Supplementary Materials

1.1 Antibodies and chemical regents

Antibodies Source Identifier (Cat number)
Anti-IRF1 antibody Abcam ab232861
Anti-dsDNA antibody Abcam ab270732
Anti-AIM2 antibody Abcam ab93015
Anti-Lamin B1 antibody Abcam ab16048
Anti-cGAS antibody Abcam ab224144
Anti-STING antibody Abcam ab239074
Anti-SSBP1 antibody Abcam ab224053
Anti-Acetyllysine Rabbit mAb PTM BIO PTM-105RM
Phospho-(Ser/Thr) Phe Antibody Cell Signaling Technology 9631
Anti-GAPDH antibody Abcam ab9485
Anti-Histone H3 antibody Abcam ab1791
Anti-P62 antibody Cell Signaling Technology 39749
Anti-LC3B antibody Abcam ab192890
Anti-Caspase-1 antibody Abcam ab207802
Anti-Cleaved-Caspase 1
Cell Signaling Technology 4199
(Asp297) Antibody
Anti-GPX4 antibody Cell Signaling Technology 52455
Anti-FACL4 antibody Abcam ab155282
Anti-Bax antibody Cell Signaling Technology 2722
Anti-Bcl2 antibody Cell Signaling Technology 15071
Anti-Caspase-8 antibody Abcam ab25901
Anti-Cleaved-Caspase 8 Antibody Cell Signaling Technology 9496
Anti-phosporylation-H2AX
Cell Signaling Technology 97148
(Ser139) antibody
Anti-phosporylation-H2AX
Abcam ab243906
(Ser140) antibody
Anti-p300 antibody Cell Signaling Technology 64062
ASC/TMS1 Monoclonal antibody Proteintech Group, Inc 67494-1-Ig
Pyroptosis Antibody Sampler Cell Signaling Technology 43811
Apoptosis/Necroptosis Antibody Cell Signaling Technology 92570
Sampler Kit
Anti-FLAG® M2-Antibody Sigma F3165
Goat anti-Rabbit IgG (H+L) Highly
Cross-Adsorbed Secondary Invitrogen A32732
Antibody, Alexa Fluor™ Plus 555
Goat anti-Mouse IgG (H+L)
Highly Cross-Adsorbed
Invitrogen A32728
Secondary Antibody, Alexa
Fluor™ Plus 647
Reagent Source Identifier (Cat number)
Dulbecco’s modified Eagle’s
Gibco 11965092
medium (DMEM)
10% of fetal bovine serum (FBS) Biological Industries 04-007-1A
4, 6-diamidino-2-phenylindole
Sigma Chemical Co D9542
(DAPI)
Fugene HD transfection reagent Promega E2311
pRL-TK Vector Promega E2241
Dual-Luciferase® Reporter Assay Promega E1960
System
Cell-Light EdU Apollo488 In Vitro Bibobio C10310-3
Kit
FITC Annexin V Apoptosis BD Biosciences 556547
Detection Kit I
Oligo(dT)12-18 primer Invitrogen 18418012
Superscript II reverse Invitrogen 18064071
transcriptase
One Step TB Green® Takara RR066A
PrimeScript™ RT-PCR Kit
MG-132 Sigma Chemical Co SML1135
4-Hydroxynonenal Sigma Chemical Co 870608H
N-Acetyl-L-cysteine ethyl ester Sigma Chemical Co 1009005
Etoposide Sigma Chemical Co E1383
Cisplatin Sigma Chemical Co PHR1624
Taxol Sigma Chemical Co T7191
Teniposide MedChemEpress HY-13761
Nilotinib MedChemEpress HY-10159
Erastin MedChemEpress HY-15763
Elesclomol Chemegen STA-4783
Cyclosporin A Sigma Chemical Co C-093
H-151 Sigma Chemical Co SML2437
2ʹ3ʹ-cGAMP Sigma Chemical Co 5318890001
L002 Sigma Chemical Co SML0759
I-CBP112 Sigma Chemical Co SML1134
STING agonist-1 (G10) Selleck S8954
Senescence β-Galactosidase ThermoFisher K146501
Staining Kit
MitoProbe™ JC-1 Assay Kit Gibco M34152
MitoSOX™ Red Gibco M36008
Reactive Oxygen Species (ROS) ThermoFisher C2938
Detection reagents
Annexin V-Alexa Fluor 647/ PI YEASEN 40304ES60
apoptosis detection kit
BODIPY™ 581/591 C11 Invitrogen D3861
mPTP assay kit Beyotime C2009S
LDH assay kit Beyotime C0016
MDA assay kit Beyotime S0131S
Protein G Magnetic Beads MedChemExpress HY-K0204
HiPure Gel Pure DNA Mini Kit Magen D2111-02
Human IL6 ELISA Kit Arigobio ARG80110
Human IL1β ELISA Kit Abcam ab214025
Human TNFα ELISA Kit Abcam ab181421
Human IFNγ ELISA Kit Beyotime P1511
Lipofectamine™ 3000 Invitrogen L3000015
RAS inhibitor Abd-7 MedChemExpress HY-122862
ERK1/2 inhibitor 1 MedChemExpress HY-112287
PI3K-IN-30 MedChemExpress HY-143404
AKT-IN-1 MedChemExpress HY-1829
PKA Inhibitor Fragment (6-22) MedChemExpress HY-P1290A
amide TFA
Cyclopamine MedChemExpress HY-17024
MSAB MedChemExpress HY-120697

1.2 Information on the compounds tested through the double luciferase reporting system
of IRF1
The 25 compounds are bought from SPECS and detailed information are provided in
https://www.specs.net/index.php?page=startpage&note=password%20for%20user%20-
%20zshuaijun%20-%20correct. The purity of these compounds is over 85%.

