THE PAN-PACIFIC ENTOMOLOGIST

98(3):1–10, (2022)

Species status of populations of Lethocerus indicus (Lepeletier and

Serville, 1825) (Heteroptera: Belostomatidae) in Southeast Asia
Sakkouna Phommavongsa1, Manh Quang Vu2,³* and Phan Hoang Anh Nguyen2
1
Ministry of Education and Sports, 1 Lanexang, Vientiane, Laos
2
Hanoi National University of Education, 136 Xuan Thuy Rd., Hanoi, Vietnam
³Ho Chi Minh City University of Food Industry, 140 Le Trong Tan St,
Ho Chi Minh City, Vietnam
*Corresponding author. E-mail: vqmanh@hnue.edu.vn

Abstract. The giant water bug, Lethocerus indicus (Lepeletier & Serville, 1825), is an
aquatic true bug that has been included in the Vietnam Red Data Book since 1992 (“ca-cuong”
in Vietnamese, “maeng-da” in Laos and Thailand). This insect also has been listed as an en-
dangered species in Japan, Laos, and South Korea. This study aimed to (1) perform a genetic
analysis to determine the species status of various populations of L. indicus in Southeast Asia,
and (2) initially survey their distribution in Vietnam and Laos. Four populations were collected:
two from the Vientiane Capital and Savannakhet Province areas of Laos, and two from the
Vinh Phuc and Long An areas of Vietnam, respectively. Cytochrome oxidase subunit I (COI)
fragments longer than 600 bps were amplified by polymerase chain reaction (PCR). Twelve
nucleotide polymorphisms were found among these four populations. A maximum likelihood
tree based on COI showed that the genetic distances among populations were very small, rang-
ing from 0.2% to 1.1%, and were substantially distant from other populations of Lethocerus.
Therefore, they are all considered to be conspecific and to represent L. indicus.
Keywords. Aquatic insect, COI gene, distribution, giant water bug, Laos, molecular analysis,
Vietnam.

Introduction
The giant water bug Lethocerus indicus (Lepeletier & Serville, 1825) is a large,
predaceous aquatic insect found throughout Southeast Asia. This species, and many
others of the subfamily Lethocerinae, also exhibits a unique male egg-caring behavior
(Smith 1977, 2003). This species has been shown to contribute to the control of harm-
ful mollusks in an aquatic community in India (Bali et al. 1984). The genus Lethocerus
Mayr, 1853 has a wide distribution, from Southeast Asia to India, Korea, Japan, ­Europe,
Africa, South America, Central America, and North America (Distant 1906, Randall
et al. 1995, Vu 1997, Ohba 2019, Sareein 2019, Phommavongsa et al. 2021). These
insects are also considered as potential indicators of environmental pollution (Pham
et al. 2000, Mukai et al. 2005). Because it is a traditional spicy human food item in
Vietnam, Laos, Cambodia, and Thailand (”ca-cuong” in Vietnamese, and “maeng-da”
in Lao and Thailand), it is a familiar insect to non-scientists (Pemberton 1988, Packard
2003, FAO, 2009). Lethocerus indicus was surveyed in Vietnam nearly 100 years ago
(Nguyen Cong Tieu 1928). Since 1992, this insect species has been included in the Viet-
nam Red Data Book (Vu 1992, 2007). It has also been listed as an endangered species
in Japan (Japan Environment Agency 2000), Laos (Lao PDR 2008) and South Korea
(NIBR 2018). This insect was also proposed as an object in teaching animal behavior
in Vietnamese schools (Vu et al. 2021). Habitat degradation, pollution, and climate
change, as well as unsustainable exploitation, are probably the main causes that have
markedly reduced the population density and distribution of this water bug (Vu 1997,
2 THE PAN-PACIFIC ENTOMOLOGIST Vol. 98(3)

Vu & Le 1999, Pham et al. 2000, Mukai et al. 2005). The Food and Agriculture Organi-
zation of the United Nations (FAO) Development Program on Human Food Surveys
conducted in Laos (2006–2009) considered L. indicus to be one of the more important
food sources for humans (FAO 2009). However, it has been suggested that there may
be more than one species of Lethocerus in Vietnam, depending on its distribution
either in the northern, central, or southern part of the country (Ichikawa 1988, Vu
2011, Ohba 2017). Many studies using DNA analyses have attempted to determine
evolutionary relationships within the family Belostomatidae in general, as well as to
determine the species status and genetic relationships of the two genera Lethocerus
and Kirkaldyia Montandon, 1909 (Hall 1999, Hebgaard et al. 2004, Wisoram et al.
2013, Devi et al. 2016, Ribeiro et al. 2018, Nakasako et al. 2022, Nakorn et al. 2022),
including studies in Vietnam (Vu 2006, Stoianova et al. 2020).
The current study was focused on L. indicus, which is commonly used as an an-
cient and popular delicacy in Vietnam, Laos, and some other Southeast Asian coun-
tries, in order to conserve and sustainably manage it. The aims of the study were to
(1) perform a molecular genetic analysis to determine the species status of various
populations of L. indicus in Southeast Asia, and (2) initially survey their distribution
in Vietnam and Laos.

