Professional Documents
Culture Documents
(Download PDF) Lehninger Principles of Biochemistry 7th Edition Nelson Solutions Manual Full Chapter
(Download PDF) Lehninger Principles of Biochemistry 7th Edition Nelson Solutions Manual Full Chapter
https://testbankfan.com/product/lehninger-principles-of-
biochemistry-7th-edition-nelson-test-bank/
https://testbankfan.com/product/lehninger-principles-of-
biochemistry-6th-edition-nelson-solutions-manual/
https://testbankfan.com/product/lehninger-principles-of-
biochemistry-6th-edition-nelson-test-bank/
https://testbankfan.com/product/principles-of-biochemistry-5th-
edition-moran-test-bank/
Principles of Biochemistry 4th Edition Horton Test Bank
https://testbankfan.com/product/principles-of-biochemistry-4th-
edition-horton-test-bank/
https://testbankfan.com/product/principles-of-medical-
biochemistry-3rd-edition-meisenberg-test-bank/
https://testbankfan.com/product/principles-of-microeconomics-7th-
edition-gottheil-solutions-manual/
https://testbankfan.com/product/principles-of-communications-7th-
edition-ziemer-solutions-manual/
https://testbankfan.com/product/principles-of-economics-7th-
edition-gottheil-solutions-manual/
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-98
chapter
9 DNA-Based Information
Technologies
1. Engineering Cloned DNA When joining two or more DNA fragments, a researcher can adjust the
sequence at the junction in a variety of subtle ways, as seen in the following exercises.
(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction
digest (include those sequences remaining from the EcoRI recognition sequence).
(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and
the four deoxynucleoside triphosphates (see Fig. 8–34).
(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in
(b) are ligated (see Fig. 25–16).
(d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that
degrades only single-stranded DNA.
(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (d).
(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction
digest (include those sequences remaining from the PvuII recognition sequence).
(g) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end
with structure (f).
(h) Suppose you can synthesize a short duplex DNA fragment with any sequence you desire. With
this synthetic fragment and the procedures described in (a) through (g), design a protocol that
would remove an EcoRI restriction site from a DNA molecule and incorporate a new BamHI
restriction site at approximately the same location. (See Fig. 9–2.)
(i) Design four different short synthetic double-stranded DNA fragments that would permit ligation
of structure (a) with a DNA fragment produced by a PstI restriction digest. In one of these
fragments, design the sequence so that the final junction contains the recognition sequences for
both EcoRI and PstI. In the second and third fragments, design the sequence so that the junction
contains only the EcoRI and only the PstI recognition sequence, respectively. Design the
sequence of the fourth fragment so that neither the EcoRI nor the PstI sequence appears in the
junction.
S-98
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-99
(5⬘),GAATTC,(3⬘)
(3⬘),CTTAAG,(5⬘)
would yield two fragments:
(5⬘),GAATTAATTC,(3⬘)
(3⬘),CTTAATTAAG,(5⬘)
(d) The fragments in (a) have sticky ends, with a protruding single-stranded region. Treat-
ment of these DNA fragments with a single-strand-specific nuclease will yield DNA frag-
ments with blunt ends:
(5⬘),GAATTC,(3⬘)
(3⬘),CTTAAG,(5⬘)
The same recombinant DNA molecule is produced by joining the right-hand fragment in
(b) to the left-hand fragment in (d).
(f) The recognition sequence for PvuII is (5⬘)CAGCTG(3⬘), with the cleavage site between
G and C (see Table 9–2). Thus, a DNA molecule with a PvuII site will yield two frag-
ments when digested with PvuII:
(5⬘),GAATTCTG,(3⬘)
(3⬘),CTTAAGAC,(5⬘)
The same recombinant DNA is produced by joining the right-hand fragment in (b) to the
left-hand fragment in (f):
(5⬘),CAGAATTC,(3⬘)
(3⬘),GTCTTAAG,(5⬘)
(h) There are two ways to convert an EcoRI restriction site to a BamHI restriction site.
Method 1: Digest DNA with EcoRI, and then create blunt ends by using either DNA
polymerase I to fill in the single-stranded region as in (b) or a single-strand-specific nu-
clease to remove the single-stranded region as in (d). Ligate a synthetic linker that con-
tains the BamHI recognition sequence (5⬘)GGATCC(3⬘) (see Table 9–2),
(5⬘)GCGGATCCCG(3⬘)
(3⬘)CGCCTAGGGC(5⬘)
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-100
between the two blunt-ended DNA fragments to yield, if the EcoRI-digested DNA is
treated as in (b),
(5⬘),GAATTGCGGATCCCGAATTC,(3⬘)
(3⬘),CTTAACGCCTAGGGCTTAAG,(5⬘)
or, if the EcoRI-digested DNA is treated as in (d),
(5⬘),GGCGGATCCCG(3⬘)
(3⬘),CCGCCTAGGGC(5⬘)
Notice that the EcoRI site is not regenerated after ligation of the linker.
Method 2: This method uses a “conversion adaptor” to introduce a BamHI site into
the DNA molecule. A synthetic oligonucleotide with the sequence (5⬘)AATTGGATCC(3⬘)
is partially self-complementary, and it spontaneously forms the structure
(5⬘)AATTGGATCC(3⬘)
(3⬘) CCTAGGTTAA(5⬘)
The sticky ends of this adaptor are complementary to the sticky ends generated by
EcoRI digestion, so the adaptor can be ligated between the two EcoRI fragments to form
(5⬘),GAATTGGATCCAATT,(3⬘)
(3⬘),CTTAACCTAGGTTAA,(5⬘)
Because ligation between DNA molecules with compatible sticky ends is more efficient than
ligation between DNA molecules with blunt ends, Method 2 is preferred over Method 1.
