Version - 1.

00
2024-06-12

Kära aktieägare,

Styrelse och ledning vill informera om bolagets situation och alternativa vägar framåt.

Summering
Den nya styrelsen har för avsikt att ansöka om företagsrekonstruktion för ISR Holding samt ISR
Regulation (HIV) och ISR Vaccine (Covid/Nasal Plattform). Rekonstruktion är något som
exempelvis Aera samt andra leverantörer/långivare vidtalar. Bolagen behöver gemensamt under
rekonstruktionerna ta in minimum 15 miljoner och maximalt ca 60 miljoner för att slutföra
aktiviteter kopplade till ISR-003 (HIV studie) samt ISR-052 (Covid-19 studie).

Det totala beloppet som kan tas in kommer avgöra hur mycket data bolagen kan ta fram, tydligare
data (positiv) ger ett bättre förhandlingsläge och värderingsgrund. Positiv avläsning i HIV studien
och/eller positiv respons i Covid-19 studien, kommer lägga en grund för kommersiella
diskussioner och avtal. Dessa aktiviteter bedömer vi ska resultera i ett ökat bolagsvärde och göra
oss till en intressantare samarbetspartner och/eller uppköpskandidat. Vi avser genomför dessa
åtgärder och aktiviteter för att möjliggöra nya/förbättrade värden åt samtliga aktieägare,
leverantörer och långivare.

Förändringar i styrelsen
Anders Milton har valt av hälsoskäl att kliva av sitt uppdrag som styrelseordförande i ISR Holding.
Styrelsen har gemensamt utsett Krister Magnelöv till ny ordförande. Krister Magnelöv
registrerades som ny ordförande samma dag (2024-06-10) som Anders Milton begärde eget
utträde.

Vi tackar för den tid och engagemang Anders Milton har bidragit med i sitt styrelsearbete genom
åren och samtidigt välkomnar vi Krister Magnelöv som ny ordförande och ser fram emot ett fortsatt
gott samarbete i en kommande period av intensivt arbete.

Nuläge
Bolaget befinner sig i en allvarlig ekonomisk situation med en stor skuldbörda som har växt över
tid. När tilltänkt finansiering har uteblivit, har olika brygglån ingåtts med olika parter, för att lösa
kortsiktiga kapitalbehov. Villkoren i dessa avtal har inte varit anpassade för att lånen skall löpa
över en längre tid, varav dessa lån idag har nått oproportionerliga nivåer. Den nya styrelsen har
nu vidtagit åtgärder och krafttag för att försöka hitta en lösning på dessa brygglån innan eller
under tidigt skede av en rekonstruktion för att slippa vidta ackordsverktyg under rekonstruktionen.
Styrelsen har som ambition att full återbetalning skall ske till alla fordringsägare, så länge villkor
och belopp är skäliga.

Det finansiella läget inom bolaget/bolagen har försvårat att attrahera nya investerare/nytt kapital.
Finansiella åtaganden från PvA samt ImmunoWise har inte lyckats materialiserats av flera olika
skäl, vilket framgår tydligare av bifogade bilagor.

Framtid
Styrelsen har utvärderat situationen och kommit fram till att bolaget/bolagen behöver ansöka om
en företagsrekonstruktion. Vid en beviljad rekonstruktion har bolagen möjlighet att frysa aktuella
skulder. Detta möjliggör att söka nytt kapital som går direkt till fortsatt drift och värdeskapande
projekt/arbetsuppgifter.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 1 / 28

 Version - 1.00
2024-06-12
Allt kapital som investeras under rekonstruktion har förtur gentemot gamla skulder. Detta
minimerar riskfaktorn för nya investerare. Detta då ingen hänsyn till tidigare skuldbörda behöver
tas samt med hänsyn till att det fortfarande bedöms att det finns relativt stora värden i bolagens
patent. Nya investeringar går oavkortat till att läsa av HIV studien samt påvisa säkerhet i människa
i klinisk Covid-19 studie.

Styrelsen gör bedömningen att full återbetalning skall kunna ske till fordringsägarna i
dotterbolagen samt även i moderbolaget om styrelsen kan komma överens om en rimlig
nedskrivning samt rimliga villkor, på aktuella brygglån. Den totala återbetalningstiden för tidigare
skuldbild bedöms till ca 1 – 3 år om aktuella projekt under rekonstruktionstiden genererar positiva
data.

Kapitalbehov
- Bolaget måste inledningsvis kunna påvisa att 3 Mkr av kapitalbehovet finns tillgängligt redan
inför en beviljad rekonstruktionsansökan, i annat fall riskerar ansökan att avslås.
Startbeloppet är dedikerat löpande driftkostnader under de tre första månaderna samt att
påbörja avläsningen av ISR-003 studien (HIV) och måste vara säkerställt via olika signerade
investeringsåtagande senast 2024-06-20.
Därefter kommer vi behöva ytterligare 12 miljoner under rekonstruktionsperioden för att kunna
påvisa livskraft gentemot rekonstruktören och tingsrätten.

- Utöver ovan 15 miljonerna som minimalt behöver tas in, kommer bolaget att ta in 20 – 45Mkr
från institutionella/större investerare (+100 000 Euro) för att kunna plocka fram mer data runt
HIV studien samt den nasala vaccinations plattformen för Covid-19. Vid positiva data kommer
vi kunna föra kommersiella dialoger med potentiella investerare/Big Pharma. Vilket kan inleda
ett licens- och royaltysamarbete för en gemensam väg till marknaden alternativt en försäljning
av hela eller delar av bolaget.

- Väl i en rekonstruktion bedömer styrelsen att möjligheterna att resa kapital ökar markant, då
riskbilden är kraftigt reducerad, jämfört med hur den ser ut idag (om kapital stoppas in utan
att ha säkrat det fulla kapitalbehovet om ca 400 miljoner).

- Styrelsen och ledningen kommer utöver det kapital som löpande har gått in senaste månaderna
att gå in med ytterligare 500 000kr i samband med rekonstruktionsansökan.

- Om vi inte hittar önskat kapital för att ingå i en rekonstruktion kommer vi bli tvingade att ansöka
om konkurs.

Förväntningar
ISR-003 studien, som utförts på sammanlagt fem centra i Sverige och Tyskland, bygger på
samma behandlingsprincip som vid tidigare utförda positiva studie i Sydafrika (ISR-001).
Skillnaden är att patienterna i ISR-003 studien nu har behandlats under 3 månader i stället för
1 månad, med 3 mån uppföljning.

Bolaget är nu angeläget att läsa av HIV studien ISR-003 under rekonstruktionen och har höga
förväntningar på att tre månaders behandling har effekt på HIV reservoarerna i infekterade T
celler. En enda patient som visar på minskad HIV reservoarer kommer att kunna öppna upp för
fruktsamma kommersiella förhandlingar och avtal.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 2 / 28

 Version - 1.00
2024-06-12
Under 2020 utfördes en uppföljning (ISR-002) av Sydafrika Fas I/IIa HIV studien som påvisade
att 6 av 13 män som hade behandlats fortfarande gick utan ART medicin (bromsmedicin) vilket är
anmärkningsvärt och indikerar en långtids påverkan av HIV-infektionen via aktivering av
immunsystemet. Bolaget planerar nu och har engagerat studieläkarna i Sydafrika att genomföra
ytterligare en uppföljning av de behandlade patienterna i ISR-001.

Gällande bolagets planerade kliniska SARS-CoV-2 vaccin studier med vårt nasala vaccin, så har
infektions och vaccinationsläget förändrat vilka studier som behöver genomföras.
Rekommendation är nu att genomföra en booster studie som jämförs med godkänt vaccin för att
påvisa säkerhet i människa för den nasala vaccin-plattformen samt även påvisa immunologiskt
skydd jämförbart eller bättre än ett godkänt vaccin. Vid ett positivt utfall i studien, kommer vi även
här omgående kunna inleda kommersiella förhandlingar samt ingå fruktsamma avtal.

Om bolaget/bolagen beviljas en rekonstruktion och kan ta fram data via att ta in 15 – 60Mkr under
rekonstruktionen skulle detta innebära att det totala kapitalbehovet endast har uppgått till ca
1/6 – 1/10 av det kapital som var tilltänkt vid en fullskalig företrädesemission för att lösa hela
skuldbilden innan bolaget kommer vidare med sina studier. Såldes beräknas utspädningen bli
betydligt mindre via denna finansiella lösning.

Styrelsen och ledningen ser väldigt positivt på framtiden, om en rekonstruktion kan beviljas och
majoriteten av alla fordringar som personer inom styrelsen och ledningen har på bolaget kommer
under rekonstruktionen därav att konverteras till aktier. Emissionskursen för denna
kvittningsemission är fastställd till 5.93SEK minus 15 % konverteringsrabatt, vilket ger styrelsen
och fordringsägare en kvittningskurs på 5.04SEK.

Värderingsgrund samt marknadspotential

Det finns inget negativt som har inträffat runt forskningen, tvärtom har det enbart kommit positiva
nyheter kopplade till Covid och HIV, sedan det att bolaget genomförde en emission via TO2
optionerna, till en teckningskurs om 70 % av en vägd genomsnittlig kurs om 11,11SEK,
2021–10 – 2021–11. Därav tar styrelsen ingen större hänsyn till hur kursen såg ut de sista
veckorna innan dess att aktien blev handelsstoppad, då detta inte återspeglar marknadens
värdering på bolaget. Kursfall och stängningskurs var helt enkelt kontentan av utebliven
kommunikation i kombination med en lättmanipulerad marknad.

Den globala vaccinmarknaden uppskattas till ca 57,47 miljarder USD för 2024, vilket skulle
motsvara ca 2,87 miljarder USD om ISR tar en marknadsandel om 5 %, vilket inte skall vara svårt
med en unik vaccinplattform. Likväl skall det tas i beaktan att det enbart i ett enskilt land som
Bangladesh skall investeras 336,5 miljoner dollar för att etablera inhemsk tillverkningskapacitet
för vaccin, terapi och diagnostik och stärka den nationella tillsynsmyndigheten som ansvarar för
att säkerställa vaccinförsörjningen i Bangladesh, varav ca 30 miljoner Euro planeras att investeras
i en Fill & Seal anläggning för torrvaccin.

Den globala HIV marknaden för bromsmediciner uppskattas likväl uppgå till ca 40 miljarder USD,
där det skall tas i beaktan att ISR har påvisat mycket stor inverkan på HIV-infektion hos 6 av 13
HIV-infekterade patienterna. Kan motsvarande eller bättre data utläsas från HIV ISR-003 studien,
kommer intresset från BP (Big Pharma) att vara omfattande.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 3 / 28

 Version - 1.00
2024-06-12
Erbjudande

Styrelsen avser att ta in kapital via moderbolaget för att läsa av HIV samt gå vidare mot kliniska
Covid-19 studier, så att nya data kan tas fram i ett tidigt skede.

