Transcriptomic profiling and novel

insights into the effect of AG ablation

on gonad development in
Macrobrachium rosenbergii - eBook
PDF
Go to download the full and correct content document:
https://ebooksecure.com/download/transcriptomic-profiling-and-novel-insights-into-the
-effect-of-ag-ablation-on-gonad-development-in-macrobrachium-rosenbergii-ebook-pd
f/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...

(eBook PDF) Field Effect Transistors, A Comprehensive

Overview: From Basic Concepts to Novel Technologies

http://ebooksecure.com/product/ebook-pdf-field-effect-
transistors-a-comprehensive-overview-from-basic-concepts-to-
novel-technologies/

Validation of Food Preservation Processes Based on

Novel Technologies 1st Edition - eBook PDF

https://ebooksecure.com/download/validation-of-food-preservation-
processes-based-on-novel-technologies-ebook-pdf/

Value Investing And Behavioral Finance: Insights Into

Indian Stock Market Realities 1st Edition Parag Parikh
- eBook PDF

https://ebooksecure.com/download/value-investing-and-behavioral-
finance-insights-into-indian-stock-market-realities-ebook-pdf/

New insights on the antiviral effects of chloroquine

against coronavirus: what to expect for COVID-19? -
eBook PDF

https://ebooksecure.com/download/new-insights-on-the-antiviral-
effects-of-chloroquine-against-coronavirus-what-to-expect-for-
covid-19-ebook-pdf/
(eBook PDF) Program Evaluation: Embedding Evaluation
into Program Design and Development

http://ebooksecure.com/product/ebook-pdf-program-evaluation-
embedding-evaluation-into-program-design-and-development/

(eBook PDF) Catheter Ablation of Cardiac Arrhythmias

4th Edition

http://ebooksecure.com/product/ebook-pdf-catheter-ablation-of-
cardiac-arrhythmias-4th-edition/

(eBook PDF) Handbook of Research on the Impact of

Fandom in Society and Consumerism

http://ebooksecure.com/product/ebook-pdf-handbook-of-research-on-
the-impact-of-fandom-in-society-and-consumerism/

(eBook PDF) The Forms and Functions of Tort Law

(Concepts and Insights) 5th Edition

http://ebooksecure.com/product/ebook-pdf-the-forms-and-functions-
of-tort-law-concepts-and-insights-5th-edition/

Novel Catalytic and Separation Processes Based on Ionic

Liquids 1st Edition Edition Dickson Ozokwelu - eBook
PDF

https://ebooksecure.com/download/novel-catalytic-and-separation-
processes-based-on-ionic-liquids-ebook-pdf/
 Aquaculture 556 (2022) 738224

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Transcriptomic profiling and novel insights into the effect of AG ablation on

gonad development in Macrobrachium rosenbergii
Kianann Tan 1, Jiongying Yu 1, Shouli Liao , Jiarui Huang , Meng Li , Weimin Wang *
College of Fisheries, Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Key Lab of Freshwater Animal Breeding, Ministry of
Agriculture, Huazhong Agricultural University, Wuhan 430070, China

A R T I C L E I N F O A B S T R A C T

Keywords: Androgenic glands (AGs) regulate male sexual differentiation in M. rosenbergii, and AG ablation may induce sex-
Macrobrachium rosenbergii reversal and male-to-neofemale transformation. However, information on gonad development following AG
Androgenic gland ablation ablation is scarce. To investigate the effects of gonad development and sex reversal after AG ablation, we utilized
Transcriptomic profiling
transcriptomic profiling, RT–qPCR, and histological and morphological observation. Transcriptomic profiling
Sex-reversal
Gonad development
generated 42.32–42.92 million clean reads. A total of 94,747 unigenes were assembled with a total length,
average length, N50, and GC content of 160,460,655 bp, 1693 bp, 3438 bp, and 39.86%, respectively. Hsp70,
IGFBP7, Mar-Mrr, Serpin, TUBA3, CREB, EF1a, and BMP7 were identified as differentially expressed by gonad
transcriptome profiling after AG ablation. Interestingly, the Rap1, Hippo, PI3K, oxytocin, thyroid hormone, and
apoptosis signalling pathways were all found to be involved in the sex-reversal process by regulating cell pro­
liferation and gonad development and maintaining homeostasis. Sexual morphology features and histological
changes following AG ablation validated the sex reversal from male to neofemale. Sexual manipulation permits
monosex culture while considerably improving output yield. Taken together, these findings provide insight into
the sexual reversal mechanism of M. rosenbergii after AG ablation. The findings in this study may aid in the future
investigation of the sex-reversal mechanisms in other decapod species and offer a new breeding and culture
strategy for M. rosenbergii aquaculture industry.

1. Introduction
M. rosenbergii is a giant freshwater prawn from Malaysia and
Thailand (Aflalo et al., 2012). Under natural conditions, M. rosenbergii
can survive in both brackish and freshwater environments (Nagamine
et al., 1980). M. rosenbergii is an important freshwater prawn cultivation
species (Hasanuzzaman et al., 2009). The monosex culture has more
merit in the aquaculture sector, including growth enhancement and
reduced sexual territorial behaviour (Sagi and Aflalo, 2005). Many so­
lutions for realizing the monosex culture have been applied to crusta­
cean production over the last 30 years (Curtis and Jones, 1995;
Lawrence, 2004; Siddiqui et al., 1997). Some techniques, such as
androgenic gland ablation, androgenic gland transplantation, and
dsRNA and siRNA knockdown of insulin-like androgenic gland hormone
(IAG), have been developed to achieve monosex culture (Nagamine
et al., 1980; Ventura et al., 2012; Tan et al., 2020). The male repro­
ductive system accessory endocrine gland was discovered in Callinectes
sapidus and was initially described as a tubule accessary gland attached
at the end of the vas deferens (Cronin, 1947). This accessory gland was
formally named the androgenic gland in 1955 (Charniaux-Cotton,
1954). The androgenic gland regulates the sexual differentiation and
development of male primary and secondary characteristics in crusta­
ceans (Sagi et al., 1990). Some have observed that removing or trans­
planting the androgenic gland can lead to sex-reversal in decapods,
implying that the androgenic gland is crucial for sexual differentiation
(Aflalo et al., 2006; Barki et al., 2006; Manor et al., 2004; Nagamine
et al., 1980). Previous studies have shown that by removing the
androgenic gland during the early stages of sexual development, males
will sex reverse into neofemales (Sagi and Cohen, 1990; Ventura, 2018).
In contrast, after androgenic gland transplantation, the female external
sexual phenotype was degraded, oocyte production was retarded, and
vitellogenesis was inhibited (Charniaux-Cotton, 1957; Charniaux-Cot­
ton, 1962; Malecha et al., 1992).
Although it is generally understood that the androgenic gland

* Corresponding author.
E-mail addresses: kianann1987@webmail.hzau.edu.cn (K. Tan), yujiongying@webmail.hzau.edu.cn (J. Yu), wangwm@mail.hzau.edu.cn (W. Wang).
1
Kianann Tan and Jiongying Yu contributed equally to this work.