S/N ID number Formula S/N ID number Formula

1 AF-399/37297032 C18 H14 N4 O2 14 AN-329/42548499 C19 H23 N3 O3 S

2 AP-853/42423499 C22 H24 N4 O4 S 15 AN-652/43340620 C18 H23 N3 O2

3 AE-641/15339005 C19 H19 N3 O4 S2 16 AO-022/43362220 C18 H13 Cl N2 O4
4 AG-690/33363030 C19 H17 N3 O4 17 AO-022/43454482 C19 H25 N3 O5 S
5 AH-487/42143600 C18 H22 N2 O3 S2 18 AO-080/43342567 C15 H20 N2 O5 S2
6 AH-487/42145372 C19 H19 N3 O5 S 19 AN-329/41397618 C18 H20 N2 O4 S
7 AH-487/42541328 C19 H23 N3 O5 S2 20 AO-476/42169341 C19 H19 N3 O4 S
8 AJ-292/41686369 C20 H18 N4 O3 S 21 AP-853/41872966 C17 H16 N2 O5 S
9 AK-918/42688803 C20 H17 Cl2 N O5 22 AE-641/00600055 C16 H20 Cl N3 O2
10 AK-918/42813888 C19 H17 F3 N2 O3 23 AP-853/42474541 C19 H20 N2 O6 S2
11 AK-968/41925712 C16 H28 N2 O2 24 AQ-088/42695009 C18 H14 N6 O S2
12 AO-080/43378310 C16 H18 N2 O5 S2 25 AQ-750/42594451 C17 H17 F N2 O4 S
13 AN-329/41876868 C19 H21 Cl N2 O4 S

1.3 Sequence and sources of siRNAs, Lentiviruses and adenoviruses

Small interfering RNA (siRNA) for negative control and siRNA targeting cGAS and STING were

purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

 The human IRF1 (NM_002198.3) coding region was amplified by PCR using a primer pair

specific to IRF1. The amplified fragment was inserted into the pLVX-IRES-Puro vector and

further sequenced for confirmation. After selection against Puro and confirmation by both PCR

and Western blotting, the stable cell lines were established in GeneCreate Biotech (Wuhan,

China). And for in vivo study, IRF1 overexpression adenovirus was obtained from HanBIO Tech

(HBAD000093OE; Shanghai, China). Detail information on other siRNAs, lentiviruses and

adenoviruses related with this manuscript were list below. Transfection or infection were

adopted according to the standard procedures.

siRNA name Target sequence (Sense 5' to 3') Source

SSBP1-1 CCGAAACAACUACCAGUUUTT GemPharm
SSBP1-2 GGCACAGAAUAUCAGUAUUTT GemPharm
SSBP1-3 GCAACAACAAUCAUAGCUGTT GemPharm
Lentivirus name Target sequence (Sense 5' to 3') Source
GTTCTCCGAACGTGTCACGTAATTCAAGA
Lenti-NC HanBIO Tech
GATTACGTGACACGTTCGGAGAATTTTTT
GGAAATTACCTGAGGACATCATTCAAGAG
Lenti-IRF1-1 HanBIO Tech
ATGATGTCCTCAGGTAATTTCCTTTTTT
GCAGATTAATTCCAACCAAATCTCGAG
Lenti-IRF1-2 HanBIO Tech
ATTTGGTTGGAATTAATCTGCTTTTT
GTCTGTCTATGGAGACTTTAGCTGTATTCAAGA
Lenti-IRF1-3 HanBIO Tech
GATACAGCTAAAGTCTCCATAGACAGATTTTTT
GAGACGTGGAAGGCCAACTTTCCTCGA
Lenti-IRF1-4 HanBIO Tech
GGAAAGTTGGCCTTCCACGTCTTTTTT

1.4 SARS-CoV-2 pseudovirus virus and expression plasmids

The SPIKEYTM SARS-CoV-2 pseudovirus (WT)-GFP was purchased from DELIVECTORY

BIOSCIENCES (Beijing, China). The pLenti-CMV-ACE2 –Flag-Puro plasmid was established by

Public Protein/ Plasmid library. 48 h after ACE2 overexpression plasmid transfection, the SARS-

CoV-2 pseudovirus (20 MOI) infection was adopted. The SARS-CoV-2 expression plasmids (all
NSP proteins exception of NSP3 and NSP16) were provided by Dr.Kefeng Lu (State Key

Laboratory of Biotherapy, West China Hospital). Selection of plasmids transfected cells was

adopted by administration of 50μg/mL puromycin for HELF and HaCaT cells.

1.5 Construction of IRF1 and STING-overexpression plasmids and transfection

Plasmids expressing the N-terminal tagged interferon regulatory factor 1 (accessions:

NM_002198.3) and the mutants (K124A, S125A, S127A and S128A) were constructed by

Public Protein/ Plasmid library (China). Plasmids expressing the N-terminal 3 × HA TMEM173

(accessions: NM_198282.4) was also bought from Public Protein/Plasmid Library (Nanjing,

China). Then the plasmids were transfected into primary skin cells from IRF1-/- skin tissues

using Lipofectamine 3000 (Life Technologies).

1.6 Establish of IRF1 Knockout HEK-293T cell line

The IRF1-KO cell line (Transcript: NM_002198) was produced by the Beyotime Biotechnology

(CAT: L27987). Briefly, the design of gRNAs was based on recommendation on the Zhang

laboratory website (http://crispr.mit.edu/), and the complementary oligonucleotides encoding

gRNAs were annealed and cloned into BsmBⅠ(Fermentas) sites in LentiCRISPRv2 (Addgene)

to construct th gRNA expression plasmid (A). Then the Lentiviral particles were generated by

transfection HEK-293T cells with LentiCRISPRv2-gRNA construct psPAX2 and pMD2.G

(Addgene) at a ratio of 4:3:1, respectively, which were collected 72 hours after transfection.

HEK293T cells were further transfected with the Lentivirus via infection, at 40% confluency and

24 hours later cells were detached and replated at low density. 3 hours after plating, 2μg/ mL

Puromycin was adopted to select the resistant cells. And 4 days later, cells were harvested for

extraction of genomic DNA for T7E1 (B). One out of four sequence was selected as the

sequence of sgRNA-IRF1: GATGAGCCCCGGGATTTGGT (C). The primer of PCR was 5’-

ATCACTTGCATGCCTGCTC-3’ (Forward) and 5’-AAACACCTGCTTGTCCCGTT-3’ (Reverse).

1.7 Fractional irradiation of skin cells
Skin cells were subjected to a conventional radiotherapy schedule of 2 Gy irradiation

administered daily for 5 days per week with an X-ray linear accelerator (KUBTEC XCELL 320,

Milford, CT) at a fixed dose rate of 1.7 Gy/min. The level of IRF1 activity was monitored at

intervals of 5 fractional irradiation treatments.

1.8 Animal models and ethic approval

To establish radiogenic injury models, mice were anesthetized with an intraperitoneal injection

of pentobarbital sodium (1%, 30 mg/kg), and the hair on hind limb of the mice was shaved using

a razor and then immobilized with adhesive tape on a plastic plate to minimize motion during

radiation exposure. A 1-cm-thick piece of lead was used to shield the animals and localize the

radiation field on hind leg. Different doses of irradiation were produced by the accelerator

(VARIAN trilogy-sn6518) according to different requirements: 35 Gy at the dose rate of 1000

cGy/min by a 6-MeV electron beam, 4 × 5.5 Gy at the dose rate of 1000 cGy/min by a 6-MeV X-

Ray (n=6). Skin reactions were followed at regular intervals using the semi-quantitative skin

injury scale from 1 (no damage) to 5 (severe damage), as previously described (1). And the

combined skin model was established through punch on the back (diameter of 8 mm)

immediately after 4 Gy total body irradiation (TBI) at a dose rate of 1000 cGy/min using a 6-MeV

X-ray (n = 6). For IHC analysis, the mice skin was irradiated with 20 Gy irradiation at a dose rate

of 1000 cGy/min using a 6-MeV X-rays and the nonirradiated and irradiated skin tissues were

collected 3 days after radiation.