Villkor*¹:
20 % ränta på kapitalet 9 månaders löptid
20 % på årsbasis efter löptiden

15 % rabatt vid konvertering till aktier*².

Minimalt reversbelopp: 50 000SEK

Mindre belopp kan investeras genom att olika ägare går samman alternativt via att låna in
kapital via ISR-SMAFF.

*¹ Erbjudandet är begränsat till 2,5 miljoner Euro per EES land

*² Konvertering till aktier kan ske som tidigast efter avslutad rekonstruktion samt senast
tre månader efter slutförd rekonstruktion. Konvertering sker då till aktuell fastställd kurs.
En rekonstruktion pågår generellt mellan 6 och 18 månader.

Risker
Bolaget/Bolagen kanske inte lyckas resa tillräckligt med kapital under rekonstruktionen, vilket då
kan leda till att rekonstruktionen avbryts och det öppnar upp för att fordringsägare återigen kan
ansöka om att försätta bolaget eller bolagen i konkurs. I händelse av en eventuell konkurs kan
inlånat kapital komma att bli låst en längre tid än vad som planerats för långivaren och skulle
tillgångarna (patenten) i bolagen säljas till lägre belopp än vad som är inlånat kan det vara så att
full återbetalning av inlånat kapital inte kan ske. Inlånat kapital har dock förtur.

Intresseanmälan
Intresseanmälan görs till Jonas Winqvist (winqvist.jonas@gmail.com) alt. Johan Nylund
(johan@jpnylund.se).

Bilagor

Bilaga 2 - Historik och Forskningsbakgrund

Bilaga 3 - Aktiedata och ägande
Bilaga 4 - Finansiell bakgrund samt PM och kursinfo
Bilaga 5 - ISR - Vaccine Publikation
Bilaga 6 - ISR - Vaccine Plattform

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 4 / 28

 Bilaga - 1

Forskningsbakgrund - ISR Immune System Regulation Holding AB (publ)

Historik
För ISR började allt redan på 90-talet med katter och en anmärkningsvärd observation. Två av ISR:s grundare, tillsammans med
Ola Winqvist, deltog i en samhällsansträngning för att stoppa spridningen av kattimmunbristviruset, eller FIV, som är
kattversionen av HIV, genom att kastrera infekterade katter. De märkte att de kastrerade katterna överlevde och att några skulle
fortsätta att leva i mer än ett decennium.
Detta kunde ha förblivit en intressant observation, men Ola, läkare och professor i immunologi, hade en idé. Tänk om
kastreringen frigör ett hormon som stimulerar immunförsvaret och därigenom hjälper kroppen att identifiera de infekterade
cellerna. Anledningen till att HIV och FIV är så farliga beror på virusets förmåga att gömma sig. Immunförsvaret kan inte hitta de
infekterade cellerna, och viruset kan därför frodas.
Studier visade att Ola hade rätt. När katter kastreras frisätts ett hormon som naturligt finns i kroppen, GnRH. Hormonet fäster
vid infekterade celler, aktiverar dem vilket avslöjar dem för immunsystemet, som sedan kan attackera och ta bort
virusinfekterade celler.
Denna upptäckt markerar början på ISR Immunsystem Regulation, som sedan 2012 har utfört kliniska studier på immun-
systemet för att hitta ett botemedel mot HIV.

Vision
Bota virusinfektioner och cancer samt förbättra livskvaliteten för patienter och deras familjer, på en global nivå.
Denna nyfikenhet – och tron på vårt immunförsvar – har präglat Olas karriär. Bara två veckor in på den första terminen på
läkarutbildningen svarade han på en lektors erbjudande att forska vid sidan av studierna. Kvällar och nätter tillbringades därefter
i laboratoriet. Det var i laboratoriet som Ola och hans vänner firade genomförda undersökningar, inte i barer.
Även efter utbildningen fortsatte han att arbeta både som läkare och forskare, och idag är han överläkare och professor i klinisk
immunologi. I huvudsak är ISR en produkt av noggrann forskning, observationer från Olas tid som arbete på sjukhus och ett
outtömligt intresse för immunologi.
Det är dock inte hans första företag som entreprenör. I början av 2000-talet grundade han ett företag som strävade efter att bota
cancer med T-cellsterapi. En metod som inte var etablerad bland onkologer på den tiden. Det skulle ta över ett decennium och
ett Nobelpris (2011) för upptäckten av hur immunsystemet aktiveras (Bruce A. Beutler och Jules A. Hoffmann (50%) samt Ralph
M. Steinman (50%), för att T-cellsterapi skulle vinna popularitet.
ISR använder fortfarande dessa upptäckter som bas för sina läkemedelskandidater. Genom att stimulera och reglera
immunsystemet syftar ISR till att utveckla botemedel och behandlingar för några av de allvarligaste sjukdomarna i dag – Sars-
CoV-2, HIV, HBV och Cancer.

Målbild
Föreställ er en framtid där vacciner enkelt appliceras av individen själv, när individen vill ha skydd och bara där kroppen behöver
det. Ett vaccin tillgängligt för alla, på global basis, som ger skydd mot alla typer av infektionssjukdomar. Vi på ISR Immune
System Regulation är inte bara säkra på att denna framtid är möjlig, vi vet att den redan är nära.
Covid-19 har drivit oss att tillämpa årtionden av immunologisk forskning inom ett område med stor potential för förbättringar, där
vi kan etablera nytt och verkligt skydd med en global räckvidd. Baserat i Stockholm, Sverige, är ISR ett innovationsdrivet företag
med uppdrag att förbättra livet för människor på global nivå.

Tillvägagångssätt
Dårskap är att göra samma sak om och om igen och förvänta sig olika resultat. Det är därför vi ständigt utmanar etablerade
rutiner och allmän visdom inom immunologi. Vårt inhalerade Covid-19-vaccinprogram är ett bevis på det.
Vi är övertygade om att vår nya behandlingsplattform, baserad på medicinska och vetenskapliga bevis, ger oss en unik väg att
skydda kroppen mot Corona-virus inklusive alla kända Covid-19-varianter. Men vår unika väg är inte begränsad till Corona.
Det möjliggör vaccination mot andra virus-härledda sjukdomar också, såsom HIV, Cancer och Hepatit B.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 5 / 28

 Bilaga - 2

Aktiekapital, aktier, aktieägare, tidigare investerat kapital samt insynshandel

ISR:s aktiekapital uppgår till 3 450 447,55 kronor fördelat på 69 008 951 utestående aktier. Bolaget har endast ett
aktieslag och samtliga aktier har lika rätt till utdelning samt berättigar till en (1) röst vid bolagsstämma.

Antal aktier Aktiekapital kr Aktier Kapital kr Värde kr

2016 Aktiesplit 950 000 - 1 000 000 50 000,00 0,05
2016 Nyemission 2 330 000 116 000,00 3 330 000 166 500,00 0,05
2016 Nyemission 4 000 000 200 000,00 7 330 000 366 500,00 0,05
2016 Apportemission 11 170 000 558 500,00 18 500 000 925 000,00 0,05
2018 Nyemission 6 218 132 310 906,60 24 718 132 1 235 906,60 0,05
2020 Nyemission 24 718 131 1 235 906,55 49 436 263 2 471 813,15 0,05
2020 Nyemission 310 810 15 540,50 49 747 073 2 487 353,65 0,05
2020 Nyemission 2 384 343 119 217,15 52 131 416 2 606 570,80 0,05
2020 Nyemission 1 000 000 50 000,00 53 131 416 2 656 570,80 0,05
2021 Teckningsoptioner 7 863 266 393 163,30 60 994 682 3 049 734,10 0,05
2021 Teckningsoptioner 8 014 269 400 713,45 69 008 951 3 450 477,55 0,05

Större aktieägare per 2022-12-31 (Till 99 % oförändrade aktiedata fram tills idag)
I nedanstående tabell redovisas ISR:s tio största aktieägare per 31 december 2022.
ISR hade den 31 december 2022, 14 339 (16 855) aktieägare.

Namn Antal aktier Andel kapital och röster i %

1. Försäkringsaktiebolaget Avanza Pension 6 002 653 8,7
2. Nordnet Pensionsförsäkring AB 1 989 510 2,88
3. Octapeptide AB (DBO grundare, Förvaltas av Gunnar Jardelöv) 1 871 525 2,71
4. Staffan Eriksson 1 840 000 2,67
5. Gyn-Sam AB (DBO grundare, Förvaltas av Gunnar Jardelöv) 1 734 620 2,51
6. Anders Milton (Styrelseordförande) 1 338 215 1,94
7. Peter Lantz 1 043 500 1,51
8. Isitar AB 967 000 1,4
9. Blue Development AB 909 091 1,32
10. Coeli Wealth Management AB (ITH AB) 872 013 1,26

Totalt tio största aktieägare 18 568 127 26,91

Övriga 50 440 824 73,09
Totalt 69 008 951 100

ISR ägs idag ca 85 – 90 % idag av personer eller bolag utan anknytning till bolagets styrelse/ledning och nyckelpersoner. Med ett
par större institutionella investerare hade bolaget aldrig hamnat i denna situation, då aktien inte hade varit lika sårbar samt så
hade även bolaget stått bättre rustade via ett bredare styrelseengagemang. Bolaget har dock förvaltats till en majoritet av
personer som är ägare till de återstående 10 – 15 % av de utestående aktierna, fram till och med 2024-04-23.

Ovannämnda aktieägare har gemensamt investerat i storleksordningen ca 600 ±100 miljoner SEK via emissioner samt över
marknad. Detta kunde konstateras i samband med att aktieföreningen ISR-SMAFF:s genomförde en undersökning bland sina
medlemmar och större aktieägare (icke medlemmar), som visade att den genomsnittliga inköpskursen ligger runt ca 10,00SEK ±
2,00SEK.

