Translated from Korean to English - www.onlinedoctranslator.

com

J. Kor. Soc. Cosm.

Journal of the Korean Society of Aesthetics

My16Kwon JeOnelike,2010
Vol. 16, No. 1 (2010) p.298-308
<Research Paper>

In C57BL/6 mice, rosemary oil was found to increase hair growth-related enzyme activity and

Effect on Cytokine Expression

Kim Mi-hyangdotKim Young-cheol†

Keimyung School School Public Health Department

The Effects of Rosemary Oil on the Activities of Enzyme and Expression of Cytokine
Relevant to Hair Growth in C57BL/6 Mice

Mi-Hyang KimdotYoung-Chul Kim†

Dept. of Public Health, Graduate School, Keimyung University

date of receipt (2010year01month29day) / modification date (2010year03month09work,03month19day) / adoption date (2010year03month24Work)

Abstract

This study was carried out to know the effects of rosemary oil on the activities of enzyme and
expression of cytokine relevant to hair growth in C57BL/6 mice. Six weeks old male mice were
divided into four groups including normal group (saline; N), vehicle control group (jojoba oil; VC),
positive control group (3% minoxidil; PC) and experimental group (3% rosemary oil; E) . The animals
were topically applied with an amount of 100μlonce a day, 6 days a week, for 4 weeks. Dermal ALP
and γ-GT activities were significantly increased in PC and E groups in comparison with N group (p
<0.05). IGF-1 mRNA expression in the skin was also significantly increased in PC and E groups in
comparison with N group (p<0.05). SCF antigens were heavily stained in bulge and sebaceous gland
in E and PC groups, while they were moderately or mildly stained in dermal papilla, sebaceous
gland and epidermis in N and VC groups. These results indicated that rosemary oil promotes the
ALP and γ-GT activities and IGF-1 mRNA expression in the skin tissues of C57BL/6 mice.

Key words：Rosemary Oil, C57BL/6 Mice, ALP, γ-GT, IGF-1

I.Introduction As it increases, the desire to recover from hair

loss is increasing.
Recently, due to changes in diet and increased stress, The hair cycle is divided into a growth phase (anagen)

the number of people suffering psychologically from hair in which hair grows, a catagen phase in which the

loss is increasing. Alopecia patients are suffering from metabolic process is delayed as the hair bulb is reduced

significant social and psychological suffering due to after stopping growth, and a telogen phase in which the

image change due to hair loss, and interest in beauty is hair follicle contracts and rises upward (telogen) (Zhao et