For single cell RNA-Seq (scRNA-Seq) analysis, the rat skin tissues were irradiated with a

single dose of 30 Gy irradiation on the buttock of rat at a dose rate of 1000 cGy/min using a 6-

MeV X-ray. Samples were collected on the 7th, 14th, 28th and 60th day after radiation,

respectively (n=4) and to the sequencing was performed by OE Biotech (Shanghai, China). For

IHC analysis, the skin tissues of SD rats were irradiated with a single dose of 45 Gy irradiation
and the nonirradiated and irradiated skin tissues were collected 7 days after radiation. And the

skin tissues of monkeys with 0 or 20 Gy irradiation were collected 3 days after radiation as

reported previously (2).

Protocols for experiments involving mice were approved by the Animal Experimentation

Ethics Committee at Sichuan University (Chengdu, China).

1.9 Human skin organoids

The skin organoids (23-ChSKIN-11) were purchased from Shanghai EPISKIN Biotechnology

Co., Ltd (Shanghai). Briefly, these full-thickness skin model was constructed by culturing normal

human keratinocytes on a substrate containing collagen and human dermal fibroblasts.

Fractional radiation prescription was consistent with cultured cell lines.

Methods
2.1 Immunofluorescence and immunohistochemistry staining
HaCaT and WS1 cells were fixed with 4% paraformaldehyde, washed with PBS, and

permeabilized with 1% NP40 in PBS. Cells were blocked with blocking buffer (5% BSA) and

incubated at 4°C with antibodies (1:200) against dsDNA, AIM2, cGAS, cleaved-Caspase1,

cleaved-GSDMD, Lamin B1, SSBP1 and IRF1 overnight. FITC-/ PE-conjugated goat anti-

mouse/ rabbit (1:300) was added for 1 h at room temperature. The cells were counter-stained

with DAPI to visualize the nuclei and observed under the Laser scanning confocal microscope

(Olympus FV1000, Japan).

For immunohistochemistry staining, the tissue samples were operated according to the

standard procedures. Specifically, due to long-term storing, the concentration of IRF1 was 1:100

for the human sample from the victim exposed to Iridium-192 (192Ir) metal chain (3), while it

remains to be 1:1000 for other human and animal samples.

2.2 Hematoxylin and Eosin (H&E) staining

Skin tissues were fixed in 10% neutral-buffered formalin and embedded in paraffin. Three-

micrometer paraffin sections were de-paraffinized and heat-treated with citrate buffer (pH 6.0)

for 7 min following an epitope retrieval protocol. The sections of mouse heart, liver, spleen, lung,

kidney, stomach and skin were further stained with H&E.

2.3 EdU incorporation assay

The proliferation of HaCaT and WS1 cells was determined by the uptake of EdU into DNA. Cells

were infected with Ad-NC or Ad-IRF1. Cells in the logarithmic growth phase were trypsinized

and measured by Cell-Light™ EdU Apollo®488 in vitro imaging kit (Bibobio, Guangzhou, China).

The cells were counter-stained with DAPI to visualize the nuclei and observed under a

fluorescence microscope (Olympus, Tokyo, Japan).

2.4 Clonogenic formation

Cells infected with Ad-NC or Ad-IRF1 and irradiated with 0 or 5 Gy X-ray. Cells were plated at

low density (1,000 cells per 6-cm plate), incubated for 10 days and fixed and stained with crystal

violet. Colonies were observed using a microscope. Colony size was calculated using ImageJ

software as previously reported (4).

2.5 Flowcytometry analysis of cell death and mPTP opening

Cells were pre-treated with indicated agents and exposed to X-ray irradiation. Then different

assay kits were adopted according to the manuscript respectively, to evaluate the state of

irradiated cells. Intensity of Annexin V-Alexa Fluor 647/PI staining was monitored using a

flowcytometry (BD Biosciences, San Jose, CA). The AV+ cells were regarded as rupture of cell

member and PI positive staining indicated damage of nuclear envelope. BIDOPY staining was

the symbol of lipid peroxidation and β-Galactosidase Staining was adopted to investigate the

level of senescence. The change of intensity of Calcein AM staining detected by flowcytometry,

reflected the opening state of mitochondrial permeablity transition pore. And the concentrate of

LDH released was monitored through a BioTek reader (Synergy HTX, Winooski).

2.6 Wound healing study

For wound assay, 3 × 105 cells/well were plated into a 6-well plate and incubated to reach

confluence. Following the scratch with a tip, the detached cells were removed through washing

with serum-free medium. Then the cells were cultured in medium without FBS. IRF1 inhibitors

were pretreated at 24 h before irradiation at the concentrate of 10 μM; Cells were photographed

at 0 h and 24 h post-wounding. The closure area of wound was calculated as follows: migration

area (%) = (A0 –A24)/A0 × 100, where A0 represents the area of initial wound area, A24

represents the remaining area of wound at the metering point.

2.7 Transmission electron microscopy

Skin tissues were fixed for 2 h with 2.5% glutaraldehyde in 0.05 M sodium cacodylate buffer, pH

7.2 at room temperature, followed by 2 h in 2% OsO4 in 0.1 M sodium cacodylate buffer and 18

h in 1% aqueous uranyl acetate solution. Primary skin cells were fixed at 4 ℃ in 0.1 M

phosphate buffered 3% glutaraldehyde and postfixed in 1% osmium tetroxide in the same buffer.

After fully rinsed in distilled water, the samples were dehydrated in graded acetone series and

embedded in SPI-Pon812. Ultrathin sections were cut with a Leica EM UC7 ultramicrotome, and

attached to copper grids with Formvar film, then stained with 2% uranyl acetate and Reynolds

lead citrate, and examined under a Hitachi HT7800 electron microscope at 80 kV.

2.8 Real-time PCR analysis

RNA from skin tissues was reverse transcribed to cDNA using an oligo(dT)12-18 primer and

Superscript II reverse transcriptase (Invitrogen). The SYBR green dye One Step TB Green®

PrimeScript™ RT-PCR Kit (Takara, Japan) was used for amplification of cDNA. mRNA levels as

well as that of the internal standard, glyceraldehyde 3-phosphate dehydrogenase (GAPDH),

were measured by real-time quantitative PCR in triplicates using a Prism 7900 real-time PCR

machine (Applied Biosystems, Foster City, CA). Real-time PCR analysis of the lncRNAs and

mRNAs was designed and conducted at AcebioX Biotech (Shanghai, China). The quantitative

real-time PCR results were analyzed and expressed as relative mRNA levels based on the

cycle threshold value, which was then converted to fold change.

