This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/authorsrights
 Author's personal copy

Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161

Contents lists available at ScienceDirect

Journal of Experimental Marine Biology and Ecology

journal homepage: www.elsevier.com/locate/jembe

A novel class of Pecten maximus POU gene, PmaPOU-IV: Characterization

and expression in adult tissues
Vanessa Lozano, Roi Martínez-Escauriaza, Cristóbal Bernardo-Castiñeira, Crimgilt Mesías-Gansbiller,
Antonio J. Pazos, José L. Sánchez, M. Luz Pérez-Parallé ⁎
Laboratorio de Biología Molecular y del Desarrollo, Departamento de Bioquímica y Biología Molecular, Instituto de Acuicultura, Universidade de Santiago de Compostela,
15782 Santiago de Compostela, Spain

a r t i c l e i n f o a b s t r a c t

Article history: POU genes encode a class of DNA-binding proteins that interact with DNA through a bipartite domain of ~150
Received 13 September 2013 amino acids. This domain is composed of two highly conserved regions, an N-terminal POU specific domain
Received in revised form 15 January 2014 and a C-terminal POU homeodomain, separated by a non-conserved linker. POU domain proteins are currently
Accepted 18 January 2014
grouped into six or seven classes. In a variety of organisms, including Drosophila, Caenorhabditis and vertebrates,
Available online 7 February 2014
POU proteins have been shown to play critical roles in the development and functioning of the nervous and neu-
Keywords:
roendocrine systems. POU-IV class genes regulate neuronal metazoan development, including a range of sensory
Bivalve mollusc neurons. However in Lophotrochozoa, their presence, function and expression is not well studied, especially in
Expression the phylum Mollusca.
Homeodomain In this study, we have isolated and fully sequenced a homologue of the vertebrate Brn-3 gene from the bivalve
Pecten maximus mollusc Pecten maximus (L.), which we have called PmaPOU-IV. The derived amino acid sequence exhibits
POU domain characteristic features of POU-IV proteins. First, the new sequence includes a POU-specific domain and a POU-
POU-IV genes homeodomain. Second, PmaPOU-IV contains a POU-IV box, found only in the proteins of class IV. Third, the Pecten
POU-IV bipartite domain shares a significant amino acid sequence identity with other members of the POU-IV
class. Finally, phylogenetic analyses confirm that PmaPOU-IV is an orthologue of POU-IV genes. We have also in-
vestigated by reverse transcription quantitative real time PCR (RT-qPCR) the expression pattern of PmaPOU-IV in
adult tissues. PmaPOU-IV was expressed in several sensory organs and gonads but was undetectable in both
muscle and the digestive gland. Our findings support the belief that POU class IV genes involved in the terminal
neuronal differentiation are still operating in the adult nervous system.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction
Transcriptional factors play essential roles in the regulation of devel-
opment and differentiation including cell-type specification. One partic-
ularly interesting type of transcription factors is POU family. The POU
family was defined following the observation that the proteins encoded
by three mammalian genes, Pit-1, Oct-1 and Oct-2 and the product of the
Caenorhabditis elegans gene unc-86 shared a region of homology, known
as the POU domain. POU transcription factors are also characterized by
the presence of a highly conserved homeodomain (Herr et al., 1988).
The bipartite POU domain varies from 150 to 191 amino acids in length
and contains two major regions of very high homology —a ~75-amino-
acid N-terminal POU specific domain (POUSD) and a 60-amino-acid C-
terminal POU-homeodomain (POUHD). A hypervariable linker joins
⁎ Corresponding author. Tel.: +34 881816049; fax: +34 981 547165.
E-mail addresses: vanessa.lozano@usc.es (V. Lozano), roi.martinez-escauriaza@usc.es
(R. Martínez-Escauriaza), crimgilt.mesias.gansbiller@rai.usc.es (C. Mesías-Gansbiller),
antonioj.pazos@usc.es (A.J. Pazos), joseluis.sanchez@usc.es (J.L. Sánchez),
luz.perez-paralle@usc.es (M.L. Pérez-Parallé).
these two segments that can vary from 15 to 56 amino acids in length.
Both subdomains contain helix-turn-helix motifs that bind to the DNA
(Herr and Cleary, 1995).
POU domain proteins have been identified from a diverse range of
species as divergent as C. elegans (Bürglin et al., 1989), Drosophila
(Billin et al., 1991), Xenopus (Agarwal and Sato, 1991), zebrafish
(Johansen et al., 1993), and humans (Herr et al., 1988). POU proteins
are known to regulate many fundamental developmental and homeo-
static processes, such as embryogenesis and histone gene expression
(Phillips and Luisi, 2000). In a variety of organisms, including verte-
brates and Drosophila these genes seem to carry out essential functions
for organ development and cellular differentiation. Several members of
the POU family have also been implicated in the control of development
and function of the neuroendocrine system (Andersen and Rosenfeld,
2001).
There are six or seven distinct gene families within the POU class
(POU I to POU VII) based on the amino acid sequence of their POU do-
mains and on the conservation of the variable linker region. The
neuronally expressed Pit proteins define Class I. The ubiquitously
expressed Oct-1 and Oct-2 are representative of type II. Brn1, 2, 4 and