https://doi.org/10.1016/j.aquaculture.2022.738224
Received 7 September 2021; Received in revised form 29 March 2022; Accepted 4 April 2022
Available online 7 April 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
K. Tan et al.
functions as a regulator in male sex determination, differentiation, and
maintenance of male primary and secondary sexual characteristics
(Nagamine et al., 1980), the actual functional component is the andro­
genic gland hormone (also known as insulin-like androgenic gland
hormone, IAG). The androgenic gland secretes IAG in decapods (Ventura
et al., 2011). IAG has been extensively researched, and an ‘IAG switch’
has been proposed to regulate sexual development and differentiation in
decapods (Levy and Sagi, 2020). IAG expression ensures male sexual
determination, but IAG depletion results in sex reversal in male deca­
pods. According to some reports, knockdown of IAG using dsRNA or
siRNA induces sex-reversal, resulting in testis to ovary transformation
and the production of neofemales (Ventura et al., 2011; Tan et al.,
2020). Furthermore, the androgenic gland cell suspension approach
successfully yields WW chromosome males that lack a masculine Z
chromosome (Levy et al., 2019).
Many strategies have been used to examine sex-reversal mechanisms,
including transcriptome sequencing analysis (high-throughput
sequencing technology) and RNA interference (RNAi). However, the
utility of RNAi technology is limited. RNAi can only be used to inves­
tigate functional genes. Transcriptome sequencing analysis is the
collection of all transcription products in a cell under physiological
conditions (Guo et al., 2014; Li et al., 2014). Transcriptomic analysis can
be used to investigate gene transcription under certain conditions, as
well as the regulation and molecular mechanism of a biological network
(Li et al., 2014). High-throughput sequencing technology has sped up
the analysis of genomic or genetic information and has been widely
utilized to improve the economic traits of crops, livestock, and aqua­
culture species. In recent years, high-throughput sequencing has also
been applied to screen genes in crustaceans for economic traits, repro­
ductive growth and disease resistance (Jung et al., 2011; Ma et al.,
2012). A Macrobrachium nipponense androgenic gland transcriptome
study was performed, and the results revealed 47 novel sex-related gene
families. In comparison to the earlier transcriptome analysis of
M. nipponense (Ma et al., 2012; Qiao et al., 2012), 40 candidate genes
related to sex regulation were discovered (Jin et al., 2013).
Androgenic gland ablation in M. rosenbergii demonstrated the sig­
nificance of the androgenic gland in male sexual differentiation, as the
ablated males were entirely feminized into functional neofemales
(Aflalo et al., 2006; Sagi and Aflalo, 2005). However, research into the
molecular mechanisms involved in sex-reversal is scarce, particularly
during the transformation of the testis into the ovary, which involves
testis degeneration and ovary development following androgenic gland
ablation. The purpose of this study was to investigate the molecular
mechanisms that occur during the transformation of the testis to the
ovary following androgenic gland ablation. The effect of androgenic
gland ablation on gonad development and sex-reversal in M. rosenbergii
juveniles was investigated using transcriptomic profiling, histological
and morphological observation, and RT–qPCR.
2. Materials and methods
2.1. Experimental animals
All males (3–4 cm, carapace length; 2 months old) of M. rosenbergii
utilized in this experiment were reared and bred at the prawn breeding
hatchery of Huazhong Agricultural University, Wuhan, Hubei Province,
China. Males were cultivated in 300 L tanks. The culture tank’s water
was aerated, and the temperature was maintained at 28 ± 0.5 ◦ C.
M. rosenbergii was fed shrimp pellets (Yuequn, Guangdong, China) four
times a day. The nutrition content of the shrimp pellet was ≥54% crude
protein, ≥ 11% crude lipid, ≤ 15% ash, ≤ 2% crude fibre, and ≤ 10%
moisture. The Huazhong Agricultural University’s Scientific Ethics
Committee authorized the experimental methodologies and animals
used in this study. The Scientific Ethics Committee’s approval code is
HZAUFI-2019-012.
2
Aquaculture 556 (2022) 738224
2.2. Androgenic gland ablation
One hundred tails of male (3–4 cm) M. rosenbergii were chosen for
bilateral androgenic gland ablation. Before performing surgical abla­
tion, all surgical tools were disinfected using 1 ppm of complex iodine
solution (Bayer, Leverkusen, Germany). Male M. rosenbergii were
anaesthetized on ice for 10 s prior to surgical ablation. Surgical scissors
were used to remove the fifth pereiopods. Then, the terminal ampullae
and vas deferens were extracted from the body using surgical forceps.
The androgenic gland was attached to the medial concave surface at the
end of the vas deferens and terminal ampullae. Thus, removing the
terminal ampullae and vas deferens results in removal of the androgenic
gland. Fig. 1 depicts the AG ablation procedure. Following surgical
ablation, the wounds at the fifth pereiopods were disinfected using a
diluted iodine solution (Bayer, Leverkusen, Germany). The ablated
M. rosenbergii was transferred into a 300 L tank for further culture. The
water temperature was kept constant at 28 ± 0.5 ◦ C. M. rosenbergii was
fed shrimp pellets (Yuequn, Guangdong, China) three times a day. Dead
M. rosenbergii were removed from the culture tank.
2.3. Sample collections
Gonad specimens were collected every two weeks after androgenic
gland ablation for a total of 6 weeks (when the testis had completely
transformed into an ovary). The sampling weeks were assigned into four
stages: Stage 1: 0 days after androgenic gland ablation (week 0); Stage 2:
14 days after androgenic gland ablation (week 2); Stage 3: 28 days after
androgenic gland ablation (week 4); Stage 4: 42 days after androgenic
gland ablation (week 6). M. rosenbergii (n = 6) with androgenic gland
ablation were anaesthetized on ice for 3 min before dissection. To pre­
vent RNA degeneration, the gonad specimens (n = 3) were surgically
excised and immediately placed into liquid nitrogen. Total RNA
extraction was performed on the gonad specimens. Another set of gonad
specimens (testis and ovary, n = 3) were preserved in 4% para­
formaldehyde for subsequent histological observation.
2.4. Morphological and histological observation
During the sex-reversal process, changes in morphological features,
such as appendix masculinity, appendix interna, ovipositing setae,
ovigerous setae, genital papillae, brood chambers, and setal buds, were
observed. The collected gonad specimens (testis and ovary) were pre­
served in 4% paraformaldehyde for histological observation. The pre­
served specimens were cleaned and encased in paraffin wax. A
microtome (Leica, IL, USA) was used to cut six-micron thin sections,
which were then mounted onto glass microscope slides. Next, the slides
were counterstained with haematoxylin and eosin. An optical light mi­
croscope (Olympus, Tokyo, Japan) was used to observe the stained
slides.
2.5. RNA isolation and transcriptome sequencing
Total RNA was extracted from the testis and ovary tissues using
TRIzol Reagent (TaKaRa Bio Inc., Dalian, China) according to the
manufacturer’s protocol. The gDNA eraser (TaKaRa Bio Inc., Dalian,
China) was used to eliminate genomic DNA from isolated RNA samples.
The quantity and quality of isolated RNA were assessed using an Agilent
Bioanalyzer 2100 (Agilent Technologies, CA, USA) and a Nanodrop ND-
2000 spectrophotometer (Thermo Fisher Scientific, MA, USA), respec­
tively. The isolated RNAs were further quantified using the Qubit 2.0
fluorometer (Life Technologies, CA, USA), and an equal weight of iso­
lated RNA from the testis of each individual was pooled and reverse-
transcribed into cDNAs for sequencing as PE125 on the Illumina
HiSeq™ 2300 sequencer (Illumina, San Diego, USA) by BGI Genomic
(Shenzhen, China). For RNA sequencing, each sample at each stage was
sequenced in triplicate.
K. Tan et al.
Fig. 1. The androgenic gland ablation procedure. (A) Surgically removal of the fifth pereiopod. (B) Forceps were used to locate and pinched the terminal ampullae.
(C) Removed the terminal ampullae. (D) The terminal ampullae (with androgenic gland) and vas deferens of M. rosenbergii were entirely excised.
2.6. De novo assembly and annotation
After RNA sequencing, the FastQC application version 0.11.5
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc) was used
to evaluate and visualize the quality of raw reads. The NGS QC Toolkit
filtered and removed low-quality reads and those read with adaptors
(Patel and Jain, 2012). The Trinity platform, including Inchworm,
Chrysalis and Butterfly, was used to assemble the de novo transcriptome
into transcripts using Kmer = 25 (Grabherr et al., 2011). To obtain the
nonredundant unigenes, the TGI Clustering Tool version 2.1 was used to
remove further sequence splicing and redundancy (Pertea et al., 2003).
BLASTx version v2.2.26 was used to perform the annotation process,
with an E-value cut off point of 10− 5. The obtained unigenes were
blasted and annotated using NCBI nonredundant protein sequences
(NR), NCBI nucleotide sequences (NT), Swiss-Prot protein database,
Pfam, Kyoto Encyclopedia of Genes and Genomes (KEGG), euKaryotic
Orthology Groups (KOG), and Gene Ontology (GO).
2.7. Differentially expressed genes (DEGs) analysis
Bowtie2 software was used to quantify the number of reads that
mapped to the genes (Langmead and Salzberg, 2012). All read counts
from each sample were loaded into the R package DESeq2 for DEG
analysis (Love et al., 2014). The expected number of fragments per
kilobase of transcript sequence per million base pairs sequenced (FPKM
values) were used to predict differential gene expression levels, and the
FPKM values were calculated based on the base mean values. The p
value was regulated by the q value (false discovery rate), where the q
value <0.05 and | log2 (fold change) | > 1 were set as the thresholds for
significant differential expression. The GOseq package was used to
perform Gene Ontology (GO) enrichment analysis for the DEGs, which
was based on the Wallenius noncentral hypergeometric distribution
(Young et al., 2010). The significantly enriched pathways were
3
Aquaculture 556 (2022) 738224
identified using KOBAS 2.0 with a false discovery rate (FDR) ≤ 0.05 (Xie
et al., 2011).
2.8. Quantitative real-time PCR assay
Total RNA from the testis and ovary was isolated using TRIzol re­
agent (TaKaRa Bio Inc., Dalian, China) according to the manufacturer’s
instructions. The purity and quantity of isolated RNA samples were
determined using 1% agarose gel electrophoresis and a Nanodrop ND-
2000 spectrophotometer (Thermo Fisher Scientific, MA, USA). After
evaluation, the samples were stored at − 80 ◦ C until use. The Serpin
(Accession number: EL696020), Hsp70 (Accession number: AY466445),
MZT (Accession number: MH883364), CREB (Accession number:
JZ905131), Caspase (Accession number: KF878972), TUBA3 (Accession
number: EL696409), EF1a (Accession number: JZ905060), and IGFBP7
(Accession number: EL696430) genes were amplified using the forward
and reverse primers listed in Table 1. β-actin was employed as a refer­
ence gene, and its stability in M. rosenbergii has been confirmed
(Thongbuakaew et al., 2016). The forward and reverse primers for
β-actin are listed in Table 5. The first strand of cDNA was obtained by
reverse transcription utilizing the Prime Script RT Reagent kit with a
genomic DNA (gDNA) eraser (TaKaRa Bio Inc., Dalian, China). All
samples were examined using Quantstudio 6 Flex (Applied Biosystems,
Thermo Fisher, USA) to examine the transcription levels of Serpin,
Hsp70, MZT, CREB, Caspase, TUBA3, EF1a, IGFBP7, and β-actin. The
RT–qPCR analysis was performed in a 96-well plate with each well
containing 20 μL of reaction mixture. The reaction mixture contained 10
μL of SYBR Premix Ex Taq II (TaKaRa Bio Inc., Dalian, China), 0.4 μL of
each forward and reverse primer (10 μM), 2 μL of cDNA template, and
7.2 μL of sterilized double distilled water (ddH2O). The RT–qPCR con­
ditions were as follows: predenaturation at 95 ◦ C for 5 mins, followed by
40 cycles of amplification at 95 ◦ C for 10 s and 72 ◦ C for 15 s. Each
sample was tested in triplicate. Three replicates were used to calculate
K. Tan et al. Aquaculture 556 (2022) 738224

Table 1 KEGG pathway analysis, including organismal systems, metabolism,

Forward and reverse primers used for transcription level quantifi­ human diseases, genetic information processing, environmental infor­
cation by RT-qPCR. mation processing, and cellular processes (Table S5, Fig. S3). Among
Gene name Primer sequence (5′ to 3′ ) these genes, 5103, 2941, 2910, 2377, and 2370 were related to signal
Serpin-F GTCAGCATCACAACGGAAGG
transduction, the immune system, the endocrine system, translation,
Serpin-R TCCTCCTGATTTTCCTGGGG and transport and catabolism, respectively. For the KOG annotation,
Hsp70-F ACAAGGGTCGCCTCAGTAAA three functional types, metabolic pathways, information storage and
Hsp70-R CCTCTGGCACCTTGTCCTTA processing, and cellular processes and signalling, were identified and
MZT-F GGTCTTCCATCGCAGTTGTG
subsequently classified into 25 divisions. General function prediction
MZT-R CGTTGTCTGCTCCAATCCTG
CREB-F TGCGTAGTTGAGACCCATGT only (21.75%), signal transduction mechanisms (12.19%), function
CREB-R TTGAGGAAGCGCAAACACTG unknown (7.89%), and posttranslational modification, protein turnover,
Caspase-F CATCTTGAAGGCAGCGAGTC and chaperones (7.54%) were the most highly enriched terms in KOG
Caspase-R TCTGCAGGCCTGAATGAAGA functional annotation (Table S6, Fig. S4).
TUBA3-F TGGGCCAGACTTAACCACAA
TUBA3-R CCTTCGTCTCGGCCTCTTAA
EF1a-F CACCACGAAGCTCTGACTGA 3.3. Differential gene expression (DEGs) analysis
EF1a-R CAGTCGAGCACAGGGGAATA
IGFBP7-F CATCCCTTGCCAGAGAGACA The six comparative groups yielded a total of 17,799 differentially
IGFBP7-R CATTTGCCGCGTCTATTCCA
expressed genes (DEGs). There were 463, 7047, 1635, 2915, 494, and
β-actin-F CTCCATCATGAAGTGCGACG
β-actin-R AGGTGGGGCAATGATCTTGA 5245 significant DEGs found between the S1 vs. S2, S1 vs. S3, S1 vs. S4,
S2 vs. S3, S2 vs. S4 and S3 vs. S4 groups, respectively (Fig. 2A). Ten
DEGs were discovered through a three-way Venn diagram in the S1 vs.
the average value per gene. The 2-△△Ct method was used to calculate S2, S2 vs. S3, and S3 vs. S4 comparisons (Fig. 2B). The volcano plot il­
the transcript levels of each gene (Schmittgen and Livak, 2008). lustrates the upregulated and downregulated genes in the S1 vs. S2, S2
vs. S3, and S3 vs. S4 groups (Fig. 3). Based on NR annotation, heat shock
2.9. Statistical analysis protein 70 (hsp70), insulin-like growth factor binding protein (IGFBP7),
male reproductive-related protein A, male reproductive-related protein
SPSS 19.0 software (IBM Analytics, VA, USA) was used to examine all B, serine protease inhibitor (Serpin), chorion peroxidase-like (Pxt),
the statistical data. The homogeneity of the variances was tested by tubulin alpha 3 chain, and ccr4-not transcription complex subunit 6-like
Levene’s test. The residuals of the data were normally distributed by (CCR4) were identified to play important roles in sexual development
Shapiro-Wilk test. Then, the one-way analysis of variance (ANOVA) and the endocrine system. cAMP-responsive element binding protein
followed by Tukey-HSD test was used to evaluate significant differences (CREB), caspase 1, elongation factor 1-alpha (EF1a), DNA-direct RNA
between samples. The statistical significance threshold was set at p < polymerase III subunit RCP9 (CRCP), bone morphogenetic protein 7
0.05 (significant). (BMP7), and mitotic-spindle organizing protein (MZT) were also found
to be involved in gonad degeneration and development during testicular
3. Results to ovarian transformation. Table 3 displays the transcript levels of the
selected genes.
3.1. Transcriptome sequencing and assembly

The DNBSEQ platform was used to sequence 12 samples from 4

developmental stages, including S1–1, S1–2, S1–3, S2–1, S2–2, S2–3, Table 2
S3–1, S3–2, S3–3, S4–1, S4–2, and S4–3. A total of 43.82–45.57 million Summary statistics for the transcriptome sequencing data from each sample.a
raw reads were sequenced. A total of 42.32–42.92 million clean reads Stage Raw Clean Clean Clean reads Clean reads
were obtained after filtering and removing low-quality and contami­ reads (M) reads (M) bases (Gb) Q30 (%) Ratio (%)
nated reads (Table 2). Then, 94,747 unigenes with a total length, Stage 43.82 42.82 6.42 91.95 97.72
average length, N50, and GC content of 160,460,655 bp, 1693 bp, 3438 1–1
bp, and 39.86% were assembled, respectively (Table S1, Fig. S1). Stage 43.82 42.81 6.42 92.06 97.70
1–2
Furthermore, 37,851 coding sequences (CDSs) (Table S2) and 40,305 Stage 43.82 42.79 6.42 93.27 97.66
simple sequence repeats (SSRs) (Table S3) were discovered. The NGS 1–3
sequenced data are available in NCBI under the BioProject number Stage 43.82 42.74 6.41 93.12 97.53
PRJNA787407. 2–1
Stage 43.82 42.82 6.42 92.36 97.72
2–2
3.2. Functional annotation and classification of the transcriptome Stage 43.82 42.77 6.42 93.18 97.60
2–3
A total of 94,747 unigenes were then annotated against seven major Stage 43.82 42.84 6.43 93.11 97.75
3–1
functional databases (NR, NT, SwissProt, KEGG, KOG, Pfam, and GO),
Stage 43.82 42.87 6.43 92.94 97.84
resulting in 40,892 (NR: 43.16%), 20,738 (NT: 21.989%), 30,407 3–2
(SwissProt: 32.09%), 32,193 (KEGG: 33.98%), 29,130 (KOG: 30.75%), Stage 43.82 42.92 6.44 92.95 97.95
32,820 (Pfam: 34.64%), and 24,639 (GO: 26.01%). All annotated 3–3
unigenes were classified into three functional categories in the Gene Stage 43.82 42.79 6.42 92.94 97.66
4–1
Ontology (GO) classification: biological process (38.52%), molecular Stage 45.57 42.32 6.35 93.76 92.86
functions (33.31%), and cellular components (28.17%) (Table S4, 4–2
Fig. S2). Cellular anatomical entity and intracellular terms were signif­ Stage 43.82 42.56 6.38 93.20 97.12
icantly enriched in cellular components, followed by cellular process 4–3
and metabolic process in biological process. Binding and catalytic ac­ a
Note: Stage 1: 0 day after androgenic gland ablation; Stage 2: 14 days after
tivity were the most well-represented terms in the molecular function androgenic gland ablation; Stage 3: 28 days after androgenic gland ablation;
category. Annotated unigenes were assigned to six pathways in the Stage 4: 42 days after androgenic gland ablation.

