MASTER VCE 3/4 BIOLOGY

LESSON 9: BOOKLET
DNA MANIPULATION PART 2

1
 VCAA STUDY DESIGN OUTLINE

DNA manipulation Part I – Already explored in previous booklet

Dot point 1: The use of enzymes to manipulate DNA, including polymerase to synthesise
DNA, ligase to join DNA and endonucleases to cut DNA

Molecular Biology Enzymes

o DNA Polymerase
§ How DNA is normally synthesised QUICK REVIEW
§ Detail a few other ways DNA can be synthesised (Reverse
Transcriptase) and very brief introduction to DNA sequencing
o DNA vs RNA Polymerase
o DNA ligase
o Restriction enzymes (endonucleases)
§ Discuss the function
§ The purpose
§ Also discuss the number of cuts required to insert a DNA fragment into
a linear vs. a circular piece of DNA

Dot point 2: The function of CRISPR-Cas9 in bacteria and the application of this function in
editing an organism’s genome

CRISPR-Cas9
o Source of CRISPR-Cas9
o Discovery
o Function
o Applications

Include an activity contrasting the action of CRISPR-Cas9 vs. endonucleases

2
 DNA manipulation Part II

Dot point 3: Amplification of DNA using polymerase chain reaction and the use of gel
electrophoresis in sorting DNA fragments, including the interpretation of gel runs for DNA
profiling

PCR
o Components
o Set-up
o Steps involved
o Applications

Gel Electrophoresis
o Components
o Set-up
§ Discuss why all components/set-up features are required
§ What would go wrong if features were faulty/removed
o Steps involved
o Basic interpretations
o Discuss what an STR is (Short-Tandem Repeat) => With very interactive
activities to help with understanding
o Applications = Intertwine interpretations with applications

Dot point 4: The use of recombinant plasmids as vectors to transform bacterial cells as
demonstrated by the production of human insulin

Recombinant plasmids
o What they are
o How they are formed (step-by-step)
o Step-by-step breakdown of human insulin production

Dot point 5: The use of genetically modified and transgenic organisms in agriculture to
increase crop productivity and to provide resistance to disease.

GMO (Genetically Modified Organisations)

o Include example

GEO/TGO (Transgenic Organisms)

o Include example

3
 GMO vs GEO/TGO (Brief contrast between the two)

Applications of GMO & TGO:

§ Increased crop productivity = Golden Rice
§ Provide resistance to disease = Bt Cotton

Copyright notice

The booklet and its content is the copyright of Novicate Academy © All rights reserved.

Any redistribution or reproduction of part or all of the contents in any form is prohibited
other than the following:

• You may print or download the booklet for your personal and non-commercial
use only if you are a VCE 3/4 Biology student of Novicate Academy or have
purchased the booklets from Novicate Academy.

You may not, except with our express written permission, distribute or commercial
exploit the content.

We acknowledge that several diagrams in the booklet have been sourced from online
mediums. Where these diagrams were not produced directly by Novicate Academy we
ensured to acknowledge the source of the diagram. To our best interest these diagrams
are not copyrighted. Any diagrams not containing a source reference were produced
authentically by Novicate Academy.

4
 LESSON OUTLINE

¨ PCR
o Components
o Set-up
o Steps involved
o Applications
¨ Gel Electrophoresis
o Components
o Set-up
o STRs (Short-Tandem-Repeats)
o Applications for paternity testing and forensics
¨ Recombinant plasmids
o What they are
o How they are formed (step-by-step)
o Applications for human insulin production
¨ GMO
¨ TGO
¨ Applications of TGO
o To increase crop productivity - Golden Rice
o To introduce resistance to disease – Bt Cotton

5
 RELEVANCE TO VCAA STUDY DESIGN:

Amplification of DNA using polymerase chain reaction and the use of gel
electrophoresis in sorting DNA fragments, including the interpretation of gel runs for
DNA profiling

DNA Amplification Using PCR

Polymerase chain reaction (PCR) is a technique which amplifies DNA through a 3-stage temperature
cycling process. It makes large numbers of copies from a small original sample. DNA amplification is
often used prior to other techniques in order to produce sufficient DNA to work with. For example, PCR
is required to obtain sufficient amounts of DNA for gel electrophoresis.

Think of the PCR process like a PHOTOCOPIER, only instead of paper we are copying DNA!

PCR involves replicating DNA in a similar fashion to DNA replication in cells.