Fyra senaste insynsköpen i ISR

2021-11-23 15 000st 9,70SEK fd. Ledamot Gunnar Jardelöv
2021-11-23 24 178st 7,78SEK fd. Ledamot Gunnar Jardelöv (TO 2 emission)
2021-11-14 7 500st 7,78SEK VD, Ola Winqvist (TO 2 emission)
2021-09-10 70 000st 9,20SEK fd. Ledamot Gunnar Jardelöv

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 6 / 28

 Bilaga - 3

Finansiell bakgrund - ISR Immune System Regulation Holding AB (publ)

Bakgrund, finansiell information samt motiv till emission

ISR noterades på Nasdaq First North i mars 2017 efter att ha slutfört en HIV Fas I/IIa studie på 26 män (13 + 13) i Syd Afrika
mellan 2014 – 2017, med bolagets produkt ISR-048. I juni 2017 fick ISR avslag från läkemedelsverket i Syd Afrika för att
genomföra en Fas IIb studie av behandlingsnaiva patienter med HIV-infektion.
I januari 2018 fick ISR i stället ett godkännande från läkemedelsverket i Sverige att genomföra den kliniska studien ISR-003 med
bolagets produkt ISR-048 i samarbete med CRO företaget A+ Science (ansvarig för monitorering av studien).
ISR048 stimulerar T-celler att uttrycka högre nivåer av HLA-klass I på cellytan vilket gör att till exempel en ökad mängd HIV-
peptider kan visas för mördar-T-celler som därmed kan döda de infekterade T-hjälparcellerna.
Studien har bedrivits på tre siter i Sverige (Huddinge, Södersjukhuset och Östra sjukhuset) samt två siter i Tyskland
(Berlin och München), som en prospektiv, randomiserad, kontrollerad multicenter-studie med parallella behandlingsarmar, i syfte
att visa ”safety and efficacy” för ISR 48 avseende reduktion av HIV-1 i reservoarer. Studien har omfattat 52 patienter (26 + 26).
Inklusionen för HIV studien ISR-003 stängdes i Q3, 2022 och provdata har sedan dess förvarats i nedfryst i väntan på finansiella
medel för avläsning. Vid positiv avläsning finns intresse från flera olika BP (Big Pharma).
2020 utfördes en treårsuppföljning av HIV Fas I/IIa studien, som utfördes i Syd Afrika, vilket påvisade att 6 av 13 män som hade
behandlats fortfarande gick utan ART medicin (bromsmedicin) vilket är anmärkningsvärt att de har klarat sig så länge utan
bromsmedicin och inte utvecklat AIDS.
2020-03-19 meddelade ISR via PM att bolaget skulle starta en vaccinutveckling för Coronavirus. Vaccinet bygger på
rekombinant producerat spike protein i ett samarbete med Icosagen stött av EU anslag, och ISR:s läkemedelspipeline med
immunstimulerande adjuvant. Coronaviruset påverkar lungorna långt nere i lungträdet. För att förhindra att viruset får fäste måste
vi flytta fram våra immunologiska skyddsbarriärer vid vaccination, en princip som ISR utvecklat.
Under juli och augusti 2021 ingår ISR ett flertal olika strategiska avtal gällande covid vaccinstudie samt samarbeten kopplade till
covid vaccinet/plattformen, vilket får aktien att pika på kurs om 14,86SEK. Under Q3 2021 genomför bolaget en emission via
teckningsoptioner (TO2, som emitterades under Q2, 2021). Aktien handlades till en volymvägd genomsnittskurs om 11,11SEK
under perioden 25 oktober till och med 5 november, 2021. Teckningskursen fastställdes till 7,78SEK (70 % av den volymvägda
genomsnittskursen, enligt villkoren för TO2 optionerna). Inga negativa händelser eller besked rörande forskningen har
kommunicerats sedan dess att TO2 emissionen genomfördes under oktober/november, 2021.

Kliniska Covidstudier i samarbete med Bangladesh (BRMC) – Naturkatastrof orsakar havererad finansiell plan
2021-07-18 ISR tecknar ett samarbetsavtal med Singapore Resources Development PTE. Ltd (”SRD”), VD för SRD är Shahjahan
Sayad (född i Bangladesh, svensk medborgare). Avtalet omfattade en investering om totalt 6,85 miljoner Euro, mot ett totalt
ägande om drygt 29 % i ett dotterbolag som ska sättas upp för ändamålet (ISR Vaccine AB). Dotterbolaget avser att initialt söka
godkännande från Bangladesh Medical Research Council att genomföra en studie av covid-19-vaccinet på människor och
utesluter inte att i framtiden även utforska andra alternativa studier.
2021-09-14 ISR tecknar kontrakt för att starta vaccinstudie i Bangladesh med CRO företaget Bangladesh Clinical Trials ltd, för att
genomföra en klinisk studie med ISR:s SARS-CoV-2 vaccin i Dhaka, Bangladesh.
2022-02-21 ISR lämnar in ansökan till Bangladesh Medical Research Council (BMRC) om att leda godkännandeprocessen för
genomförande av fas I/II-studie med ISR52 nasalt torrpulvervaccin mot SARS CoV-2.
2022-06-20 Delegation från Bangladesh besöker ISR för studieförberedelse. ISR är värd för en workshop med en delegation från
Bangladesh för att förbereda företagets fas I/II kliniska prövning av det nasala torrpulvervaccinet mot SARS-CoV-2.
2022-07-01 SARS-CoV-2-vaccinstudie godkänns av Bangladesh BMRC. ISR:s ansökan om att genomföra en klinisk fas I/II
prövning av det torra pulvernasala vaccinet mot SARS-CoV-2 i Bangladesh har godkänts.
Dagarna efter att BMRC godkänner ISR:s SARS-CoV-2-vaccinstudie, drabbas Bangladesh av en omfattande översvämning, som
medför att landet tar upp ett lån från IMF, innehållande lånevillkor som förhindrar utförsel av kapital, vilket gör att tilltänkt
finansiell plan med Bangladesh havererar och utlöser en kedjereaktion för ISR, runt tecknade samarbetsavtal.
Denna omfattande och hastiga förändring runt tilltänkt finansiell plan, blev för mycket för ISR:s nätta organisation, vilket medförde
att löpande förvaltning, såsom kommunikation med aktieägare samt marknadsplats (Nasdaq) havererade, vilket ledde till ett
omfattande kursfall under Q3 och Q4, 2022 för att slutligen landa i ett handelsstopp 2022-12-06.

Väsentliga händelser efter havererad finansiell plan samt handelsstopp och avnotering
2023-11-24 godkände Asian Development Bank (ADB) ett lånepaket på 336,5 miljoner dollar för att etablera inhemsk
tillverkningskapacitet för vaccin, terapi och diagnostik och stärka den nationella tillsynsmyndigheten för att säkerställa
vaccinförsörjningen i Bangladesh.
ISR:s VD och styrelseordförande kommer under juni eller juli månad, 2024 att besöka Bangladesh premiärminister, gällande en
investering om 30 miljoner Euro (ca 350 miljoner SEK), dedikerat en lokal Fill & Seal anläggning i Dhaka, Bangladesh.
Anläggningen kommer tillverka torrvaccin anpassat till ISR:s nasala vaccinplattform, mot en licens- och royaltyavgift.
Detta är potentiella värden som skall tas i beaktan när det kommer till en värdering av bolaget.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 7 / 28

 Bilaga - 3

PM och handelskurser, 2022–01 – 2022–12

2022-01-26 ISR:s vaccin ger antikroppssvar mot Omicronvarianten av SARS-CoV-2 (7,60SEK)
2022-02-21 ISR:s har lämnat in ansökan till Bangladesh Medical Research Council (BMRC) (5,65SEK)
2022-03-01 5,85SEK 2022-03-30 7,34SEK
2022-04-01 7,07SEK 2022-04-29 6,71SEK
2022-05-02 6,60SEK 2022-05-19 5,94SEK
2022-05-20 ISR tecknar avtal med Gerresheimer för omfattande produktion av IcoOne näsinhalatorer för kliniskt bruk (6,10SEK).
2022-06-02 Preklinisk studie visar att ISR-052 ger långsiktigt skydd mot SARS-CoV-2 (5,63SEK).
2022-06-28 ISR signs development agreements with Catalent to scale-up its spray-dried nasal vaccine (5,41SEK)
2022-07-01 SARS-CoV-2 vaccin studie godkänns av Bangladesh BMRC (6,27SEK)
2022-08-29 ISR har nu stängt inklusionen till HIV studien ISR-003 (5,35SEK)
2022-10-03 Handelskurs (4,68SEK) / 2022-10-31 (4,26SEK) (Max 5,40SEK (4/10), Min 3,47SEK (24/10))
2022-11-01 Handelskurs (4,14SEK) / 2022-10-30 (2,44SEK) (Max 4,09SEK (3/11), Min 2,35SEK (28/10))
2022-12-01 Nasdaq låter mäklarstatistik anonymiseras.
2022-12-06 Nasdaq låter aktien handelsstoppas efter att kursen dyker från 2,50SEK till 1,08SEK (1,40SEK vid handelsstopp).

Kursfallet mellan 2022–05 – 2022–12

Med facit i hand, är det inte svårt att konstatera att aktiekursen straffades i en stor omfattning, på grund av utebliven
kommunikation om exakt bakgrund och orsak till den havererade finansiella planen, vilket slutligen orsakade ett handelsstopp
2022-12-06. Detta då aktien sedan Q3 2021 har haft en extremt liten mängd aktier i omlopp samt sett till att de flesta äldre
aktieägarna har legat väldigt tungt viktade med ISR aktier, i sina portföljer. Detta har medfört att det funnits liten ekonomisk
kapacitet att hålla kursen uppe via stödköp från befintliga ägare, speciellt sett till att intresset bland ägarna svalnade av, i och
med den bristfälliga kommunikationen. Något som blankare passade på att utnyttja och de kunde på så sätt under de två senaste
månaderna som aktien handlades, påverka aktien i en mycket stor utsträckning med väldigt små finansiella medel.

Kommunicerad finansiering 2023-02-28

2023-02-28 meddelar ISR via PM att bolaget har beslutat om en riktad emission om 67 MSEK samt meddelar avsikt att besluta
om en företrädesemission i närtid. Prinz von Anhalt (PvA) Vermögensverwaltung Projekt Untermitterdorf UG, har via avtal åtagit
sig att teckna samtliga aktier i den riktade nyemissionen. Det uppges i PM att den totala finansieringen i samband med
emissionerna förväntas tillföra bolaget 400 miljoner SEK före emissionskostnader.

ISR:s VD ska genom det egna bolaget ImmunoWise AB ha säkrat ett lån om ca 200 miljoner SEK, för att kunna garantera en
företrädesemission i ISR. Lånet är dock villkorat att en investering görs i ISR, via en riktad emission om minimum ca 70 ± 5
miljoner SEK. Likväl krävs att investerande part försvarar sin prorataandel i samband med efterföljande företrädesemission.
Det åtagande som PvA åtog sig via avtal har till dags datum inte införlivats. PvA administratör/företrädare, Hans Theodor
Bedburdick, är likväl mellanhand till det konsortium som ligger bakom det lån som utlovats till ImmunoWise AB, vilket försvårar
Bolagets finansiella läge än mer. Bakgrunden till utebliven finansiering uppges bero på att PvA:s likvida medel skall vara låsta i
Turkiet sedan Rysslands invasion i Ukraina samt det geopolitiska läget mellan Sverige och Turkiet. PvA har skickat ett PM som
påvisar att han vill fullfölja sitt åtagande samt även skickat ett antal intentionsutlåtanden mot styrelsen, där det även har framgått
att han söker alternativt kapital. Sanningsgraden i dessa påstående är inget som ISR:s styrelse varken kan bekräfta eller
dementera, då detaljerad insikt om ursprunget för PvA:s kapital saknas.