2.9 Co-immunoprecipitation (Co-IP) study and nondenaturing SDS-PAGE.

Cells pretreated with targeted siRNAs, agonists or antagonists of STING and P300 were

irradiated with a single 20 Gy X-ray. Then, cells were washed with pre-chilled phosphate-

buffered saline (PBS) and lysed with RIPA buffer containing protease inhibitor compounds and

PMSF (1%). 500 μg cell lysates was subjected to immunoprecipitation with 3 μg indicated

antibodies for co-immunoprecipitation (Co-IP) by using Protein G Magnetic Beads (MedChem

Express). The protein level was detected by using indicated antibodies with Western blotting

analysis.

For nondenaturing SDS-PAGE, in 1-12 h after 20 Gy irradiation, cell lysates were mixed with

5× SDS sample buffer without 2-ME and incubated at 37 °C for 60 min. Samples were then

separated by 10% SDS-PAGE, transferred to PVDF membrane and analyzed by Western

blotting.

2.10 Chromatin immunoprecipitation (ChIP) assay

At 2 h after 20 Gy irradiation, pretreated with/ without specific inhibitors, 5× 106 HaCaT cells

were fixed with formaldehyde (1%) to preserve the cellular protein-DNA interactions.

Immunoprecipitation was conducted with IRF1-specific antibody (mAb, ab232861). ChIP assay

was performed in accordance with the manufacturer’s instructions (Magna ChIP™ A/G

Chromatin Immunoprecipitation Kit, Millipore), essentially as we described (50). Detection of the

IRF1-responsive promoter in cells infected with 6 × IRF-RLUC adenovirus was performed with

the following oligonucleotides: GGAGTTCCGACCGGTTCTA. The reported sequence

(TCCCAATACATGTACAGGCCC) targeting binding site in Caspase 1 by IRF1 was used to

investigate the transcriptional activity in non-transfected cells (36). Quantitative RT-PCR with

the precipitated chromatin was performed to calculate the percentage of input. After

normalization of the data according to the respective negative control, the percent of input

chromatin was calculated.

2.11 Dual luciferase assay

The full-length of rat LOC692021 and LOC100910604 sequence was synthesized Suzhou

Synbio Co. Ltd. (Suzhou, China) and cloned downstream of pGL3-Promoter vector (Promega,

Madison, WI). The plasmids were verified by sequencing. The potential binding sites of lncRNAs

for miRNAs were identified using the online software program starBase v2.0

(http://starbase.sysu.edu.cn/index.php). The IRF1-responsive luciferase reporter and the control

reporter were obtained from Qiagen. The luciferase reporter with IRF1-responsive elements was

inserted upstream of the luciferase gene in the pGL4-Basic vector. WS1 cells, primary skin cells,

293T and other cells except HaCaT cells were transfected with reporter vectors using Fugene

HD transfection reagent (Promega). In each transfection, pRL-TK (Promega) was used to

correct for the transfection efficiency. Luciferase activity was measured with the Dual-Luciferase

Reporter Assay System (Promega). Promoter activity was expressed as the ratio of firefly

luciferase to Renilla luciferase activity.

Due to limited transfection effectiveness of HaCaT cells, h-IRF1 promoter-rluc was further

established based on the CMV-FLUC vector by Hanbio Tech (Shanghai, China). Promoter

activity was expressed as the ratio of Renilla luciferase to firefly luciferase activity. The

sequence of 6×IRF-RLUC were list as follows:

GGAAGCGAAAATGAAATTGACTGGAAGCGAAAATGAAATTGACTGGAAGCGAAAATGAAAT

TGACTGGAAGCGAAAATGAAATTGACTGGAAGCGAAAATGAAATTGACTGGAAGCGAAAAT

GAAATTGACT.

Plasmids for investigation on the specific and sensitive of established 6×IRF-RLUC were

were purchased from the Public Protein/ Plasmid library (Nanjing, China).

Plasmid name Gene name Catalog number

pIRF-TA-luc 6xIRF response element PPL01160-2a
pGL3-Basic-CCL20 promoter CCL20 promoter PPL00419-2a
ER Stress Response
pER Stress Response-TA-luc response element PPL00988-2a
 pMIR-Reporter-IL13(3‘UTR) IL13(3‘UTR) PPL00445-2a
pGL3-promoter-ISRE ISRE PPL00949-2a
pGL4.19-NFkB response element NFkB response element PPL00010-2c
pNrf1-TA-luc Nrf1 response element PPL01428-2a
pp53-TA-luc p53 response element PPL00288-2a
pGL4.19-TA-STAT1 response STAT1 response element
element PPL00014-2d
pGL4.19-TA-STAT3 response STAT3 response element
element PPL00013-2d
pGL4.19-TA-FOXO response FOXO response element
element PPL00993-2a
pGL3-Basic-ZEB2 promoter(FL) ZEB2 promoter(FL) PPL00808-2a
pGL3-Basic-VCAM1 promoter VCAM1 promoter PPL00418-2a
pGL4.19-TA-TGF Beta response TGF Beta response element
element PPL00222-2e
pGL4.19-STAT4 response STAT4 response element
element PPL00564-2b
pGL3-Basic-PRDX6 promoter(- PRDX6 promoter(-2000~-1)
2000~-1) PPL00160-4a
pGL3-Basic-PD-L1 promoter(- PD-L1 promoter(-1000~+200)
1000~+200) PPL00385-2a
pGL3-Basic-MAVS promoter MAVS promoter PPL00723-2a
pHIF-1 alpha-TA-luc HIF-1 alpha response element PPL00599-2e
pFXR-TA-luc FXR response element PPL00896-2b
pGL4.19-TA-CREB response CREB response element
element PPL00586-2b

3 Multi-omics studies in this manuscript

3.1 Bioinformatic analysis of RNA-Seq data
Details of comparative analysis of RNA-Seq for irradiated HaCaT cells (GSE86252) and mouse

stomach tissues (GSE114246) were reported previously (5). And the information on RNA-Seq of

irradiated rat lung tissues will be reported in another study recently. In this study, 20 Gy X-ray
irradiation was administrated for hind limb of rats. Then skin tissue samples were collected in

three days after irradiation and further transported to OE Biotech (Shanghai, China) for RNA-

Seq analysis.1500bp upstream promoter sequences of the dysregulated lncRNAs for

locating known cis-regulatory elements was conducted using the sequence-analysis tool

MEME with a combined P-value < 0.01 as threshold. The matrices generated by MEME

were then compared with the TRANSFAC database using the DNA binding motif

similarity tool STAMP as previously reported (6).