0022-0981/$ – see front matter © 2014 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.jembe.2014.01.013
 Author's personal copy
V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161
Tst-1, involved in central nervous system development are included in
class III. Members of the IV class are involved in neural development
within embryonic and adult neural tissues. Type V proteins are involved
in early embryogenesis like Oct-3, 4. Type VI proteins, such as RPF-1, are
expressed in the central nervous system (CNS) while it seems that type
VII proteins are critical for early developmental stages (CEH-18)
(Phillips and Luisi, 2000; Ryan and Rosenfeld, 1997).
The POU-IV class proteins have critical functions in vertebrate CNSs
and sensory organs. POU-IV genes like Brn-3 and unc-86 appear to be
neural genes involved in the differentiation of sensory neurons, as dem-
onstrated in the gastropod Haliotis, the insect Drosophila, the nematode
C. elegans and in vertebrates. Brn-3 genes are involved in mouse neural
development especially in the development of the sensory cells involved
in vision, hearing and olfaction (Latchmann, 1999). The Drosophila Brn-
3-homologue (iPOU) is expressed in the visual and chemosensory sys-
tems and acts as a transcriptional repressor in the central and peripheral
nervous system from late embryonic to adult stages (Certel et al., 2000).
The C. elegans unc-86 POU protein is required for the commitment of
several sensory and motor neuroblast lineages as well as for the specifi-
cation and maintenance of particular neural phenotypes (Finney and
Ruvkin, 1990). In Cnidaria, AurBrn3, a POU-IV homologue is expressed
during sensory cell development (Nakanishi et al., 2010). In the primi-
tive bilaterian acoela Neochildia fusca, Brn-1 and 3 genes are expressed
in distinct subsets of nerve cells in juvenile and adult worms
(Ramachandra et al., 2002) supporting the hypothesis that POU genes
act as transcription factors for neuron type-specific proteins. The ascidi-
an Ciona intestinalis Ci-POU-IV gene is expressed in the precursor cells of
the neural system during development and in the neural system of the
larva (Candiani et al., 2005). Finally, in the amphioxus Branchiostoma
floridae, AmphiPOU-IV acts early in the pathway of sensory neural spec-
ification (Candiani et al., 2006).
Currently, their presence, function and expression in the bilaterian
clade Lophotrochozoa, comprising molluscs, are still unclear (Bassaglia
et al., 2013; Hedgecock et al., 2005). Two class-IV POU genes have
been identified in the gastropod Haliotis asinina (O'Brien and Degnan,
2000) and in the bivalve Crassostrea gigas (Zhang et al., 2012). In Haliotis
POU-III and POU-IV genes have been implicated in the development of
peripheral sensory cells and were expressed in the adult central nervous
system and in several sensory tissues, as well as in the cerebral and
pleuropedal ganglia from adults (O'Brien and Degnan, 2002a, 2002b).
We have isolated and fully sequenced a homologue of the vertebrate
Brn-3 gene from the bivalve mollusc Pecten maximus (L.), which we
have called PmaPOU-IV. We have also described the expression of this
class IV gene. This study is the first complete characterization and ex-
pression analysis of a POU gene in bivalves.
2. Materials and methods
2.1. Samples
For this study, specimens of the great scallop Pecten maximus
(Pectinidae) were collected from the Ría de Pontevedra, Galicia
(Spain). A total of 10 adults were investigated. Digestive gland, gill,
male and female gonad, adductor muscle, mantle edge (including
eye), cerebropedal ganglia and parietovisceral ganglion were all dissect-
ed from adult scallops (Beninger and Le Pennec, 2006). Tissue samples
were prepared in RNAlater (Sigma, MO, USA) and stored at − 20 °C
until used.
2.2. Molecular cloning of PmaPOU-IV from P. maximus
Total RNA extraction was performed from 100 mg of gill tissue using
RNAaqueous (Ambion, UK) according to the manufacturer's instruc-
tions. Total RNA was stored at −80 °C.
First strand cDNA was synthesized from 12 μg of total RNA with a
SMART RACE cDNA Amplification kit (Clontech Laboratory Inc. Japan).
155
A 614 bp fragment was generated using RACE procedures with the
primer 5′ GTACGCTTGCGCTTTTTGTCAGC 3′ that corresponds to nt 208
to 230 of HasPOU-IV (AF231943, O'Brien and Degnan, 2000) (Table 1).
The PCR reaction mixture contained 1.5 μl cDNA, 0.1 mM of the primer,
1 μl of 50× Advantage 2 Polymerase Mix, 5 μl of 10× Advantage 2 PCR
Buffer and 0.2 mM dNTPs in a final volume of 50 μl. PCR was performed
at 94 °C (2 min), followed by 30 cycles (94 °C, 30 s; 62 °C, 30 s; 72 °C,
1 min) and an additional extension at 72 °C for 3 min on a Biometra
thermocycler.
RACE PCR products were purified by using a MiniElute Gel Extraction
Kit (Qiagen, Germany) and later cloned by the pGem-T Easy Vector Sys-
tem II (Promega, WI, USA). DNA from individual clones, obtained using
a GenElute Plasmid Miniprep Kit (Sigma, MO, USA), was double strand
sequenced by using an ABI Prism dRhodamine Terminator Cycle Se-
quencing kit (Applied Biosystems, CA, USA).
Based on the sequence, gene-specific primers were designed to carry
out the 5′and 3′RACE on SMART cDNA. These primers (Thermo Scientif-
ic Inc. Germany) are listed in Table 1. The amplification of the 3′and 5′