(i) Joining of the DNA fragments in (a) to a fragment generated by PstI digestion requires a
conversion adaptor. This adaptor should contain a single-stranded region complementary
to the sticky end of an EcoRI-generated DNA fragment, and a single-stranded region
complementary to the sticky end generated by PstI digestion. The four adaptor se-
quences that fulfill this requirement are shown below, in order of discussion in the prob-
lem (N ⫽ any nucleotide):
(5⬘)AATTCNNNNCTGCA(3⬘)
(3⬘)GNNNNG(5⬘)
(5⬘)AATTCNNNNGTGCA(3⬘)
(3⬘)GNNNNC(5⬘)
(5⬘)AATTGNNNNCTGCA(3⬘)
(3⬘)CNNNNG(5⬘)
(5⬘)AATTGNNNNGTGCA(3⬘)
(3⬘)CNNNNC(5⬘)
For the first adaptor: Ligation of the adaptor to the EcoRI-digested DNA molecule
would yield
(5⬘),GAATTCNNNNCTGCA(3⬘)
(3⬘),CTTAAGNNNNG(5⬘)
This product can now be ligated to a DNA fragment produced by a PstI digest, which has
the terminal sequence
(5⬘)G,(3⬘)
(3⬘)ACGTC,(5⬘)
to yield
(5⬘),GAATTCNNNNCTGCAG,(3⬘)
(3⬘),CTTAAGNNNNGACGTC,(5⬘)
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-101
(5⬘),GAATTCNNNNGTGCAG,(3⬘)
(3⬘),CTTAAGNNNNCACGTC,(5⬘)
The EcoRI site is retained, but not the PstI site.
For the third adaptor:
(5⬘),GAATTGNNNNCTGCAG,(3⬘)
(3⬘),CTTAACNNNNGACGTC,(5⬘)
The PstI site is retained, but not the EcoRI site.
For the fourth adaptor:
(5⬘),GAATTGNNNNGTGCAG,(3⬘)
(3⬘),CTTAACNNNNCACGTC,(5⬘)
Neither the EcoRI nor the PstI site is retained.
2. Selecting for Recombinant Plasmids When cloning a foreign DNA fragment into a plasmid, it is
often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracy-
cline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify
clones containing recombinant plasmids with foreign DNA. With a bacteriophage l vector it is not nec-
essary to do this, yet one can easily distinguish vectors that incorporate large foreign DNA fragments
from those that do not. How are these recombinant vectors identified?
Answer Bacteriophage l DNA can be packaged into infectious phage particles only if it is be-
tween 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage l vector have
about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional,
foreign DNA is of sufficient length: 10,000 to 23,000 bp.
3. DNA Cloning The plasmid cloning vector pBR322 (see Fig. 9–3) is cleaved with the restriction
endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage)
is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform
bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline.
(a) In addition to the desired recombinant plasmid, what other types of plasmids might be found
among the transformed bacteria that are tetracycline resistant? How can the types be distin-
guished?
(b) The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three
different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giv-
ing the patterns shown below. What does each pattern say about the cloned DNA? Note that in
pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no
cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
c09DNA-BasedInformationTechnologies.qxd 7/18/16 7:52 AM Page S-102
Nucleotide
1 2 3 4
length
5,000
Electrophoresis
3,000
1,500
1,000
750
500
250
Answer
(a) Ligation of the linear pBR322 to regenerate circular pBR322 is a unimolecular process
and thus occurs more efficiently than the ligation of a foreign DNA fragment to the
linear pBR322, which is a bimolecular process (assuming equimolar amounts of linear
pBR322 and foreign DNA in the reaction mixture). The tetracycline-resistant bacteria
would include recombinant plasmids and plasmids in which the original pBR322 was
regenerated without insertion of a foreign DNA fragment. (These would also retain
resistance to ampicillin.) In addition, two or more molecules of pBR322 might be ligated
together with or without insertion of foreign DNA.
(b) The clones giving rise to the patterns in lanes 1 and 2 each have one DNA fragment
inserted, but in different orientations (see the diagrams, which are not drawn to scale;
keep in mind that the products on the gel are from EcoRI cleavage). The clone produc-
ing the pattern in lane 3 has two DNA fragments, ligated such that the EcoRI-site
proximal ends are joined.
PstI EcoRI
EcoRI
EcoRI
PstI PstI
EcoRI
PstI EcoRI PstI PstI
EcoRI EcoRI
EcoRI
PstI PstI
4. Restriction Enzymes The partial sequence of one strand of a double-stranded DNA molecule is
5⬘---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG---3⬘
The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.
EcoRI PstI
g g
* *
(5 ) GAATTC (3 ) (5 ) CTGCAG (3 )
CTTAAG GACGTC
*g *
g
Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with
both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand
sequence given above.
Answer Begin by writing the sequence of the double-stranded molecule and identifying any
restriction sites for EcoRI and PstI.
PstI EcoRI
g g
* *
(5 )---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG---(3 )
(3 )---CTGCTTCACGACGTCTTTCAGGCGCAATTACCGTACTTAAGGACACC---(5 )
*g * g
If the molecule is cleaved by the enzymes at the sites shown, the fragment will be reduced to
(5 )GAAAGTCCGCGTTATAGGCATG(3 )
(3 )ACGTCTTTCAGGCGCAATTACCGTACTTAA(5 )
(3 )---GACGAAGTGCTGCA AATTCCTGAGG---(3 )
(5 )---CTGCTTCACG GGACACC---(5 )
5. Designing a Diagnostic Test for a Genetic Disease Huntington disease (HD) is an inherited neu-
rodegenerative disorder, characterized by the gradual, irreversible impairment of psychological, motor,
and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any
age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is becoming
better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein
(Mr 350,000) of unknown function. In individuals who will not develop HD, a region of the gene that
encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine) that is re-
peated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically repeated
40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than 70 times. The
length of this simple trinucleotide repeat indicates whether an individual will develop HD, and at ap-
proximately what age the first symptoms will occur.
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-104
A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below.