4
K. Tan et al. Aquaculture 556 (2022) 738224

Fig. 2. The summary of identified DEGs. (A) The number of up- and down-regulated DEGs. (B) Three-way Venn diagram of all evidencing numbers of the DEGs
identified in the S1 vs S2, S2 vs S3, and S3 vs S4 comparisons.

Fig. 3. The expression volcano plot demonstrated the up- and down-regulated of identified DEGs. (A) S1 vs S2. (B) S2 vs S3. (C) S3 vs S4. Indication, Up: up-
regulated; Down: down-regulated.

3.4. Functional categorization (GO and KEGG) of DEGs

Table 3
The transcription level of annotated DEGs involved in the sexual development
Cellular anatomical entity, binding, catalytic activity, cellular pro­
and endocrine system.a
cess, intracellular, and metabolic process were revealed to have the
Gene annotation (matched species) Fold change highest number of candidate genes in the S1 vs. S2, S2 vs. S3, and S3 vs.
S1 vs S2 vs S3 vs S4 groups in the GO analysis of DEGs. A total of 130, 102, 63, 62, and 49
S2 S3 S4 candidate genes were enriched in cellular anatomical entity, binding,
Heat shock protein 70 [Macrobrachium rosenbergii] + 6.92 + 2.29 - 1.05 catalytic activity, cellular process, and intracellular, respectively, in the
Insulin-like growth factor binding protein 7 + 3.25 - 1.92 + 1.68 S1 vs. S2 group. In the S2 vs. S3 group, candidate genes in cellular
[M. rosenbergii] anatomical entity, binding, catalytic activity, cellular process, and
Male reproductive-related protein A + 6.22 - 2.79 0
[M. rosenbergii]
metabolic process were found to be 656, 572, 494, 357, and 252,
Male reproductive-related protein B [M. rosenbergii] + 4.82 - 0.78 0 respectively. The number of candidate genes for cellular anatomical
Serine protease inhibitor [M. rosenbergii] + 4.48 - 2.54 + 3.35 entity, binding, catalytic activity, cellular process, and metabolic pro­
Chorion peroxidase-like [Penaeus vannamei] + 3.36 - 0.85 +2.60 cess in the S3 vs. S4 group was 1142, 982, 828, 795, and 534, respec­
Tubulin alpha 3 chain [M. rosenbergii] 2.14 - 0.64 + 1.17
+
tively. Table 4 illustrates the involvement of GO terms (up- and
CCR4-NOT transcription complex subunit 9-like + 5.42 - 0.85 + 1.80
[P. vannamei] downregulated) in the S1 vs. S2, S2 vs. S3, and S3 vs. S4 groups. The
cAMP responsive element binding protein + 3.65 + 0.34 - 1.60 majority of DEGs were annotated into immune system, translation,
[Procambarus clarkii] signal transduction, signalling molecules and interaction, cell growth
Caspase 1 [P. vannamei] + 3.17 - 0.85 - 1.60 and death, endocrine system, and transport and catabolism in the KEGG
Elongation factor-1-alpha [M. rosenbergii] + 3.76 + 1.11 + 0.88
DNA-directed RNA polymerase III subunit RPC9- + 5.14 + 0.14 + 1.51
analysis. In the S1 vs. S2 group, a total of 53, 52, 29, 20, and 29
like [P. vannamei] candidate genes were annotated in the immune system, signal trans­
Bone morphogenetic protein 7 [Palaemon + 3.92 - 0.82 + 0.79 duction, signalling molecules and interaction, cell growth and death,
carinicauda] and endocrine system, respectively. Furthermore, in the S2 vs. S3 group,
Mitotic spindle organizing protein [M. rosenbergii] + 2.58 - 0.96 - 0.30
233, 167, 131, 130, and 86 candidate genes were assigned to signal
a
Indicator: ‘+’ represent up-regulated, ‘-’ represent down-regulated. transduction, the immune system, the endocrine system, transport and

5
K. Tan et al. Aquaculture 556 (2022) 738224

Table 4 the top KEGG signalling pathways and the number of annotated candi­
The list of GO terms (up- and down-regulated) in S1 vs S2, S2 vs S3, and S3 vs S4 date genes in each.
groups.
Group Go term 3.5. Histological and morphological study
Up-regulated Down-regulated
Histological observation is an excellent method for studying and
- Regulation of actin
examining changes in the testis after androgenic gland (AG) ablation.
- Integral component membrane cytoskeleton organization
- Chromatin remodeling - Cell-cell adhesion Prior to observation, the gonads were sectioned and stained with
S1 vs - ATP binding - Adherens junction haematoxylin-eosin. The seminiferous lobules of the testis can be easily
S2 - Extracellular region - Plasma membrane detected before AG ablation and are completely occupied with sper­
- Insulin receptor signalling pathway organization matozoa (Fig. 4A). The seminiferous lobules of the testis were loosely
- Initiation complex - Regulation of transcription
by RNA polymerase
oriented after two weeks of AG ablation, and many spermatocytes were
- mRNA processing - Metal ion binding observed (Fig. 4B). Four weeks after AG ablation, several previtellogenic
- RNA binding - Helicase activity oocytes and developing oocytes were observed (Fig. 4C). The sixth week
S2 vs - Growth factor activity - ATP binding after AG ablation, there was better proliferation of developing oocytes
S3 - Calcium ion binding - Ligase activity
(Fig. 4D) that looked like vitellogenic oocytes in the female ovary
- Bicellular tight junction assembly - Ubiquitin-protein
- - NAD binding transferase activity (Fig. 4E). Of note, the anatomy of the testis before AG ablation is com­
- Regulation of microtubule parable to that of a mature male (Fig. 4F).
polymerization or depolymerization - Metal ion binding After AG ablation, the sexual morphological features of the ablated
- Wnt signalling pathway - Protein kinase activity male changed, particularly in the gonopore flap, genital papillae, ap­
S3 vs
- Integral component of membrane - ATP binding
S4
- Intracellular signal transduction - voltage-gated chloride
pendix masculine, and appendix interna. The gonopore flap of
- Signal transduction channel activity M. rosenbergii can be seen at the ventral site 0 and 14 days following AG
- Protein phosphorylation ablation (Fig. 5A, B). Female phenotypes such as setal bud and brood
chamber were observed instead of gonopore flap and genital papillae as
development progressed (Fig. 5C, D). On the other hand, the appendix
catabolism, and cell growth and death, respectively. In the S3 vs. S4 masculine and appendix interna can be plainly seen on the second
group, a total of 388, 235, 201, 249, and 189 candidate genes were pleopod on 0 and 14 days after AG ablation (Fig. 5E, F). However, as
annotated into signal transduction, translation, endocrine system, im­ development progressed, the second pleopod, ovigerous setae and ovi­
mune system, and transport and catabolism, respectively. Table 5 shows positing setae (Fig. 5G, H) were observed instead of the appendix
masculine and appendix interna.

Table 5 3.6. RNA-seq validation and quantification analysis of mRNA with RT-
The list of KEGG signalling pathways and the number of annotated candidate
qPCR
genes.
Group Term Signalling pathway Gene Serpin, CREB, Caspase, TUBA3, EF1a, and IGFBP7 were chosen for
number
RNA-seq data validation in M. rosenbergii. RT–qPCR was used to quantify
Platelet activation 11 these selected genes. The RT–qPCR results demonstrated concordance
Immune system Leukocyte transendothelial between the RNA-seq and RT–qPCR results, indicating that the RNA-seq
10
migration
Rap1 signalling pathway 17
data were trustworthy (Fig. 6). Furthermore, the transcription patterns
Signal transduction of Serpin, CREB, Caspase, TUBA3, EF1a, IGFBP7, Hsp70, and MZT were
Hippo signalling pathway 12
ECM-receptor interaction 14 studied across the four gonad development stages after AG ablation
S1 vs Signalling molecules and
Neuroactive ligand-receptor (Fig. 7). During stage 1 (0 days after AG ablation), CREB and Serpin
S2 interaction 14
interaction
displayed the highest transcript levels, while EF1a had the lowest tran­
Apoptosis 11
Cell growth and death
Cellular senescence 4 script levels. Caspase exhibited the highest transcript levels, whereas
Oxytocin signalling pathway 13 CREB had the lowest levels as the gonad continued to develop (14 days
Endocrine system Thyroid hormone signalling
10
after AG ablation). At stage 3 (28 days after AG ablation), CREB still had
pathway the lowest transcript levels, while Hsp70 and MZT transcript levels
Rap1 signalling pathway 43
Signal transduction
PI3K signalling pathway 38
increased dramatically to reach their highest levels. EF1a, IGFBP7, and
IL-17 signalling pathway 38 TUBA3 had the highest transcript levels, but CREB still exhibited the
Immune system Th1 and Th2 cell lowest transcript levels 42 days after AG ablation.
20
differentiation
S2 vs Thyroid hormone signalling
31 4. Discussion
S3 Endocrine system pathway
Oxytocin signalling pathway 21
Phagosome 40 M. rosenbergii monosex culture outperforms mixed sex culture in the
Transport and catabolism
Lysosome 38 aquaculture industry. M. rosenbergii can devote all its energy to growth
Apoptosis 29 and development in the monosex population, resulting in rapid growth
Cell growth and death
Necroptosis 19
PI3K signalling pathway 76
(Mohanakumaran Nair et al., 2006; Levy et al., 2017). As a result,
Signal transduction several approaches for achieving all-male monosex culture have been
Rap1 signalling pathway 58
RNA transport 127 developed and deployed, including manual segregation, dsRNA or
Translation
mRNA surveillance pathway 71 siRNA knockdown, and androgenic gland ablation (Sagi et al., 1990;
Thyroid hormone signalling
S3 vs 50 Ventura et al., 2012). According to several studies, the androgenic gland
Endocrine system pathway
S4
Oxytocin signalling pathway 33 plays an important role in the sex differentiation mechanisms of crus­
IL-17 signalling pathway 64 taceans, including M. rosenbergii (Charniaux-Cotton, 1962; Katakura,
Immune system
Platelet activation 34 1989; Sagi et al., 1997; Sagi et al., 1988). M. rosenbergii androgenic gland
Endocytosis 78 ablation causes sex-reversal, and IAG knockdown also induced sex-
Transport and catabolism
Lysosome 36
reversal. The genes and signalling pathways involved in gonadal

6
K. Tan et al. Aquaculture 556 (2022) 738224

Fig. 4. The histological section of the gonads stained with haematoxylin-eosin after AG ablation. (A) AG ablated male, 0 days after AG ablation. (B) AG ablated male,
14 days after AG ablation. (C) AG ablated male, 28 days after AG ablation. (D) AG ablated male, 42 days after AG ablation. (E) Female. (F) Male. SC, spermatocytes;
SZ, spermatozoa; PO, previtellogenic oocytes; DO, developing oocytes; VO, vitellogenic oocytes.

development following androgenic gland ablation were discovered in
this study. Furthermore, the morphological features and histological
changes were investigated.
Several mRNAs, including heat shock protein 70 (Hsp70), insulin-like
growth factor binding protein 7 (IGFBP7), male reproductive-related
protein (Mar-Mrr), serine protease inhibitor (Serpin), tubulin alpha 3
chain (TUBA3), cAMP responsive element binding protein (CREB),
elongation factor 1 alpha (EF1a), and bone morphogenetic protein 7
(BMP7), were differentially expressed in the transcriptomic profiling of
gonads after AG ablation. In general, gonad development necessitates a
high energy supply, and heat shock proteins may serve as a major stress
tolerance mechanism and contribute to cellular energy requirements in
crustaceans, including M. rosenbergii. Heat shock proteins were previ­
ously found to be ubiquitous and transcribed in all organisms, and they
were recognized to improve stress tolerance and facilitating protein
synthesis efficiency (Brokordt et al., 2015; Javid et al., 2007). Further­
more, heat shock proteins play an important role in protein biogenesis
by preventing premature folding and polymerization of polypeptides
(Frydman et al., 1994; Hartl and Hayer-Hartl, 2002). Hsp70 was
expressed during testis to ovary transformation in this study, similar to
the findings of Brokordt et al., who reported that Hsp70 is expressed
during the gonad maturation process in Argopecten purpuratus (Brokordt
et al., 2015). In addition, a previous study reported that Hsp70 was
substantially expressed during the early stages of gonad development in
Gammarus fossarum, significantly decreasing when it matured (Schirling
et al., 2004), consistent with the findings in our study. Spermatogenesis
was halted, and the testis degenerated after AG ablation. As a result, it is
speculated that Hsp70 not only functions in stress tolerance but also
rescues the damaged proteins, prevents aggregation and aids in the
retention of proteins and irreversible damage during testis degeneration

7
K. Tan et al. Aquaculture 556 (2022) 738224

Fig. 5. The sexual morphology of the ventral surface and second pleopods in AG ablated male M. rosenbergii. (A) Ventral surface of an AG ablated male, 0 days after
AG ablation. (B) Ventral surface of an AG ablated male, 14 days after AG ablation. (C) Ventral surface of an AG ablated male, 28 days after AG ablation. (D) Ventral
surface of an AG ablated male, 42 days after AG ablation. (E) Second pleopod of an AG ablated male, 0 days after AG ablation. (F) Second pleopod of an AG ablated
male, 14 days after AG ablation. (G) Second pleopod of an AG ablated male, 28 days after AG ablation. (H) Second pleopod of an AG ablated male, 42 days after AG
ablation. BC, brood chamber; SB, setal buds; GF, gonopore flap; AI, appendix interna; AM, appendix masculine; OVG, ovigerous setae; OVP, ovipositing setae.