Värderingsgrund
Värderingen i detta memorandum är baserad på tidigare kurshistorik under 2022 samt med hänsyn till de senaste insynsköpen i
bolaget. Det finns inget negativt som har inträffat runt forskningen, tvärtom har det enbart kommit positiva nyheter kopplade till
Covid och HIV, sedan det att bolaget genomförde en emission via TO2 optionerna, till en teckningskurs om 70 % av en vägd
genomsnittlig kurs om 11,11SEK, 2021–10 – 2021–11. Därav tas ingen hänsyn till hur kursen såg ut de sista veckorna innan
dess att aktien blev handelsstoppad, då detta inte återspeglar marknadens värdering på bolaget. Kursfall och stängningskurs var
helt enkelt kontentan av utebliven kommunikation i kombination med en lättmanipulerad marknad.
Det har även tagits i beaktan att den globala vaccinmarknaden uppskattas till ca 85 miljarder USD för 2024, vilket skulle motsvara
ca 4,25 miljarder USD om ISR tar en marknadsandel om 5 %, vilket inte skall vara svårt med en unik vaccinplattform. Likväl skall
det tas i beaktan att det enbart i ett enskilt land som Bangladesh skall investeras 336,5 miljoner dollar för att etablera inhemsk
tillverkningskapacitet för vaccin, terapi och diagnostik och stärka den nationella tillsynsmyndigheten för att säkerställa
vaccinförsörjningen i Bangladesh, varav ca 30 miljoner Euro planeras att investeras i en Fill & Seal anläggning för torrvaccin.
Den globala HIV marknaden för bromsmediciner uppskattas likväl uppgå till ca 40 miljarder USD, där det skall tas i beaktan att
ISR har påvisat immunologiska långtidseffekter av HIV-infektion hos 6 av 13 HIV-infekterade patienter. Kan motsvarande eller
bättre data utläsas från HIV ISR-003 studien, kommer intresset från BP (Big Pharma) att vara omfattande.
Emissionen enligt detta Memorandum genomförs således för att kunna genomföra en avläsning av ISR-003 HIV studien samt
genomföra en Booster studie för Covid-19 vaccinet.

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 8 / 28

 Bilaga - 4
Vaccine 41 (2023) 4743–4751

Contents lists available at ScienceDirect

Vaccine
journal homepage: www.elsevier.com/locate/vaccine

Protective immunity induced by an inhaled SARS-CoV-2 subunit vaccine

Elizabeth Elder a, Chandrashekar Bangalore Revanna b, Catharina Johansson b,
Robert P.A. Wallin c, Johan Sjödahl b, Ola Winqvist b, Ali Mirazimi a,d,⇑
a
National Veterinary Institute, Uppsala, Sweden
b
ISR Vaccine AB, Solna, Sweden
c
SciEd Solutions Stockholm, Sweden
d
Clinical Microbiology, LABMED, Karolinska Institute, Sweden

a r t i c l e i n f o a b s t r a c t

Article history: Targeting the site of infection is a promising strategy for improving vaccine effectivity. To date, licensed
Received 7 October 2022 COVID-19 vaccines have been administered intramuscularly despite the fact that SARS-CoV-2 is a respi-
Received in revised form 31 May 2023 ratory virus. Here, we aim to induce local protective mucosal immune responses with an inhaled subunit
Accepted 2 June 2023
vaccine candidate, ISR52, based on the SARS-CoV-2 Spike S1 protein. When tested in a lethal challenge
Available online 6 June 2023
hACE2 transgenic SARS-CoV-2 mouse model, intranasal and intratracheal administration of ISR52
provided superior protection against severe infection, compared to the subcutaneous injection of the vac-
Keywords:
cine. Interestingly for a protein-based vaccine, inhaled ISR52 elicited both CD4 and CD8 T-cell Spike-
Local immunity
SARS-CoV-2
specific responses that were maintained for at least 6 months in wild-type mice. Induced IgG and IgA
Inhaled responses cross-reacting with several SARS- CoV-2 variants of concern were detected in the lung and
Respiratory tract in serum and protected animals displayed neutralizing antibodies. Based on our results, we are develop-
Dry powder ing ISR52 as a dry powder formulation for inhalation, that does not require cold-chain distribution or the
Subunit vaccine use of needle administration, for evaluation in a Phase I/II clinical trial.
Ó 2023 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC license
(http://creativecommons.org/licenses/by-nc/4.0/).

1. Introduction
Mass vaccination campaigns have changed the course of the
COVID-19 pandemic and reduced the morbidity and mortality
associated with SARS-CoV-2 infection [1,2]. Nevertheless, waning
immunity and antigenic drift will likely see the need for updated
and improved vaccines that are distributed equitably across
nations [3,4]. Several second-generation vaccines seek to target
the site of infection, namely the respiratory tract, to induce local
immunity [5–7]. These include licensed vaccines reformulated as
nasal sprays [8] (Phase I clinical trial NCT04816019), and new can-
didates designed for intranasal administration or aerosolisation
[9–20]. Preclinical results for these candidates suggest similar or
better protection against SARS-CoV-2 compared with injected vac-
cines, with one even describing the induction of sterilizing immu-
nity [21].
On top of the potential benefits to immunity, inhaled vaccine
formulations have logistical advantages compared to injectable
formulations. This is particularly true when the vaccine can be for-
mulated as a dry powder for inhalation, completely avoiding the
⇑ Corresponding author at: National Veterinary Institute, Uppsala, Sweden.
E-mail address: Ali.Mirazimi@ki.se (A. Mirazimi).
need for cold chain distribution [22,23]. Such a vaccine could be
administered via a disposable dry powder inhaler directly into
the respiratory tract, eliminating the risk of blood-borne disease
transmission associated with the use of needles and syringes. Fur-
thermore, the requirement for trained healthcare professionals is
reduced. Preclinical studies using dry powder vaccines have shown
promise for various pathogens and toxins including Mycobac-
terium tuberculosis, Human papillomavirus, and influenza A virus
[24–27], and a safe and effective SARS-CoV-2 dry powder vaccine
would be a boon to global vaccination efforts [4,22,23].
Here we describe the development and testing of our SARS-
CoV-2 Spike S1 protein vaccine candidate ISR52. The SARS-CoV-2
Spike glycoprotein has been suggested to be an essential antigen
for protective immunity against severe COVID-19 disease
[28–30]. Indeed, several Spike-based subunit vaccines have shown
efficacy in clinical and preclinical development [9,13–15,31]. We
compare the effect of administering ISR52 via the subcutaneous,
intranasal, and intratracheal route, the latter a simulation for pul-
monary inhalation which to our knowledge has not previously
been tested for SARS-CoV-2 vaccines.
Both respiratory routes gave 100% protection in a lethal
challenge mouse model even at a low dose of ISR52, whereas
only partial protection was seen with low-dose subcutaneous

https://doi.org/10.1016/j.vaccine.2023.06.015
0264-410X/Ó 2023 The Authors. Published by Elsevier Ltd.
This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 9 / 28

 E. Elder, C. Bangalore Revanna, C. Johansson et al.
immunisation. We find anti-Spike IgG and IgA that cross reacts
with variants of concern, the induction of durable cellular immu-
nity, and demonstrate the robustness of our platform when com-
bining the Spike S1 protein with the adjuvant PolyICLC. Our
results support the further development of ISR52 as a dry powder
vaccine for inhalation.
2. Results and discussion
2.1. Respiratory administration of Spike protein vaccine ISR52 protects
hACE2 transgenic mice against lethal SARS-CoV-2 challenge
We prepared our vaccine candidate (ISR52) for administration
into female AC70 hACE2 mice [32], a lethal SARS-CoV and SARS-
CoV-2 infection model [32–34], where hACE2 expression is driven
by the CAG promoter. Although the aim is to create an inhaled dry
powder vaccine, the use of small animal models for powder inhala-
tion was not feasible in this case. We therefore used a solution of
the SARS-CoV-2 Spike protein combined with the adjuvant in our
preclinical studies. The ancestral or founder SARS-CoV-2 sequence,
first isolated in Wuhan, China in early 2020 [35], was used for the
first vaccine formulation. We used a low and high dose of Spike
protein together with poly I:C and all-trans retinoic acid (ATRA)
as candidate adjuvants (Table S1). Three different routes of admin-
istration were tested: subcutaneous (s.c.) injection, intranasal (i.n.),
and intratracheal (i.t.) instillation. While intranasal immunisation
has been previously tested for SARS-CoV-2 vaccines [5,7,8], intra-
tracheal administration, which simulates pulmonary inhalation,
has to our knowledge not been reported, but has shown success
for other pathogens [24,27,36,37]. We immunised 7 or 8 mice
per group and included an additional control group of unvacci-
nated mice (Table S1). Two immunisations were spaced two weeks
apart, and we then challenged with 2  105 TCID50 of founder
strain SARS-CoV-2 (Fig. 1A). Prior to challenge, three mice from
the high-dose intratracheal group died, one from complications
from anaesthesia, and two from complications related to the i.t.
administration technique. Furthermore, one mouse from the
high-dose s.c. group and one from the low-dose i.t. group failed
to receive complete doses of vaccines. These mice are excluded
from the analysis.
After challenge, we monitored the health of all mice each day,
and euthanized mice when they had lost >20% of their body weight
or displayed stronger symptoms in line with our ethical permit.
According to these criteria, all mice from the non–vaccinated con-
trol group were euthanized on day 4 post infection (Fig. 1B). For
the low-dose s.c. group, 5/7 mice were euthanized on day 5 or 6
post infection, indicating suboptimal protection. We found 100%
protection in all other groups, including at lower dose for the i.n.
and i.t. groups, indicating that ISR52 raises protective immunity
against SARS-CoV-2. These results are supported by analysis of
change in body weight of the mice during infection (Fig. S1A). Pre-
viously published s.c. and i.n. Spike subunit vaccines have also eli-
cited good protection in preclinical studies, but our data show that
intratracheal immunisation is also an effective route of vaccine
administration.
Bronchoalveolar lavage fluid (BAL), and organs were harvested
from mice at the day of termination. We analysed the presence
of SARS-CoV-2 RNA at the time of euthanasia in BAL and lung tis-
sue (Fig. 1C). We detected SARS-CoV-2 RNA in BAL from mice
which died during infection, including control mice and 4 mice
from the low-dose s.c. group. Meanwhile, low to no detectable viral
RNA was found in mice that survived (Ct > 35). We obtained sim-
ilar results with lung tissue, though fewer animals overall had
quantifiable SARS-CoV-2 RNA. These results indicate that the vac-
cinated animals, with the exception of the low dose s.c. group,
4744
 Signerat 2024-06-12 19:29:23 UTC
Vaccine 41 (2023) 4743–4751
either cleared the infection by day 11 post infection or that the
virus never entered the lungs. We also investigated evidence of
pathology in brain tissue of challenged mice, since neuronal dam-
age is a major part of the pathology of SARS-CoV-2 in hACE2 mouse
models [21,38,39]. Histopathology analysis revealed inflammation
and necrosis in brain tissue for unvaccinated (8/8) and both low
(5/7) and high (2/7) dose subcutaneously vaccinated groups; no
similar observations were made for animals vaccinated by the res-
piratory routes (Fig. 1D, Table S2). These results demonstrate that
both i.n. and i.t. administration of ISR52, even at low dose, protect
from signs of neuronal damage in the hACE2 mouse model. Overall,
we saw a clear benefit of respiratory tract vaccination versus tradi-
tional subcutaneous vaccination at low doses of ISR52.
2.2. SR52 immunisation induces humoral responses that cross react
with variants of concern
Since anti-Spike antibodies are likely important in protective
immunity against SARS-CoV-2, we investigated the reactivity of
sera from vaccinated mice collected prior to viral challenge. We
analysed levels of both serum IgG and serum IgA against Spike
S1 from the founder strain, and against the receptor binding
domain (RBD) for the alpha variant of concern (VOC) B.1.1.7, and
the beta VOC B.1.351. We found that all vaccinated groups had
detectable anti-Spike IgG to at least a 1:10000 dilution for each
variant, with higher dose groups demonstrating higher levels of
IgG (Fig. 1E, S1B, S1C). We found larger differences between the
vaccinated groups when we analysed anti-Spike IgA. Intranasal
vaccination gave a stronger serum IgA response compared with
intratracheal vaccination, whereas subcutaneous immunisation
induced a negligible IgA titer (Fig. 1F, S1D, S1E). Since one of the
aims of intranasal and intratracheal immunisation is to induce a
local mucosal immune response at the relevant infection site, we
also harvested BAL from animals at the time of euthanasia. We
found robust anti-Spike IgA in BAL from the high dose i.n. group
(Fig. 1G), with weak induction present in the s.c and i.t. groups.
This pattern was reproduced when we analysed the neutralizing
capacity of antibodies present in BAL (Fig. 1H). We found that sub-
cutaneous immunisation was not associated with neutralizing
activity in BAL (1 out of 13 animals in both low and high dose
groups had detectable titres of neutralizing antibodies). However,
we found that 44% of the intranasal and intratracheal groups had
detectable levels of neutralizing antibodies up to a titre of 1 in
32 (low dose i.n. 2/8; high dose i.n. 5/7; low dose i.t. 1/7; high dose
i.t. 4/5).
Taken together with survival and brain histopathology data,
these antibody data suggest a more robust protection is elicited
by i.n. and i.t. administration compared with s.c. immunisation.
These results are consistent with previous studies of intranasal
vaccination [5,8,11,13,14,21], but show for the first time evidence
for the effectiveness of intratracheal immunisation against SARS-
CoV-2.
2.3. Dose-dependent response to vaccine candidate ISR52 with variant
Spike
Following changes in predominant circulating variants, and
their possible immune escape mutations, we updated our vaccine
candidate to include equal amounts of alpha variant and beta vari-
ant Spike S1. We now focussed on the i.n. and i.t. administration
routes and decided to lower the dose to 5 and 20 lg of total Spike
S1 (Table S3), this time immunising 11 female hACE2 mice per
group. We chose polyICLC as the adjuvant, which has recently been
effective in an intramuscular nucleocapsid-RBD fusion subunit vac-
cine in hACE2 mice [40]. During this study, we harvested and anal-
ysed serum after the first and second immunisations. As expected,
Oneflow ID 7737067 Sida 10 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al. Vaccine 41 (2023) 4743–4751