Materials and Methods

Field Procedures. Populations of L. indicus were collected from two locations in Laos
including (L1) and (L2); and two in Vietnam including (C1) in the north and (C2) in the south
(Table 1). At each study location, 10 to 15 adults were collected from three habitat
types: (a) streams, (b) ponds or lakes, and (c) rice paddies or other water-plant fields
(Table 1).
Laboratory Procedures. DNA analysis of L. indicus populations was performed at
the Institute of Ecology and Biological Resources Hanoi, Vietnam Academy of Science
and Technology (VAST), and included the following main steps: DNA extraction, am-
plification and sequence of the mitochondrial gene cytochrome oxidase subunit I (COI),
polymerase chain reaction (PCR) reaction, PCR purification, DNA sequencing, and
data analysis. The chemicals used were agarose, ethidium bromide (EtBr), Tris-Boric
acid-EDTA buffer (TBE), Sephadex G50 and other biomolecular chemicals (analytical
grade). The kits used were DNeasy Blood and Tissue kit (Qiagen, Germany) for total
DNA extraction, QIAquick Gel Extraction kit (Qiagen, Germany) for purification of
DNA fragments from agarose gels, and PCR mastermix (Thermoscientific). The COI
reference sequences obtained from GenBank are given in Table 2.

Table 1. Giant water bugs sampling locations.

Country sample Sample name Sampling location

Laos 1 L1 Vientiane Capital: Pak Ngum district, Pak Ngum village, coordinates
18°09′29.7″N X 103°03′20.1″E.
Laos 2 L2 Savannakhet province: Dong Khone district, Nong Hai village,
coordinates 16°16′25.3″N X 105°11′42.5″E.
Vietnam 1 C1 Vinh Phuc province in the North: Tu Du commune, Lap Thach
district, coordinates 21°24′3″N X 105°28′49″E.
Vietnam 2 C2 Long An province in the South: Duc Lap Thuong commune, Hoa Duc
district, Long An province, coordinates 10°55′08″N X 106°24′17″E.
2022 LETHOCERUS INDICUS IN VIETNAM AND LAOS 3

Table 2. Twelve reference DNA sequences of COI gene obtained from GenBank for comparison.

No. Species GenBank accession

1 Lethocerus indicus KR072671.1

2 Lethocerus indicus KM588201.1
3 Lethocerus indicus KP274068.1
4 Lethocerus americanos KR570232.1
5 Lethocerus americanus KR582126.1
6 Lethocerus uhleri KR040447.1
7 Lethocerus uhleri KR044284.1
8 Lethocerus sp. KR567372.1
9 Belostoma flumineum KT708568.1
10 Kirkaldyia deyrolli MK926428.1
11 Kirkaldyia deyrolli MK926427.1
12 Kirkaldyia deyrolli MK926426.1

The COI gene was used to asses populations of L. indicus. The gene fragment
recovered had a length of nearly 700 base pairs (bps). The PCR designed based
on the 2-terminal sequence of the gene fragment published in the NCBI GenBank
(Sequence NC_056774.1 of cytochrome C oxidase subunit I, L. indicus) . Primers used
to hybridize with DNA to obtain COI gene fragments were TCAACAAAYCATAAR-
GATATYGGAA (forward direction), and GAAGAAGGCAGTATTTAGGTTTCG
(reverse direction).
Total DNA was extracted from muscle tissue in the forelegs using the DNeasy Blood
and Tissue kit (Qiagen, Germany) according to the manufacturer’s instructions. PCR
reactions contained 10 µL 2× mastermix, 1 µL 5-mM forward primer, 1 µL 5-mM
reverse primer, 1 µL 10-ng/μl DNA template, and 7 µL PCR water (DNase free) to
20 µL final volume. The thermocycle conditions included: initial denaturation at
95 °C for 120 seconds; 35 cycles of 95 °C for 25 seconds, 56 °C for 25 seconds, and
72 °C for 60 seconds); and final elongation at 72 °C for 180 seconds. Samples were held
at 4 °C until using.
PCR products were electrophoresed on 1% agarose gel in 1× TBE buffer, stained
with EtBr, and displayed on a GelDoc reader (BioRad) at 302 nm. The amount of
PCR product was increased to 30 µl, then loaded into 1% agarose gel. PCR products
were then purified, and sequenced on an ABI 3100 machine using the BigDye Termi-
nator v3.1 kit. The amplified DNA product (nearly 700 bps long) was cut from the gel
and purified using the QIAuick Gel Extraction kit (Qiagen, Germany) according to
the manufacturer’s instructions. Sequencing reactions contained 1 µL 20-ng/μL PCR
product, 1 µL 3-mM forward primer, 4 µL 2.5× Big Dye, and 4 µL water (DNase free)
to 10 µL final volume. The thermocycle conditions included: initial denaturation at 96
°C for 60 seconds; 25 cycles of 96 °C for 10 seconds, 50 °C for 5 seconds, and 60 °C for
90 seconds). Samples were held at 4 °C until using.
Purification of the sequencing reaction product by gel filtration chromatography
(Sephadex G50 column) was performed according to the following procedure:
(1) hydrate sephadex gel for two to four hours, (2) centrifuge 2000 ´ g for 1 min, pour
off the solution, (3) place the entire DNA sequencing reaction product on the column,
centrifuge 2000 ´ g for 1 min, (4) dry the product after gel filtration with a rotary
vacuum evaporator, and (5) read the sequence on the ABI 3100- Avant Genetic Ana-
lyzer (Applied Biosystems, U.S.A.).
4 THE PAN-PACIFIC ENTOMOLOGIST Vol. 98(3)