There are several reactants that need to be placed into a PCR tube prior to starting the process.

Reactant Why is this reactant needed?

• This is the original piece of DNA that is being copied via

DNA Template
the PCR process.
• These are the nucleic acid ‘building-blocks’ used to
Nucleotides
assemble the new strands of DNA.

• These are short pieces of DNA that are complementary

Primers to the ends of the DNA template segments.
• They provide an attachment site for DNA polymerase

• This is a specific type of DNA polymerase from a type of

thermophilic bacteria (Taq – Thermus Aquaticus -
Taq Polymerase Lives in a hot environments)
• The enzyme is selected as it does not enzymatically
denature under high temperatures.

Exam Tip: Remember all 4 reactants as you can expect questions asking you about PCR in great detail

6
 FUN FACT! PCR was developed in 1983 by Kary B. Mullis, an American biochemist who won the
Nobel Prize for Chemistry in 1993 for his work

Here is an example of a PCR machine.

As one of the most common processes
used in biomedical research, you can
expect to find these in most labs!

Source: https://www.ck12.org/biology/pcr/lesson/The-Polymerase-Chain-Reaction-Advanced-BIO-ADV/

PCR Preparation and Set Up

PCR is a repeating process involving the following three main steps.

Denaturing Annealing Extension

STEP 1: Denaturation

• The four reactants are combined, and the solution is raised to a temperature of 95ºC.
• This breaks the hydrogen bonds holding the strands together to separate the DNA sample needs
to be separated into two single strands.
• Any DNAse enzymes will be denatured.

STEP 2: Annealing
• Primers bind to a complementary sequence at the 3’ ends of the template DNA at a temperature
of 55 ºC.

NOTE: You need 2 primers for either side of the DNA as by starting with a dsDNA molecule, you will
have 2 complementary DNA sequences. As these sequences differ, they require different primers.

7
STEP 3: Extension

• Taq polymerase synthesises new strands in a 5’ to 3’ direction at a temperature of 72 ºC.

NOTE: A supply of ‘free’ nucleotides must be available in order for this step to occur!

Source: https://ib.bioninja.com.au/standard-level/topic-2-molecular-biology/27-dna-replication-transcri/pcr.html

AFTER: REPEAT THE CYCLE

• This amplifies the original DNA fragment using PCR principles

Source: https://www.researchgate.net/figure/The-exponential-amplification-of-DNA-in-PCR_fig4_236065209

8
It takes approximately 5 minutes for one PCR cycle to occur, doubling the DNA each time. This process
can be repeated multiple times to obtain many copies of the DNA of interest.

Summary of major points required to know for PCR

o 3 stages of PCR (their names and their roles)

o The 3 temperatures in PCR
o The 4 reactants
o Biomolecular applications of PCR

If you would like to further explore the PCR process watch the great educational/interactive
resource video - https://learn.genetics.utah.edu/content/labs/pcr/

9
PCR Applications

The PCR process is commonly used for a wide variety of applications including genotyping, mutation
detection, sequencing, forensics and paternity testing.

Let’s have a look now at one of the most popular PCR applications, genotyping!

Source: https://www.practicallyscience.com/introduction-to-pcr-and-animal-genotyping/

PCR is used to amplify specific sequences. This is achieved by designing two primers to flank a
particular DNA region of interest.

With sufficient DNA copies produced, these are then run on gel electrophoresis and any size differences
(because of changes to DNA sequence) can be easily detected.

NOTE: If the target gene is expressed by the cell or organism DNA amplification will occur. If the
gene is not expressed, then the primer will NOT bind to the DNA and so PCR will NOT OCCUR!

Before moving on to our next topic, let us consolidate our understanding of PCR. To do this, fill in the
missing labels on the diagram below.

Nucleotide

Annealing

Primase

Template

10
 Gel Electrophoresis
Gel electrophoresis is a process mainly used to sort biological molecules such DNA, RNA or proteins
based on two major properties:
• Size
• Electric charge
Gel electrophoresis has many vital scientific applications; including DNA fingerprinting and the detection
of genetic variants involved in health and disease. This process is even used to help solve crimes, identify
bodies in natural disasters…how cool is that!

Components of gel electrophoresis

Gel electrophoresis involves using an electrical field to separate fragments based on size and charge.
This field is typically generated in an electrophoretic chamber (a hard plastic tank), known as a gel box.