regions of the gene was performed following the standard RACE proto-
cols using the cycling parameters described above with an annealing
temperature of 65 °C. These products were similarly cloned and se-
quenced, and the contig was generated with the program CAP (Huang,
1992) using the BioEdit package (Hall, 1999). The full length coding se-
quence of the novel POU gene was deposited in the EMBL-EBI gene bank
with the indicated accession number FR734404. We assigned a name to
the new sequences beginning with three letters indicating the abbrevi-
ated species name (the first letter of the genus and the first two letters
of the specific epithet) and followed by POU-IV.
2.3. Alignments and phylogenetic analyses
The initial orthology of the PmaPOU-IV gene was tested by searching
homologous sequences using the Fasta option with the EBI server
(Matrix Blosum50, set at default parameters gap open = 10, gap exten-
sion = 0.1). Amino acid alignments of the deduced PmaPOU-IV protein
with homologous proteins were performed using Clustal W2.1 using
the POU-specific domain and POU homeodomain regions. The identity
between sequences was calculated as a percentage of identity
(100 × number of matches / total number of amino acids).
Phylogenetic analyses of the amino acid sequence PmaPOU-IV were
performed using a distance method, neighbor-joining (NJ) (Felsenstein,
1996; Saitou and Nei, 1987) and two character methods, maximum par-
simony (MP) (Eck and Dayhoff, 1966; Felsenstein, 1996) and maximum
likelihood (ML) (Felsenstein, 1996; Jones et al., 1992). NJ, MP and ML
methods were implemented using the MEGA5 package (Tamura et al.,
2011). The trees were inferred using the JTT model of amino acid substi-
tution and gamma distribution with eight discrete categories. The reli-
ability of the resulting evolutionary tree was tested by bootstrap
analysis using 2000 replicates. A variety of sequences for homologous
gene products and Class I, II, III, V and VI POU gene products were select-
ed for the analyses. The trees were rooted using C. intestinalis POU-like
as the outgroup.
Table 1
Oligonucleotide primer sequences and annealing temperatures.
Primer name Primer sequence 5′-3′ °C
POU-IV 5′ GTACGCTTGCGCTTTTTGTCAGC 3′ 62°C
POU RACE 3′ 5′ CTTCCTGGGGTTGGGTCCCTCAGTCAG 3′ 65°C
POU Nested 3′ 5′ GCATGGCTTGAGGAAGCTGAGAAACAAG 3′ 65°C
POU RACE 5′ 5′ GGTGTCCATGCATCTGTAACTGTTGACG 3′ 65°C
POU Nested 5′ 5′ CGTGTTTCATCATCTGTTGTGAAGATTGC 3′ 65°C
 Author's personal copy
156 V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161
2.4. Quantitative real-time PCR
Total RNA was extracted from 20 mg of individual dissected diges-
tive gland, gill (GI), male and female gonad (MG and FG, respectively),
adductor muscle, mantle (MT), cerebropedal ganglia (CPG), and
parietovisceral ganglion (VG) using NucleoSpin RNA II (Machery-
Nagel, Germany). RNA was precipitated with 0.5 volume of lithium
chloride (LiCl, 7.5 M) and then treated with 1 μl (2U) of DNase (Turbo
DNA-free, Ambion, UK) and stored at −80 °C until used. cDNA was syn-
thesized using 0.5 μg of RNA with the iScript™cDNA Synthesis kit
(BioRad Laboratories, CA, USA) according to the manufacturer's
recommendations.
For accurate relative quantification of gene expression, a normaliza-
tion using internal reference genes whose expression levels are stable
must be performed (Andersen et al., 2004; Bustin et al., 2009; Pfaffl
et al., 2004; Vandesompele et al., 2002, 2009). A total of 7 candidate ref-
erence genes: glyceraldehyde-3-phosphate dehydrogenase (gapdh), NADH
dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 7 (ndufa7), cyto-
chrome c oxidase subunit 1 (cox1), eukaryotic translation elongation factor
1 alpha (ef1a), actin (act), 40S ribosomal protein SA (rpsa), and 18S ribo-
somal RNA (18S) (Table 2), were evaluated using three software applica-
tions: NormFinder (Andersen et al., 2004), geNorm (Vandesompele
et al., 2002) and BestKeeper (Pfaffl et al., 2004). The candidate reference
genes have been previously used for the normalization of RT-qPCR data
by our research group (Mauriz et al., 2012). Primers were designed with
the program OligoAnalyzer 3.1 (Integrated DNA technologies Inc.,
http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer) from the
sequences of Table 2. Oligonucleotide primers were synthesized by
Thermo Scientific Inc (Germany). The primer sequences and amplicon
lengths are listed in Table 3. The primers used for quantitative RT-PCR
analysis of 18S were as previously reported by Dondero et al. (2005).
A quantitative real-time reverse transcription polymerase chain re-
action (RT-qPCR) was conducted in 96-well reaction plates on an iCycler
iQ® Real-time System (BioRad, CA, U.S.A.) using SsoFastTM EvaGreen
(BioRad). Non-template controls (NTC) were also included in each
run. The reaction mix contains 10 μl of 0.5 × SsoFast EvaGreen Mix,
0.4 μM per primer, and 20 ng of cDNA per 20 μl reaction. For all the anal-
yses the cycling conditions were 95 °C for 30 s, 40 cycles of 95 °C for 5 s,
60 °C for 10 s, and 10 s at 75 °C for fluorescence measurement. At the
end of each run a melting curve was performed: 95 °C for 20 s and
60 °C for 20 s followed by an increase in temperature from 60 to
100 °C (with temperature increases in steps of 0.5 °C every 10 s).
Baseline values were automatically determined for all plates using