Fig. 6. The transcription patterns of Serpin, CREB, Caspase, TUBA3, EF1a and IGFBP7 were compared to the expression patterns in the RNA-seq.

(Fink, 2018; Parsell and Lindquist, 1993).
M. rosenbergii and Portunus pelagicus male reproductive-related pro­
tein (Mrr) were previously identified and characterized (Cao et al., 2006;
Sroyraya et al., 2013). Mrr was revealed to play role in M. rosenbergii
sperm fertilization and capacitation (Phoungpetchara et al., 2012). In
this study, two copies of Mrr were found to be upregulated in the testis
and downregulated during testis degeneration, but none were found to
be upregulated during ovary development. These findings are consistent
with a previous study in which Mrr expression was non-existent in fe­
male M. rosenbergii (Jiang et al., 2019). It was confirmed that Mrr was
exclusively identified and expressed in males and that Mrr was not
detected in sex-reversed males after AG ablation. Serine protease in­
hibitor (Serpin) regulates protease activity in inflammation, fertilization,
coagulation, fibrinolysis, complement activity, apoptosis, and remod­
eling (Carrell et al., 1991; Ligoxygakis et al., 2003; Pak et al., 2004;
Travis and Salvesen, 1983). Serpin is also engaged in a variety of
extracellular and intracellular processes, such as regulating sperm pro­
tease and decapacitation activity in Penaeus monodon (Chotwiwattha­
nakun et al., 2018). Serpin has been found in both male and female
growing gonads (Charron et al., 2006). Serpin was found to be down­
regulated during testis degeneration and upregulated as ovary devel­
opment progressed after AG ablation. Serpin is thought to play a
significant role in female gonad development. Bone morphogenetic
protein (BMP) is a member of the transforming growth factor-beta su­
perfamily and has a regulatory role in germ cell development, including
germ cell proliferation and maintenance (Kawase et al., 2004; Narita
et al., 2000; Shivdasani and Ingham, 2003). Furthermore, BMP7 is
expressed in the gonads of both male and female mice (Ross et al., 2007).
A previous study discovered BMP7 in the chicken ovary following sexual
differentiation (Hoshino et al., 2005). BMP7 was upregulated in the

8
K. Tan et al. Aquaculture 556 (2022) 738224

Fig. 7. The transcription pattern of selected genes in four developmental stages. (A) Caspase. (B) CREB. (C) EF1a. (D) Hsp70. (E) IGFBP7. (F) MZT. (G) Serpin. (H)
TUBA3. Indication: S1, stage 1 (0 days after AG ablation); S2, stage 2 (14 days after AG ablation); S3, stage 3 (28 days after AG ablation); S4, stage 4 (42 days after AG
ablation). Error bar represents standard error of the mean (SEM); the statistical difference among stages (P < 0.05) represented by different lowercase letters.