Cathode (-)

Anode (+)
Source: https://www.aatbio.com/catalog/gel-electrophoresis

A gel box is a buffer-filled container which has both a cathode (negative (-) terminal) at one end, an
anode (positive (+) terminal) at the opposite end, and an external power source.

The gels (jelly plates) that are submerged in the buffer act both an anti-convective and sieving medium
to separate different sized fragments. Samples are always loaded into the wells of the gel, located near
the anode (+ terminal).

NOTE: The most common material used to create the gel is agarose gel. This material is isolated
from the seaweed genera Gelidium and Gracilaria and consists of repeated agarobiose sub-units.

11
To summarise the key components required for gel electrophoresis fill in the table below.

Component Why this component is needed?

• Most commonly made of agarose.

• Contains a series of wells at the cathode end.
Gel Plate
• Acts as a sieving and anticonvective medium to separate
fragments by size.
• An electrophoretic chamber in which the gel plate is
Gel Box
submerged within a buffer solution.

• Loaded into the wells of the gel using a pipette.

DNA samples • Samples are combined with a DNA loading dye to allow
for visualisation under UV light.

• Connected to the gel box to apply an electric field to the

Power Supply buffer solution.
• DNA is attracted to the positive end of the gel.

• Simple salt solution.

Buffer Solution • Facilitates the separation of fragments by transmitting
the charge through the gel.

Identify each of the key components on the diagram below.

Power Supply
Gel Plate

Wells

Source: https://www.yourgenome.org/facts/what-is-gel-electrophoresis

Buffer Electrophoresis tank

solution

12
How gel electrophoresis works?
Once the experiment is set up and an electrical charge is applied to the gel box, charged molecules move
through the gel and can be separated according to size. This is known as migration.

NOTE: DNA is negatively charged, therefore, when an electric current is applied to the gel, DNA
will always migrate towards the positively charged electrode.

As shorter strands of DNA move more quickly through the gel than longer strands, fragments can be
arranged by size. Specifically, smaller molecules migrate faster and travel further than larger fragments
that migrate slower and therefore, travel a shorter distance.

Gel plate sieving mechanism

r t o le c ture
Refe
e c or d in g
r

13
Gel electrophoresis output

• Gel bands = bands on gel electrophoresis representing DNA of different sizes

• Gel run = Gel electrophoresis column
• DNA ladder = continuous/vertical gel run/column allowing experimenter to determine size of
gel bands in the same horizontal line

Looking at the DNA bands on the following gel plate, can you identify the largest sample? Why?

Source: https://www.yourgenome.org/facts/what-is-gel-electrophoresis

14
 Let’s now have a go setting up our own gel electrophoresis experiment.

Draw a line between each number and a set-up step to show your understanding of this process.

1 Allow fragments to move through agarose gel according to size.

2 Combine the DNA samples with a loading dye.

3 Observe DNA fragments as bands under UV light.

4 Place the dyed DNA samples in the wells at the end of the gel.

5 Immerse the agarose gel in a buffer solution within the gel box.

6 Expose the agarose gel to an electric field.

NOTE: The most common material used to create the gel is agarose gel. This material is isolated
from the seaweed genera Gelidium and Gracilaria and consists of repeated agarobiose sub-units.

Now that you understand the essential components of gel electrophoresis, can you think of what
may go wrong if these features were faulty or removed? Common errors have been listed below.

• Sample contamination = Incorrect results/DNA bands

• Insufficient sample = DNA bands to faint

• Incorrect current direction = DNA will not migrate through gel

• Improper gel setting = Results in unsteady migration

15
Using DNA for identification

Gel electrophoresis is commonly used to identify individuals or biological species, such as in forensics
or paternity testing. Both nuclear and mitochondrial DNA can be used for identification; however, their
use depends on the presence of segments of DNA that vary greatly between individuals. These DNA
regions are known as hypervariable regions and include short tandem repeats (STRs).

NOTE: STRs are short repeated DNA sequences found within chromosomes. They are termed
‘short’ as they are only 2-5 base pairs long and ‘tandem’ as they occur one after the other.

For example: Locate the STR in this sequence below

CCTATTTAGTAGTAGTAGGGAGGTTTCGACTAC

Getting back to DNA profiling, the beauty of these STRs is two things:
• They are shared amongst the genome of people worldwide
• Any given STR is hypervariable, which means that the number repeats in one individual with
the same STR sequence is likely to be different to someone else who is not directly related.

This idea is illustrated in the diagram below. 3 individuals share the same STR sites, but each have a
different number of repeats in each. This means that the 3 individuals are unrelated.