The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the
gene below it, and the CAG repeat is shaded. Using Figure 27–7 to translate the genetic code, outline a
PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must
be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein
is displayed with the coding strand—the sequence identical to the mRNA transcribed from the gene
(except for U replacing T)—on top, such that it is read
307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC
1 M A T L E K L M K A F E S L K S F
358 CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
18 Q Q F Q Q Q Q Q Q Q Q Q Q Q Q Q Q
409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG
35 Q Q Q Q Q Q Q Q Q P P P P P P P P
460 CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG
52 P P P Q L P Q P P P
Source: The Huntington’s Disease Collaborative Research Group, Cell 72: 971, 1993.
Answer Your test would require DNA primers, a heat-stable DNA polymerase, deoxynucleo-
side triphosphates, and a PCR machine (thermal cycler). The primers would be designed to
amplify a DNA segment encompassing the CAG repeat. The DNA strand shown is the coding
strand, oriented 5⬘→ 3⬘ left to right. The primer targeted to DNA to the left of the repeat
would be identical to any 25-nucleotide sequence shown in the region to the left of the CAG
repeat. Such a primer will direct synthesis of DNA across the repeat from left to right. The
primer on the right side must be complementary and antiparallel to a 25-nucleotide
sequence to the right of the CAG repeat. Such a primer will direct 5⬘→ 3⬘ synthesis of DNA
across the repeat from right to left. Choosing unique sequences relatively close to the CAG
repeat will make the amplified region smaller and the test more sensitive to small changes in
size. Using the primers, DNA including the CAG repeat would be amplified by PCR, and its
size would be determined by comparison to size markers after electrophoresis. The length of
the DNA would reflect the length of the CAG repeat, providing a simple test for the disease.
Such a test could be carried out on a blood sample and completed in less than a day.
6. Using PCR to Detect Circular DNA Molecules In a species of ciliated protist, a segment of
genomic DNA is sometimes deleted. The deletion is a genetically programmed reaction associated with
cellular mating. A researcher proposes that the DNA is deleted in a type of recombination called site-
specific recombination, with the DNA on either end of the segment joined together and the deleted
DNA ending up as a circular DNA reaction product.
proposed
reaction
Suggest how the researcher might use the polymerase chain reaction (PCR) to detect the presence of
the circular form of the deleted DNA in an extract of the protist.
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-105
Answer Design PCR primers complementary to DNA in the deleted segment, but which
would direct DNA synthesis away from each other. No PCR product will be generated unless
the ends of the deleted segment are joined to create a circle.
7. Glowing Plants When grown in ordinary garden soil and watered normally, a plant engineered to
express green fluorescent protein (see Fig. 9–16) will glow in the dark, whereas a plant engineered to
express firefly luciferase (see Fig. 8-36) will not. Explain these observations.
Answer The plant expressing firefly luciferase must take up luciferin, the substrate of lu-
ciferase, before it can “glow” (albeit weakly). The plant expressing green fluorescent protein
glows without requiring any other compound.
A B C D E F
1 Nine
2 restriction
fragments
3
Electrophoresis
4
5
8
9
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-106
Answer Solving a restriction fragment map is a logic puzzle. The agarose gel shows which
fragments are part of each clone, but deducing their order on the chromosome takes some
work.
Clone A: fragments 1, 3, 5, 7, and 9
Clone B: fragments 2, 3, 4, 6, 7, and 8
Clone C: fragments 1, 3, 4, 5, and 7
Clone D: fragments 2, 3, 4, 5, and 7
Clone E: fragments 1, 5, and 9
Clone F: fragments 2, 4, 6, and 7
Begin with clone E, which has the fewest fragments. Fragments 1, 5, and 9 must be adjacent,
but may be in any order. However, clone C includes fragments 1 and 5, but not 9, so we can
conclude that fragments 1 and 5 are adjacent; 9 could be adjacent to either 1 or 5, but is not
between them (i.e., the order is 9-1-5 or 1-5-9). Clones C and D are identical except that C
also includes fragment 1, and D also includes fragment 2; from this we can deduce that frag-
ments 1 and 2 must be at opposite ends of the overlapping region, which includes fragments
3, 4, 5, and 7 (in an as yet undetermined order). Because we have already concluded that
fragments 1 and 5 are adjacent, we can propose the following sequence: 1-5-(3,4,7)-2.
To find the order of fragments 3, 4, and 7, look for fragments that contain a subset of
these with a flanking fragment. Clone A includes fragments 5, 3, and 7, but not 4 (thus,
5-(3,7)-4); clone F includes fragments 4, 7, and 2 (thus, (4,7)-2). Combining these possibili-
ties allows us to deduce the order as 1-5-3-7-4-2. We concluded earlier that 9 is adjacent to
either 1 or 5. If it were adjacent to 5, it would be a part of clones C and D; because it is not in
C or D, it must be adjacent to 1.
We can now propose the following sequence: 9-1-5-3-7-4-2. Because clone F includes
these last three fragments and fragment 6, we can append 6 after 2: 9-1-5-3-7-4-2-6. Finally,
clone B is the only one that includes fragment 8, so it must occur at either end of our deduced
sequence. Given the other fragments in clone B, fragment 8 must be adjacent to fragment 6.
Thus, we have the order 9-1-5-3-7-4-2-6-8.
The fragments were numbered based on their migration distance in the gel, which corre-
lates inversely with the size of the fragment. Fragment 1 is the longest; fragment 9 the short-
est. The relative sizes and the positions of the fragments on the chromosome are shown be-
low. Molecular weight markers in the gel would allow a better estimation of the sizes of the
various fragments.
9 1 5 3 7 4 2 6 8
A
B
C
D
E
F
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-107
Answer The production of labeled antibodies is difficult and expensive. The labeling of every
antibody to every protein target would be impractical. By labeling one antibody preparation
for binding to all antibodies of a particular class, the same labeled antibody preparation can be
used in many different immunofluorescence experiments.
10. Yeast Two-Hybrid Analysis You are a researcher who has just discovered a new protein in a fungus.
Design a yeast two-hybrid experiment to identify the other proteins in the fungal cell with which your
protein interacts and explain how this could help you determine the function of your protein.