9
K. Tan et al.
testis and during ovary development but downregulated during the
testis degeneration process in this study. It has been proposed that BMP7
may play an important role in sex differentiation during gonadogenesis
after AG ablation. The cAMP response element binding protein (CREB),
on the other hand, is also involved in the testis-to-ovary transformation
after AG ablation. CREB is a transcription factor superfamily member
that influences gene expression by binding to the cAMP response
element sequence (Auger, 2003). CREB may also help RNA polymerase
reach the transcription initiation site faster, and CREB phosphorylation
is essential for spermatogenesis in Sertoli cells (Fix et al., 2004; Meyer
and Habener, 1993). In this study, androgenic gland ablation resulted in
testis degeneration and spermatogenesis inhibition. Of note, the levels of
CREB expression decreased from 14 days after androgenic gland abla­
tion. As a result, it is speculated that CREB may play a significant role in
spermatogenesis in M. rosenbergii. Notably, after AG ablation, only a few
genes were engaged in the testis-to-ovary transformation process. The
majority of the identified genes were involved in cell proliferation,
gonadogenesis, sperm protease, and decapacitation activity, enhanced
stress tolerance, protein synthesis efficiency, and protein biogenesis. AG
ablation results in the depletion of an important gene, IAG, which is
essential for testis development, spermatogenesis, and maintenance of
primary and secondary male sex characteristics (Ventura et al., 2012;
Levy and Sagi, 2020). Depletion of IAG in M. rosenbergii causes testis
degeneration and induces ovary transformation (Ventura et al., 2012).
Hence, it is speculated that these genes each have their own functions
and collaborate to regulate the process of organogenesis and maintain
normal homeostasis after AG ablation.
Aside from the discovered differentially expressed genes, some sig­
nalling pathways that are notably involved in the mechanisms of testis to
ovary transformation after AG ablation were identified. The primary
signalling pathways discovered were Rap1, Hippo, PI3K, IL-17,
oxytocin, thyroid hormone, apoptosis and ECM-receptor interaction.
The Rap1 signalling pathway is present in all groups and is essential for
platelet coagulation, angiogenesis, endothelial barrier function, and
lymphocyte homing (Chrzanowska-Wodnicka, 2013; Pannekoek et al.,
2014). In addition, Rap1 signalling promotes integrin-mediated adhe­
sion, cell motility, cell polarization, and transendothelial migration
downstream of the chemokine receptor (Boettner and Van Aelst, 2009;
De Bruyn et al., 2002; McLeod et al., 2002). Furthermore, earlier
research has shown that Rap1 is required for normal vascular develop­
ment and function (Chrzanowska-Wodnicka, 2013). The Hippo signal­
ling pathway is a conserved mechanism that is important in the
regulation of organ growth and cell fate (Misra and Irvine, 2018). The
Hippo pathway regulates organ growth and tissue size by restricting cell
proliferation and inducing apoptosis in excess cells (Halder and John­
son, 2011). Previous studies have shown that the Hippo pathway is
crucial in tissue repair and regeneration in Drosophila by modulating
cell density, cell–cell contact and cell stretching following tissue damage
(Staley and Irvine, 2012). Generally, the PI3K signalling pathway is vital
in mice for cellular activities and physiological regulation (Santana-
Santana et al., 2021). Previous studies found that the PI3K signalling
pathway regulates cellular activities such as oocyte maturation, growth,
translation, proliferation, and transcription in Monopterus albus and
Micropogonias undulatus (Chi et al., 2017; Datta et al., 1999; Pace and
Thomas, 2005). Notably, in this study the PI3K signalling pathway was
heavily implicated during ovarian development after AG ablation. The
transformation of the testis to the ovary is a complex process that in­
volves a series of signalling pathways. In this study, multiple signalling
pathways were found to be substantially enriched throughout the testis-
to-ovary transformation process. These signalling pathways are thought
to play a role in organ growth regulation, cell fate, oocyte maturation,
translation, proliferation, as well as stimulating integrin-mediated
adhesion, cell motility, and cell polarization during the testis-to-ovary
transformation process. As a result, involvement of these signalling
pathways may shape and govern the testis-to-ovary transformation
process.
10
Aquaculture 556 (2022) 738224
The oxytocin signalling pathway was also discovered to be involved
in testis-to-ovary transformation after AG ablation. Oxytocin signalling
is believed to play a physiological role in female puberty regulation,
accelerating sexual maturity by increasing GnRH secretion (Bourgui­
gnon et al., 1992; Parent et al., 2008; Rettori et al., 1997; Yamanaka
et al., 1999). Not only does oxytocin signalling play a role in sexual
maturation, but it also participates in early development, neuron func­
tionality and synapse formation (Bakos et al., 2018; Palanisamy et al.,
2018; Ripamonti et al., 2017). Sexual maturation and synapse formation
are both essential for the development of the ovary after testis degen­
eration. The thyroid hormone signalling pathway was found to have a
diverse set of functions in growth and development, homeostasis
maintenance, cell proliferation and differentiation. Thyroid hormone
signalling has indeed been related to male and female reproduction, as
well as testis and ovary development, according to some studies. Thy­
roid hormone signalling may influence testicular cell differentiation and
proliferation, affecting testicular function and size in rats (Gao et al.,
2014; La Vignera et al., 2017). Thyroid hormone signalling also impacts
ovarian physiology and reproductive functional properties in adult rats
(Meng et al., 2017). The thyroid signalling pathway was identified
during testicular degeneration and ovary formation in this study.
Sex-reversal is a complex process involving a series of multiple signal­
ling and regulatory processes. The androgenic gland secretes IAG, which
has a strong influence on testis development and spermatogenesis in
decapod crustaceans. Thus, androgenic gland ablation inhibits IAG
secretion, resulting in testicular degeneration and spermatogenesis ar­
rest, which induces ovary development (Levy and Sagi, 2020). The
androgenic gland ablated male will become a neofemale with a female
phenotype after being femininized.
The androgenic gland not only affects primary and secondary male
characteristics but is also responsible for maintaining the anatomical
and sexual morphological features of male M. rosenbergii (Ventura et al.,
2009). The transformation of male to female morphological features
demonstrates that the male morphology feature had degraded following
androgenic gland ablation. The brood chamber, setal buds on the ventral
surface, ovigerous setae, and ovipositing setae in the second pleopod can
all be seen in turn. These characteristics are only present in M. rosenbergii
females. In general, the androgenic gland secretes insulin-like andro­
genic gland hormone (IAG) to maintain male morphology (Sagi et al.,
1990; Tan et al., 2020). Due to the lack of an androgenic gland, IAG
production ceased, resulting in the degradation of male physical fea­
tures. These findings are congruent with those reported in an IAG
silencing study, which found that silencing IAG induced sex-reversal and
a shift in morphological characteristics from male to female (Tan et al.,
2020). In addition, a previous study revealed that appendix masculine
loss was observed after androgenic gland ablation (Nagamine et al.,
1980). As a result, this confirms the significance of the androgenic gland
in sustaining male morphological features.
In most cases, the feminization process occurs after androgenic gland
ablation. The testis degenerates and gradually transforms into an ovary
as the process of feminization progresses. In this study, degeneration of
the testis was observed 14 days following androgenic gland ablation.
The degeneration of the testis and the retardation of spermatogenesis are
thought to be signs of feminization. The seminiferous lobules in the testis
vanish 28 days after androgenic gland ablation and are replaced by
previtellogenic oocytes and developing oocytes. Mature oocytes such as
vitellogenic oocytes can be observed 42 days following androgenic
ablation, and they resemble those found in normal females. The absence
of IAG led to testis degeneration and induced ovary development. This
phenomenon is comparable to that described by Ventura et al., in which
male gonads and genital ducts were feminine and histologically
resembled those in females (Ventura et al., 2012). Furthermore, previ­
ous research revealed that IAG silencing halted spermatogenesis (Tan
et al., 2020). It has been suggested that removing the androgenic gland
from male M. rosenbergii can induce sex-reversal and the transformation
of the testis to the ovary (Ventura et al., 2012).
K. Tan et al.
5. Conclusion
In conclusion, this is the first description of the involvement of genes,
signalling pathways, and changes in the morphology and histology of
the testis to the ovary after androgenic gland ablation. Hsp70, IGFBP7,
Mar-Mrr, Serpin, TUBA3, CREB, EF1a, and BMP7 were identified as
differentially expressed in gonad transcriptomic profiling in response to
androgenic gland ablation. The Rap1, Hippo, PI3K, IL-17, oxytocin,
thyroid hormone, apoptosis and ECM-receptor interaction signalling
pathways were all enriched during the sex-reversal process, regulating
cell proliferation and gonad development and maintains homeostasis.
Sexual morphological features and histological changes after androgenic
gland ablation indicated sex-reversal from male to neofemale. Taken
together, these findings provide insight into the sex-reversal mechanism
of M. rosenbergii after androgenic gland ablation. The findings of this
study may aid in the future investigation of the sex-reversal mechanism
in other decapod species and provide a new breeding and culture
strategy for the M. rosenbergii aquaculture industry.
Ethics statement
The experimental techniques and animals used in this study were
approved by the Scientific Ethic Committee of the Huazhong Agricul­
tural University. The approval code of the Scientific Ethic Committee is
HZAUFI-2019-012.
CRediT authorship contribution statement
Kianann Tan: Methodology, Investigation, Writing – original draft,
Formal analysis. Jiongying Yu: Methodology, Investigation, Visualiza­
tion. Shouli Liao: Methodology. Jiarui Huang: Formal analysis. Meng
Li: Investigation. Weimin Wang: Project administration, Supervision,
Funding acquisition, Writing – review & editing, Resources,
Conceptualization.
Declaration of Competing Interest
The authors declared that there is no conflict of interest in this study.
Acknowledgements
This research was financially supported by The National Natural
Science Foundation of China under Grant No. 31501858.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aquaculture.2022.738224.
References
Aflalo, E.D., Hoang, T.T.T., Nguyen, V.H., Lam, Q., Nguyen, D.M., Trinh, Q.S., Sagi, A.,
2006. A novel two-step procedure for mass production of all-male populations of the
giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 256, 468–478.
https://doi.org/10.1016/j.aquaculture.2006.01.035.
Aflalo, E.D., Raju, D.V.S.N., Bommi, N.A., Verghese, J.T., Samraj, T.Y.C., Hulata, G.,
Sagi, A., 2012. Toward a sustainable production of genetically improved all-male
prawn (Macrobrachium rosenbergii): evaluation of production traits and obtaining
neo-females in three Indian strains. Aquaculture 338–341, 197–207. https://doi.org/
10.1016/j.aquaculture.2012.01.025.
Auger, A.P., 2003. Sex differences in the developing brain: crossroads in the
phosphorylation of cAMP response element binding protein. J. Neuroendocrinol. 15,
622–627. https://doi.org/10.1046/j.1365-2826.2003.01041.x.
Bakos, J., Srancikova, A., Havranek, T., Bacova, Z., 2018. Molecular mechanisms of
oxytocin signaling at the synaptic connection. Neural Plast. 2018, 4864107. https://
doi.org/10.1155/2018/4864107.
Barki, A., Karplus, I., Manor, R., Sagi, A., 2006. Intersexuality and behavior in crayfish:
the de-masculinization effects of androgenic gland ablation. Horm. Behav. 50,
322–331. https://doi.org/10.1016/j.yhbeh.2006.03.017.
11
Aquaculture 556 (2022) 738224
Boettner, B., Van Aelst, L., 2009. Control of cell adhesion dynamics by Rap1 signaling.
Curr. Opin. Cell Biol. 21, 684–693. https://doi.org/10.1016/j.ceb.2009.06.004.
Bourguignon, J.P., Gerard, A., Gonzalez, M.L.A., Franchimont, P., 1992. Neuroendocrine
mechanism of onset of puberty-sequential reduction in activity of inhibitory and
facilitatory N-methyl-D-aspartate receptors. J. Clin. Invest. 90, 1736–1744. https://
doi.org/10.1172/JCI116047.
Brokordt, K., Pérez, H., Herrera, C., Gallardo, A., 2015. Reproduction reduces HSP70
expression capacity in Argopecten purpuratus scallops subject to hypoxia and heat
stress. Aquat. Biol. 23, 265–274. https://doi.org/10.3354/ab00626.
Cao, J.X., Yin, G.L., Yang, W.J., 2006. Identification of a novel male reproduction-related
gene and its regulated expression patterns in the prawn, Macrobrachium rosenbergii.
Peptides 27, 728–735. https://doi.org/10.1016/j.peptides.2005.09.004.
Carrell, R., Evans, D., Stein, P., 1991. Mobile reactive Centre of serpins and the control of
thrombosis. Nature 353, 576–578.
Charniaux-Cotton, H., 1954. Découverte chez un Crustacé Amphipode (Orchestia
gammarella) d’une glande endocrine responsable de la différenciation des caractères
sexuels primaires et secondaires mâles. Compt. Rendus Hebd. Seances l’Academie
Sci. Paris 239, 780–782.
Charniaux-Cotton, H., 1957. Croissance, régénération et déterminisme endocrinien des
caractères sexuels d’Orchestia gammarella Pallas (Crustacé Amphipode). Ann. Sci. Nat.
Zool. Biol. Anim. 19, 411–559.
Charniaux-Cotton, H., 1962. Androgenic gland of crustaceans. Gen. Comp. Endocrinol. 1,
241–247. https://doi.org/10.1016/0016-6480(62)90095-3.
Charron, Y., Madani, R., Nef, S., Combepine, C., Govin, J., Khochbin, S., Vassalli, J.D.,
2006. Expression of serpinb6 serpins in germ and somatic cells of mouse gonads.
Mol. Reprod. Dev. 73, 9–19. https://doi.org/10.1002/mrd.20385.
Chi, W., Gao, Y., Hu, Q., Guo, W., Li, D., 2017. Genome-wide analysis of brain and gonad
transcripts reveals changes of key sex reversal-related genes expression and signaling
pathways in three stages of Monopterus albus. PLoS One 12, 1–19. https://doi.org/
10.1371/journal.pone.0173974.
Chotwiwatthanakun, C., Santimanawong, W., Sobhon, P., Wongtripop, S.,
Vanichviriyakit, R., 2018. Inhibitory effect of a reproductive-related serpin on sperm
trypsin-like activity implicates its role in sperm maturation of Penaeus monodon. Mol.
Reprod. Dev. 85, 205–214. https://doi.org/10.1002/mrd.22954.
Chrzanowska-Wodnicka, M., 2013. Distinct functions for Rap1 signaling in vascular
morphogenesis and dysfunction. Exp. Cell Res. 319, 2350–2359. https://doi.org/
10.1016/j.yexcr.2013.07.022.
Cronin, L.E., 1947. Anatomy and histology of the male reproductive system of Callinectes
sapidus Rathbun. J. Morphol. 81, 154–159.
Curtis, M.C., Jones, C., 1995. Observations on monosex culture of redclaw crayfish
Cherax quadricarinatus von martens (Decapoda: Parastacidae) in earthen ponds.
J. World Aquacult. Soc. 26, 154–159.
Datta, S.R., Brunet, A., Greenberg, M.E., 1999. Cellular survival: a play in three akts.
Genes Dev. 13, 2905–2927. https://doi.org/10.1101/gad.13.22.2905.
De Bruyn, K.M.T., Rangarajan, S., Reedquist, K.A., Figdor, C.G., Bost, J.L., 2002. The
small GTPase Rap1 is required for Mn2+- and antibody-induced LFA-1- and VLA-4-
mediated cell adhesion. J. Biol. Chem. 277, 29468–29476. https://doi.org/10.1074/
jbc.M204990200.
Fink, A.L., 2018. Chaperone-mediated protein folding. Physiol. Rev. 79, 425–449.
Fix, C., Jordan, C., Cano, P., Walker, W.H., 2004. Testosterone activates mitogen-
activated protein kinase and the cAMP response element binding protein