Fig. 1. Respiratory administration of Spike trimer vaccine protects against lethal challenge. A) Schematic showing the vaccination and challenge schedule in female K18
hACE2 mice. Mice were infected intranasally with 1.875x105 TCID SARS-CoV-2 isolate SARS-CoV-2/01/human/2020/SWE. Animals were euthanized after losing > 20% of their
body mass or when other symptoms became severe. Half of the surviving animals were euthanized at 10 dpi and the other half at 11 dpi. B) Kaplan-Meier survival curve of the
control and vaccinated groups. Vaccinated groups are labelled with dose of Spike trimer and the route of administration; s.c., subcutaneous; i.n., intranasal; i.t., intratracheal.
The groups included the following number of animals: control n = 8, low dose s.c. n = 7, high dose s.c. n = 7, low dose i.n. n = 8, high dose i.n. n = 8, low dose i.t. n = 7, and high
dose i.t. n = 5. Statistical analysis by log-rank (Mantel-Cox) test where *** indicates P < 0.001. C) SARS-CoV-2 RNA levels in BAL fluid and lung tissue at termination. 1 mL of
BAL fluid for each mouse was collected at the day of euthanasia. Of this fluid, 90 ll was subjected to RNA extraction and SARS-CoV-2 E gene RT-qPCR. Ct values are plotted for
each vaccine group on the left y axis. A section of lung tissue was harvested at termination for RNA and 5 ng of RNA was subsequently analysed by RT-qPCR for E gene copy
number (shown on right y axis). D) Histopathology scoring of perivascualar inflammatory cell infiltration in striatum-level meninges tissue from the brains of the challenged
mice at termination. E) Anti-Spike S1 IgG ELISA for pre-challenge serum samples, two weeks after second immunisation. Serum was analysed for IgG against the Spike domain
from SARS-CoV-2 (Founder 2020 strain first detected in Wuhan, China). F) As E, except anti-Spike S1 IgA was analysed G) Anti-Spike S1 IgA was analysed from BAL fluid
harvested at termination. BAL was diluted 1:30 and the optical density (OD) is shown for individual mice. H) Neutralizing antibodies from BAL fluid at termination. BAL was
then diluted beginning at 1-in-4 (LoD) and tested for neutralization of SARS- CoV-2 infection of Vero E6 cells. Results for each individual are plotted.

4745
 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 11 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al.
one immunisation gives a weak anti-Spike IgG response (Fig. 2A).
The second immunisation clearly leads to a strong increase in
anti-Spike IgG titre in a dose dependent manner, supporting our
two-dose strategy (Fig. 2B); however, no differences between
immunisation routes were observed (i.n.vs i.t.). We then investi-
gated cross-reactivity of serum IgG and serum IgA after two immu-
nisations, to three variant Spike RBDs, from the alpha, beta and
delta variants of concern. Despite immunising with a combination
of alpha and beta Spike S1 proteins, we saw similar levels of IgG
and IgA against all variant RBDs within groups (Fig. 2C, S2A, S2B,
4746
 Signerat 2024-06-12 19:29:23 UTC
Vaccine 41 (2023) 4743–4751
S2C, S2D, S2E, S2F, S2G). Between groups, we saw evidence of dose
dependency but again no significant differences between i.n. and i.
t. groups of the same dose.
These serological data were complemented by analysis of neu-
tralizing activity in pooled pre-challenge sera from each group. We
found virus neutralization against the beta and the delta variant in
a dose dependent manner in vaccinated mice from both i.n. and i.t.
groups (Fig. 2D). Both higher dose 20 lg i.n. and i.t. groups had
neutralizing titres of 1:128 and 1:64 against beta and delta, respec-
tively, consistent with our serological data (Fig. S2B, S2C). The only
Oneflow ID 7737067 Sida 12 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al. Vaccine 41 (2023) 4743–4751

potential difference was seen with the low dose groups; low-dose
i.t. showed a titre of 1 in 32 against the delta variant, but there was
no detectable neutralizing antibodies in the low dose i.n. group at a
detection limit of 1 in 16 (Fig. 2D).
Having observed clear pre-challenge immune responses with
our updated vaccine, we decided to challenge the power of our vac-
cine candidate by using a higher infectious dose of SARS-CoV-2
(1x106 TCID50) compared to the first challenge study. As with
the first challenge study, all control unvaccinated mice lost weight,
demonstrated symptoms, and were euthanized at day 4 post infec-
tion (Fig. 2E, 2F, S2H). Unfortunately, an equipment failure led to
the death of four mice in the high-dose intranasal group at 2 days
post infection; the deaths of these mice were considered not
related to infection and they were therefore excluded from further
analysis. The low-dose groups showed a modest effect of the vac-
cine; 3/11 from the low-dose i.n. group and 4/11 from the low-
dose i.t. group survived infection, whereas the remaining animals
were euthanized on days 4, 5, or 6 (Fig. 2E). Both of these groups
lost, on average, a significant proportion of their body weight by
day 4 post infection (Fig. 2F). The high-dose groups showed a
greater level of protection, where 4/7 of the i.n. and 7/11 of the i.
t. groups survived challenge. Consistent with this, we did not
observe a significant decline in weight in these mice (Fig. 2F,
S2H). There was thus a clear dose-dependency of our vaccine,
though we did not see differences between the route of adminis-
tration by analysing health status and survival.
Finally, we analysed presence of SARS-CoV-2 RNA and neutral-
izing activity in BAL harvested at termination. The presence of
SARS-CoV2 RNA was detectable in non-vaccinated control animals
(Fig. 2G). However, in one control animal, no virus was detectable;
the reason for this is unclear. In vaccinated animals, viral replicates
were generally low or undetectable. However, in a few animals in
each group, C(t) values similar to control animals were measured.
The number of animals with low or undetectable viral titres were
generally higher in high-dose groups, and in animals vaccinated
via the i.t. route. The viral load was significantly correlated with
survival.
As shown in Fig. 2H, we found neutralizing antibodies in the
majority of protected mice, but not in susceptible mice. This strong
correlation suggests that the ability of the vaccine to induce an
immune response in the airways is important for its ability to pro-
tect against severe infection and death. At the same time, despite a
high viral infectious dose, we did not see significant differences
between intranasal and intratracheal immunisation. This could
be a result of a ‘common mucosal immunity’ phenomenon, where
immunisation at one mucosal site leads to immunity at distal sites
[6,31,41,42]. One of the limitation of this present study is lack of
data on vaccine efficacy against contemporarVoCs.
2.4. ISR52 based on Alpha Spike reveals the induction of long-term T
cell and broad cross-reactive antibody responses by intranasal
administration
Our challenge studies showed the promise of vaccine candidate
ISR52 when administered i.n. or i.t., inducing antibodies as well as
protective immunity at low dose. We next wished to explore both
humoral and cellular immune responses to our candidate, over a
longer time frame, this time using Spike S1 of the alpha variant
(B.1.1.7) as the antigen. We focused on i.n. and i.t. immunisation
in female C57BL/6J (black 6) mice, using 5 lg and 20 lg total
amount of Spike S1 in this study (Table S4). We immunised 5 or
6 mice per group at day 0 and day 14, and harvested blood, BAL,
and splenocytes at day 28. Spike IgG levels in serum were dose
dependent and cross reacted with the RBD of the delta VOC
(B.1.617.2) and omicron VOC (B.1.1) (Fig. 3A, S3A, S3B). We found
a similar pattern with BAL IgA, indicating the induction of anti-
Spike IgA in a relevant tissue prior to any virus exposure (Fig. 3C,
S3C, S3D), thus confirming that our immunisation strategy leads
to the induction of local immune responses. These data are promis-
ing in the light of recent clinical data showing the role of cross-
reactive mucosal IgA against the omicron VOC [43].
T cell responses are likely important in eliciting long-term
cross-protection against severe COVID-19 disease [44], with recent
reports showing protective T cell responses in the absence of
detectable neutralizing antibodies in hamster and mouse models
[40]. We therefore investigated if ISR52 could elicit Spike
peptide- responsive T cells. We stimulated T cells from mice two
weeks post second immunisation and found both IFN-c and IL-2
producing T cells by ELISpot in all mice administered i.n. (Fig. 3C,
S3E), consistent with previous analyses of intranasal COVID-19
vaccines [11,16,17,45]. Fewer mice immunised i.t. showed these
responses, perhaps indicating that intranasal administration is
more efficient at generating T cell responses. We found a similar
pattern when analysing IFN-c responding T cells by intracellular
cytokine staining, finding both CD4+ and CD8+ populations in the
higher i.n. dose group (Fig. 3D, 3E).
Next, we repeated our immunisation of C57BL/6J mice in order
to follow up T cell responses over a longer period of time
(Table S4). We continued to see significant CD8+ T cell responses
in the higher i.n. group at 6 months post vaccination and observed
a similar trend for CD4+ T cell responses (Fig. 3F, S3F). These results
indicates the induction of durable CD8+ T cell response that is
often a challenge for subunit vaccines [46]. These cellular
responses were matched by sustained high levels of anti-RBD anti-
body across 6 months (Fig. 3G). In these longer term analyses, we
found overall a better cellular and humoral response elicited by i.n.
immunisation compared with i.t. administration.