increasing along with economic improvement. al., 2007) ). In each hair growth cycle, various factors act
to induce wool or hair loss. There are several known
causes of hair loss, but recently, it has been reported
†Corresponding author：Young-Chul Kim Tel
：053-580-5931 that hair growth factors are involved in hair loss.
E-mail：yckim@kmu.ac.kr ak and Chan, 2003).
 Effects of rosemary oil on hair growth-related enzyme activity and cytokine expression in C57BL/6 mice
Looking at the research on the hair loss mechanism
revealed so far, among the cytokines present in the
skin, interleukin (IL)-1 and tumor necrosis factor
(TNF)-α cause hair loss by inducing cell death of hair
cells and transforming growth factor (TGF). )-β2And
the male hormone androgen shortens the growth
phase of the hair, thereby causing the hair to enter
the degenerative phase faster than normal. On the
other hand, growth factors such as insulin-like
growth factor (IGF)-1, epidermal growth factor (EGF),
and fibroblast growth factor (FGF) are known to
promote hair growth and prevent hair cell death
(Krause and Foitzik). , 2006; Toshihiko and Toshio,
2004). Alkaline phosphatase (ALP), an enzyme related
to hair growth, is involved in angiogenesis and
facilitates hair growth (Mesister and Anderson, 1983),
and γ-glutamyl transpeptidase (γ-GT) is known as a
good indicator of the growth phase (Handjiski et al.,
1994).
Currently approved by the US Food and Drug
Administration (US-FDA) to promote hair growth
are finasteride and minoxidil (Trüeb, 2001). The
mechanism of action of minoxidil on hair growth
is that it acts on peripheral blood vessels to induce
local blood flow to the skin, thereby promoting
hair growth (Wester et al., 1984), shortening the
catagen phase and prolonging the growth phase.
(Mori and Uno, 1990), known to act as a potassium
channel opener to activate hair follicles (Goñi-Allo
et al., 2007). However, as the exact mechanism of
action is not yet elucidated, further research is
needed in the future. In addition, in the case of
minoxidil, several side effects are known. In
particular, it has been reported that it may cause
itching, erythema, dermatitis accompanied by
epidermal peeling and dryness, and in some cases
may cause allergic contact dermatitis and
seborrheic dermatitis (Peters et al. al., 1996;
Barceloux and Ellenhorn, 1988). Due to these
safety issues,
hair growth using soft material
299
Histological, biochemical, or molecular biological studies are
being actively conducted.
Rosemary oil is a natural essential oil that has
a medical analgesic effect and is used to treat
muscle pain and arthritis. It is effective in
improving memory. From a cosmetic point of
view, it relieves wrinkles, burns and wounds,
protects the scalp and hair, and is known to be
effective in treating dandruff, seborrheic
dermatitis, cellulite and obesity (Wilson, 2002).
In this study, by transdermal application of
rosemary oil to the back of the C57BL/6 mouse
experimental animal model for 4 weeks, the
existing US-FDA-approved product, minoxidil,
and its effects on hair growth
The activity of cattle and the expression level of cytokines were evaluated over time.
compare withdotIt is intended to prepare scientific basic
data on the mechanism of hair growth of rosemary oil by
analyzing it.
II.Materials and Methods
1. Reagents and Instruments
As a test substance, rosemary oil is a 100%
pure natural essential oil certified by an organic
certification body (ECOCERT-F-32600), Sanoflore
(France) product, and jojoba oil is a Desert
Whale (USA) product. to use Reagents ALP and
γ-GT are from Thermo (Finland), Trizol is from
Invitrogen (New Zealand), cDNA synthesis and
PCR kit, and primers for GAPDH and IGF-1 are
from BioNEER (Korea). The product is used, and
the SCF antibody is manufactured by Santa
Cruz (USA). For other general reagents, use
special grade products.
Experimental equipment is auto hematology analyzer
(Hemavet, HV-950FS, USA), auto biochemistry analyzer
(Thermo, Konelab 20XT, Finland), refrigerated centrifuge
(Beckman Coulter Inc., AVANTI)
zer (IKA, T25 basic,
(Bio-RAD, MycyclerTM
300 J. Kor. Soc. Cosm. Vol. 16, No. One; 2010
thermal cycler, USA), spectrophotometer
(Shimadzu, UV-1601, Japan), mini centrifuge
(Hitachi, MIKRO 200R, Germany), white/UV
transilluminator (Kodak, EDAS 290, USA),
inverted microscope (Carl Zeiss, Axiovert 200,
Germany) and general instruments used in
laboratories are used.
2. Experimental animals and treatment
After receiving 5-week-old male C57BL/6 mice from Daehan
Biolink Co., Ltd. and acclimatizing them in a breeding room for 1
week, 6-week-old mice with pink color on their back were divided
into 4 groups by the egg mass method, 11 per group.
Experiments were carried out by percutaneous application of
each animal for 4 weeks. The animal breeding room has a
temperature of 22±1℃, The relative humidity was 50±5%, and the
lighting cycle was maintained for 12 hours each day and night,
and feed and water were freely supplied throughout the
experiment. Experimental animals were normal group (N): Saline
applied group, solvent control group (VC): Jojoba oil (JO) applied
group, positive control group (PC): 3% minoxidil (MXD) applied
group, experimental group (E): 3% rosemary Essential oil (REO)
application group, divided into a total of 4 groups. Measure the
amount of food and water once a week, and the body weight
once a week just before the start of the experiment and during
the experiment. Experimental animals were treated at 1, 2, and 4
weeks, respectively, 3, 3, and 5 animals, and after fasting for 4
hours, organs were removed under ether anesthesia. Of the
organs, the spleen is removed immediately after blood collection,
washed with physiological saline, the moisture is removed with a
filter paper, and the weight is measured. The remainder is stored
frozen and used for enzyme activity and cytokine expression
testing.
3. Preparation and application of samples
The REO sample was prepared by mixing 3% of the solvent JO, and
the hair on the back was removed using an electric clipper for animals.
cm×4cmAfter hair removal with , the sample is applied once a day 100
μlEach, 6 days a week, 4 weeks percutaneous injection is also included.
4. Measurement of enzyme activity of skin tissue
1) Alkaline phosphatase (ALP)
At the 1st, 2nd, and 4th weeks of the test, the skin
tissue is cut into microsections under ice-cooling, and a
certain amount of it is weighed, and 4 times the amount
of phosphate buffer solution (PBS) of the skin tissue is
added and a homogenizer (homogenizer). ) was used to
prepare a homogenate. This homogenate was
centrifuged 4℃Centrifuge at 12,000 rpm for 20 minutes
and analyze the supernatant using an automatic
biochemical analyzer.
2) γ-glutamyl transpeptidase (γ-GT)
At the 1st, 2nd, and 4th weeks of the test, the skin tissue
was cut into micro-sections under ice-cooling, and a certain
amount of it was weighed, and 4 times the amount of PBS
was added thereto to make a homogenate using a grinder.
This homogenate was centrifuged 4℃Centrifuged at 12,000
rpm for 20 minutes and the supernatant was analyzed using
an autogenous chemistry analyzer.
5. Observation of cytokine expression in skin tissue
1) Insulin-like growth factor-1 (IGF-1)
(1) RNAextraction
In the first, second, and fourth weeks of the test, cut the cut
skin into small pieces and place it in a cryogenic freezer (-70℃)
stored in the skin tissue 50mg1 permlTrizol is added and
pulverized with a grinder. The pulverized tissue was incubated at
room temperature for 5 minutes and then chloroform 200μlwas
added and left at room temperature for 3 minutes at 15000 rpm,
4℃, After centrifugation for 15 minutes, the supernatant was
removed and 70% ethanol 1mlwas added to wash the RNA pellet.
All. Again 15000rpm, 4℃,After centrifugation for 2 minutes,
the supernatant is removed and the remaining RNA pellet is dried
at room temperature and then diethylpyrocarbonate
(DEPC) dilute at 260nm optical
RNA is quantified by measuring the density (OD) value.
280nmMeasure the OD value and the absorbance ratio
(A260/A280) is 1.8~Make sure it's between 2.0
 Effects of rosemary oil on hair growth-related enzyme activity and cytokine expression in C57BL/6 mice 301