And skin tissues from IRF1+/+ and IRF1-/- mice were collected for the other RNA-Seq. RNA

extraction and microarray profiling were performed in the laboratory of OE Biotech (Shanghai,

China). Sample labeling, microarray hybridization, and washing were performed based on the

manufacturer’s standard protocols. The labeled cRNAs were hybridized onto the mouse RNA

array (Agilent-084388 Mouse lncRNA Microrray V3; 4×180K, Design ID: 084388), including

mRNAs, lncRNAs and circRNAs. After washing, the arrays were scanned with the Agilent

Scanner G2505C (Agilent Technologies, Santa Clara, CA). Feature Extraction software (version

10.7.1.1, Agilent Technologies) was used to analyze the array images and extract the raw data.

Genespring (Version 12.5, Agilent Technologies) was employed to complete the basic analysis

of the raw data. To begin with, raw data was normalized using the quantile algorithm. The

probes that had at least 1 condition out of 2 conditions flagged as “P”, were chosen for further

data analysis. Differentially expressed RNAs were then identified through fold-change as well as

P values, calculated using t-test. The threshold set for up- and down-regulated genes was fold

change ≥ 2.0 and a P value < 0.05. Then, Hierarchical Clustering was performed to display the

distinguishable expression patterns of mRNAs, lncRNAs and circRNAs among the two groups.

3.2 ChIP-Seq analysis

Briefly, cGAS and AIM2 were pulled down through the specific antibody from cytoplasm lysates

of HaCaT cells in 2 h and 4 h after irradiation respectively and then the binding DNA was
extracted from the complex of protein/ nucleic acids through HiPure Gel Pure DNA Mini Kit.

Details on ChIP assay were provided on the supplementary materials. The purified DNA was

then sent to OE Biotech (Shanghai, China) and Igenebook Biotech (Wuhan, China) respectively.

Analysis of DNA profiles was then adopted according to the standard protocol.

3.3 PTM analysis

IRF1 protein was pulled down through the specific antibody (ab232861) from cell lysates and

the gel around the targeted weight was then sent to JINGJIE PTM BioLab, Inc (Hangzhou,

China). In-gel digestion was adopted according to standard protocols and the tryptic peptides

were dissolved in 0.1% formic acid (solvent A), directly loaded onto a home-made reversed-

phase analytical column. The gradient was comprised of an increase from 6% to 35% solvent B

(0.1% formic acid in 98% acetonitrile) over 22 min, 35% to 80% in 4 min then holding at 80% for

the last 4 min, all at a constant flow rate of 450 nl/min on an EASY-nLC 1000 UPLC system.

Then, the peptides were subjected to NSI source followed by tandem mass spectrometry

(MS/MS) in Q ExactiveTM Plus (Thermo) coupled online to the UPLC. The electrospray voltage

applied was 2.1 kV. The m/z scan range was 350 to 1800 for full scan, and intact peptides were

detected in the Orbitrap at a resolution of 70,000. Peptides were then selected for MS/MS using

NCE setting as 28 and the fragments were detected in the Orbitrap at a resolution of 17,500. A

data-dependent procedure that alternated between one MS scan followed by 20 MS/MS scans

with 15.0s dynamic exclusion. Automatic gain control (AGC) was set at 5E4.

The resulting MS/MS data were processed using both MaxQuant 1.6.15.0 and Proteome

Discoverer 2.4. Tandem mass spectra were searched against IRF1 (NP_002189.1 interferon

regulatory factor 1 isoform 1 (325 aa) [Homo sapiens]). Trypsin/P (or other enzymes if any) was

specified as cleavage enzyme allowing up to 2 missing cleavages. Mass error was set to 10

ppm for precursor ions and 0.02 Da for fragment ions. Carbamidomethyl on Cys were specified

as fixed modification and oxidation on Met was specified as variable modification. Peptide

confidence was set at high, and peptide ion score was set > 20.
3.4 Interactomes analysis
IRF1 was pulled down through the specific antibody from samples and the gel around the

targeted weight was then sent to JINGJIE PTM BioLab (Hangzhou, China). Analysis of

interactomes of IRF1 was then adopted according to the standard protocols.

3.5 Single cell RNA-Seq (scRNA-Seq)

IRF1 expression profiles were investigated based on two scRNA-Seq analysis of irradiated rat

skins and skin samples from a victim exposed to irradiation by OE Biotech (Shanghai, China).

The treatment of rat and brief information on the victim were described above and more details

will be reported in future. IRF1 expression profiles in response to single 20 Gy and fractional 2

Gy X-ray irradiation and ionizing radiation induced PANoptosis were further adopted and

investigated by bioinformatics analysis of the scRNA-Seq of irradiated HaCaT cells in Singleron

Biotechnology Coo., Ltd (Nanjing, China). Cell communication based on bioinformatics analysis

of scRNA-Seq datasets for irradiated rat skins was adopted through CellChat as reported by OE

Biotech (7).

3.6 Immunoassay of inflammation factors through Raybiotech kit QAM-INF-1

Skin tissues from different groups of mice were collected and frozen in liquid nitrogen. Protein

extraction and microarray profiling were performed based on the manufacturer’s standard

protocols in the laboratory of Raybiotech, Inc (Guangzhou, China). Concentration of the 40

kinds of inflammation factors were compared between different groups and further analysis was

based on the Z-SCORE of each group.

Identify small molecular targeted DBP of IRF1

4.1 Protein preparation
The IRF1 and DNA interface is characterized by an extended flat surface, similar to most

protein–protein interfaces (Fig. 7A), which provides a potential target to inhibit gene transcription

(8). The 3D structure of IRF1 in complex with DNA was downloaded from the Protein Data Bank

(PDB entry 1IF1).1 DNA was removed, and hydrogen atoms were added to the protein
according to the protonation states of chemical groups at pH 7. The added hydrogen atoms

were further minimized by the conjugate gradient algorithm with a distance-dependent dielectric

of 4r and a nonbonding cutoff of 14 Å.

4.2 Preparation of the SPECS library

The library of about 210,000 compounds was downloaded from ZINC (9). The library was firstly

filtered by physicochemical properties (e.g., clogP) and removing reactive-motif contained

compounds by the program QueryDB (www.lephar.com). Compounds with fewer than two

hydrogen bond acceptors were further removed, as suggested by the key H-bonding

interactions between IRF-1 and DNA. Finally, about 50,000 compounds passed all criteria for

docking.