3
Fig. 2. Dose-dependent protection from vaccination with a high infectious virus dose challenge model. A) Female hACE2 mice were immunised twice with combination alpha
and beta variant Spike S1 by the indicated routes of administration. Fourteen days after the 1st immunisation, blood samples from vaccinated mice were taken and the serum
diluted and analysed for IgG against the Founder strain Spike protein by ELISA. The average optical density (OD) for each vaccinated group is plotted for each dilution. B) As A,
except with serum samples obtained 14 days after the 2nd immunisation. C) As B, except anti-Spike S1 IgA was analysed. D) Neutralizing activity of pre-challenge serum
against variants of concern was assessed. Pre-challenge sera were pooled for each vaccinated group and tested for neutralizing activity against beta variant of concern and
delta variant of concern at a starting dilution of 1-in-16 (LoD). D) Immunised mice were infected intranasally with 1.05x106 TCID SARS-CoV-2 isolate SARS-CoV-2/01/human/
2020/SWE 14 days after the second immunisation. Health was monitored and animals were euthanized after losing > 20% of their body mass or when other symptoms
became severe. Alternatively, surviving animals were euthanized at 11 dpi. Figure shows a Kaplan-Meier survival curve of the control and vaccinated groups. Vaccinated
groups are labelled with total dose of Spike S1 and the route of administration; subcutaneous; i.n., intranasal; i.t., intratracheal. All groups included 11 animals each except
high dose i.n. group that included 7 animals. Statistical analysis by log-rank (Mantel-Cox) test where * indicates P < 0.05, ** indicates P < 0.01 *** indicates P < 0.001 in a
comparison with control animals. F) Absolute body mass of individual mice at day 0 and day 4 post infection for each group. Statistical analysis by two-way ANOVA using
Sidak’s multiple comparison test, ns indicates P > 0.05, *** indicates P < 0.001, **** indicates P < 0.0001. G) SARS-CoV-2 RNA levels in BAL fluid at termination. Equal amounts
of BAL fluid for each mouse was subjected to RNA extraction and SARS-CoV-2 E gene RT-qPCR. Ct values are plotted for each vaccine group.H) Neutralizing antibodies from
BAL fluid at termination. 1 mL of BAL fluid for each mouse was collected at the day of euthanasia. BAL was then diluted beginning at 1-in-4 (LoD) and tested for neutralization
of SARS- CoV-2 infection (founder variant) of Vero E6 cells. Results for each individual are plotted and further divided into mice that survived to day 11 (Protected) and those
that were euthanized early due to symptoms (Not protected).

4747
 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 13 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al. Vaccine 41 (2023) 4743–4751

Fig. 3. Long-term spike-specific cellular and humoral immunity is induced by ISR52. A) Female C57BL/6J mice were immunised twice with Spike S1 alpha variant vaccine by
the indicated routes of administration. Two weeks after the final immunisation, mice were euthanized and blood, BAL and spleens were harvested. Anti-alpha variant Spike
RBD IgG responses in serum were assessed by ELISA, and the average optical density (OD) for each vaccinated group is plotted for each dilution of serum. B) BAL samples from
mice from (A) were taken, diluted, and analysed for anti-alpha variant Spike RBD IgA by ELISA. The average optical density (OD) for each vaccinated group is plotted for each
dilution. C) ELISpot analysis of T cells from spleens harvested two weeks after the second immunisation described in (A) for IFN-c producing T cells stimulated either with
medium only or by a peptide pool covering the S1 domain of the alpha variant Spike protein. Results and median for individual mice are plotted. Statistical testing by ANOVA
with Sidak’s multiple comparison test, where *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates P > 0.05 in a comparison with the corresponding medium-
stimulated samples. D) T cells from vaccinated mice as per (C) were stimulated twice with S1 peptide pool or left untreated, followed by T cell marker and intracellular IFN-c
staining and flow cytometry. The proportion of IFN-c positive CD4+ T cells is indicated. Statistical testing by ANOVA with Kruskal- Wallis multiple comparison test, where **
indicates P < 0.01. All other comparison were not significant. E) As (D), but showing the proportion of CD8+ T cells. F) Female C57BL/6J mice were immunised twice with Spike
S1 alpha variant vaccine by the indicated routes of administration. At day 182 post initial vaccination (6 months), all animals ere euthanized, and T cells from spleens were
analysed for response to S1 peptide pool as described in (D). Statistical testing by ANOVA with Sidak’s multiple comparison test, where ** indicates P < 0.01and ns indicates
P > 0.05. G) Serum samples from mice in (F) were analysed at the indicated times post immunisation for anti-Alpha variant Spike RBD2 IgG responses by ELISA. The average
optical density (OD) for each vaccinated group is plotted for the 1:100 dilution of serum.

Overall, our modified ISR52 vaccine candidate showed good
effectivity against a high dose of virus of a different strain than
those to which the mice where immunised; this was true for both
i.n. and i.t. administration at the higher 20 lg Spike S1 dose. Fur-
thermore, we found long-term spike-specific humoral and cellular
immune responses with the alpha Spike S1 domain administered i.
n. Based on these promising virus challenge, serological, and cellu-
lar immunity data, we are moving forward with a dry powder for-
mulation of ISR52 for inhalation in Phase I/II clinical trials.
3. Materials and methods
(Tartu, Estonia). For the first challenge study, SARS-CoV-2 trimeric
Spike was used (Cat. no P-309–100); for the second challenge
study, monomeric SARS-CoV-2 Spike S1 VOC 202012/K (alpha)
(Cat. no P-310–100) and monomeric SARS-CoV-2 Spike S1 VOC
501.V2 (beta) (Cat. no P-319–100) were used. In the T-cell response
study, monomeric SARS-CoV2 Spike S1 B.1.17 (Similar to Cat. no
P-310–100, but without His-tag) was used. For the first challenge,
all-trans retinoic acid (Sigma-Aldrich) was used as a supportive
substance, 40 lg per mouse, with 10 lg polyIC (Invivogen) as an
adjuvant. For the remaining studies, 10 lg polyICLC (Hiltonol,
Oncovir) was used as an adjuvant.

