Name : ___________________________________________________ Date: _________________

Year and Section: ___________________Group No. _________ Score:

Professor/Instructor: ____________________________________

ACTIVITY 21

A. Research on the following terms:

1. Chargaff’s rule
2. Restriction Enzyme
3. Sexual incompatibility barrier
4. Gene pole
5. Osteoarthritis
6. Aortic aneurysm
7. Duchenne muscular dystrophy
8. Huntington disease
9. Fragile X-syndrome
10.Breast cancer disposition gene BRCA 1 and BRCA 2
11.p53 gene
12.amalgamation
13.mitigation
14.DNA barcodes
15.transcriptomics

B. Identification of unknown gene

The researcher had isolated the human gene with the following nitrogenous base
sequence:

AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGT
GGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCG

Using the Basic Local Alignment Search Tool (BLAST), determine the protein that
is coded by the nucleotide sequence.

Direction:

1. Open the website of BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and click the

“Nucleotide Blast” (pointed by the arrow).
2. Click the “blastn” (upper left arrow).
3. Enter the given nucleotide sequence in the box (pointed by the left arrow).
4. Scroll down and click "BLAST". Wait for a few seconds or minutes while the
software is analyzing your entry.
Answer the following:

a. Request ID (RID):
b. Query ID:
c. Molecule Type:
d. Query Length:
e. Description:
f. Program:
g. Name of the protein coded by the sequence
h. List at least five organisms that possess that gene.
i. What is the function of the protein?
j. What happened to the person when a gene that codes for that protein mutates?
k. How that person’s disorder could be treated?

C. If you know how to do recombinant DNA technology, what organism you want to
modify, and why? You can use extra sheets to answer.