Source: https://ib.bioninja.com.au/standard-level/topic-3-genetics/35-genetic-modification-and/dna-profiling.html

16
STR analysis is a common technique used to compare allele repeats at a specific locus in DNA between
two or more samples. As the number of repeats of an STR marker varies greatly between individuals,
identifying the number of repeats on a person’s chromosome allows for unique identification.

NOTE: At each STR locus, a person is either homozygous (two of the same alleles) or heterozygous
(two different alleles). Remember an ‘allele’ is a variant form of the same gene.
.

17
 RELEVANCE TO VCAA STUDY DESIGN:

The use of recombinant plasmids as vectors to transform bacterial cells as demonstrated

by the production of human insulin

Recombinant Plasmids
A plasmid is a small, circular, double-stranded DNA molecule that is separate from a cell's chromosomal
DNA. Plasmids naturally exist in bacterial cells; however, can also occur in some funky eukaryotes. Genes
carried on plasmids often provide an accessory survival advantage (Eg: antibiotic resistance) and
contrary to chromosomal genes which code for proteins which are vital for the function of an organism.

Plasmid Bacterial DNA

NOTE: All plasmids are self-
replicating, containing an origin
of replication (ORI). This means
they can replicate independently
of the main bacterial
chromosome.
Source: https://blog.edvotek.com/2020/02/27/taking-transformation-to-the-next-level-with-colony-pcr-2/

Recombinant plasmids: Genetically manipulated plasmids which contain foreign DNA.

These plasmids are not naturally occurring plasmids. These plasmids are constructed by scientists to
contain foreign DNA as well as specific features that make them ideal for laboratory use.

18
 Plasmid Feature Function

• Recognised by cell’s own DNA replication proteins.

Origin of Replication • Allows for initiation of new DNA synthesis.

• Located upstream of target genes.

Promoter region
• Determines where and when a gene is expressed.

• Markers used to distinguish between different

bacteria or cell types.
Selectable marker
• Examples include antibiotic resistance genes and
green fluorescent protein (GFP).
• Used to confirm that the plasmid is recombinant.
Screening/Reporter marker • An example includes Blue-White Screening method
using the lacz gene.
• Contains multiple endonuclease cut sites.
Multiple cloning site • Allows plasmids to act as a vector to insert DNA into
another cell.

19
Making Recombinant Plasmids
The formation of a recombinant plasmid involves two important enzymes; endonucleases (cut the DNA)
and DNA ligases (join the DNA). It occurs in the following 3 steps.

Fragment joined with

DNA fragment mixed
Initial plasmid cut plasmid DNA - forms
with plasmid
recombinant plasmid

Source: https://blog.addgene.org/topic/plasmids/page/3

NOTE: Foreign DNA fragments are prepared using the same endonuclease used to cut the plasmid.
This is important to ensure that the DNA fragment has sticky ends complementary to the cut plasmid.

This process is not 100% effective. What you’re left with is a sample of successfully produced
recombinant plasmids and some non-recombinant plasmids.

The next steps are to expose this plasmids sample (which has both recombinant and non-recombinant
plasmids) to bacteria that can actually uptake them.

20
Making Bacteria that can take up Recombinant Plasmids - Competent Bacteria

Bacterial transformation is the process by which bacteria are exposed to a DNA vector/foreign DNA and
take-it up and express it as their own genome. This process requires the production of competent cells.
Experimentally competent cells are produced by the use of:

• Heat shock – increase in temperature then rapid decline in temperature to increase the
membrane fluidity of bacterial membranes, increasing the chance of successful transformation.

• Electroporation works by a somewhat similar mechanism but uses electrical charge instead.

After competent bacteria are produced, the sample of plasmids (with both recombinant and non-
recombinant plasmids) are exposed to the bacteria. Some bacteria take it up, some do not. Your task
then is to determine:
• Which bacteria were successfully transformed = Took up a plasmid
• Which bacteria have the desired recombinant plasmid = Took up the recombinant Plasmid

After competent bacteria are produced, the sample of plasmids (with both recombinant and non-
recombinant plasmids) are exposed to the bacteria. Some bacteria take it up, some do not. Your task
then is to determine:
• Which bacteria took up a plasmid = Using a selectable marker (eg: antibiotic resistant gene)
• Which bacteria took up the desired recombinant plasmid = Using a screening/reporter
gene (eg: LacZ gene – culture bacteria on Xgal medium and look for blue-white colonies. Blue
means non-recombinant, white means desired recombinant).