3.1. ISR52 3.2. Virus

The ISR52 vaccine is based on SARS-CoV-2 Spike S1 Alpha pro-
tein and the adjuvant PolyICLC. During the development of the vac-
cine, presented in this manuscript, different Spike variants have
been evaluated. Each Spike protein was manufactured by Icosagen
4748
 Signerat 2024-06-12 19:29:23 UTC
440 SARS-CoV-2 virus strain SARS-CoV-2/01/human/2020/SWE
[47] is described here as the Founder strain. SARS-CoV-2 virus
strain hCoV-19/Sweden/21–51217/2021 (lineage B.1.351) [48] is
described here as the beta strain. SARS-CoV-2 virus strain
Oneflow ID 7737067 Sida 14 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al.
SARS-CoV-2/hu/DK/SSI-H13 (lineage B.1.167.2) was provided by Dr
Charlotta Polacek Strandh, Statums Serum Institut, Copenhagen,
Denmark and is described here as the delta strain. All SARS-CoV-
2 strains were grown and titered in a BSL-3 facility on VeroE6 cells
by plaque assay [47,49] or TCID50 using the presence of cytopathic
effect (CPE) as the endpoint [50].
3.3. Animal experiments
Female AC70 hACE2 mice [32] were purchased from Taconic,
Denmark. Treatment of the mice was governed by ethical permit
(reference 16765–202, approved by the regional animal experi-
mental ethics committee in Stockholm). All animal challenge stud-
ies were conducted at Astrid Fagraeus Laboratorium in Solna,
Sweden, under BSL-3 conditions by Adlego Biomedical AB. Addi-
tional animal experiments were conducted at the Adlego Biomed-
ical AB laboratory, Department of Comparative Medicine,
Karolinska University Hospital, Solna, Sweden. Isofluorane anaes-
thesisa was used for intransal vaccination (25 ll volume), intransal
infection, euthanasia, and broncheoalveolar lavage. Ketaminol and
Rompun anaesthesia was used for intratracheal vaccination, and
once mice were fully anaesthetised, they were placed in a supine
position. A bent 19 G steel gavage tube was used to administer
25 ll of vaccine between the vocal cords. Indicated adjuvants
Poly(I:C) (HMW) (Cat. no vac-pic, Invivogen), ATRA (Cat no:
R2625, Sigma Aldrich), and/or PolyICLC (Hiltonol, Oncovir Inc)
were mixed with antigen just prior to immunisation. Mice were
infected with the indicated infectious dose of SARS-CoV-2 intrana-
sally in a volume of 25 ll. Health status was documented on vac-
cination days and daily after infection according to a modified
Irwin screen.
3.4. Cells
VeroE6 cells were obtained from ATCC (CRL-1586) and main-
tained in DMEM medium supplemented with 10% fetal calf serum
(FCS; Gibco), 1% Non-essential amino acids (Gibco), and 10 mM
HEPES (Gibco) at 37 °C in a 5% CO2 humidified atmosphere.
3.5. Microneutralization assay
VeroE6 cells were seeded on 96 well plates at a seeding density
of 2x104 cells per well one day prior to infection. BAL or serum was
heat inactivated for 30 min at 56 °C before dilution in DMEM med-
ium supplemented with 2% FCS, 100 units/mL of penicillin and
100 lg/mL streptomycin. The diluted BAL/serum was then dis-
tributed in triplicate into 96 well round bottom plates and mixed
with 500 plaque forming units of SARS-CoV-2 per well, and incu-
bated at 37 °C/5% CO2 for 1 h. Medium from the VeroE6 cells was
aspirated and replaced with virus:BAL/serum mix. Virus only,
BAL/serum only, and convalescent patient serum controls were
included. After 3 days’ incubation at 37 °C/5% CO2, the presence
of CPE was checked. Neutralizing activity was assigned to wells
which showed a complete absence of CPE. The neutralizing titer
was then calculated as the dilution factor where >50% of wells
showed neutralizing activity.
3.6. ELISA
Clear flat bottom immuno nonsterile 96 well polystyrene plates
(Thermo Scientific) were coated with either founder strain Spike
S1, alpha variant RBD2, beta variant RBD2, delta variant RBD2, or
omicron variant RBD2 purchased from Icosagen (Tartu, Estonia)
at 5 lg/ml in PBS 1X buffer, pH 7.2, using 50 ll/well. The plates
were covered with sealing tape, incubated overnight at 4 °C and
then washed with PBS + 0.05% Tween 20. Blocking was performed
4749
 Signerat 2024-06-12 19:29:23 UTC
Vaccine 41 (2023) 4743–4751
by applying 150 ll/well of diluent solution for 1 h at RT and plates
were then washed. 100 ll of serum diluted in diluent solution
were applied per well, incubated for 2 h at RT, followed by wash-
ing. Detection antibody, 100 ll/well, diluted 1:1000 in diluent
was added and incubated for 1 h at RT. For IgG, conjugated anti-
mouse IgG alkaline phosphatase (ALP) (Cat. no 3310–4, Mabtech)
was used, and for IgA first biotinylated anti-mouse IgA (100 ll/
well, diluted 1:1000 in diluent) (Cat. no 3865–6, Mabtech) and
then streptavidin ALP (100 ll/well, diluted 1:1000 in diluent)
(Cat. no 3310–8, Mabtech) was added and incubated for 1 h at
RT. After washes, 100 ll pNPP substrate per well was added, the
enzymatic reaction was developed for 30 min and analyte absor-
bance (410 nm) and background absorbance (620 nm) measured
by a BMG LABTECH FLUOstar omega ELISA plate reader. Results
were considered positive when the optical density (OD) obtained
with the ELISA was three times higher than the negative control.
All antibodies, the diluent solution and the pNPP substrate were
from Mabtech.
3.7. IL-2 and IFN-c ELISpot
IL-2 and IFN-c ELISpot reagents were purchased from Mabtech
and the assays were performed according to manufacturer instruc-
tions. Mabtech’s mouse IL-2 ELISpot PLUS kit (ALP) and mouse IFN-
c ELISpot PLUS kit (ALP) were used for detection of IL2 and IFN-c,
respectively. The precoated plates are washed 4 times with sterile
PBS pH 7.2 (Gibco Life Technologies Limited) and conditioned by
blocking with 10/90% FBS/RPMI 1640 Glutamax (Gibco Life Tech-
nologies Limited) for at least 30 min at room temperature. SARS-
CoV-2 S1 scanning pool antigen stimuli stock solution (Mabtech),
200 lg/ml, was prepared from the lyophilized peptide pool by
addition of 40 ll of DMSO and 85 ll PBS followed by further dilu-
tion in cell culture medium giving a peptide concentration of 2 lg/
ml. Conditioning medium was removed from the plates and 100 ll
of peptide pool, followed by 100 ll of cell suspension, such that
250,000 mouse splenocytes were stimulated per well. The plates
were incubated at 37 oC, 5% CO2 for 15–18 h for IL2 plates and
32–35 h for IFN-c plates. The next day cells were removed and
the plates washed five times followed by incubation with 100 ll/
well of detection antibody (5H4-biotin) diluted to 1 lg/ml in PBS
containing 0.5 % FBS, for IL-2 detection and detection antibody
R4-6A2-biotin for IFN-c detection, for 2 h at room temperature.
The plates were then washed five times with PBS followed by incu-
bation with 100 ll/well of Streptavidin-ALP diluted 1:1000 in PBS
containing 0.5 % FBS. After incubation at room temperature for 1 h,
the plates were washed as before and 100 ll/well of the substrate
(BCIP/NBT-plus) was added and the plates incubated for 15 min at
room temperature in the dark. After extensive washing in tap
water, the plates were dried overnight before detection of spot
forming units using either an IRIS or ASTOR ELISpot instrument.
3.8. In vitro proliferation and intracellular cytokine staining (ICS)
analysis by flow cytometry
Splenocytes from vaccinated and control mice were prepared
and stained with CellTrace Violet dye according to the manufactur-
ers instructions (ThermoFisher Scientific, MA, USA). One million
splenocytes were then stimulated or left untreated for 4 days in
wells of a flat bottom 96 well plate in duplicate. After 4 days, the
cells were restimulated with antigen for a further 24 h. At 6–8 h
prior to harvesting, protein transport inhibitor cocktail was added
to the cells (ThermoFisher Scientific). The cells were harvested and
the duplicate wells pooled into V bottom 96 well plates to reduce
cell loss during the intracellular staining. The cell samples were
then stained with T-cell surface markers (CD3 FITC, CD8 PerCp-
Cy5.5, CD4 APC, all ThermoFisher Scientific) followed by intracellu-
Oneflow ID 7737067 Sida 15 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al.
lar staining of IFN-gamma (IFN-c PE clone XMG1.2. ThermoFisher
Scientific) using the intracellular fix/perm kit (ThermoFisher Scien-
tific) according to the manufacturer’s instructions. The samples
was analyzed with a MACSQuant16 instrument (Miltenyi Biotech).
3.9. SARS-CoV-2 RT-qPCR
Equal volumes of BAL from each mouse was mixed with Trizol
(Thermo Fisher). RNA was extracted using Direct Zol RNA mini
kit (Zymo Research), and analyzed for the content of SARS-CoV-2
RNA by RT-qPCR using the following primers/probes as previously
described [47]. SARS-CoV-2 E gene: forward: ACAGGTACGTTAA-
TAGTTAATAGCGT; reverse: ATATTGCAGCAGTACGCACACA; probe:
FAM- ACACTAGCCATCCTTACTGCGCTTCG-MGB.
Lung tissue was lysed in Trizol and RNA was extracted using
Direct Zol RNA mini kit (Zymo research). The copy number of
SARS-CoV-2 RNA was determined by analysing 5 ng of RNA from
each lung tissue sample, using E gene RNA transcripts of a defined
copy number (EDX SARS-CoV-2 Standard, Biorad) to generate a
standard curve. Primers and probes as above.
3.10. Histopathology
Histopathology analysis was performed by BioVet AB. Brain tis-
sue was harvested and fixed in 4% formaldehyde and sectioned
(between 4 and 6 lm). Sections were stained with haematoxylin-
eosin and scored for histopathological changes according to distri-
bution, severity (miminal, slight, moderate, marked, and severe),
and morphologic character.
Data availability
Data will be made available on request.
Declaration of Competing Interest
The authors declare the following financial interests/personal
relationships which may be considered as potential competing
interests: EE and AM declare no competing interests. C.B.R., C.J., J.
S., and O.W. are employed by Immune System Regulation AB
(ISR). R.P.A.W. is a consultant working for ISR. O.W. and J.S. are
shareholders in ISR, and O.W. is the founder of ISR. ISR have regis-
tered a patent based on the vaccine candidate described in this
manuscript.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.vaccine.2023.06.015.
References
[1] Zheng C et al. Real-world effectiveness of COVID-19 vaccines: a literature
review and meta-analysis. Int J Infect Dis 2021.
[2] Kandimalla R et al. Counting on COVID-19 vaccine: insights into the current
strategies. Progrand Fut Challen Biomed 2021;9(11).
[3] Milne G et al. Does infection with or vaccination against SARS-CoV-2 lead to
lasting immunity? Lancet Respir Med 2021;9(12):1450–66.
[4] Van De Pas R et al. COVID-19 vaccine equity: a health systems and policy
perspective. Expert Rev Vaccines 2021:1–12.
[5] Chavda VP et al. Intranasal vaccines for SARS-CoV-2: From challenges to
potential in COVID-19 management. Drug Discov Today 2021;26
(11):2619–36.
[6] Lavelle EC, Ward RW. Mucosal vaccines - fortifying the frontiers. Nat Rev
Immunol 2021.
[7] Alu A et al. Intranasal COVID-19 vaccines: From bench to bed. EBioMedicine
2022;76:103841.
4750
 Signerat 2024-06-12 19:29:23 UTC
Vaccine 41 (2023) 4743–4751
[8] Doremalen NV et al. Intranasal ChAdOx1 nCoV-19/AZD1222 vaccination
reduces viral shedding after SARS-CoV-2 D614G challenge in preclinical
models. Sci Transl Med 2021;13(607):eabh0755.
[9] Guebre-Xabier M et al. NVX-CoV2373 vaccine protects cynomolgus macaque
upper and lower airways against SARS-CoV-2 challenge. Vaccine 2020;38
(50):7892–6.
[10] Kumar US et al. Gold-nanostar-chitosan-mediated delivery of SARS- CoV-2
DNA vaccine for respiratory mucosal immunization: development and proof-
of-principle. ACS Nano 2021.
[11] Hassan AO et al. A single-dose intranasal ChAd vaccine protects upper
and lower respiratory tracts against SARS-CoV-2. Cell 2020;183(1):169–84.
e13.
[12] Wu S et al. Safety, tolerability, and immunogenicity of an aerosolised
adenovirus type-5 vector-based COVID-19 vaccine (Ad5-nCoV) in adults:
preliminary report of an open-label and randomised phase 1 clinical trial.
Lancet Infect Dis 2021;21(12):1654–64.
[13] Sui Y et al. Protection against SARS-CoV-2 infection by a mucosal vaccine in
rhesus macaques. JCI Insight 2021;6(10).
[14] Du Y et al. Intranasal administration of a recombinant RBD vaccine induced
protective immunity against SARS-CoV-2 in mouse. Vaccine 2021;39
(16):2280–7.
[15] van der Ley PA et al. An intranasal OMV-based vaccine induces high mucosal
and systemic protecting immunity against a SARS-CoV-2 infection. Front
Immunol 2021;12:781280.
[16] O’Donnell KL et al. Optimization of single-dose VSV-based COVID-19
vaccination in hamsters. Front Immunol 2021;12:788235.
[17] Chung NH et al. Induction of Th1 and Th2 in the protection against SARS-CoV-2
through mucosal delivery of an adenovirus vaccine expressing an engineered
spike protein. Vaccine 2022;40(4):574–86.
[18] Liu X et al. A single intranasal dose of a live-attenuated parainfluenza virus-
vectored SARS-CoV-2 vaccine is protective in hamsters. Proc Natl Acad Sci USA
2021;118(50).
[19] Stark FC et al. Intranasal immunization with a proteosome-adjuvanted SARS-
CoV-2 spike protein-based vaccine is immunogenic and efficacious in mice and
hamsters. Sci Rep 2022;12(1).
[20] Afkhami S et al. Respiratory mucosal delivery of next-generation COVID-19
vaccine provides robust protection against both ancestral and variant strains
of SARS-CoV-2. Cell 2022;185(5):896–915. e19.
[21] Ku MW et al. Brain cross-protection against SARS-CoV-2 variants by a
lentiviral vaccine in new transgenic mice. EMBO Mol Med 2021:e14459.
[22] AboulFotouh K, Cui Z, Williams 3rd RO. Next-generation COVID-19 vaccines
should take efficiency of distribution into consideration. AAPS PharmSciTech
2021;22(3):126.
[23] Heida R, Hinrichs WL, Frijlink HW. Inhaled vaccine delivery in the combat
against respiratory viruses: a 2021 overview of recent developments and
implications for COVID-19. Expert Rev Vaccines 2021:1–18.
[24] Kesarwani A et al. The safety and efficacy of BCG encapsulated alginate particle
(BEAP) against M.tb H37Rv infection in Macaca mulatta: A pilot study. Sci Rep
2021;11(1):3049.
[25] Bahamondez-Canas TF, Cui Z. Intranasal immunization with dry powder
vaccines. Eur J Pharm Biopharm 2018;122:167–75.
[26] Luczo JM et al. Intranasal powder live attenuated influenza vaccine is
thermostable, immunogenic, and protective against homologous challenge in
ferrets. NPJ Vaccines 2021;6(1):59.
[27] Rossi I et al. A respirable HPV-L2 dry-powder vaccine with GLA as
amphiphilic lubricant and immune-adjuvant. J Control Release 2021;340:
209–20.
[28] Fergie J, Srivastava A. Immunity to SARS-CoV-2: lessons learned. Front
Immunol 2021;12:654165-654165.
[29] Shrock E et al. Viral epitope profiling of COVID-19 patients reveals cross-
reactivity and correlates of severity. Science (New York, N.Y.) 2020;370(6520):
eabd4250.
[30] Robbiani DF et al. Convergent antibody responses to SARS-CoV-2 in
convalescent individuals. Nature 2020;584(7821):437–42.
[31] Jearanaiwitayakul T et al. Peritoneal administration of a subunit vaccine
encapsulated in a nanodelivery system not only augments systemic responses
against SARS-CoV-2 but also stimulates responses in the respiratory tract.
Viruses 2021;13(11).
[32] Tseng CT et al. Severe acute respiratory syndrome coronavirus infection of
mice transgenic for the human Angiotensin-converting enzyme 2 virus
receptor. J Virol 2007;81(3):1162–73.
[33] Xu G et al. SARS-CoV-2 promotes RIPK1 activation to facilitate viral
propagation. Cell Res 2021:1–14.
[34] Yoshikawa N et al. Differential virological and immunological outcome of
severe acute respiratory syndrome coronavirus infection in susceptible and
resistant transgenic mice expressing human angiotensin-converting enzyme
2. J Virol 2009;83(11):5451–65.
[35] Zhou P et al. A pneumonia outbreak associated with a new coronavirus of
probable bat origin. Nature 2020;579(7798):270–3.
[36] Feng J et al. Construction of a live-attenuated vaccine strain of yersinia pestis
EV76-B-SHUDpla and evaluation of its protection efficacy in a mouse model by
aerosolized intratracheal inoculation. Front Cell Infect Microbiol 2020;10.
473–473.
[37] Griffiths GD et al. Liposomally-encapsulated ricin toxoid vaccine delivered
intratracheally elicits a good immune response and protects against a lethal
pulmonary dose of ricin toxin. Vaccine 1997;15(17–18):1933–9.
Oneflow ID 7737067 Sida 16 / 28
 E. Elder, C. Bangalore Revanna, C. Johansson et al.
[38] Golden JW et al. Human angiotensin-converting enzyme 2 transgenic mice
infected with SARS-CoV-2 develop severe and fatal respiratory disease. JCI
Insight 2020;5(19).
[39] Rathnasinghe R et al. Comparison of transgenic and adenovirus hACE2 mouse
models for SARS-CoV-2 infection. Emerg Microbes Infect 2020;9(1):2433–45.
[40] Castro JT et al. Promotion of neutralizing antibody-independent immunity to
wild-type and SARS-CoV-2 variants of concern using an RBD- Nucleocapsid
fusion protein. Nat Commun 2022;13(1):4831.
[41] van Splunter M et al. Oral cholera vaccination promotes homing of IgA(+)
memory B cells to the large intestine and the respiratory tract. Mucosal
Immunol 2018;11(4):1254–64.
[42] Weisz-Carrington P et al. Organ and isotype distribution of plasma cells
producing specific antibody after oral immunization: evidence for a
generalized secretory immune system. J Immunol 1979;123(4):1705–8.
[43] Havervall S et al. Anti-spike mucosal IgA protection against SARS- CoV-2
omicron infection. N Engl J Med 2022.
[44] Moss P. The T cell immune response against SARS-CoV-2. Nat Immunol
2022;23(2):186–93.
4751
 Signerat 2024-06-12 19:29:23 UTC
Vaccine 41 (2023) 4743–4751
[45] Pillet S et al. Safety, immunogenicity, and protection provided by
unadjuvanted and adjuvanted formulations of a recombinant plant-derived
virus-like particle vaccine candidate for COVID-19 in nonhuman primates. Cell
Mol Immunol 2022;19(2):222–33.
[46] Ho NI et al. Adjuvants enhancing cross-presentation by dendritic cells: The key
to more effective vaccines? Front Immunol 2018;9:2874.
[47] Monteil V et al. Inhibition of SARS-CoV-2 infections in engineered human
tissues using clinical-grade soluble human ACE2. Cell 2020;181(4):905–913
e7.
[48] Normark J et al. Heterologous ChAdOx1 nCoV-19 and mRNA-1273 Vaccination.
N Engl J Med 2021;385(11):1049–51.
[49] Becker MM et al. Synthetic recombinant bat SARS-like coronavirus is
infectious in cultured cells and in mice. Proc Natl Acad Sci 2008;105
(50):19944–9.
[50] Wulff NH, Tzatzaris M, Young PJ. Monte Carlo simulation of the Spearman-
Kaerber TCID50. J Clin Bioinf 2012;2(1):5.
Oneflow ID 7737067 Sida 17 / 28
 Bilaga - 5