transcription factor in Sertoli cells. Proc. Natl. Acad. Sci. U. S. A. 101, 10919–10924.
https://doi.org/10.1073/pnas.0404278101.
Frydman, J., Nimmesgern, E., Ohtsuka, K., Hartl, F.U., 1994. Folding of nascent
polypeptide chains in a high molecular mass assembly with molecular chaperones.
Nature 370, 111–117. https://doi.org/10.1038/370111a0.
Gao, Y., Lee, W.M., Cheng, C.Y., 2014. Thyroid hormone function in the rat testis. Front.
Endocrinol. 5, 1–8. https://doi.org/10.3389/fendo.2014.00188.
Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Regev, A.,
2011. Full-length transcriptome assembly from RNA-Seq data without a reference
genome. Nat. Biotechnol. 29, 644–652. https://doi.org/10.1038/nbt.1883.
Guo, L., Zhao, Y., Yang, S., Zhang, H., Chen, F., 2014. An integrated analysis of miRNA,
lncRNA, and mRNA expression profiles. Biomed. Res. Int. 345605 https://doi.org/
10.1155/2014/345605.
Halder, G., Johnson, R.L., 2011. Hippo signaling: growth control and beyond.
Development 138, 9–22. https://doi.org/10.1242/dev.045500.
Hartl, F.U., Hayer-Hartl, M., 2002. Protein folding. Molecular chaperones in the cytosol:
from nascent chain to folded protein. Science 295, 1852–1858. https://doi.org/
10.1126/science.1068408.
Hasanuzzaman, A.F.M., Siddiqui, M.N., Chisty, M.A.H., 2009. Optimum replacement of
fishmeal with soybean meal in diet for Macrobrachium rosenbergii (De man 1879)
cultured in low saline water. Turk. J. Fish. Aquat. Sci. 9, 17–22.
Hoshino, A., Koide, M., Ono, T., Yasugi, S., 2005. Sex-specific and left-right asymmetric
expression pattern of Bmp7 in the gonad of normal and sex-reversed chicken
embryos. Develop. Growth Differ. 47, 65–74. https://doi.org/10.1111/j.1440-
169x.2004.00783.x.
Javid, B., MacAry, P.A., Lehner, P.J., 2007. Structure and function: heat shock proteins
and adaptive immunity. J. Immunol. 179, 2035–2040. https://doi.org/10.4049/
jimmunol.179.4.2035.
Jiang, J., Yuan, X., Qiu, Q., Huang, G., Jiang, Q., Fu, P., Jiang, H., 2019. Comparative
transcriptome analysis of gonads for the identification of sex-related genes in giant
freshwater prawns (Macrobrachium rosenbergii) using RNA sequencing. Genes 10,
1–18. https://doi.org/10.3390/genes10121035.
Jin, S., Fu, H., Zhou, Q., Sun, S., Jiang, S., Xiong, Y., Zhang, W., 2013. Transcriptome
analysis of androgenic gland for discovery of novel genes from the oriental river
K. Tan et al.
prawn, Macrobrachium nipponense, using Illumina Hiseq 2000. PLoS One 8, e76840.
https://doi.org/10.1371/journal.pone.0076840.
Jung, H., Lyons, R.E., Dinh, H., Hurwood, D.A., McWilliam, S., Mather, P.B., 2011.
Transcriptomics of a giant freshwater prawn (Macrobrachium rosenbergii): De Novo
assembly, annotation and marker discovery. PLoS One 6, e27938. https://doi.org/
10.1371/journal.pone.0027938.
Katakura, Y., 1989. Endocrine and genetic control of sex differentiation in the
malacostracan crustacea. Invertebr. Reprod. Dev. 16, 177–181. https://doi.org/
10.1080/07924259.1989.9672075.
Kawase, E., Wong, M.D., Ding, B.C., Xie, T., 2004. Gbb/Bmp signaling is essential for
maintaining germline stem cells and for repressing bam transcription in the
Drosophila testis. Development 131, 1365–1375. https://doi.org/10.1242/
dev.01025.
La Vignera, S., Vita, R., Condorelli, R.A., Mongioì, L.M., Presti, S., Benvenga, S.,
Calogero, A.E., 2017. Impact of thyroid disease on testicular function. Endocrine 58,
397–407. https://doi.org/10.1007/s12020-017-1303-8.
Langmead, B., Salzberg, S.L., 2012. Fast gapped-read alignment with bowtie 2. Nat.
Methods 9, 357–359. https://doi.org/10.1038/nmeth.1923.
Lawrence, C.S., 2004. All-male hybrid (Cherax albidus× Cherax rotundus) yabbies grow
faster than mixed-sex (C. albidus× C. albidus) yabbies. Aquaculture 236, 211–220.
Levy, T., Sagi, A., 2020. The ‘IAG-switch’ - a key controlling element in decapod
crustacean sex differentiation. Front. Endocrionol. 11, 1–15.
Levy, T., Rosen, O., Eilam, B., Azulay, D., Zohar, I., Aflalo, E.D., Sagi, A., 2017. All-female
monosex culture in the freshwater prawn Macrobrachium rosenbergii - a comparative
large-scale field study. Aquaculture 479, 857–862.
Levy, T., Rosen, O., Manor, R., Dotan, S., Azulay, D., Abramov, A., Sagi, A., 2019.
Production of WW males lacking the masculine Z chromosome and mining the
Macrobrachium rosenbergii genome for sex-chromosome. Sci. Rep. 9, 12408.
Li, J., Ni, J., Li, J., Wang, C., Li, X., Wu, S., Yan, Q., 2014. Comparative study on
gastrointestinal microbiota of eight fish species with different feeding habits. J. Appl.
Microbiol. 117, 1750–1760. https://doi.org/10.1111/jam.12663.
Ligoxygakis, P., Roth, S., Reichhart, J.M., 2003. A serpin regulates dorsal-ventral axis
formation in the Drosophila embryo. Curr. Biol. 13, 2097–2102. https://doi.org/
10.1016/j.cub.2003.10.062.
Love, M.I., Huber, W., Anders, S., 2014. Moderated estimation of fold change and
dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 1–21. https://doi.org/
10.1186/s13059-014-0550-8.
Ma, K., Qiu, G., Feng, J., Li, J., 2012. Transcriptome analysis of the oriental river prawn,
Macrobrachium nipponense using 454 pyrosequencing for discovery of genes and
markers. PLoS One 7, 1–11. https://doi.org/10.1371/journal.pone.0039727.
Malecha, S.R., Nevin, P.A., Ha, P., Barck, L.E., Lamadrid-Rose, Y., Masuno, S.,
Hedgecock, D., 1992. Sex-ratios and sex-determination in progeny from crosses of
surgically sex-reversed freshwater prawns, macrobrachium rosenbergii. Aquaculture
105, 201–218. https://doi.org/10.1016/0044-8486(92)90087-2.
Manor, R., Aflalo, E.D., Segall, C., Weil, S., Azulay, D., Ventura, T., Sagi, A., 2004.
Androgenic gland implantation promotes growth and inhibits vitellogenesis in
cherax quadricarinatus females held in individual compartments. Invertebr. Reprod.
Dev. 45, 151–159. https://doi.org/10.1080/07924259.2004.9652584.
McLeod, S.J., Li, A.H.Y., Lee, R.L., Burgess, A.E., Gold, M.R., 2002. The rap gtpases
regulate b cell migration toward the chemokine stromal cell-derived factor-1
(CXCL12): potential role for Rap2 in promoting B cell migration. J. Immunol. 169,
1365–1371. https://doi.org/10.4049/jimmunol.169.3.1365.
Meng, L., Rijntjes, E., Swarts, H.J., Keijer, J., Teerds, K.J., 2017. Prolonged
hypothyroidism severely reduces ovarian follicular reserve in adult rats. J. Ovarian
Res. 10 (1), 1–8.
Meyer, T., Habener, J., 1993. Cyclic adenosine 3′ , 5′ -monophosphate response element
binding protein (CREB) and related transcription-activating deoxyribonucleic acid-
binding proteins. Endocr. Rev. 14, 269–290. https://doi.org/10.1007/978-1-4020-
6754-9_1752.
Misra, J.R., Irvine, K.D., 2018. The hippo signaling network and its biological functions.
Annu. Rev. Genet. 52, 65–87. https://doi.org/10.1146/annurev-genet-120417-
031621.
Mohanakumaran Nair, C., Salin, K.R., Raju, M.S., Sebastian, M., 2006. Economic analysis
of monosex culture of giant freshwater prawn (Macrobrachium rosenbergii De man): a
case study. Aquac. Res. 37, 949–954.
Nagamine, C., Knight, A.W., Maggenti, A., Paxman, G., 1980. Masculinization of female
Macrobrachium rosenbergii (de man) (Decapoda, Palaemonidae) by androgenic gland
implantation. Gen. Comp. Endocrinol. 41, 442–457.
Narita, T., Saitoh, K., Kameda, T., Kuroiwa, A., Mizutani, M., Koike, C., Yasugi, S., 2000.
BMPs are necessary for stomach gland formation in the chicken embryo: a study
using virally induced BMP-2 and noggin expression. Development 127, 981–988.
https://doi.org/10.1242/dev.127.5.981.
Pace, M.C., Thomas, P., 2005. Steroid-induced oocyte maturation in Atlantic croaker
(Micropogonias undulatus) is dependent on activation of the phosphatidylinositol 3-
kinase/Akt signal transduction pathway. Biol. Reprod. 73, 988–996. https://doi.org/
10.1095/biolreprod.105.041400.
Pak, S.C., Kumar, V., Tsu, C., Luke, C.J., Askew, Y.S., Askew, D.J., Silverman, G.A., 2004.
SRP-2 is a cross-class inhibitor that participates in postembryonic development of
the nematode Caenorhabditis elegans: initial characterization of the clade L serpins.
J. Biol. Chem. 279, 15448–15459. https://doi.org/10.1074/jbc.M400261200.
Palanisamy, A., Kannappan, R., Xu, Z., Martino, A., Friese, M.B., Boyd, J.D., Culley, D.J.,
2018. Oxytocin alters cell fate selection of rat neural progenitor cells in vitro. PLoS
One 13, 1–18. https://doi.org/10.1371/journal.pone.0191160.
Pannekoek, W.J., Post, A., Bos, J.L., 2014. Rap1 signaling in endothelial barrier control.
Cell Adhes. Migr. 8, 100–107. https://doi.org/10.4161/cam.27352.
12
Aquaculture 556 (2022) 738224
Parent, A.S., Rasier, G., Matagne, V., Lomniczi, A., Lebrethon, M.C., Gérard, A.,
Bourguignon, J.P., 2008. Oxytocin facilitates female sexual maturation through a
glia-to-neuron signaling pathway. Endocrinology 149, 1358–1365. https://doi.org/
10.1210/en.2007-1054.
Parsell, D.A., Lindquist, S., 1993. The function of heat-shock proteins in stress tolerance:
degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27, 437–496.
https://doi.org/10.1146/annurev.ge.27.120193.002253.
Patel, R.K., Jain, M., 2012. NGS QC toolkit: a toolkit for quality control of next
generation sequencing data. PLoS One 7, e30619. https://doi.org/10.1371/journal.
pone.0030619.
Pertea, G., Huang, X., Liang, F., Antonescu, V., Sultana, R., Karamycheva, S.,
Quackenbush, J., 2003. TIGR gene indices clustering tools (TGICL): a software
system for fast clustering of large EST datasets. Bioinformatics 19, 651–652. https://
doi.org/10.1093/bioinformatics/btg034.
Phoungpetchara, I., Tinikul, Y., Poljaroen, J., Changklungmoa, N., Siangcham, T.,
Sroyraya, M., Sobhon, P., 2012. Expression of the male reproduction-related gene
(mar-Mrr) in the spermatic duct of the giant freshwater prawn, Macrobrachium
rosenbergii. Cell Tissue Res. 348, 609–623. https://doi.org/10.1007/s00441-012-
1380-1.
Qiao, H., Fu, H., Jin, S., Wu, Y., Jiang, S., Gong, Y., Xiong, Y., 2012. Constructing and
random sequencing analysis of normalized cDNA library of testis tissue from oriental
river prawn (Macrobrachium nipponense). Comp. Biochem. Phys. D. 7, 268–276.
Rettori, V., Canteros, G., Renoso, R., Gimeno, M., McCann, S.M., 1997. Oxytocin
stimulates the release of luteinizing hormone-releasing hormone from medial basal
hypothalamic explants by releasing nitric oxide. Proc. Natl. Acad. Sci. U. S. A. 94,
2741–2744. https://doi.org/10.1073/pnas.94.6.2741.
Ripamonti, S., Ambrozkiewicz, M.C., Guzzi, F., Gravati, M., Biella, G., Bormuth, I.,
Rhee, J.S., 2017. Transient oxytocin signaling primes the development and function
of excitatory hippocampal neurons. Elife 6, 1–31. https://doi.org/10.7554/
eLife.22466.
Ross, A., Munger, S., Capel, B., 2007. Bmp7 regulates germ cell proliferation in mouse
fetal gonads. Sex. Dev. 1, 127–137. https://doi.org/10.1159/000100034.
Sagi, A., Aflalo, E.D., 2005. The androgenic gland and monosex culture of freshwater
prawn Macrobrachium rosenbergii (De man): a biotechnological perspective. Aquac.
Res. 36, 231–237. https://doi.org/10.1111/j.1365-2109.2005.01238.x.
Sagi, A., Cohen, D., 1990. Growth, maturation and progeny of sex-reversed
Macrobrachium rosenbergii males. World Aquac. Rep. 21, 87–90.
Sagi, A., Milner, Y., Cohen, D., 1988. Spermatogenesis and sperm storage in the testes of
the behaviorally distinctive male morphotypes of Macrobrachium rosenbergii
(Decapoda, Palaemonidae). Biol. Bull. 174, 330–336. https://doi.org/10.2307/
1541958.
Sagi, A., Cohen, D., Milner, Y., 1990. Effect of androgenic gland ablation on morphotypic
differentiation and sexual characteristics of male freshwater prawns, Macrobrachium
rosenbergii. Gen. Comp. Endocrinol. 77, 15–22. https://doi.org/10.1016/0016-6480
(90)90201-V.
Sagi, A., Snir, E., Khalaila, I., 1997. Sexual differentiation in decapod crustaceans: role of
the androgenic gland. Invertebr. Reprod. Dev. 31, 55–61. https://doi.org/10.1080/
07924259.1997.9672563.
Santana-Santana, M., Bayascas, J., Giménez-Llort, L., 2021. Fine-tuning the PI3K/Akt
signaling pathway intensity by sex and genotype-load: sex-dependent homozygotic
threshold for somatic growth but feminization of anxious phenotype in middle-aged
PDK1 K465E knock-in and heterozygous mice. Biomedicines 9, 747.
Schirling, M., Triebskorn, R., Köhler, H.R., 2004. Variation in stress protein levels (hsp70
and hsp90) in relation to oocyte development in Gammarus fossarum (koch 1835).
Invertebr. Reprod. Dev. 45, 161–167. https://doi.org/10.1080/
07924259.2004.9652585.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT
method. Nat. Protoc. 3, 1101.
Shivdasani, A.A., Ingham, P.W., 2003. Regulation of stem cell maintenance and transit
amplifying cell proliferation by TGF-β signaling in Drosophila spermatogenesis. Curr.
Biol. 13, 2065–2072. https://doi.org/10.1016/j.cub.2003.10.063.
Siddiqui, A.Q., Al-Hafedh, Y.S., Al-Harbi, A.H., Ali, S., 1997. Effects of stocking density
and monosex culture of freshwater prawn Macrobrachium rosenbergii on growth and
production in concrete tanks in Saudi Arabia. J. World Aquacult. Soc. 28, 106–112.
Sroyraya, M., Hanna, P.J., Changklungmoa, N., Senarai, T., Siangcham, T., Tinikul, Y.,
Sobhon, P., 2013. Expression of the male reproduction-related gene in spermatic
ducts of the blue swimming crab, Portunus pelagicus, and transfer of modified protein
to the sperm acrosome. Microsc. Res. Tech. 76, 102–112. https://doi.org/10.1002/
jemt.22142.
Staley, B.K., Irvine, K.D., 2012. Hippo signaling in Drosophila: recent advances and
insights. Dev. Dyn. 241, 3–15. https://doi.org/10.1002/dvdy.22723.
Tan, K., Zhou, M., Jiang, H., Jiang, D., Li, Y., Wang, W., 2020. siRNA-mediated MrIAG
silencing induces sex reversal in Macrobrachium rosenbergii. Mar. Biotechnol. 22,
456–466. https://doi.org/10.1007/s10126-020-09965-4.
Thongbuakaew, T., Siangcham, T., Suwansa-Ard, S., Elizur, A., Cummins, S.F.,
Sobhon, P., Sretarugsa, P., 2016. Steroids and genes related to steroid biosynthesis in
the female giant freshwater prawn, Macrobrachium rosenbergii. Steroids 107,
149–160. https://doi.org/10.1016/j.steroids.2016.01.006.
Travis, J., Salvesen, G., 1983. Human plasma proteinase inhibitors. Annu. Rev. Biochem.
52, 655–701.
Ventura, T., 2018. Monosex in aquaculture. Results Probl. Cell Differ. 65, 91–101.
https://doi.org/10.1007/978-3-319-92486-1_6.
Ventura, T., Manor, R., Aflalo, E.D., Weil, S., Raviv, S., Glazer, L., Sagi, A., 2009.
Temporal silencing of an androgenic gland-specific insulin-like gene affecting
phenotypical gender differences and spermatogenesis. Endocrinology 150,
1278–1286. https://doi.org/10.1210/en.2008-0906.
K. Tan et al.
Ventura, T., Manor, R., Aflalo, E.D., Weil, S., Khalaila, I., Rosen, O., Sagi, A., 2011.
Expression of an androgenic gland-specific insulin-like peptide during the course of
prawn sexual and morphotypic differentiation. ISRN Endocrinol. 1-11 https://doi.
org/10.5402/2011/476283.
Ventura, T., Manor, R., Aflalo, E.D., Weil, S., Rosen, O., Sagi, A., 2012. Timing sexual
differentiation: full functional sex reversal achieved through silencing of a single
insulin-like gene in the prawn, Macrobrachium rosenbergii. Biol. Reprod. 86, 1–6.
https://doi.org/10.1095/biolreprod.111.097261.
Xie, C., Mao, X., Huang, J., Ding, Y., Wu, J., Dong, S., Wei, L., 2011. KOBAS 2.0: a web
server for annotation and identification of enriched pathways and diseases. Nucleic
Acids Res. 39, 316–322. https://doi.org/10.1093/nar/gkr483.
13
Aquaculture 556 (2022) 738224
Yamanaka, C., Lebrethon, M.C., Vandersmissen, E., Gerard, A., Purnelle, G.,
Lemaitre, M., Bourguignon, J.P., 1999. Early prepubertal ontogeny of pulsatile
gonadotropin-releasing hormone (GnRH) secretion: I. inhibitory autofeedback
control through prolyl endopeptidase degradation of GnRH. Endocrinology 140,
4609–4615. https://doi.org/10.1210/endo.140.10.6971.
Young, M.D., Wakefield, M.J., Smyth, G.K., Oshlack, A., 2010. Gene ontology analysis for
RNA-seq: accounting for selection bias. Genome Biol. 11, R14. https://doi.org/
10.1186/gb-2010-11-2-r14.
Another random document with
no related content on Scribd:
The Project Gutenberg eBook of Tarinoita ja
tapahtumia
This ebook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
ebook or online at www.gutenberg.org. If you are not located in the
United States, you will have to check the laws of the country where
you are located before using this eBook.