Analytical Procedure. The sequences were corrected and compared with similar se-
quences on GenBank using BLAST. Clustal W program was used to pair and compare
gene sequences, and alignment of divergent protein sequences in this program has been
improved (Thompson et al. 1994, 1997). In Clustal W, a Markov substitution model
describes changes over evolutionary time. DNA sequences were examined for nucle-
otide distribution, hypothesis testing, and evolutionary model testing. Survey results
were used as input parameters to calculate a genetic distance matrix and construct a
­phylogenetic tree using MEGA 6.0.6 software. Substitution models were used to calcu-
late the likelihood of phylogenetic trees using multiple sequence alignment data. Thus,
substitution models are central to maximum likelihood estimation of phylogeny. The
model used to correct genetic distances among sequences was the evolutionary distanc-
es ­computed from DNA sequence data that are primarily estimates of the number of
­nucleotide substitutions per site (d) between two sequences. There are many methods for
estimating evolutionary distances, depending on the pattern of nucleotide substitutions
(Nei 1987, Gojobori et al. 1990). The phylogenetic analysis was performed with
­maximum likelihood method and Tamura-Nei substitution model. The DNA model
was established based on the COI gene. DNA alignment was done with 1000 boot-
strap with Tamura-Nei methods (Tamura et al. 2013, Wisoram et al. 2013, Kumar et
al. 2018, Vu et al. 2020). The genus Kirkaldyia was the outgroup in the phylogenetic
analysis to confirm the relationship between our species.

Results and Discussions

Sequence Similarity Comparison. The 680 bps COI gene fragment was trimmed at
the ends to be 630 bps long. The comparison of the four studied sequences with se-
quences on GenBank confirmed they were most related to the sequences of L. indicus.
The sequences had 99% similarity with the sequences of L. indicus originating from
Thailand (GenBank accession KR072671) and 90% similarity with the sequences of
L. indicus originating from India (KM588201.1 and KP274068.1). They also had 85%
similarity with the sequences of an undetermined species of Lethocerus (GenBank
MN648331–MN64833). Part of the sequence comparison results of sample C1 is
shown in Table 3.
The genetic distance coefficients of the four studied sample populations and the ref-
erence samples from the genera Lethocerus and Kirkaldyia are shown in Table 3. The
data from Table 3 show that the populations of L. indicus originating from Southeast
Asia (Laos, Vietnam, and Thailand) are closely related (Vu 1992, FAO 2009, Nakorn
et al. 2022). There are small genetic distances among them, which range from 0.2%
to 1.1%. Meanwhile, the populations from Southeast Asia are more distantly related
to populations from India. The genetic distances between them range from 11.1% to
11.3%. The data in Table 3 also show that the genetic distances between different spe-
cies of Lethocerus are greater than 16%. Only two species, L. americanus (Leidy, 1847)
and L. uhleri (Montandon, 1896), are separated by a smaller genetic distance, between
1.1% and 1.5% (Table 3).
Sequence Analysis. Nine distinct nuceltoide positions of the four COI gene sequenc-
es of Lethocerus populations were recovered. Populations L2, C2, and C1 had dif-
ferent nucleotide sequences at positions 8, 32, 62, 263, 322, 431, 453, 455, and 463
(Table 4). These variants were all homologous mutations.
 Table 3. Genetic distance between studied sequences and some reference sequences.
2022