Answer Express the desired protein (Protein X in Fig. 9–21) in yeast strain 1 as a fusion pro-
tein with one of the domains of Gal4p—say, the DNA-binding domain. Using yeast strain 2,
make a library in which essentially every protein of the fungus is expressed as a fusion protein
with the activation domain of Gal4p. If you mate strain 1 with the strain 2 library, some of the
resulting colonies will express both the Protein X–Gal4p DNA-binding domain fusion protein
and a fusion protein with one domain that interacts with Protein X and a Gal4p activation do-
main. Only in these colonies, where the binding of Protein X to Protein Y brings the fused
Gal4p domains in proximity, will there be transcription of the reporter gene that will color the
colonies, making them detectable. Sequencing and identifying all “Y” proteins that X interacts
with can help identify the function of X in the cell.
11. Use of Photolithography to Make a DNA Microarray Figure 9–22 shows the first steps in the
process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining
steps needed to obtain the desired sequences (a different four-nucleotide sequence on each of the
four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide se-
quence attached at each spot.
Answer Cover spot 4, add solution containing activated T, irradiate, and wash. The resulting
sequences are now
1. A-T 2. G-T 3. A-T 4. G-C
Cover spots 2 and 4, add solution containing activated G, irradiate, and wash.
1. A-T-G 2. G-T 3. A-T-G 4. G-C
Cover spot 3, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C 3. A-T-G 4. G-C-C
Cover spots 1, 3, and 4, add solution containing activated C, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G 4. G-C-C
Cover spots 1 and 2, add solution containing activated G, irradiate, and wash.
1. A-T-G-C 2. G-T-C-C 3. A-T-G-C 4. G-C-C-C
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-108
Answer The Orangutan is the outgroup against which the human and Chimpanzee are being
compared to determine the likely sequence of the protein in their last common ancestor. The
orangutan protein shares the W of the chimpanzee, the V of the human, and has the DG that
is present in the chimpanzee but lacking in the human. Therefore, the sequence of the pro-
tein in the last common ancestor is likely to be:
ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV
13. Human Migrations I Native American populations in North and South America have mitochondrial
DNA haplotypes that can be traced to populations in northeast Asia. The Aleut and Eskimo populations
in the far northern parts of North America possess a subset of the same haplotypes that link other Native
Americans to Asia, and also have several additional haplotypes that can be traced to Asian origins but
are not found in native populations in other parts of the Americas. Provide a possible explanation.
Answer The northeast Asian haplotypes shared by all Native American populations reveal the
Asian origins of these populations. The unique haplotypes found in the Aleut and Eskimo pop-
ulations strongly indicate that these populations migrated from Asia in a separate migration
event, occurring at a different time or involving different subpopulations from northeast Asia,
or both.
14. Human Migrations II DNA (haplotypes) originating from the Denisovans can be found in the genomes
of Indigenous Australians and Melanesian Islanders. However, the same DNA markers are not found in
the genomes of people native to Africa. Explain.
Answer All of the human migration paths began in Africa and branched out as the paths
moved through the Middle East, Asia, and Europe. Australia and Melanesia are endpoints of
some of the migration paths through Asia. The presence of Denisovan markers in Australian
and Melanesian populations (and their absence in all others) suggests that these human popu-
lations encountered the Denisovans, but others did not. The Denisovan remains were discov-
ered in Asia, so the encounter presumably occurred there. Thus, interbreeding between
Denisovans and the Homo sapiens groups that ended up in Australia and Melanesia most
likely took place at a late stage of the migrations of these populations through Asia.
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-109
15. Finding Disease Genes You are a gene hunter, trying to find the genetic basis for a case inherited dis-
ease. Examination of six pedigrees of families affected by the disease provides inconsistent results. For
two of the families, the disease is co-inherited with markers on chromosome 7. For the other four families,
the disease is co-inherited with markers on chromosome 12. Explain how this might have arisen.
Answer Although an inherited disease can be caused by a defect in a single protein, which
would generally be confined to a single site on one chromosome, a disease may also be caused
by a deficiency in a pathway. In this case a deficiency in any of the enzymes in the pathway
could produce the same phenotype and the same disease. In many cellular processes, two or
more different proteins act in concert to produce a particular outcome (a product or a signal)
so that a deficiency of any of them would cause a disease. Thus, the same disease condition
can be caused by a defect in one of several genes, which may be on different chromosomes.
4. Treat the labeled molecules with DNases to break them into a mixture of mono-, di-, and
trinucleotides.
5. Determine the sequence of the labeled mono-, di-, and trinucleotides by comparing them with
oligonucleotides of known sequence on thin-layer chromatography.
The labeled products were identified as follows: mononucleotides: A and G; dinucleotides:
(5⬘)ApA-(3⬘) and (5⬘)GpA(3⬘); trinucleotides: (5⬘)ApApC(3⬘) and (5⬘)GpApC(3⬘).
(e) Which model of cleavage is consistent with these results? Explain your reasoning.
Kelly and Smith went on to determine the sequence of the 3⬘ ends of the fragments. They found a
mixture of (5⬘)TpC(3⬘) and (5⬘)TpT(3⬘). They did not determine the sequence of any trinucleotides at
the 3⬘ end.
(f) Based on these data, what is the recognition sequence for the nuclease and where in the
sequence is the DNA backbone cleaved? Use Table 9–2 as a model for your answer.
Answer
(a) DNA solutions are highly viscous because the very long molecules are tangled in solu-
tion. Shorter molecules tend to tangle less and form a less viscous solution, so decreased
viscosity corresponds to shortening of the polymers—as caused by nuclease activity.
(b) An endonuclease. An exonuclease removes single nucleotides from the 5⬘ or 3⬘ end and
would produce TCA-soluble 32P-labeled nucleotides. An endonuclease cuts DNA into
oligonucleotide fragments and produces little or no TCA-soluble 32P-labeled material.