the Bio-Rad iCycler iQ software V3.1 (IQ™ Real-Time PCR Detection Sys-
tem). In order to ensure comparability between the data obtained from
different experimental plates, the threshold value was set manually at
200 relative fluorescence units (RFU) for calculating the Cq values. To
generate the data basis for the determination of PCR amplification effi-
ciency (E) of each transcript, it is recommended to use various dilutions
in triplets of a pool of all available cDNAs (Pfaffl, 2001).
Therefore for each primer pair a standard curve was obtained based
on known quantities of cDNA (5-fold serial dilutions corresponding to
cDNA transcribed from 20 to 0.0064 ng of total RNA). Each dilution
was assayed in triplicate. PCR efficiency (defined as percentage) was
Table 2
Gene symbols, gene names and accession numbers of reference genes.
Gene symbol Gene name Accession number
ndufa7 NADH dehydrogenase (ubiquinone) HE572783
1 alpha subcomplex subunit 7
gapdh Glyceraldehyde-3-phosphate dehydrogenase DN794150
cox1 Cytochrome c oxidase subunit 1 DN793748
ef1a Eukaryotic translation elongation factor 1 alpha DN794050
rpsa 40S ribosomal protein SA HE572589
act Actin DN794215
18S 18S ribosomal RNA L49053
calculated with the Bio-Rad iQ software V3.1 from the slope of the stan-
dard curve, E = [10(−1/slope) − 1] × 100, E (%) = E × 100. The Cq values
were transformed to quantities by using the equation Q = (1 + E)−Cq.
The normalized gene expression was calculated as the ratio between Q
and the normalization factor. The normalization factor used was the
geometric mean of the quantities (Q) of the selected reference genes.
The IBM SPSS statistic 19.0 package was used to perform one-way
analyses of variances (ANOVA). Gene expression was log-transformed
(base 2) to meet the requirements of normality and homogeneity of
variances. Post hoc comparisons between tissues were carried out
with the Tukey Honestly Significant Difference (HSD) test. Differences
were considered significant when p b 0.05.
3. Results and discussion
3.1. Sequence, structure and phylogenetic analysis of PmaPOU-IV
The entire coding sequence for P. maximus POU-IV gene was isolated
by a combination of 3′ and 5′rapid amplification of cDNA ends (RACE).
3′ and 5′RACE yielded a cDNA of 1280 bp with an open reading frame
of 987 bp (329 amino acid residues). The new gene was designated
PmaPOU-IV for Pecten maximus class IV-POU. Both nucleotide and
amino acid sequences are provided in Fig. 1 (EMBL Accession number
FR734404). The derived amino acid sequence exhibits characteristic
features of POU-IV proteins. First, the new sequence includes a POU-
specific domain (POUSD) near the amino terminus of the putative
PmaPOU-IV protein between residues 167 and 244 and a POU-
homeodomain (POUHD) closed to the carboxyl terminus between resi-
due 264 and 322. The POUSD and the POUHD were separated by a short
linker region of 19 amino acids (Fig. 2). The POUS region can be
subdivided further into two highly conserved regions (A and B) which
display high identity with other POUS domains overall; these two subre-
gions are separated by a well conserved 9-amino acid sequence. Second,
within the amino-terminal end PmaPOU-IV contains a stretch of homol-
ogy, a new domain called POU-IV box, found only in the proteins of class
IV (Candiani et al., 2006). Third, the Pecten POU-IV bipartite domain has
a significant amino acid sequence identity with other members of the
POU-IV class. Finally, phylogenetic analyses confirm that PmaPOU-IV is
an orthologue of the POU-IV genes.
Searches for related sequences in public databases were performed
using the Fasta option with the EBI server. Alignment of the PmaPOU-
IV gene product with other metazoan POU class IV sequences from the
Uniprot database reveals a high level of conservation and indicates
that this scallop gene is homologue of other POU class IV genes present
in bilaterian genomes. Fig. 2 shows a comparison of 16 POU-domain se-
quences indicating the position of α-helices in the POUSD and POUHD
and residues that are invariant among those sequences.
Based on the primary sequence throughout the POU domain, the
patterns of highest conservation in the linker region separating the
POUS and POUH domains and also on phylogenetic analyses, we were
able to assign the new gene to the POU class IV family.
The POUSD is predicted to contain four helices and the POUHD is pre-
dicted to contain three helices which correspond to those of the classic
homeodomains, with the third recognition helix of the POU-domain
gene family. Both domains contain a helix-turn-helix (HTH) motif, a
structure common to a broad class of DNA-binding domains. This struc-
ture consists of two α-helices (α2 and α3) connected by a short turn.
The HTH motif is stabilized by the other two α-helices (α1 and α4) in
the POUSD, whereas in the POUHD, a single α-helix (α1) stabilizes the
HTH motif (Herr and Cleary, 1995).
PmaPOU-IV has invariant residues Leu, Glu, Phe, Ala, Phe, Lys, Gln,
Arg, Ile, Leu, Gly, Thr, Gln, Val, Gly, Arg and Leu at positions 9, 10, 12,
13, 16, 17, 18, 20, 21, 23, 24, 26, 27, 30, 31, 33 and 37, respectively, in
the POUSD-A region. Invariant residues Ser, Thr, Ile, Arg, Phe, Glu, Leu,
Leu, Ser, Asn, Met, Leu, Leu and Trp at positions 48, 49, 50, 52, 53, 54,
56, 58, 61, 63, 66, 70 and 83, respectively, in the POUSD-B region.
 Author's personal copy