Vaccine program

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 18 / 28

 Formulering Covid-vaccin

Spike-protein Hiltonol Poly IC)

Administrationssätt – Nasal inhalation

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 19 / 28

 Vaccine developement
Icosagen (Estonia)
Business agreement signed
Tech transfer to Northway

Iconovo (Lund, Sweden)

ICOone Nasal quotes for Phase III production

Upperton (UK)
Formulation development of vaccine dry powder

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 20 / 28

 Spike antigen production

Northway Biotech (Vilnius, Lithuania)

Contracted for GMP manufacture for Phase I/II and
Phase III

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 21 / 28

 PolyICLC adjuvant production
Oncovir (US)
Owns PolyICLC and the IP
Business agreement signed and first payment
made

Dalton (Canada)
Manufactures PolyICLC for Oncovir
Audited successfully

PCI
Labelling and clinical storage
Audited successfully

Eurofarma (Brazil)
Oncovir has discussions with Eurofarma, Brazil
Regulatory discussions initiated
Possible manufacturer for evergreen
 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 22 / 28
 BOOSTER VACCINATION
• Phase II/III, prospective, randomized,
• to evaluate the safety, tolerability, and immunogenicity
• of one booster vaccination with ISR52 at optimal dose
• from Phase I/II vs Comirnaty (Pfizer) at established adult booster dose

• Subjects with 2 doses of vaccination against SARS-CoV-2 >12 weeks prior to inclusion
• Randomization two arms
• Single doses of Pfizer vs. ISR nasal vaccine booster
• 100 + 100 subjects to be included ?
• 3-10 centers for inclusion
• Evaluation at days 15, 30 and 180 days
• Neutralizing Ig response
• Anti Spike IgG and IgA response
• T cell response
• Safety

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 23 / 28

 ISRs vaccine recognizes all variants of concern including

Delta and Omicron

Delta: 8-12 amino acids mutation

Omicron: 32 amino acids mutation

ISRs vaccine comprises of the extracellular

full-length, 721 amino acid, spike protein

VOI XBB 1.5 N460K

S486P
 Signerat 2024-06-12 19:29:23 UTC
F490S
Oneflow ID 7737067 Sida 24 / 28
 New vaccines contain Omicron XBB

On September 11, 2023, the Food and Drug Administration amended the emergency
use authorization (EUA) of Moderna COVID-19 Vaccine to include the 2023-2024
formula. The Moderna COVID-19 Vaccine (2023-2024 Formula) includes a monovalent
(single) component that corresponds to the Omicron variant XBB

The Pfizer-BioNTech COVID-19 Vaccine (2023-2024 Formula) includes a monovalent

(single) component that corresponds to the Omicron variant XBB. 1.5 of SARS-CoV-2

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 25 / 28

VACCINE PLATFORM
Other potential vaccines based on our platform
New variants of concern SARS-CoV-2

• SARS-CoV-3

• Influenza A, B

• Combination

• Adenovirus

• Rhinovirus

• RSV

• Pneumococcus

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 26 / 28

 Deltagare

KRISTER MAGNELÖV Sverige

Signerat med E-signering 2024-06-12 19:26:44 UTC

Krister Magnelöv Datum

krister@hiqbygg.se
19750420-0259
Leveranskanal: E-post
IP-adress: 95.193.160.184

ALEXSANDAR GOCIC Sverige

Signerat med E-signering 2024-06-12 19:28:39 UTC

Alexsandar Gocic Datum

alexsandar.gocic@benteler.com
19830308-6972
Leveranskanal: E-post
IP-adress: 81.26.240.145

HENRIK EGERTUN Sverige

Signerat med E-signering 2024-06-12 19:29:23 UTC

Henrik Egertun Datum

henege74@gmail.com
19740823-7555
Leveranskanal: E-post
IP-adress: 83.226.134.139

JOHAN NYLUND Sverige

Signerat med E-signering 2024-06-12 19:26:23 UTC

Johan Nylund Datum

johan@jpnylund.se
197905101973
Leveranskanal: E-post
IP-adress: 78.72.16.230

OLA WINQVIST Sverige

Signerat med E-signering 2024-06-12 19:26:10 UTC

Ola Winqvist Datum

ola.winqvist@telia.com
19650828-3972
Leveranskanal: E-post
IP-adress: 188.150.5.248

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 27 / 28

 JONAS WINQVIST Sverige

Signerat med E-signering 2024-06-12 19:26:32 UTC

Jonas Winqvist Datum

winqvist.jonas@gmail.com
196901134251
Leveranskanal: E-post
IP-adress: 78.69.1.40

 Signerat 2024-06-12 19:29:23 UTC Oneflow ID 7737067 Sida 28 / 28