(c) The 5⬘ end. If the phosphate were left on the 3⬘ end, the kinase would incorporate signif-
icant 32P as it added phosphate to the 5⬘ end; treatment with the phosphatase would
have no effect on this. In this case, samples A and B would incorporate significant
amounts of 32P. When the phosphate is left on the 5⬘ end, the kinase does not incorpo-
rate any 32P: it cannot add a phosphate if one is already present. Treatment with the
phosphatase removes 5⬘ phosphate, and the kinase then incorporates significant
amounts of 32P. Sample A will have little or no 32P, and B will show substantial 32P
incorporation—as was observed.
(d) Random breaks would produce a distribution of fragments of random size. The produc-
tion of specific fragments indicates that the enzyme is site-specific.
(e) Cleavage at the site of recognition. This produces a specific sequence at the 5⬘ end of
the fragments. If cleavage occurred near but not within the recognition site, the se-
quence at the 5⬘ end of the fragments would be random.
(f) The results are consistent with two recognition sequences, as shown below, cleaved
where shown by the arrows:
g
(5⬘),GTT AAC,(3⬘)
(3⬘),CAA TTG,(5⬘)
h
which gives the (5⬘)pApApC and (3⬘)TpTp fragments; and
g
(5⬘),GTC GAC,(3⬘)
(3⬘),CAG CTG,(5⬘)
h
which gives the (5⬘)pGpApC and (3⬘)CpTp fragments.
c09DNA-BasedInformationTechnologies.qxd 7/15/16 11:13 AM Page S-111
References
Kelly, T.J. & Smith, H.O. (1970) A restriction enzyme from Haemophilus influenzae: II. Base sequence of the recognition site.
J. Mol. Biol. 51, 393– 409.
Smith, H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenzae: I. Purification and general properties.
J. Mol. Biol. 51, 379–391.
Another random document with
no related content on Scribd:
the first landing, again on June 4, and again in August when the
ambitious advance was made from Anzac and Suvla, victory had
been in sight, and the lack of reserves had robbed the Dardanelles
army of the triumph for which they had paid so heavy a price.
On arrival at the crowded beach they awaited their turn to board
the “beetles.” The French had a number of haystacks on the shore,
and had posted a sentry to give warning of the coming of the shells
by blowing a horn the instant that he saw the flash from an “Asiatic
Annie” across the Straits. The bursting of the shell had been timed to
follow the flash by twenty-three seconds, so the sounding of the horn
was the signal for a rush to the haystacks or other available cover.
These were seconds of extreme tension until the crash came and
men realized that they at any rate had respite for a time; though in
the dark it was impossible to know what damage had been done
elsewhere. Piers were struck and great gaps made as parties were
about to cross. Throughout the long night the embarkation
proceeded, most of the men crossing the hulk of the River Clyde.[6]
The wind was rising, and the transfer from the lighters to the larger
transports was made dangerous by the roll of both vessels, and
much argument ensued between the Royal Navy and the Mercantile
Marine. In due course it was accomplished and, as the dawn showed
pink in the east, the convoy steamed away towards Mudros. Eight
months ago nearly 14,000 Lancashire Territorials had disembarked
on the inhospitable shores which were now receding. The Division
that left Gallipoli barely numbered 5000, though every battalion and
unit had received drafts from the second and third lines in England,
or from Egypt, and thousands of casualties had rejoined from
hospital. Few of the 14,000 who had landed in May with such high
hopes and in such good spirits, took part in the last melancholy
parade to the beaches, or sailed on this December day to Mudros,
but those few thought of what might have been, and of the great-
hearted comrades and brothers-in-arms whom they had left behind.
Many now lay in the cemetery above Lancashire Landing, a glorious
resting-place from which, when alive, they had looked out upon the
intense blue of the Ægean Sea, with the peaks of Imbros and
Samothrace to the west, to the south and east the coast of Asia
Minor and the straits, and direful Achi Baba to the north; others had
been buried where they fell. Soon the lovely blossoms of the rock-
rose and the gorgeous poppy would be covering their graves.
Perhaps to none of the survivors would these memories be more
poignant than to two of the padres, the Rev. E. T. Kerby, M.C.,[7] and
the Rev. F. W. Welbon, M.C., who had been untiring and absolutely
fearless in giving comfort to the dying, in performing the last rites
under fire, and in sharing the dangers and privations of the men in
the front line.
The Divisional Artillery remained behind, and also a small
detachment of Engineers and the 1st and 3rd Field Ambulances, all
attached for duty to the 13th Division. The more modern guns must
first be saved, and as each battery was withdrawn a battery of the
old 15-pounders of the 42nd Division was substituted, so there was
no cessation of fire during the day. For several nights no artillery fire
was permitted between 9 p.m. and 2 a.m., in order to accustom the
Turk to quiet nights with little or no firing. When the final evacuation
took place three of the old guns were taken away successfully and
the remainder destroyed. Some of the gunners and the greater part
of the R.A.M.C. left a few days before the curtain fell on the final
scene of the great tragedy of Gallipoli. The last men of the 42nd
Division—and among the very last of the allied forces—to leave the
peninsula were detachments of artillery and R.A.M.C. and a small
party of Engineers.
On the 7th of January the last fight was fought on Gallipoli. After
seven hours’ heavy bombardment the Turks attacked, but they found
the front line more heavily manned than it had been for months past,
and the attack failed. Probably they were surprised by the vigour of
their repulse, as they must have been convinced by now that the
Helles force was in process of evacuation. It is likely that the strong
opposition encountered led the Turk to believe that the British
departure was less imminent than he had hoped, and that he would
have to wait a little longer before he could catch his enemy on the
run. If his suspicions were lulled in this way it was fortunate that he
chose for his attack the day immediately preceding the final
evacuation. Heavy casualties were inflicted on both sides, and the
East Lancs R.A.M.C. men were hard at work without a pause from
5.30 p.m. to 3.30 a.m. on the 8th. Their good work in attending to the
wounded of the 13th Division brought them the personal thanks of
General Maude, who also sent a letter of appreciation to the
Divisional Commander. Lieutenant R. Hartley, R.F.A., distinguished
himself and upheld the Division’s reputation, by putting out a fire,
which had started in a wagon full of ammunition, at great personal
risk.
Other
Officers.
Ranks.