V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161 157

Table 3
Primers used in this study, amplicon length (bp), efficiency (E %) and correlation coefficients (r) from the standard curves for each primer pair to estimate efficiencies.

Gene symbol Sense primer (5′-3′) Antisense primer (5′-3′) Amplicon E% r

PmaPOU-IV GTCGTACACCTGCGTTTGAGA GGTCATGTACTCCTCCTGAGA 108 105.3 0.993

ndufa7 ATTACACACGAGATGGACGCTG ACATCAGAGCTGGCTGTTTCAG 115 97.3 0.994
gapdh TCCGGATGTGTCTGTTGTTGAC TTCAGATCTCCATCAGCTGCAC 102 94.8 0.998
cox1 AGTGGAGAACTATTGGGTGTGC AGACCTAGGCCGATTTCCAAAC 119 94.8 0.991
ef1a AGGGCTCCTTCAAGTATGCCTG TGAGCGGTCTCGAACTTCCAC 100 88.9 0.99
rpsa CTGGTCCGCAGCAGCTCCAG ATGCCTATCCCCAGTTGTCAG 131 86.1 0.993
act TGTAGCCGCTTTGGTTGTAGAC TGTCCCATACCAACCATCACAC 135 94.4 0.991
18S TCGATGGTACGTGATATGCC CGTTTCTCATGCTCCCTCTC 84 93.4 0.992

POU homeobox domains are more closely related to each other than
to other homeodomains (Bürglin, 2011; Mesías-Gansbiller et al., 2012).
The carboxy-terminal subregion is extremely well conserved among
homeoboxes. However, in contrast to other homeodomains, in the
PmaPOU-IV homeodomain the ninth residue of the DNA-recognition
helix (α3) is a cysteine; this Cys50 is unique to the POU class of homeo-
boxes. Gln54, which interacts with an adenine base in the DNA, is one of
the most highly conserved in the POU family, and also distinguishes
POUHD from conventional homeodomains (Phillips and Luisi, 2000).
In these highly conserved POU-specific domain and homeodomain,
PmaPOU-IV was 67% similar to the C. elegans unc-86 protein and was
most similar to molluscan sequences, with the C. gigas being iPOU 98%
similar and the H. asinina POU-IV being 96% similar. Furthermore, in
terms of amino acid identity the PmaPOU-IV gene is less close to
human, mouse, rat, chicken and Xenopus POU-IV genes (86–89%),
followed by the ascidian C. intestinalis (83%) and amphioxus (82%).
Comparison of the nucleotide sequence of PmaPOU-IV gene with
other molluscan POU specific regions reveals that it has been conserved
at the amino acid level but not as well conserved at the nucleotide level,
especially the sequence coding non-POU domains regions (73% identity
with Cgi-iPOU and 69% identity with HasPOU-IV). This comparison sug-
gests that the POU-specific regions have been conserved through func-
tional constraints on the protein products.
The orthology assignment of the Pecten POU gene was also con-
firmed by phylogenetic analyses by the maximum likelihood (Fig. 3),
neighbor-joining and maximum parsimony methods (supplementary
material). The reliability of the resulting evolutionary tree was tested
by bootstrap analysis using 2000 replicates. The major groups of pro-
teins are well supported by high bootstrap values, as well as the cluster-
ing of PmaPOU-IV with other POU-IV proteins. PmaPOU-IV gene groups
into a single clade with other POU-IV genes with strong bootstrap values
(ML bootstrap values 89%, MP and NJ, 97%) in all trees (Fig. 3 and sup-
plemental figures). PmaPOU-IV is also placed into the same clade with
the molluscan POU-IV sequences albeit with moderate support (ML,
52%), indicating the antiquity of this gene class within the larger
multigene families.