Title: Tarinoita ja tapahtumia

Author: Kauppis-Heikki

Release date: March 30, 2024 [eBook #73299]

Language: Finnish

Original publication: Porvoo: Werner Söderström, 1897

Credits: Juhani Kärkkäinen and Tapio Riikonen

*** START OF THE PROJECT GUTENBERG EBOOK TARINOITA

JA TAPAHTUMIA ***
TARINOITA ja TAPAHTUMIA

Kirj.

Kauppis-Heikki

Porvoossa, Werner Söderström, 1897.

SISÄLLYS:

Saitureita.
Pääskysten elämästä.
Syksyllä ja keväällä.
Ihaili.
Alarapun aviopari.
Hessu.
Varosen jouluharmit.
Oja-Taavetin lasku.
Miten Mikko käytti Katria jouluna kirkossa.
Omena ja Kaunikki.
Naapurit.
Kahden puolen ikkunata.

Saitureita.

Kuosmas-veljekset olivat tehtaan hiilenpolttajan poikia ja asuivat

isänsä eläissä pienessä metsämökissä. Polven korkuisesta täytyi
heidän olla isänsä apuna hiilihautoja purkamassa ja siitä olivat Kusto
nimisen pojan silmät käyneet tihrusmaisiksi, mutta vähän nuorempi,
Mauno niminen, säilyi melkein tervesilmäisenä.

Isänsä kuoltua jättivät veljekset mökin ja asettuivat itseensä

tehtaalle työmiehiksi, johon heidän ijäkäs äitinsä seurasi mukana ja
piti huolen ruasta ja vaatteista.

Heti tehtaalle muutettua heräsi veljeksissä kiihkeä säästämisen

halu ja se kiihtyi sitä mukaa kuin säästötkin karttuivat. Tehtaalla kun
on usein tarjona yö- ja sunnuntaitöitä, olivat veljekset niin itseänsä
säästämättömiä, ett'eivät monella viikolla levänneet jos parina yönä
ja muutaman tunnin verran päivillä jossain työn lomassa. Kovin oli
ruumis aina väsynyt, mutta sitä palkitsi se ilo, kun näki markan
lisääntyvän markan viereen. Usein he tekivätkin tiliä tuloistaan ja
menoistaan, jotka olivat tarkasti merkittynä kumpaisenkin veljen
taskukirjaan.

Alussa nämä "tilikirjat" sisälsivät ainoastaan isältä opittuja viivoja

ja hyvin huonotekoisia numeroita, mutta kun oli kovin vaikea
muistaa, mitä asiata mikin viiva ja numero merkitsi, täytyi ponnistella
joku kirjaimen sukunenkin joukkoon.

Sillä tavalla oli Mauno oppinut tekemään joka kirjaimen lajit,

vieläpä osasi asetella sanoiksikin, mutta Kusto ei päässyt
edistymään niin pitkälle. Hänelle oli tietämistä, jos sai kuhunkin
sanaan kuuluvista kirjaimista puoletkaan kyhätyksi. Mutta mitä
muistoon panojen tarkkuuteen tuli, niin siinä ei Kusto ollut veljestään
jälellä. Yksikään penni ei jäänyt pois kirjasta ja hän vetosi voivansa
vannoa, että siinä ei ole liikaa, eikä vaille. Kirjoituspuolta tosin täytyi
panna arvaamalla, mutta kun Kusto tiristeli vähän aikaa silmiänsä,
syntyi sana kun syntyikin.
 Ikävimpänä pitivät veljekset ruokapuolen tiliä ja varoittelivat usein
äitiänsä olemaan säästäväinen. Ja kyllä tämä ei heillä herkkupaloja
syötellyt, eikä komeuteen kiihoitellut. Ruokana kala ja leipä,
vaatteina sarka ja karkea liinatoimikas, joita niitäkään ei vuosikausiin
uudistettuna muuten kuin paikkaamalla.

Mutta vaikka heistä jokainen koetti ijartaa parhaansa mukaan, ei

vaan koko karttunut mieltä myöten.

— Ei tällä tehtaan työllä pääse ikänään varoihinsa, kun täytyy

kaikki ruokatavarat ostaa, eikä sovellu omituista hevostakaan pitää,
puhkesi Kusto kerran tiliä tehdessä puhumaan. Mitä sanot, veli
Mauno, jos mentäisiin Juureisahoon lampuodiksi, siitä kuuluu
entinen kohta pois lähtevän.

— Jos tuohon pääsisi ja sopisi maksuilla, sanoi Mauno. Olisihan

meillä jo siksi varoja, että päästäisiin alkuun.

— No jos sinä olet taipuvainen, niin käydään kysymässä, päätti

Kusto.

— Entäs äiti, muistutti Mauno.

— Äiti hoitaa taloutta.

— Jaksaneeko?

Kysyivät itseltään, ja sanoi jaksavansa ja oli kehoittamassa.

Veljekset lähtivät heti tietämään arenttiehtoja paikan omistajalta ja

onnistuivatkin jo samalla tiellä tekemään päällisen sopimuksen
viiden vuoden ajaksi. Kevättalvella sai jo muuttaa asumaan.
 Nyt tuli veljeksille kiire elukkain hankkiminen. Ensi töikseen
riensivät he läheisille markkinoille hevosta ostamaan. Kauppa
onnistui niin hyvin, että heille kohta tarjottiin parikymmentä markkaa
voittoa. Kuston valtasi samassa voitonhimo ja hän sanoi:

— Mene sinä Mauno katselemaan toista, minä myön tämän.

Mauno meni ja kohta hänellä olikin toinen.

— Tuossa on sinulle kaikki rahat, sanoi Kusto yhä innostuen. Osta

niin monta kuin saat, vaan elä anna pettää itseäsi. Tämä kauppa
taitaa kannattaa.

Mauno suostui jatkamaan ja kohta heillä oli toista sataa

voittorahoja. Hän oli tarkka hevosen tuntia ja oppi pian ostomiehelle
tarpeelliset metkuttelemiskeinot. Kusto taas oli kuin luotu hevosen
myöjäksi. Jokainen tuntematoin ajatteli ulkomuodosta katsoin, että
tuolta mieheltä minä otan hevosen puolella hinnalla, mutta
loppupäätös oli aina se, että muutamia markkoja jäi Kustolle voittoa
ja välistä kymmeniäkin.

Hyvillä mielin palasivat veljekset markkinoilta ja alkoivat ostella

muitakin talossa tarvittavia elukoita ja kaikkia tärkeimpiä työkaluja.
Entiset rahat kuluivat jotenkin vähiin, mutta nyt oli heillä tiedossa
useampia keinoja, miten rahoja vastaisuudessa hankistaan.

Kevättalvella muuttivat Kuosmas-veljekset Juureisaholle, joka oli

toista peninkulmaa etäällä tehtaasta. Paljon oli heittänyt entinen
asukas tekemistä, mutta kyllä veljeksetkin näyttivät, miten töitä
tehdään. Melkein yötä päivää he vedättivät makua pelloille ja samoin
sulan tultua latoivat aitoja, ojittivat peltoja niin, että sen huomasi
syrjäisetkin, että tuossa tehdään työtä. Kävipä maanomistaja itsekin
ihailemassa vastatulleiden lampuotiensa uutteruutta ja arveli
itsekseen, että viiteen vuoteen ne perkkaavat hänen maansa
kasvitarhan kalttaiseksi. Tässä toivossaan hän kumminkin pettyi.
Kesän aikana ja varsinkin ensimäisen, tahtoivat veljekset panna
kaikki voimansa maantyöhön, mutta talven tultua tuli muutos. Ennen
opitut tehtaan työt vetivät puoleensa kuukausiksi ja markkina-ajat
menivät hevoskaupan hoteella. Kaikistellen se ei kyllä ollut yhtä
edullista, vaan kannatti kumminkin.

*****

Viisivuotisesta asumusajasta oli viimeinen talvi veljeksillä

menossa.
He olivat juuri tulleet markkinoilta ja tekivät tiliä voitoistaan.
Samalla tekivät he laskua kaikista rahavaroistaan, jotka nousivat jo
paljo kolmannelle tuhannelle.

— Mitä sanot Mauno, virkkoi Kusto, vieläkö jatketaan tässä oloa

eteenpäin.

— Mistäpä niitä parempiakaan olopaikkoja löytynee, sanoi Mauno.

— Niin mutta ajatteleppa, kun isäntä tahtoo, että meidän pitää

tähän rakentaa uusi tupa ja korjata navetta. Sinä et ymmärrä, veli
Mauno, kuinka paljon ne tulevat maksamaan.

— Maksaahan ne, myönnytti Mauno. Mutta tupa tässä on aivan

tarpeellinen, sillä tämä kohta kaatuu päälle.

— Siksipä minä olen ajatellut, että muututaan toiseen paikkaan,

sanoi
Kusto.
 — Ei nyt yhden tuvan tautta muututa, esteli Mauno. Onhan meillä
siitä kulukista luvassa kolmea vertaa pitempi kontrahti.

— Jää sinä tähän, sanoi Kusto, mutta minä haen asuntoni

muualta.

— Ettäkö ero tulisi? kysyi Mauno vähän ihmetellen.

— Niin, en minä rupea semmoisiin kulutuksiin toisen maalla,

vahvisti
Kusto.

— Mitenkäs äidin kohta sitten jäisi? kysyi Mauno.

— Annetaan äidin olla toinen kuukausi toisen luona, esitti Kusto.

— Sehän olisi kuin kerjäläisen muuttelemista, moitti Mauno. Miksei

koko vuotta?

— Vuosittain ei tule elatuskustannus tasaisesti jaetuksi, jos sattuu

katovuotena toiselle ja hyvänä vuotena toiselle, selitteli Kusto.

— Tulee tarpeeksi tasaista, jos muuttuu keskitalvella.

— Kyllä sitten, jos keskitalvella.

— Suostuneeko äiti siihenkään.

— Miksei suostuisi, eihän äidillä ole mitään perintöä.

Mauno tahtoi kumminkin kysyä äidiltä itseltään, suostuisiko tämä

heidän tuumaan, jos ero tulisi. Ja kuului suostuvan, vaikka ei
näyttänyt olevan mieleistä erotuuma yleensä.
 — Milloinka sinä jo tahtoisit erottavan? kysyi Mauno.

— Vaikka kohtakin, sanoi Kusto, että ennättäisi vielä kelin aikana

katsella asuinpaikkaa.

— Aijotko ostaa omituisen maan?

— Mitenkäpä minä niin vähillä varoilla…

Kusto tahtoi pitää ajatustaan salassa, vaikka hän oli jo pitemmän

aikaa kuulostellut, missä olisi sopiva maatila, Ja kyllähän niitä
syrjäisiä sydänmaan tiloja olisi ollut, mutta Kusto halutti päästä
keskelle pitäjästä, johonkin suuren kylän laitaan, sillä siellä on aina
parempi tilaisuus kokoilla penniä, kuin syrjässä sydänmaalla. Ja
viimeisellä markkinamatkalla hän olikin kuullut, että Jokijärven kylällä
on pari pienen talon omistajaa ihan köyhtymisen partaalla ja se
seutu oli kaikin puolin Kuston mieleinen. Olipa vielä joku esitellyt,
että siellä toisella kylällä, Juurikan talossa, olisi perinnökäs talontyttö,
ihan kuin Kustolle luotu emännäksi.

Nämä kaksi asiaa olivat kiihoituksena tavaran jakoon, sillä sitten

olisi vapaa mies, niin toista kuin toistakin asiata tiedustelemaan.
Nytkin parhaallaan ne pyörivät mielessä ja hyvittääkseen veljeänsä
hän sanoi:

— Elä sinä, veli Mauno, luule, että minä sinuun olisin suuttunut: ei
ensinkään. Tämä tuvan huonous se on pääasia ja toiseksi olen
huomannut, että ehkä halutat ottaa emännän ja silloin se kumminkin
jako tulisi, kun toiselle puolen lisääntyisi suita syömään. Vai mitä
sanot nuorempi veli, puhunko oikein?
 — Oikein puhut, myönnytti Mauno nauraen. Nyt se on kyllä sopivin
aika jakaa.