4.3 Molecular docking

The helix-turn-helix motif of IRF1 latches to DNA through three of five conserved tryptophan

residues, namely, Trp11, Trp38 and Trp58 and small molecules docked to the putative binding

sites, which was delineated by residues Arg64, Asn80, Cys83, Ala84, Leu88 and Pro89 in the

helix-turn-helix motif, as well as Trp11, Leu12, Glu13, and Trp58. The binding site was

delineated by residues from 80 to 90, as well as Arg64, Trp58, Trp11, Leu12 and Glu13. The

compound library was then docked into the defined binding site by the program LeDock (10).

4.4 Scoring and selection

Docking poses were minimized by the program CHARMM4 while keeping the protein rigid, and

rescored by the previously reported scoring function). Compounds failing to make H-bonding

interactions with Leu12 and Trp58 were discarded (11). The 687 compounds with predicted

binding affinity greater than -6 kcal/mol and ligand efficiency higher than 0.24 kcal/mol per

heavy atom were then clustered into 273 clusters according to the maximum common

substructure, and subject to visual inspection (12).

4.5 Functional analysis of drugs in vitro and in vivo

The selected 25 compounds were further tested through dual luciferase reporter assay, viability

assay and LDH analysis in vitro. Then the adverse effects of two most effective agents were
explored, where mice were prescribed with continuous subcutaneous injection or gavage for

four days (50 mM, 100μL/time) and subsequently, mice were further administrated

subcutaneously twice in three days before irradiation (50 mM, 100μL/time) to evaluated the

protective effects in the progression of radiogenic skin injury in vivo.

Other details

Detailed descriptions of the methods and other methods used in this study can be obtained

through e-mail contact with the corresponding author.

REFERENCES

1. Brand RM, Epperly MW, Stottlemyer JM, Skoda EM, Gao X, Li S, Huq S, Wipf P, Kagan VE,

Greenberger JS, Falo LD Jr. (2017). A Topical Mitochondria-Targeted Redox-Cycling Nitroxide

Mitigates Oxidative Stress-Induced Skin Damage. J Invest Dermatol. 137(3):576-586.

2. Qiu Y, Gao Y, Yu D, Zhong L, Cai W, Ji J, Geng F, Tang G, Zhang H, Cao J, Zhang J, Zhang

S.(2020). Genome-Wide Analysis Reveals Zinc Transporter ZIP9 Regulated by DNA

Methylation Promotes Radiation-Induced Skin Fibrosis via the TGF-β Signaling Pathway. J

Invest Dermatol. 140(1):94-102.e7.

3. Yu D, Zhang S, Mo W, Jiang Z, Wang M, An L, Wang Y, Liu Y, Jiang S, Wu A, Cao J, Zhang

S. (2021). Transplantation of the Stromal Vascular Fraction (SVF) Mitigates Severe Radiation-

Induced Skin Injury. Radiat Res. 196(3):250-260.

4. Xue J, Zhu W, Song J, Jiao Y, Luo J, Yu C, Zhou J, Wu J, Chen M, Ding WQ, Cao J, Zhang

S. (2018). Activation of PPARα by clofibrate sensitizes pancreatic cancer cells to radiation

through the Wnt/β-catenin pathway. Oncogene. 37(7):953-962.

5. Chen G, Feng Y, Sun Z, Gao Y, Wu C, Zhang H, Cao J, Chen Z, Cao J, Zhu Y, Zhang S.

(2019). mRNA and lncRNA Expression Profiling of Radiation-Induced Gastric Injury Reveals
Potential Radiation-Responsive Transcription Factors. Dose Response.

17(4):1559325819886766.

6. Song J, Zhang H, Wang Z, Xu W, Zhong L, Cao J, Yang J, Tian Y, Yu D, Ji J, Cao J, Zhang

S.. (2018).The Role of FABP5 in Radiation-Induced Human Skin Fibrosis. Radiat Res.

189(2):177-186.

7. Jin S, Guerrero-Juarez CF, Zhang L, Chang I, Ramos R, Kuan CH, Myung P, Plikus MV, Nie

Q. (2021). Inference and analysis of cell-cell communication using CellChat. Nat Commun.

12(1):1088.

8. Escalante CR, Yie J, Thanos D, Aggarwal AK. (1998). Structure of IRF-1 with bound DNA

reveals determinants of interferon regulation. Nature. 391 (6662):103-6.

9. Irwin JJ, Shoichet BK. (2005). ZINC--a free database of commercially available compounds

for virtual screening. J Chem Inf Model. 45(1):177-182.

10. Zhang N, Zhao H. (2016). Enriching screening libraries with bioactive fragment space.

Bioorg Med Chem Lett. 26(15):3594-3597.

11. Brooks BR, Brooks CL 3rd, Mackerell AD Jr, Nilsson L, Petrella RJ, Roux B, Won Y,

Archontis G, Bartels C, Boresch S, Caflisch A, Caves L, Cui Q, Dinner AR, Feig M, Fischer S,

Gao J, Hodoscek M, Im W, Kuczera K, Lazaridis T, Ma J, Ovchinnikov V, Paci E, Pastor RW,

Post CB, Pu JZ, Schaefer M, Tidor B, Venable RM, Woodcock HL, Wu X, Yang W, York DM,

Karplus M. (2009) CHARMM: the biomolecular simulation program. J Comput Chem.

30(10):1545-1614.

12. Zhao H, Huang D. (2011). Hydrogen bonding penalty upon ligand binding. PLoS One.

6(6):e19923.
Supplementary datasets
Fig.S1 Supplementary information on modulation of IRF1 expression, translocation and

activation by ionizing radiation

(A) Primary skin cells from IRF1+/+ and IRF1-/- mice were transfected with 20 different luciferase

reporters as indicated, together with the same TK plasmid. IRF1 overexpressing adenovirus (Ad-

IRF1) and the negative control virus (Ad-NC) infection were used to trigger the potential target genes.