(2) cDNAsynthesis The primary antibody was dropped on the tissue

According to the protocol provided by BioNEER's
CycleScript RT PreMix (dT20) kit, the total RNA amount
was 0.1~Oneμg/μlPut the RNA sample so that it becomes
205 and DEPCμlAfter filling up to 30℃for 1 min at 50℃12
cycle reaction for 4 minutes at 9 5℃The reaction was
terminated by heating for 5 minutes.
(3) PCRand electrophoresis
BioNEER'sAccupowerTMPurchase and use the
PCR PreMix kit. Template 2μl, Forward primer
and reverse primer (10p㏖/ℓ, BioNEER, Korea)
1.4 eachμl,Sterile Distilled Water 15.2μland PCR
reaction (Bio-RAD, MycyclerTM
thermal cycler, USA). Primer was GAPDH (58℃,
35 cycle), IGF-1 (60℃,35 cycle) and the base
section and reacted at room temperature for 12
hours. For dilution of the primary antibody, 0.1M
PBS mixed with 1% normal goat serum (Vector
Laboratories Inc., USA) and 0.3% Triton X-100
(Sigma, USA) is used. Then, the tissue sections
were washed twice with 0.1M PBS for 15 minutes
at room temperature, and then immersed in
peroxidase-labeled ABC solution and reacted at
room temperature for 1 hour. After that, wash
twice with 0.1M PBS for 15 minutes and then 30
mg150 of 3-3' diaminobenzidinemlAfter reacting
for 5 minutes in a solution dissolved in 0.1M PBS
of Organizations that have responded
Wash again several times with 0.1M PBS.
After counterstaining with hematoxylin for 20 seconds,

sequences of the primers used are shown in dehydrated and cleared according to the usual method,