Divisional Headquarters 14 120
Divisional Signal Company, Cable Section and 5 229
Airline Section
Artillery and Divisional Ammunition Column 108 2,520
Royal Engineers 16 296
125th Brigade and Signal Section 124 1,764
126th Brigade and Signal Section 117 2,244
127th Brigade and Signal Section 114 1,584
A.S.C. Supply Details 9 77
R.A.M.C 24 537
Attached—
3rd County of London Yeomanry 5 93
1/2nd W. Lancs. Field Coy., R.E. 6 143
Monmouth R.E. 3 83
Sanitary Section, R.A.M.C. 1 22
19th Mobile Veterinary Section 1 12
1st Essex Regiment 26 934
2nd Hampshire Regiment 25 900
Total 598 11,558
(1) The northern caravan route along the coast through El Arish to
Kantara, the route by which Joseph’s brethren, and later the Holy
Family, and in more recent times Napoleon, had travelled from
Palestine to Egypt.
(2) The central Hassana—Ismailia route.
(3) The southern Akaba—Suez route.
Lack of water along the greater part of the central and southern
tracks renders them impracticable for any but a small, mobile,
desert-bred force, and against raiding parties of this description the
chain of posts under construction would be a sufficient defence. But
the El Arish—Katia—Kantara route is of a different character. Oases
are more numerous, and in the vicinity of Katia and Romani, within
twenty miles of the Canal, wells are plentiful, and the water, though
brackish, is drunk by animals, and to a certain extent by natives. No
army, British or Turkish, could occupy this region until water-pipes
and a railway had been laid, but the possibility of a rapid dash had to
be provided against, so the system of defence on the northern route
was extended to a point much farther east than was necessary in the
central and southern sections, and it included the coast of the Bay of
Tina and the water-bearing area around Katia and Romani.
Kantara was the base for this northern section, El Ferdan for the
central, and Shallufa, where the 42nd Division was stationed during
February and March, for the southern. Here trenches were dug and
revetted with wooden frames and hurdles backed with canvas; miles
of barbed-wire entanglements were put up; hutments of matting over
wooden frames for mess and recreation, sun-proof standings for
horses, and fly-proof larders were erected at the posts on the Canal
banks. Gangs hauled the chain-ferry, and every one was kept
steadily at work. In fact, the whole of the Canal zone for a hundred
miles from Port Said to Suez has been described as a vast hive of
workers; and the company humorist—who, by the way, always
alluded to the desert as “the croft”—would ask plaintively: “Is it true,
sir, that we’re staying here till we’ve got all the desert into
sandbags?”
Water for men and animals was obtained from the Nile, via the
Sweet Water Canal, which runs a few hundred yards west of the
Suez Canal. Darius the Persian is credited with the construction of
the Sweet Water Canal, which he used for transport between the
Mediterranean and the Red Sea. After Actium the remnant of
Cleopatra’s galleys took refuge therein. It fell into disuse for
centuries, and was restored by de Lesseps as a water-supply for his
workmen while the Suez Canal was under construction. There were
filtering plants at all pumping stations, and as Nile water contains the
parasite of the dreaded disease bilharziosis, there was a strict rule
against bathing in the Nile or the Sweet Water Canal. Water for the
troops was at first brought in barges from Suez and stored in tanks
on both sides of the Suez Canal, being distributed by camel
transport to the outposts in fanatis. A fantasse (plural, fanatis) is a
stoppered flat box of zinc which holds from ten to twelve gallons and
usually leaks a little. A camel carries a fantasse slung on either side.
As the scheme grew the engineers laid a six-inch water-main across
the desert, and thus the ancient prophecy that Palestine would never
be freed from the Turkish yoke until Nile water flowed into it was
fulfilled.
The third line of works was within easy walking Shallufa and Suez
distance of the Canal. It was good fun for the
veterans of Gallipoli to bandy repartees from the water with the
newly-trained drafts for India and Mesopotamia who, looking down
upon them from the towering decks of big transports, asked when
they were going to “do their bit,” instead of taking a seaside holiday
at an Egyptian pleasure-resort. Much booty in the form of tins of
cigarettes thrown by passengers on liners was gathered in by bold
swimmers. The weather was cool, and, in spite of very strenuous
labour in the loose sand, the stay at Shallufa was a pleasant holiday
as compared with conditions in Gallipoli. The sandstorms of March
were decidedly unpleasant, however, for the sand penetrated
everywhere. To attempt to keep it out of food, equipment, clothing or
lungs was quite futile, and a sandstorm would quickly fill the trenches
that had been dug at the cost of several days’ steady labour. These
sandstorms began with amazing regularity about midday and
continued until 6 p.m. All cooking had to be done before or after
these hours.
During the Shallufa period many officers and men returned to duty
from hospital. These would feel that this record of the 42nd Division
would be incomplete indeed were no reference made and no tribute
paid to the founder and the workers of the admirable Convalescent
Home at Alexandria, established in June, 1915, by Lady Douglas,
whose solicitude for the welfare of all ranks under her husband’s
command will be remembered with lasting gratitude by the Division.
The hospital was supported by the units and by subscriptions from
friends at home. In addition to the return of those who had been
absent through wounds and sickness, units were further
strengthened by small drafts from home—but numbers still remained
much below strength. The Division was weakened by the return to
England of time-expired Territorials, including a number of the best
men. Two officers who had been in command of their units
throughout the Gallipoli campaign also left the Shallufa camp for
England in the spring of 1916—Lieut.-Colonel S. L. Tennant, R.E., on
leave, and Major England, A.S.C., who left to take charge of the 66th
Divisional Train, the duties of Senior Supply Officer devolving upon
Captain A. Gillibrand.