The ratio of normalized luciferase value (Firefly/Relina LUC, which is inverse in the established IRF1

reporter system) in Ad-IRF1 infected and Ad-NC infected cells were calculated. (B) Primary skin cells

from wild type mice were infected with the established IRF1 reporter and 48 h after infection, cells

were administrated with inhibitors against the indicated signals. 24 h later, cells were exposed to 20

Gy X-rays and 2 h after irradiation dual-luciferase assay was performed. (C) 293T cells were

infected with the established IRF1 reporter and 48 h after infection Ad-NC or Ad-IRF1 virus in

different MOI were used to stimulate IRF1 activation. The dual-luciferase assay was adopted in

another 48 h after Ad-NC or Ad-IRF1 infection. (D) Western blot results showing the change in IRF1

and SSBP1 expression in HaCaT cells exposed to 2 Gy irradiation. (E) and (F) Analysis of the

effects of radiation, a single 2 Gy or 10 Gy doses on IRF1 transcriptional activity in HaCaT cells

through the dual-luciferase assay. (G) Influence of MG132 on IRF1 activity in irradiated HaCaT cells

as determined by dual-luciferase reporter assay. (H) and (I) Change in IRF1 expression in WS1 cells

after 2-, 5- and 10-Gy irradiation in the presence or absence of MG-132 (10 μM, 24 h). (J) and (K)

Detection of radiation-induced nuclear translocation of IRF1 in WS1 and mice primary skin cells

determined by immunofluorescence analysis. (L) Transfection of siRNA-SSBP1 facilitates nuclear

translocation of IRF1 in irradiated WS1 cells. (M) Transfection of Ad-IRF1 increased the expression

of SSBP1 in irradiated HaCaT cells. (N) Identifying the potential sites of acetylation modifications of

IRF1 caused by irradiation through mass spectroscopy. (O) Influence of SSBP1 knockdown by

siRNAs transfection in ubiquitination of IRF1, detected by IP analysis. (P) Change of the interaction

between IRF1 and SSBP1 in HaCaT cells exposed to 2 Gy×10 fractional radiation, detected by Co-
IP analysis. (Q) Schematic of functional domains and residues of IRF1, highlighting the evolutionary

conservation of the nuclear location sequence (NLS) among rodents, mammals, primates and

humans.
Fig. S2 Supplementary information on mechanism of IRF1 activation, which influences

skin and systematic inflammation response

(A) Localization of double-stranded DNA (dsDNA) in the cytoplasm caused by adenoviral infection

and ionizing irradiation of skin cells, as detected by a specific antibody against the dsDNA. (B)

Decrease in the intensity of calcein AM staining 1-2 h after irradiation. (C) Annexin/propidium iodide

(PI) staining to detect dead HaCaT cells transfected with Lenti-NC or Lenti-shIRF1 virus and

irradiated (20 Gy, 72 h) in the presence or absence of CsA. (D) Pretreatment with a STING agonist

(2’3’-cGAMP) and antagonist (H151) changed IRF1 activity in UVB-exposed HaCaT cells, but

transfection with siRNA-SSBP1 exerted little effect. (E) The effects of the STING agonist G10 and

the ATM inhibitor KU-55988 on IRF1 activity in HaCaT cells 4 h after irradiation. (F) The influence of

STING-expression plasmid transfection in IRF1 transcription activity in 293T cells detected by dual-

luciferase reporter assay. (G) Influence of STING on the radiation-induced IRF1 response in primary

skin cells from mice with, as determined through a dual-luciferase reporter assay. (H) Western blots

showing the expression of cell death-related biomarkers 72 h after irradiation. (I) Heatmap showing

the altered levels of inflammatory factors and chemokines in irradiated skin tissues, as detected

through immunoassay performed by RayBiotech. (J) Kyoto Encyclopedia of Genes and Genomes

(KEGG) analysis of altered inflammatory factor and chemokine levels in irradiated skin tissues. (K)

Western blots showing cell death-related biomarker expression in irradiated HaCaT cells transfected

with the indicated lentiviruses. (L) Elisa analysis of the IL-1, IL-6, TNFα and IFNγ levels in heart, liver

and spleen tissues from IRF1+/+ and IRF1-/- mice, of which the right limbs were exposed to single 35

Gy electron beam irradiation 72 h ago.

Fig. S3 IRF1 induces cell death of skin cells.

(A) and (J) Effects of IRF1 on cell death as determined by Annexin/propidium iodide (PI) staining in

IRF1-overexpressing and IRF1-knockdown cells. (B), (C), (K) and (L) Effects of IRF1 on cell self-

renewal ability as determined by through a colony formation assay with IRF1-overexpressing and

IRF1-knockdown cells. (D), (E), (M) and (N) Effects of IRF1 on cell proliferation as determined by

EdU staining in IRF1-overexpressing and IRF1-knockdown cells. (F), (G), (O) and (P) Effects of IRF1

on the senescence of IRF1-overexpressing and IRF1-knockdown cells and primary skin cells from

mice with different IRF1 genotypes, as determined by SA-β-Gal staining. (H), (I), (Q), (R) and (S)

Effects of IRF1 on the migratory ability of IRF1-overexpressing and IRF1-knockdown cells as

determined by wound healing analysis. (G) Effects of IRF1 on the cell death of IRF1-overexpressing

cells as determined by AV/PI staining.

Fig. S4 The role of PTMs and SSBP1 in IRF1-mediated cell injury through gain- and loss-of-

function experiments.

(A) to (F) HaCaT and WS1 cells were infected with Lenti-IRF1 virus to establish IRF1-knockdown

cells. Meanwhile the established IRF1-knockdown cells were transfected with IRF1-Wildtype, IRF1

K124-A, IRF1 S125-A, IRF1 S127-A and IRF1 S128-A expressing plasmids and 72 h after

transfection cells were irradiated to 20 Gy X-rays. Cell death was detected using AV/PI staining

in HaCaT cells 72 h after irradiation (A and B). Cell senescence was determined by SA-β-Gal

staining in WS1 cells 7 days after irradiation (C and D). Cell proliferation was monitored through

EdU staining in HaCaT cells 24 h after irradiation (E and F). (G) The strategy of establishing

IRF1-KO 293T cells adopted by the Beyotime Biotechnology. (H) The efficiency of IRF1

knockout detected through extraction of genomic DNA for T7E1. (I) Detailed information on the

selected sgRNA-IRF1: GATGAGCCCCGGGATTTGGT. For (J) to (O), IRF1-KO cells were

cultured in complete DMEM medium supplied with 2 μg/ mL puromycin. Transfection of

plasmids and siRNA were adopted according to instructions. (J) Influence of mutation of PTMs

sites in IRF1 activation 4 h after 5 Gy irradiation, detected through dual luciferase reporter assay.

(K and L) Influence of mutation of PTMs sites in nuclear translocation of IRF1 4 h after 5 Gy

irradiation, detected through Western blotting analysis. Investigate on the role of SSBP1 in

IRF1-mediated cell injury in IRF1-KO cells 72 h after 20 Gy irradiation. (M to O) Cell death, lipid

peroxidation and membrane injury were evaluated through AV/PI based staining, BODIPY

581/591 C11 and calcein AM staining, respectively.

Fig. S5 Activation of IRF1 magnified radiation-induced mitochondrial dysfunction and

nuclear envelope rupture.