<Table 1>. Electrophoresis on 1.5% agarose gel sealed, and observed under an optical microscope.

using tris-acetate ethylene-diaminetetra acetric

acid (TAE) buffer, stain with ethidium bromide, 6. Statistical processing

and wash with water. The DNA band is checked
by irradiating UV, and the identified band is
statistically processed by quantifying the
expression level using the Kodak 1D v3.6 Image
Analysis System.
2) Stem cell factor (SCF)
Stem cell factor (SCF) diluted 1:50
SPSS 14.0 for windows (SPSS Inc., USA)
statistical program using One-way ANOVA
(one-way ANOVA) to analyze the homogeneity. To
test the difference between each group, a post-hoc
analysis was performed using Duncan's multiple
range test. The statistical significance of this study
was verified at α=0.05.

Table 1.Nucleotide sequence of the primers and their expected size of PCR products

Expected size
Items Primers
(bp)3)

GAPDHOne) Forward (5'→3') AACGGATTTGGYCGTATTGG 302

Reverse (5')→3') AGCCTTCTCCATGGTGGTGAAGAC
IGF-12) Forward (5')→3') AGAGACCCTTTGCGGGGCTGA 255
Reverse (5')→3') CTTCTGAGTTTGGGCATGT

One)GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

2)IGF-1:Insulin-like growth factor-1
3)bp: base pair
302 J. Kor. Soc. Cosm. Vol. 16, No. One; 2010

showed high activity (p<0.05). At the 4th week, the positive control
Ⅲ.Results and Discussion
group showed a statistically significantly higher activity by about 155%

1. Changes in enzyme activity in skin tissue compared to the normal group, and the experimental group showed a

1) Alkaline phosphatase (ALP) significantly higher activity by about 141% than the normal group (p

ALP is an enzyme involved in angiogenesis and is <0.05). ALP activity tends to increase with each week, and at week 4,

known to facilitate hair growth by supplying an amount both the positive control group and the experimental group showed

to the capillaries collected in the dermal papilla. significantly higher activity than the normal group and the solvent

Therefore, ALP activity measurement enables indirect control group (p<0.05).

estimation of the hair growth effect, and ALP activity It

has been reported that the re-growth site significantly 2) γ-Glutamyl transpeptidase (γ-GT)
increased compared to the non-growth site (Meister and γ-GT is highly expressed in cells with active

Anderson, 1983). As the ALP activity increases, the proliferation and division, and decreases when

dermis thickens, the hair follicles grow, and the length of entering the resting phase, and increases when

the hair follicles increases (Iida et al., 2007). entering the sexual organ (Kawabe et al., 1994). The

The results of measuring the enzyme activity of ALP in the skin tissue were role of γ-GT in hair follicle cells is known to act in the

shown in <Fig. 1> is the same as At week 1, the positive control group showed process of separation of the cysteine moiety from
the highest activity, which was significantly higher than that of the normal glutathione tripeptide to obtain cysteine and to
group by about 48% (p<0.05). At week 2, the positive control group had about synthesize keratin (Lowry et al., 1951).
154% improvement compared to the normal group.

Fig. One.Changes of skin alkaline phosphatase activity in an alopecia model

of C57BL/6 mice applied with test compounds topically for 4 weeks.
N: Saline application group VC: JO
application group PC: 3% MXD
application group E: 3% REO
application group
Values are the means±SD of 3, 3, 5 mice at 1, 2, 4 week, respectively. Values with
d totally different
(p<0.05) by