3.2. Expression of PmaPOU-IV in P. maximus

Using specific primers, we have determined by RT-qPCR amplifica-

Fig. 1. Nucleotide sequence and predicted amino acid sequence of PmaPOU-IV gene. Aster-
isk denotes the end of the 3′ translated region of the gene. Gray boxes indicate POUSD,
POUHD and POU-IV box. Nucleotide and amino acid numbering are to the right.
tion whether PmaPOU-IV transcripts were present in a variety of adult
tissues. In the selection of reference genes geNorm (Table 4) ranks
ndufa7, gapdh, ef1a and cox1 as the most stable genes, the NormFinder
results (Table 4) were similar although in different order (ef1a, ndufa7,
cox1 and gapdh). High coefficient of correlation (r) of Cq values to the
BestKeeper index and low SD of Cq values are characteristic of stable
reference genes (Pfaffl et al., 2004). BestKeeper index is the geometric
mean of candidate reference gene Cq values. The genes with higher cor-
relation coefficients with BestKeeper Index were ef1a, ndufa7 and
gapdh, while cox1 Cq values showed the lowest SD (Table 4). Therefore
ndufa7, gapdh, ef1a and cox1 were selected as the best reference genes
for normalization. In P. maximus (Mauriz et al., 2012) ndufa7, rpsa and
ef1a were the most stable genes in ovary and 18S, ndufa7 and gapdh in
testis. The normalized expression levels of PmaPOU-IV in adult tissues
are shown in Fig. 4. The highest expression levels of POU-IV gene were
found in both gill and mantle from adult specimens. A moderate expres-
sion was observed in ovary and parietovisceral ganglion with similar ex-
pression profiles. PmaPOU-IV was also expressed in both cerebropedal
ganglia and male gonad and it presented a negligible expression in the
digestive gland and muscle. PmaPOU-IV transcripts were about 15 to
25-fold more abundant in gill and mantle than in female gonad or
 Author's personal copy

158 V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161

Fig. 2. Alignment of derived amino acid sequences of Pecten maximus POU-IV gene with other known POU-IV metazoan sequences. The position of POU subdomains, POUSD, POUHD, and
POU-IV box are indicated as well as the linker region between POUSD and POUHD. Dots indicate invariant residues and dashes represent gaps. Boxes indicate the positions of the α-helices
within the POU domains. Taxa abbreviations were mentioned above in Fig. 1.

parietovisceral ganglion. Statistical analysis showed that significant dif- and mantle than in the other tissues (p b 0.05). Expression in female
ferences existed in the expression of POU-IV in different tissues of gonad and visceral ganglion did not differ significantly from the expres-
P. maximus. The expression of POU-IV was significantly higher in gill sion in the male gonad and cerebropedal ganglion.
 Author's personal copy

V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161 159

hPOUIV
89
rPOUIV
71
mPOUIV
52
XtrPOUIV
TniPOUIV
HasPOUIV

52 PmaPOUIV
CgiPOU
DrePOUIV
GgaPOUIV
BfrPOUIV
CinPOUIV

89 75
Dmei-POU
CquPOUIV
PhuPOUIV
unc-86

95 oct-1
oct-2
ceh-18
ceh-6

79 brn-1
brn-2

99 oct-3/4
POU5F1
pit-1

95 Brn-5
RPF-1
CinPOU-like

0.5

Fig. 3. Phylogenetic analysis of PmaPOU-IV by the maximum likelihood method. Representative sequences from metazoans were selected for comparison. Alignment of selected sequences
was constructed by Clustal W2.1 and phylogenetic analyses were conducted in MEGA5. The tree was constructed using sequences from the POUSD, linker region and POUHD. Pecten se-
quence is marked in gray. Numbers on the branches indicate bootstrap support value (only indicated when N50). Taxa abbreviations are Bfl, Branchiostoma floridae (amphioxus); Cin,
Ciona intestinalis; Cgi, Crassostrea gigas; Cqu, Culex quinquefasciatus; Dre, Brachydanio rerio; Dme, Drosophila melanogaster; Has, Haliotis asinina; Gga, Gallus gallus; h, human; m, mouse;
Pma, Pecten maximus; Phu, Pediculus humanus; r, rat; Tni, Tetraodon nigrovidis; Xtr, Xenopus tropicalis. Unc-86 is from C. elegans.

Although there is extensive knowledge about the role of the POU-IV
gene in ecdysozoan and deuterostome organisms, there have been only
a few reports of these genes and their expression in lophotrochozoan as
molluscs. The expression patterns for POU genes have been previously
described in the cephalopod L. pealeii and in the gastropod H. asinina
where they could be involved in the development of the central nervous
system and various sensory organs. rpf-1, a POU class VI gene is
expressed in the developing and adult stellate ganglion of the squid
Loligo pealeii, a cluster of neurons that innervates the muscles of the
mantle (Burbach et al., 2001). In the gastropod Haliotis HasPOU-III tran-
scripts were detected in the epipodial fringe, tentacle, eye, gill and mus-
cle. HasPOU-IV was expressed in the cerebral and pleuropedal ganglia.
HasPOU-IV was also expressed in the fringe, eye, tentacle and gill but
was undetectable in the gut, gonad, muscle or digestive gland (O'Brien
and Degnan, 2000, 2002a). The Pecten orthologue was also expressed
in several sensory tissues (like mantle/eye and gills) but was undetect-
able in muscle and digestive gland as in the case of HasPOU-IV; however
PmaPOU-IV was detectable in female and male gonad.
These data agree with a number of other studies in several inverte-
brate species where the POU-IV genes are expressed in the central ner-
vous system and several sensory tissues. Ci-POU-IV is expressed in the
precursor cells of the neural system during development and in the lar-
vae of the ascidian C. intestinalis (Candiani et al., 2005) and in C. elegans
unc-86 is expressed in sensory and motor neurons (Finney and Ruvkin,
1990). In amphioxus AmphiPOU-IV is expressed in the neural tube and
epidermal sensory neural cells during development (Candiani et al.,
 Author's personal copy

160 V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161

Table 4
Ranking of candidate reference genes in Pecten maximus.