The Artillery here received their 18-pounder guns—handed over
by the 29th Division—and their training and reorganization were
taken seriously in hand, with firing practice in the desert. The three
Field Ambulances remained on the Canal bank, and when not
engaged in training or in attending to the cases brought in on camels
or by light railways from the desert posts, were able to enjoy the
bathing in the Canal. Sick were conveyed by steam launch from
Kabrit and Genefa to Shallufa, and many of the high-temperature
cases were dipped and sponged in the cooling, refreshing water of
the Salt Lake. The Division settled down to a diet of “ginger, spit, and
polish,” the hard work, the swimming, games, sports, concerts—
including a singing competition “for the championship of Asia”—
proved wonderfully efficacious in restoring the vitality and the
smartness of the Division after its long spell of trench life. Invariably,
however, there is the man who has to acquire polish at the cost of
much tribulation to himself and to his immediate superiors. There
was, for instance, the sentry who failed to turn out the guard for the
Divisional Commander. In excuse he explained: “Well, sir, I didn’t
see at first that you were a Staff Colonel,” then, being of an amiable
disposition, he leant forward and added in confidential tones: “You
see, by rights I oughtn’t to be here at all. I’m the sanitary man!” It
was felt that this man was not a success, either as sentry or
diplomat.
During the last days of March and the first days of April, the
Division left Shallufa to camp in the desert about two miles north-
west of Suez. With the assistance of a Belgian contractor and native
carpenters the infantry, under the supervision of the engineers,
rapidly erected a large number of huts with double roofs of matting
and also long lines of stables. A macadam road was made through
the camp and was eventually extended to Kubri. A thorough course
of company, battalion, and brigade training was carried out here, the
physique and efficiency of the troops improving greatly in
consequence. Much of this training was carried out in the desert
west of Suez and along the ancient tower-marked road that leads to
Cairo—the “far end” of the very road which had become so familiar
to the Division in the first autumn and winter of the war. The
machine-gun sections had constant practice; and it was here that the
Brigade M.G. Companies took definite form as separate units.
Emphasis was laid on the training of the young officer; and the
offensive spirit was successfully fostered and stimulated. Once more
it was proved that close-order drill and punctilious discipline,
diversified and relieved by games and sports, formed the basis on
which that military ideal must be built up. Rugby, soccer, hockey, and
even donkey polo were played, and the Rugby team of the 5th
Manchesters won great renown. Canteens now provided cigarettes,
biscuits, chocolates, and other articles much appreciated by the
troops. A Dramatic Society was formed, and plays specially written
by Major G. B. Hurst were given at the “Theatre Royal.” The
rehearsals and presentation gave great fun.
While at Suez the Artillery brigades and batteries were renamed.
The 1st E.L. Brigade became the 210th Brigade, and the 2nd, 3rd,
and 4th became the 211th, 212th, and 213th respectively, each
having three four-gun batteries designated A, B, and C, with the
exception of the 213th Brigade, which consisted of two howitzer
batteries. After the Division left the Shallufa camp it was found that
the defences there were not progressing with sufficient rapidity, and
at the end of May the 7th and 8th Lancashire Fusiliers and the 127th
Infantry Brigade were sent to Kubri and Shallufa to assist the 54th
Division. In spite of the great heat, the Lancashire men, now more or
less acclimatized, got through more in a few days than the recently
arrived troops had accomplished in a month, and they received
deserved praise from the G.O.C. of the section for their work at
Manchester, Salford, Ashton, and other posts.
The heat in June was terrific, and a temperature of 120 degrees in
the shade—the difficulty being to find the shade!—was normal, and
on one or two occasions a midnight temperature of 105 degrees was
registered. During this hot period the scouts and signallers of the
125th Brigade, while taking part in a training scheme, were sent out
to the Ataka Hills, some seven or eight miles from camp, two parties
operating as opposing forces. Movement among the hills proved
more arduous than had been anticipated, and the men suffered
much from the blazing sun—the rays being refracted by the rocks—
and also from want of water. The greater part of them got back to
camp with considerable difficulty. A Yeomanry patrol and an
aeroplane were sent out on June 16, and parties of Arabs two days
later, to look for the missing, and the bodies of two men who had
died from heat and exhaustion were brought in. After this no training
was permitted between the hours of 8.30 a.m. and 6 p.m. For the
remaining ten hours of the day the average man could do little
except lie, lightly clad, envying the Russians in the Caucasian
snows, and dreaming of the invention or discovery of an ice-cold
drink that could be produced in unlimited quantities even in a desert,
and would remain unaffected by the temperature. But—
Khamsin winds made life almost unbearable, and bathing was the
one resource, for even bridge became too strenuous a game, though
nap was played occasionally by the energetic ones.
On June 19 the Division was ordered north to El Ferdan
take over from the 11th Division the El Ferdan
Section, the central section of the Canal zone, midway between
Ismailia and Kantara. The move was completed by the end of the
month. The 7th and 8th Lancashire Fusiliers took over the defences
at Ballah, a station on the Canal, and the 5th and 6th Lancashire
Fusiliers at Ballybunnion, a desert post about six miles to the east.
The 6th and 8th Manchesters and the 126th Brigade were stationed
at El Ferdan and Abu Uruk, about five miles north-east of El Ferdan.
The artillery was split up among the posts, the 210th Brigade at
Ballah and the 211th at El Ferdan, and during this period the
howitzer batteries were rearmed with 4·5 Q.F. howitzers. The 1st
Field Company, R.E., was at Ballah and Ballybunnion; the 2nd Field
Company at Abu Uruk, and the recently arrived 3rd Field Company
at Ferdan, where were also the 2nd and 3rd Field Ambulances. The
Division was now occupying the ground where, according to
tradition, the Israelites crossed the Red Sea. The 5th and 7th
Manchesters went as far north as Kantara, where they were
attached to the 52nd Division, and the friendship with the Lowland
Scots, begun and cemented in Gallipoli, was here revived. They also
took over posts from the 11th Manchesters, the first of the
“Kitchener” battalions of their own regiment.
