate protein translation. Nucleic Acids Res. 50, 8143–8153 (2022).
11. Majee, P. et al. Identification and characterization of two conserved G-quadruplex
forming motifs in the Nipah virus genome and their interaction with G-quadruplex
tn

specific ligands. Sci. Rep. 10, 1–12 (2020).

12. Oliva, R. et al. Binding Properties of RNA Quadruplex of SARS-CoV-2 to Berberine
Compared to Telomeric DNA Quadruplex. Int. J. Mol. Sci. 23, 1–21 (2022).
rin

13. Mishra, S. K. et al. Characterization of G-Quadruplex Motifs in espB, espK, and cyp51
Genes of Mycobacterium tuberculosis as Potential Drug Targets. Mol. Ther. - Nucleic
Acids 16, 698–706 (2019).
14. Lv, L., Cui, H., Chen, Z., Zhou, Y. & Zhang, L. G-quadruplex ligands inhibit
ep

chikungunya virus replication. J. Med. Virol. 94, 2519–2527 (2022).

15. Artusi, S. et al. Antiviral activity of the g-quadruplex ligand tmpyp4 against herpes
simplex virus-1. Viruses 13, (2021).
16. Watt, A. et al. A Novel Life Cycle Modeling System for Ebola Virus Shows a Genome
Pr

Length-Dependent Role of VP24 in Virus Infectivity. J. Virol. 88, 10511–10524 (2014).

17. Uebelhoer, L. S. et al. High-throughput, luciferase-based reverse genetics systems for
identifying inhibitors of Marburg and Ebola viruses. Antiviral Res. 106, 86–94 (2014).

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754
 18. Chung, W. C. et al. G-quadruplexes formed by Varicella-Zoster virus reiteration
sequences suppress expression of glycoprotein C and regulate viral cell-to-cell spread.

ed
PLoS Pathog. 19, 1–25 (2023).
19. Fang, P. et al. Unfolding of an RNA G-quadruplex motif in the negative strand genome
of porcine reproductive and respiratory syndrome virus by host and viral helicases to
promote viral replication. Nucleic Acids Res. 51, 10752–10767 (2023).

iew
20. Wang, J. et al. G-quadruplex in hepatitis B virus pregenomic RNA promotes its
translation. J. Biol. Chem. 299, 105151 (2023).
21. Abiri, A. et al. Unlocking G-quadruplexes as antiviral targets. Pharmacol. Rev. 73, 897–
923 (2021).
22. Ruggiero, E. & Richter, S. N. Survey and summary G-quadruplexes and G-quadruplex

v
ligands: Targets and tools in antiviral therapy. Nucleic Acids Res. 46, 3270–3283 (2018).

re
23. Lv, L. & Zhang, L. Characterization of G-Quadruplexes in Enterovirus A71 Genome and
Their Interaction with G-Quadruplex Ligands. Microbiol. Spectr. 10, 1–17 (2022).
24. Shitikov, E. et al. Genome-Wide Transcriptional Response of Mycobacterium
smegmatis MC2155 to G-Quadruplex Ligands BRACO-19 and TMPyP4. Front.
Microbiol. 13, (2022).
25.
er
Molnár, O. R., Végh, A., Somkuti, J. & Smeller, L. Characterization of a G-quadruplex
from hepatitis B virus and its stabilization by binding TMPyP4, BRACO19 and
PhenDC3. Sci. Rep. 11, 1–11 (2021).
pe
ot
tn
rin
ep
Pr

This preprint research paper has not been peer reviewed. Electronic copy available at: https://ssrn.com/abstract=4816754