— No se on oikein, kiitteli Kusto. Sinä olet kunnon veli. Ja

sovittanneenhan me itse jakamaan, ettei tarvitse palkata syrjäisiä;
siinä vaan kuluu.

— Koetetaan.

— Niin, ja sitten, veli Mauno, muista se, ettei toisen, eikä toisen
puoleen.

— Olenkos minä ennenkään omaan puoleeni?

— Et ole, en kykene sanomaan, mutta jos näin viimetilissä sattuisi

mielet muuttumaan.

— Jos et itse muuta.

— En minä missään tapauksessa, vakuutti Kusto.

— Mutta minua jo epäilyttää, ettei me sovita kaikkia tavaroita

jakamaan, sanoi Mauno. Kumpiko meistä esimerkiksi ottaa
liinakkotamman, se kun on vähän potkuri?

— Saatan minä ottaa, sanoi Kusto. Mutta jos luulet minun

voittavan, niin arvataan edeltäpäin kumpaisellekin hevoselle hinta ja
joka paremman ottaa, palkitkoon rahalla huonomman. Se keino on
hyvä muitakin tavaroita jakaissa.

— Mikä ne sitten lopussa muistaa, kuka se kulloinkin on joutunut

maksuun ja minkä verran, huomautti Mauno.
 — Ei heitetä loppuun, selitti Kusto. Jaetaan rahat ensin ja joka
ottaa paremman elukan, tai muun kapineen, niin maksakoon rahat
paikalla käteen.

— Rahatko ne siis otetaan ensin jaettavaksi? kysyi Mauno.

— Heitetään iltaan, mennään ensin aittaan, siellä ei tarvita rahoja,

kun otetaan puntari.

Nyt saatiin asia alulle. Kusto otti puntarin ja keräsi liedestä

kourallisen kylmiä hiiliä mukaansa aittaan. Jauhot suostuivat he
jakamaan ensiksi. Mauno rupesi säkkiä pitämään ja toinen
ammentamaan.

— Nosta jo, käski Kusto.

— Pane heitä niin paljon kuin varot puntarin kannattavan, sanoi

Mauno.

— Ei panna leiviskätä enempi kerrallaan, sillä lopulla puntaria

tekee hivuskarvan ala naulan ereyksen ja silloin ei tule tasaista.

— No huokeampi se on minulle, mutta aikaa tässä menee.

— Onhan meillä aikaa, lohdutteli Kusto ja riputteli hypyn kerrallaan

pussiin, samalla kuin toinen kiikutti sitä puntarin nokassa.

— Kumpaiselleko ensiksi kopistetaan?

— Se on sama, ei tässä hairausta tule.

— Tuossa on sitten sinulle.

 Samassa vetää kahnautti Kusto hiilellä seinään merkin ja joutui
neuvomaan:

— Elä pitele säkin nurkista niin, että sinne jääpi jauhoja.

— Ei jäänyt. Alahan ammentaa uudestaan ja joutuin, uupuu siinä

käsi, jos sinä kovin tarkasti tiputtelet.

Toinen mittaus kävi jo paljon sukkelammin. Kusto piti tarkan

huolen hiilimerkistä ja joutui aina muistuttamaan, ettei jauhoja jäänyt
säkin nurkkiin, kun hänen puolelle tyhjennettiin.

Jyviä jakaissa ei ollut muuta silmällä pidettävää, kuin ettei

mittakappaa missään tapauksessa kolauteta ennen pyhkäsemistä ja
että pyhkäsy tapahtuu niin ettei jyvääkään jää laiteille. Viimeisen
vajaan kapan jakoi Mauno rehellisesti kouralla, vaikka Kusto ensin
esitteli puntarijakoa.

*****

Yönseutuna jakoivat veljekset raha-omaisuutensa ja seuraavana

aamuna voivat ryhtyä muun irtaimen tavaran kimppuun. Ensin oli
koottava kaikki näkösälle. Jokainen nurkka siinä katseltiin ja mikä
vaan penninkään arvoiseksi arvattiin, tuotiin jaettavien joukkoon.
Kaikki vanhat virsut, kengän kappaleet ja mitä vaan oli, otettiin
tutkittavaksi raha-arvon mukaan.

Kun ei enää huoneista, eikä ulkoa löytynyt muuta kun joku luudan
tynkä, alkoi itse jakaminen. Kusto haki uunilta pari sileäpintaista
pärettä ja ojensi niistä toisen Maunolle.

— Mitä sinä näillä? kysyi tämä.

 — Ei kulu paperi, selitti Kusto. Otahan kynä käteesi.

Heidän taloudessaan kun ei ollut rautaa arvokkaampia

metallitavaroita, joutui kaksi kirvestä ensiksi esille. Kuston keksimä
järjestys vaati, ettei niitä saanut yhtä rintaa vertailla toisiinsa, vaan
ne olivat tutkittavat yksi kerrallaan. Esineen hinnasta ei saanut
keskustella sen enempi, kuin että minkä se uutena maksoi ja sitten
ajatella nykyinen hinta ja merkitä päreesen numeroilla. Sen tehtyä
asetettiin päreet rinnatusten. Jos numerot olivat samat, ei siinä ollut
mitään korjaamista, muuten pantiin eroitus kahtia. Niin tuli toiselle
kirveelle hintaa 1 markka 60 penniä, toiselle 1 markka 22 1/2 penniä.

— Mitenkäs nyt tehdään? kysyi Mauno. Kumpiko maksaa ne 37 ja

puoli penniä?

— Se joka haluttaa ottaa paremman kirveen.

— Minä otan paremman, se kun on minun nimikkoni, sanoi

Mauno.

— Ota vaan, sanoi Kusto. Et tarvitse antaa kuin 37 penniä, puoli

penniä pannaan muistiin.

Mauno antoi rahat paikalla. Tätä tekoa tekivät veljekset niin

ahkerasti, että tuskin syödäkään malttoivat. Silloin tällöin vaan
kävivät hevosille antamassa ruokaa.

Alussa oli tavaroiden otto vapaaehtoinen, mutta Mauno siitä

viimein teki muistutuksen.

— Sinä otat aina sen puolen, jossa on rahaa muassa, sanoi hän.
 — Eihän se mitään, lohdutteli Kusto. Sinä saat tavarat sitä
parempia.

— En minä aina paraimpiakaan tahtoisi, sillä se on rahoille hupa.

Asetetaan nyt niin, että vuorotellen toiselle ja toiselle rahapuoli.

— Ei hyvä veli se oikein sovellu, sillä kuka sen takaa, tuleeko

enempi sinulta kuin minultakaan olluksi ajattelematta omaa etua,
kuin on edeltäpäin tiedossa, mikä tavara millekin joutuu. Jaetaan
ennen vaikka arvalla silloin kuin kumpainenkin haluttaisi ottaa saman
puolen.

— No jaetaan arvalla, mutta mistä ne arvat tehdään?

— Onhan meillä pieniä penniä, laitetaan niistä. Anna sinä yksi,

minä panen toisen.

— Tuossa on, vaan mitenkä niillä…

— Kohta sen näet.

Kusto otti veitsensä ja raapasi sen kärjellä toisen pennin kupeesen

pari raamua.

Ensimäisen erimielisyyden sattuessa vetäsi Kusto jaettavaan

esineesen hiilellä ristin ja asetti sitten pennit hattuun, jossa puisteli
niitä vähän aikaa ja sitten ottamaan. Jolle nousi merkitty penni, se
sai hiiliristillä merkityn esineen.

Tämän keinon keksittyä jatkoivat veljekset jakoa aivan

tyytyväisesti, vaikka kyllä siinä meni monta päivää. Viimein joutuivat
miesten omat vaatteet jaettavaksi ja siinäpä ei enää entiset jakotavat
oikein soveltuneet. Kusto oli paljon pienempi Maunoa, joten vaatteita
ei sopinut vaihettaa. Täytyi panna omatunto kiusaukseen, niin
vaarallista kuin se olikin. Pahimmin pelkäsi Kusto veljeänsä, sillä se
oli pitkässä jakotyössä käynyt entistään joutuisammaksi
hinnoittelemisessa. Kerran -vaan katsahti esineen päälle ja tekasi
samassa numerot päreen pinnalle. Siinä olikin parhaallaan käsissä
muutamia paria hurstihousuja.

— Mauno, tee omantunnon mukaan! varoitti Kusto katsellen

lahkeen suut ja kaikki. Uneuta sinä pois mielestäsi, että nämä ovat
minun housut, eläkä pane korkeampaa hintaa kuin oikein. Katsos,
täälläkin on reikä.

— Revennyt vähäisen, mitä se…

— Niin, ja Kuston housut ovat pienempiäkin, sanoi äiti, joka oli

tullut katsomaan vaatteiden jakoa ja pitämään siinä lempipoikansa
puolta.

— Sekin on otettava lukuun, vahvisti Kusto.

— Mitäs te sanotte siihen, kun leipä loppuu, mistä minä jauhoja

otan? kysyi äiti, kesken muun homman.

— Niin, mitenkä tehdään, sanoi Kusto kääntyen Maunon puoleen.

— Ottakaa nyt kumpaisen säkistä hyvänsä ja toisella kerralla

toisen.
Muistaahan nuo.

— Ei sen äidin muistiin ole luottamista, sanoi Kusto. Käy

mittaamassa puntarilla yhtä paljon kumpaisenkin säkistä; se on
selvin.
 — Potattiakin pitäisi hakea kuopasta, minä en niitä sieltä asti saa,
kun säilöstelee jalkoja.

— Ja nehän ovat unehtuneet vielä jakamatta.

Vaatteiden jaon toimittivat he kumminkin loppuun ja sitten kävivät

yhtenä antamassa äidille jauhoja ja siltä tieltä suoraan potattia
jakamaan ja noutamaan.

— Kapalla ne kaiketi jaettaneen, sanoi Mauno ja aikoi ottaa sitä

käteensä aitasta lähtiessä, vaan Kusto joutui estämään.

— En minä anna hiekkasia potattia mitata vasta ruunatulla kapalla,

se kuluu siinä, sanoi hän ja otti omansa pois.

— No milläs ne mitataan? kysyi Mauno vähän kiukustuen.

— Ennen vaikka puntarilla.

— Sinä sitä et osaa millään muulla kuin puntarilla, sanoi Mauno

alkaen työlästyä. Silläkö ne halotkin jaetaan?

— No pysytäänhän, veli Mauno, sovinnossa loppuun asti,

houkutteli Kusto. En minä voi panna mittakappaani hiekkaisiin
potattiin, sillä ei sen tarvitse paljon kulua, kun se ulos mitatessa viepi
useita jyviä liikaa. Mitataan vaikka pienellä vakalla ja sitten tähteet
puntarilla.

Kusto piti hyvin kovasti puntarimitan puolta ja vasta sitten, kuin

Mauno sanoi, että kaikki ihmisethän sillä nauravat, jos tietoon
pääsevät, heitti puntarin pois ja tyytyi siihen, kun Mauno lupasi jakaa
loput yksin potatin, ja niin se kävikin.
 *****

Veljes-eron päätyttyä pyöri Kuston päässä monenlaisia ajatuksia.

Olisi pitänyt lähteä talon ostoon, mutta lumi lepäsi mailla ja esti
näkemästä minkälaiset ovat niityt ja pellot. Toiseksi olisi ollut
mentävä sulhasiksi, mutta morsian oli tuntematoin, ei edes nimeä
muistanut. Kovin nukkavierut olivat sulhaisvaatteetkin, mutta sääli oli
ruveta uusiakin laittamaan, kun ei ollut kotona kudottua vaatetta.

Viimein keksi Kusto keinon ja rupesi vasikannahkain ostelijaksi.

Siinä sivussa oli hyvä tilaisuus katsella taloa itselleen ja käydä
kysäisemässä, mikä sen morsiamen nimi on ja että olisiko siitä
minkä verran etua talon ostoon.

Ensimäiseksi kierteli hän Jokijärven kylällä, tiedustellen yhdeltä ja

toiselta sen seudun kaupan alla olevista maista ja pian hänellä oli
jotenkin tarkat tiedot niistä. Täältä jatkoi hän matkaansa sille kylälle,
jossa tuo hänelle neuvottu morsian-ihminen oli.

Vasikannahkoista ei Kustolla ollut erittäin suurta vastusta, sillä hän

antoi kovin huokeat hinnat. Muumia kymmeniä niitä oli kumminkin
kertynyt, niin että reen laidan yli häilyi koko joukko vasikanhäntiä,
jotka ilmaisivat minkä liikkeen harjoittaja tässä oli.

Juurikan taloon mennessä liikkui Kustossa vähän rauhattomuuden

väreitä. Kaikki olivat tuntemattomia ja naisia, nuoria jos vanhojakin,
liikkui niin monta, ettei niistä päässyt mitenkään selville. Pinolta
huomasi hän renkipojan ja siltä sopi parhaiten kysellä.

— Onko tässä talossa monta talontytärtä? kysyi hän pojalta.

— Onhan niitä neljä, sanoi poika.