The Engineer-in-Chief, Major-General H. B. Wright, called to his
aid the engineers of the Egyptian Government. Civil contractors,
labour and plant were brought down to the Canal and material was
requisitioned from all parts of the globe—from Australia, timber and
wire-netting, the latter to be used for road-making over the loose
sand; from India, water-pipes, matting and meat-safes; reed-matting
from the Sudan; the whole of her stock of Decauville (two-foot
gauge) railway material from Egypt; engines and pumps from
England; and from the United States, through Mr. J. Pierpont
Morgan, a shipload of water-pipes which were so precious as to
require a cruiser as escort. It was, however, upon the R.E. of the
Division and Corps that the brunt of the work fell, though it might
almost be said that the whole Division was temporarily transformed
into a corps of engineers. The system of communication maintained
by the Divisional Signal Company was extensive, all posts and
outlying positions being connected with Headquarters by cable, often
buried in the sand for many miles, and by visual signalling. Also all
posts had their own system of inter-communication by telephone.
Though the great heat continued during the six weeks in this section
there was often a cool breeze on the higher ground, and conditions
generally were far preferable to those prevailing in the dusty, fiery
atmosphere of Suez.
Toward the end of July information was received that a large
enemy force, led by German officers, and armed with German and
Austrian artillery and machine-guns, was moving, with a rapidity that
was surprising when the difficulties of the march of an army across
the desert are realized, westwards from El Arish. Before long aircraft
located Turkish troops at Oghratina Hod—a hod being a plantation of
date-palms—about ten miles east of Romani, held by the 52nd
Division. Aerial activity increased on both sides, and traffic swarmed
on the Romani road. The Turks meant to force a fight in the worst
possible season for British troops, and their march across the desert
was a notable military achievement.
It was now decided to transform the 8th Corps, of which the 42nd
Division formed part, into a Mobile Column, under Major-General the
Hon. H. A. Lawrence (a former Brigadier of the 127th Brigade) for
operations in the desert east of the fortified posts. Camels were to be
provided to carry all stores, such baggage as was absolutely
necessary, engineering, material, food, ammunition, and water. Kit
was cut down to the bare minimum. Wheeled transport was removed
as useless, and gun-carriages and limbers were fitted with pedrails
and equipped with extended splinter-bars to allow four animals to
pull abreast, each team consisting of twelve horses. Sand-carts and
camel cacolets would be provided for the R.A.M.C., and for the
engineers new equipment for well-sinking on an extensive scale,
with camels to carry the well-lining materials, troughs, pumps, tools,
etc.
In the last week of July the Division was hurriedly ordered north to
Kantara, the El Ferdan and Ballah area being handed over to the
54th Division and the 3rd Australian Light Horse Brigade. On the
29th and 30th of July the Mobile Column scheme was issued to unit
commanders in rough outline, details being left to them. A Base
Depot was formed at Ballah for the R.A. of the Mobile Force, and A
Battery, 210th Brigade, and certain Ammunition Column details
remained at the depot. The horse transport of the remainder of the
Division and the heavier baggage were left at the base camp at
Kantara.
The 127th Brigade, now complete, as the 5th and 7th Manchesters
had rejoined, was the advance brigade at Hill 70. On July 31 it
moved forward along the new railway to Gilban, together with the
Divisional Squadron, a battery of the 212th Brigade, R.F.A., the 3rd
Field Company, R.E., and the 3rd Field Ambulance. On the evening
of August 3 the 6th Manchesters proceeded to Pelusium, near the
coast and six miles north-west of Romani, to prepare defensive
works east of the railway line, and to cover the detraining of the rest
of the Brigade. Early in the morning of August 4 the sound of artillery
fire from the direction of Romani announced that the Turkish attack
had begun. The remainder of the Brigade was hurriedly ordered to
Pelusium, and at 3.27 p.m., as the last battalion was detraining,
Brig.-General Ormsby received the order to march at once in support
of the Anzacs, who were heavily engaged in the neighbourhood of
Mount Royston, to the south of Romani. At 3.30 p.m., within three
minutes of receipt of the order, the 5th, 7th, and 8th Manchesters
moved off without any transport—as none of the camels had arrived
—and also without their dinners, the stew which had been prepared
for them being left untouched. They passed through the 6th
Manchesters, who were ordered to remain in their positions covering
Pelusium, in order to escort and assist in organizing the expected
camel transport. Artillery, cavalry, and engineer detachments arrived
at Pelusium and moved forward, but nothing was seen or heard of
the camels until 11 p.m., when two long files, each of 1000 camels,
turned up. It was pitch dark, the transport was new to the Division,
and the task of sorting out the animals, allocating them to the various
units, loading them with fanatis, rations, ammunition and blankets,
was a stupendous one. But the 6th Manchesters understood what
every moment’s delay in delivering the goods—especially the water
—might mean to their comrades, and they put their backs into it. By
4 a.m. the camel convoys for the 127th Brigade and the attached
troops had been despatched on their trek into the desert, and the 6th
Manchesters had moved off to rejoin their Brigade.
The Turkish army numbered about 18,000 men, Battle of Romani,
including 4000 in reserve, and was well equipped. Aug. 4, 1916
The soldiers had been assured that during the
great Fast of Ramadan they should destroy the infidel and march
victoriously into Egypt. But General Lawrence, whose cavalry and
aircraft had been in touch with the advancing army since July 21,
had made very thorough preparations for its reception, and the Battle
of Romani was fought strictly in accordance with his plans, the
enemy conforming with pleasing docility to the tactics he laid down
for them. General Lawrence had a large force of artillery, cavalry,
and infantry in an entrenched camp at Romani, secured on the north
by the sea, and conspicuously protected on its eastern and southern
fronts by strong redoubts and entrenchments. The south-western
front, being left open ostentatiously, invited attack. The enemy could
not ignore the force at Romani and march on towards Kantara and
Dueidar, where the 42nd Division and two brigades of cavalry were
stationed, as they would then be taken in rear and flank by the
troops from Romani and in front by the Kantara force. They fell into
the trap. Their aircraft reported the strength of the British position to
the east and south of Romani and its apparent weakness to the
south-west. On the night of August 3 they had attacked the cavalry
outposts to the south of the camp, and had slowly driven them in. On
the morning of the 4th they made a strong feint, with the greater part
of their artillery, against the redoubts held by the 52nd Division on