Source: https://www.biologyexams4u.com/2020/11/puc-vector-features-selectable-markers.html

21
Human Insulin Production

One of the most common uses of recombinant proteins is for the synthesis of human insulin, a life-
saving hormone used in the treatment of diabetes. Today, if the beta cells of the human pancreas fail to
produce insulin, recombinant human insulin can substitute for the missing hormone.

FUN FACT! Recombinant human insulin (known as Humulin) was first produced in the 1980’s by
the American drug company Eli Lily. In 1982 it was approved by the FDA for human use!

Let’s take a closer a look at the life-saving application and the breakdown of Humulin production!

Source: https://ib.bioninja.com.au/standard-level/topic-3-genetics/35-genetic-modification-and/gene-transfer.html

22
This process of gene transfer can be summarised in four key steps.

1. Production of human insulin gene

• The insulin gene is produced through using reverse transcription

2. Digestion of gene and vector (mixing)

• The insulin gene and plasmid are cut by an endonuclease to form sticky ends.

3. Producing recombinant plasmids

• The insulin gene is inserted into the cut plasmid using DNA Ligase.
• This produces recombinant plasmids.

4. Production of recombinant bacteria

• Competent bacteria are produced either by ‘heat-shock’ or ‘electroporation.

• The recombinant plasmid are exposed to the competent bacteria- Producing transformed
bacteria.
• Transformed bacteria are cultured in a fermentation tank
o Small scale = Culture on petri dish
o Large-scale = Culture in fermentation tank

5. Extraction and purification of human insulin

• Recombinant bacteria produce human insulin as plasmid DNA is expressed.
• Extracted insulin is purified for use as a medical treatment for patients with diabetes.

23
 RELEVANCE TO VCAA STUDY DESIGN:

The use of genetically modified and transgenic organisms in agriculture to increase

crop productivity and to provide resistance to disease.

Genetically Modified Organisms (GMOs)

GMOs are organisms whose genomes have been altered using genetic engineering technology. These
organisms have novel combinations of genes that do not occur in their species natural population.

Transgenic Organisms
Transgenic organisms are a subgroup of GMOs including those in which the genetic alteration involves
the genetic material of another species.

G MO

TGO

NOTE: All transgenic organisms are GMOs but not all GMOs are transgenic organisms!

TIP: When identifying a transgenic organism, it is useful to ask yourself, “does the added gene
come from a different species”? If the answer is YES than it is transgenic!

24
Looking at the following GMOs circle those you think are transgenic organisms? Why?

Source: https://www.mdanderson.org/publications/focused-on-health/gmos-cancer.h15-1589046.html Source: https://www.dbioro.eu/genetically-modified-organisms/

Source: https://www.reuters.com/news/picture/genetically-modified-animals-idUSRTXTZ7A

Applications of GMOs and Transgenic Organisms

GMOs are commonly used in food production and agriculture as foreign genes confer resistance to
insect pests and viruses, improve tolerance to herbicides and increase production loads.

Conducting your own research, can you identify a GMO crop used today?

Individual student response

One common example is Golden Rice. Let’s take a closer look at this useful GMO crop!

GOLDEN RICE = BETA-CAROTENE = VITAMIN A

Golden rice is genetically modified to produce beta-carotene,

which is not normally found in rice. Within our body, beta-
carotene is converted into vitamin A: a vitamin which is essential
for healthy skin, immunity and vision!
source: https://www.theguardian.com/environment/2019/oct/26/gm-golden-rice-delay-cost-millions-of-lives-child-blindness

How do you think this GMO will improve vitamin A deficiencies in developing countries?
Model answer: GMO rice will increase access to vitamin A in developing communities.

25
Another common example of a GMO crop is insect resistant Bt Cotton!

This crop was developed to reduce the amount of insecticide used in

cotton farming. By expressing a gene from the soil bacterium, Bacillius
thuringienesis (Bt), that produces toxins against harmful insects, Bt
cotton is able to resist moth larvae infections.

Bt COTTON CROP = INSECT RESISTANCE

Source: https://researchoutreach.org/articles/genetically-modified-cotton-how-changed-india/

How do you think this GMO would benefit the cotton industry?

Model answer: GMO cotton will be resistant to infection and therefore, easier to grow. Larger
cotton crops will allow for larger crop yields and income.

26