(A) Detection of morphological changes in mitochondria in skin tissues of IRF1-WT (swelling) and

IRF1-knockout (KO; nonswelling) mice as determined through transmission electron microscopy

(TEM). (B) Gene set variation analysis GSVA showing the influence of gene sets on the metabolism

pathway based on an irradiated IRF1-mutant and IRF1-wild-type (WT) mice and related altered

genes. (C) Analysis for correlation between mRNA level of IRF1 and CMPK2 based on datasets

from scRNA-Seq of HaCaT cells. (D) to (F) Changes in mitochondrial membrane potential (MMP),

mitochondrial ROS formation and mitochondrial permeability transition pore (mPTP) opening in

irradiated cells transfected with lenti-shIRF1, as determined by JC-1, MitoSOX and Calcein AM

staining, respectively. (G) Detection of double-stranded DNA (dsDNA) in the cytoplasm of in IRF1-

knockdown cells as determined through immunofluorescence analysis. (H) Detection of

morphological changes of the ruptured nuclear envelope in primary cells of skin tissues in WT IRF1

and IRF1-KO mice, as determined through TEM. (I) Western blots showing changes in the cleavage

of Caspase1 and Lamin B1 and the expression of autophagy biomarkers in IRF1-knockdown cells.

(J) Flow cytometry analysis showing IRF1-knockdown cells transfected with mRFP-GFP-LC3;

GFP+/RFP+ cells represent autophagosomes and GFP+/RFP- cells represent autolysosomes. (K)

Detection of autophagosomes in primary cells of skin tissues in WT IRF1 and IRF1-KO mice, as

determined through TEM. (L) Change of Lamin B1 staining caused by Lenti-shIRF1 transfection in

irradiated cells. Reduplicate experiments were adopted for at least three times for each study. *P <

0.05 and **P < 0.01, compared with the control group.
Fig. S6 IRF1 plays as a key regulator in communication between structural and immune
cells in response to ionizing radiation.
(A) Expression of immune-related genes in structural and immunes cells, from 7 to 60 days after

irradiation. (B) Divided keratinocytes and fibroblasts into different clusters based on the level of IRF1

mRNA. (C) Alteration of interaction strength caused by irradiation. Interactions are divided into

incoming and outgoing events. (D) Circos plots displaying putative ligand–receptor interactions

between structural and immune cells, from 7 to 60 days after irradiation. Different cell populations

are color-coded, and brand color represents cells with outgoing evens and width represents

communication strength. Expression of receptors and ligands in clusters of keratinocytes (E) and

fibroblasts (F) with different IRF1 expression, annotated with the cell–cell interactions that they may

mediate with immune cells. (G) The inferred signaling networks between different cell clusters.

Different cell populations are color-coded, and brand color represents cells with outgoing evens and

width represents communication strength. (H) Protracted activation of IRF1 in IFE-BII cels (cluster

10) after irradiation visualized by heapmap of SCENIC analysis. (I) Expanding of T cell populations

visualized by t-SNE across scRNA-seq datasets from irradiated rat skin tissues.
Fig. S7 Influence of IRF1 inhibitors on the inflammatory response in skin cells and
radio/chemotherapy sensitivity of cancer cells
(A) The panel of the 25 selected compounds for analysis by dual luciferase reporter assays. (B)

Selection of potential inhibitors of IRF1 used to treat A375 cells, as determined based on a dual

luciferase reporter assay. (C) and (D) Decreased lactate dehydrogenase (LDH) release in WS1 cells

in the first three days after irradiation. (E) Decreased lactate dehydrogenase (LDH) release by

HaCaT cells 24 and 48 h after irradiation. (F) and (G) Decreased lactate dehydrogenase (LDH)

release in primary skin cells cells in the first three days after irradiation. (H) Kyoto Encyclopedia of

Genes and Genomes (KEGG) analysis of the changes in inflammatory signaling pathways in

irradiated skin tissues pretreated with I-2.

Fig. S8 The radiation mitigators harbor potential to serve for immune disorders with IRF1

activation in clinical settings

Screening of SARS-CoV-2-encoded proteins for activation of IRF1 in HELF cells, as determined

based on a dual luciferase reporter assay (A). Investigation of the SARS-CoV-2-NSP plasmids

transfection induced activation of IRF1 in HaCaT cells, as determined based on a dual luciferase

reporter assay (B). (C)Western blot analysis of SARS-CoV-2-encoded proteins for expression of

IRF1 in HaCaT cells.

(D) HELF, HaCaT and WS1 cells were pretreated with 20 μM I-2 or I-19 for 24 h, then the plasmid

expressing SARS-CoV-2-NSP10 and luciferase reporter system were transfected into different cells.

The cell lysate was extracted and dual luciferase reporter assay were adopted 72 h after transfection.

(E) Plasmid expressing ACE2 and luciferase reporter system were transfected into HELF cells and

50 μM I-2 or DMSO were administrated 48 h after transfection. And after 24 h, the medium was

replaced with serum-free medium and pseudovirus infection were adopted. Complete medium was

supplied in 12 h after infection and luciferase reporter assay were adopted in 24-96 h after infection.

(F) and (G) Analysis of the effects of etoposide (Eto), elesclomol (ES, in combination of 3mM Cu2+),

erastin, teniposide and nilotinib on IRF1 activity in HaCaT cells, detected with the dual-luciferase

reporter assay system. Analysis of the effects of UVB (H), ROS and lipid peroxidation (I) on IRF1

transcriptional activity through the dual-luciferase assay. Analysis of the effects of radiation on IRF1

activity in cutaneous squamous cell carcinoma cells (A431 cells) and melanoma cells (A375 cells)

(J). (K) to (N) Influence of I-2 and I-19 in cytotoxic effects of ionizing radiation, cisplatin (DDP),

etoposide (Eto) and pachitaxel taxol (PTX) on cutaneous melanoma cells (A375 cells), squamous

cell carcinoma cells (A431 cells) and esophagus cancer cells (TE-1 and K150). (O) and (P) Clinical

and gene expression data were download from the TCGA database. The IRF1 mRNA profiles in

SKCM and HNSC patients receiving radiotherapy or not and the influence of IRF1 expression in

overall survival of SKCM and HNSC patients were further analyzed. High and low expression were

divided by the mean of mRNA expression. The left number in the icon stands for the death fatalities
and the right number represent the incidence. *P < 0.05 and **P < 0.01, compared with the control

group.
Fig. S9 No adverse effects of the selected IRF1 inhibitors administrated for C57 mice
through gavage or subcutaneous injection were observed.
(A) Curves of body weight for mice treated with I-2/ I-19 showed no significant difference (n=4). (B)

and (C) Histological staining of heart, liver, spleen, lung, kidney, stomach and skin from mice treated

with I-2/ I-19 by gavage or subcutaneous injection revealed no significant pathologic differences

(n=4).