Rank geNorm average M NormFinder stability BestKeeper r BestKeeper SD Global

1 ndufa7/gapdh 0.628 ef1a 0.440 ef1a 0.912 cox1 0.50 ndufa7

2 ndufa7/gapdh 0.628 ndufa7 0.571 ndufa7 0.831 18S 0.84 ef1a
3 ef1a 0.943 cox1 0.612 gapdh 0.810 ndufa7 1.06 gapdh
4 cox1 1.164 gapdh 0.762 rpsa 0.748 ef1a 1.21 cox1
5 rpsa 1.329 18S 0.880 act 0.562 gapdh 1.31 rpsa
6 18S 1.423 rpsa 0.919 cox1 0.489 act 1.48 18S
7 act 1.557 act 1.111 18S 0.303 rpsa 1.60 act

Fig. 4. Expression of PmaPOU-IV gene by RT-qPCR analysis in adult tissues. Box-and-
whisker plots show the normalized expression levels of PmaPOU-IV based on RT-qPCR
analysis, gene in gill (GI), female gonad (FG), male gonad (MG), cerebropedal ganglia
(CPG), parietovisceral ganglion (VG) and mantle (MT). Differences were considered sig-
nificant when p b 0.05.
2006). NeoBrn-3 from the acoela N. fusca is expressed in neurons in the
brain (Ramachandra et al., 2002).
The expression patterns of those invertebrates support the hypothe-
sis that the ancestral role for class IV POU genes is in the development of
the sensory cells and neuronal differentiation where they could function
as transcriptional activators or as repressors. Our findings also support
the belief that POU class IV genes involved in the terminal neuronal dif-
ferentiation are still operating in the adult nervous system. This is the
first report of the characterization and study of expression of a POU
gene in bivalve molluscs.
Acknowledgments
We are very grateful to Arturo Silva for providing the samples and
to John Souto for helpful comments on the English version of the
manuscript. [SS]
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.jembe.2014.01.013.
References
Agarwal, V.R., Sato, S.M., 1991. XLPOU 1 and XLPOU 2, two novel POU domain genes
expressed in the dorsoanterior region of Xenopus embryos. Dev. Biol. 147, 363–373.
Andersen, B., Rosenfeld, M.G., 2001. POU domain factors in the neuroendocrine system:
lessons from developmental biology provide insights into human disease. Endocr.
Rev. 22, 2–35.
Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantitative re-
verse transcription-PCR data: a model-based variance estimation approach to
identify genes suited for normalization, applied to bladder and colon cancer data
sets. Cancer Res. 64, 5245–5250.
Bassaglia, Y., Buresi, A., Franko, D., Andouche, A., Baratte, S., Bonnaud, L., 2013. Sepia
officinalis: a new biological model for eco-evo-devo studies. J. Exp. Mar. Biol. Ecol.
447, 4–13.
Beninger, P.G., Le Pennec, M., 2006. Structure and function in scallops. In: Shumway, S.E.,
Parsons, G.J. (Eds.), Scallops: Biology, Ecology and Aquaculture. Elsevier, Amsterdam,
pp. 126–198.
Billin, A.N., Cockerill, K.A., Poole, S.J., 1991. Isolation of a family of Drosophila POU domain
genes expressed in early development. Mech. Dev. 34, 75–84.
Burbach, J.P.H., Hellemons, A.J.C.G.M., Hoekman, M., Grant, P., Pant, H.C., 2001. The stellate
ganglion of the squid Loligo pealeii as a model for neuronal development: expression
of a POU Class VI homeodomain gene rpf-1. Biol. Bull. 201, 252–254.
Bürglin, T.R., 2011. Homeodomain subtypes and functional diversity. Sub-Cell. Biochem.
52, 95–122.
Bürglin, T.R., Finney, M., Coulson, A., Ruvkun, G., 1989. Caenorhabditis elegans has scores of
homeobox containing genes. Nature 341, 239–243.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan,
T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C., 2009. The MIQE guidelines —
minimum information for publication of quantitative real-time PCR experiments. Clin.
Chem. 55, 611–622.
Candiani, S., Pennati, R., Oliveri, D., Locascio, A., Branno, M., Castagnola, P., Pestarino, M.,
De Bernardi, F., 2005. Ci-POU-IV expression identifies PNS neurons in embryos and
larvae of the ascidian Ciona intestinalis. Dev. Genes Evol. 215, 41–45.
Candiani, S., Oliveri, D., Parodi, M., Bertini, E., Pestarino, M., 2006. Expression of
AmphiPOU-IV in the developing neural tube and epidermal sensory neural precursors
in amphioxus supports a conserved role of class IV POU genes in the sensory cells de-
velopment. Dev. Genes Evol. 216, 623–633.
Certel, S.J., Clyne, P.J., Carlson, J.R., Johnson, W.A., 2000. Regulation of central neuron
synaptic targeting by the Drosophila POU protein, Acj6. Development 127,
2395–2405.
Dondero, F., Piacentini, L., Banni, M., Rebelo, M., Burlando, B., Viarengo, A., 2005. Quanti-
tative PCR analysis of two molluscan metallothionein genes unveils differential ex-
pression and regulation. Gene 345, 259–270.
Eck, R.V., Dayhoff, M.O., 1966. Atlas of Protein Sequence and Structure. National Biomed-
ical Research Foundation, Silver Springs, Maryland.
Felsenstein, J., 1996. Inferring phylogenies from protein sequences by parsimony, distance
and likelihood methods. Methods Enzymol. 266, 418–427.
Finney, M., Ruvkin, G., 1990. The unc-86 gene product couples cell lineage and cell iden-
tity in Caenorhabditis elegans. Development 121, 3405–3416.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.
Hedgecock, D., Gaffney, P.M., Goulletquer, P., Guo, X., Reece, K., Warr, G.W., 2005.
The case for sequencing the Pacific oyster genome. J. Shellfish Res. 24 (2),
429–441.
Herr, W., Cleary, M.A., 1995. The POU domain: versatility in transcriptional regulation by a
flexible two-in-one DNA-biding domain. Genes Dev. 9, 1679–1693.
Herr, W., Sturm, R.A., Clerc, R.G., Corcoran, L.M., Baltimore, D., Sharp, P.A., Ingraham, H.A.,
Rosenfeld, R.G., Finney, M., Ruvkun, G., Horvitz, H.R., 1988. The POU domain: a large
conserved region in the mammalian pit-1, oct-1, oct-2 and Caenorhabditis elegans unc-
86 gene products. Genes Dev. 2, 1513–1516.
Huang, X., 1992. A contig assembly program based on sensitive detection of fragment
overlaps. Genomics 14, 18–25.
Johansen, T., Moens, U., Holm, T., Fjose, A., Krauss, S., 1993. Zebrafish pou[c]: a divergent
POU family gene ubiquitously expressed during embryogenesis. Nucleic Acids Res.
21, 475–483.
Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation data ma-
trices from protein sequences. CABIOS 8, 275–282.
Latchmann, D.S., 1999. POU family transcription factors in the nervous system. J. Cell.
Physiol. 179, 126–133.
Mauriz, O., Maneiro, V., Pérez-Parallé, M.L., Sánchez, J.L., Pazos, A.J., 2012. Selection of ref-
erence genes for quantitative RT-PCR studies on the gonad of the bivalve mollusc Pec-
ten maximus L. Aquaculture 370–371, 158–165.
Mesías-Gansbiller, C., Sánchez, J.L., Pazos, A., Lozano, V., Martínez-Escauriaza, R., Pérez-
Parallé, M.L., 2012. Conservation of Gbx genes from EHG homeobox in bivalve mol-
luscs. Mol. Phylogenet. Evol. 63, 213–217.
Nakanishi, N., Yuan, D., Hartenstein, V., Jacobs, D.K., 2010. Evolutionary origin of rhopalia:
insights from cellular-level analyses of Otx and POU expression patterns in the devel-
oping rhopalial nervous system. Evol. Dev. 12, 404–415.
O'Brien, E.K., Degnan, B., 2000. Expression of POU, Sox and Pax genes in the brain ganglia
of the tropical abalone Haliotis asinina. Mar. Biotechnol. 2, 545–557.
 Author's personal copy
V. Lozano et al. / Journal of Experimental Marine Biology and Ecology 453 (2014) 154–161
O'Brien, E.K., Degnan, B., 2002a. Developmental expression of a class IV POU gene in the
gastropod Haliotis asinina supports a conserved role in sensory cell development in
bilaterians. Dev. Genes Evol. 212, 394–398.
O'Brien, E.K., Degnan, B., 2002b. Pleiotropic developmental expression of HasPOU-III, a
class III POU gene in the gastropod Haliotis asinina. Mech. Dev. 114, 129–132.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res. 29 (9), e45.
Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable
housekeeping genes, differentially regulated target genes and sample integrity:
BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26,
509–515.
Phillips, K., Luisi, B., 2000. The virtuoso of versatility: POU proteins that flex to fit. J. Mol.
Biol. 302, 1023–1039.
Ramachandra, N.B., Gates, R.D., Ladurner, P., Jacobs, D.K., Hartenstein, V., 2002. Embryonic
development in the primitive bilaterian Neochildia fusca: normal morphogenesis and
isolation of POU genes Brn-1 and Brn-3. Dev. Genes Evol. 212, 55–69.
161
Ryan, A.K., Rosenfeld, M.G., 1997. POU domain family values: flexibility, partnerships, and
developmental codes. Genes Dev. 11, 1207–1225.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molec-
ular evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman,
F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol. 3 (RESEARCH0034).
Vandesompele, J., Kubista, M., Pfaffl, M.W., 2009. Reference gene validation software for
improved normalization. In: Logan, J., Edwards, K., Sauders, N. (Eds.), Real Time PCR
Current Technology and Applications. Caister Academic Press, London, pp. 47–64.
Zhang, G., Fang, X., Guo, X., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., et al., 2012.
The oyster genome reveals stress adaptation and complexity of shell formation.
Nature 490, 49–54.