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Belostoma flumieum
KT708568.1 0.055 0.054 0.056 0.056 0.058 0.057 0.045 0.045 0.045 0.045 0.046 0.045 0.057 0.053 0.057
C1 0.242 0.002 0.004 0.004 0.003 0.025 0.026 0.037 0.037 0.037 0.038 0.037 0.042 0.041 0.043
L1 0.237 0.003 0.004 0.004 0.004 0.025 0.025 0.036 0.036 0.036 0.037 0.036 0.042 0.040 0.042
L2 0.251 0.011 0.011 0.003 0.005 0.025 0.026 0.037 0.037 0.037 0.038 0.037 0.044 0.042 0.044
C2 0.247 0.010 0.010 0.005 0.004 0.025 0.025 0.037 0.037 0.037 0.038 0.037 0.043 0.041 0.043
Lethocerus indicus KR72671.1
Thailand 0.247 0.008 0.008 0.013 0.011 0.025 0.025 0.036 0.036 0.037 0.037 0.037 0.041 0.040 0.042
Lethocerus indicus KM588201.1
India 0.251 0.119 0.115 0.117 0.115 0.113 0.001 0.032 0.032 0.034 0.037 0.034 0.040 0.038 0.041
Lethocerus indicus KP274068.1
India 0.249 0.121 0.117 0.119 0.117 0.115 0.002 0.032 0.032 0.034 0.034 0.034 0.040 0.038 0.041
Lethocerus americanus
KR570232.1 0.206 0.173 0.169 0.176 0.173 0.167 0.150 0.148 0.000 0.004 0.034 0.004 0.039 0.037 0.040
Lethocerus americanus
KR582126.1 0.206 0.173 0.168 0.176 0.173 0.166 0.149 0.148 0.000 0.004 0.004 0.004 0.039 0.037 0.040
Lethocerus uhleri KR040447.1 0.211 0.175 0.171 0.178 0.175 0.173 0.160 0.158 0.011 0.011 0.004 0.000 0.040 0.037 0.041
Lethocerus uhleri KR044284.1 0.215 0.179 0.175 0.182 0.179 0.177 0.164 0.162 0.014 0.014 0.003 0.02 0.041 0.038 0.041
Lethocerus sp. KR567372.1 0.211 0.175 0.171 0.178 0.175 0.173 0.160 0.158 0.011 0.011 0.000 0.003 0.040 0.037 0.041
LETHOCERUS INDICUS IN VIETNAM AND LAOS

Kirkaldyia deyrolli MK926428.1 0.245 0.199 0.194 0.204 0.199 0.192 0.188 0.186 0.180 0.179 0.186 0.186 0.186 0.025 0.003
Kirkaldyia deyrolli MK926427.1 0.234 0.187 0.183 0.192 0.187 0.183 0.172 0.174 0.169 0.169 0.173 0.178 0.173 0.115 0.025
Kirkaldyia deyrolli MK926426.1 0.249 0.202 0.197 0.207 0.201 0.195 0.191 0.189 0.182 0.182 0.189 0.189 0.189 0.005 0.117
5
6 THE PAN-PACIFIC ENTOMOLOGIST Vol. 98(3)

Table 4. Nucleotide polymorphisms in COI among four populations of Lethocerus indicus.

Locality 8 32 62 263 322 431 453 454 463

L1 C G A A G G T T C
C2 . A G G A A . . T
C1 T . . . . . . . T
L2 . A . G A A A A T

Figure 1. Best maximum likelihood tree. Numbers at nodes represent bootstrap values.

Phylogenetic Tree Analysis. The phylogenetic tree is divided into two larger clades
(Fig. 1). The first clade above consists of seven sequences belonging to L. indicus,
which further divides into two subclades with 99% boostrap support of 99 ­(Figure 1).
One subclade contains five sequences of L. indicus from Southeast Asia, with 100%
2022 LETHOCERUS INDICUS IN VIETNAM AND LAOS 7

bootstrap support. The second subclade contains only two sequences belonging to
L. indicus native to India, also with 100% bootstrap support. The second large clade
consists of five sequences belonging to other species of Lethocerus, which further
divide into two subclades. The first subclade contains two sequences of L. ameri-
canus from the U.S.A. The second subclade contains three sequences belonging to
L. uhleri and Lethocerus sp. with bootstrap values of 99 and 98. Recently, Nakorn
et al. (2022) studied L. indicus in northeastern Thailand, clearly distinguished L.
indicus from other species, and recovered L. patruelis (Stål, 1855) as a sibling spe-
cies. The complete mitogenome sequence of L. indicus was published by Devi et al.
(2016); they also provided fundamental data useful in conservation genetics and
aquaculture diversification. Therefore until now, there has been no basis from which
to assess conspecificity of L. indicus populations from Vietnam, Laos and Thailand,
and distinction from the two populations from India (Distant 1906, Randall et al.
1995, Goodwyn 2006).
Nakasako et al. (2020) analyzed the complete mitochondrial genome of the giant
water bug Kirkaldyia deyrolli (Vuillefroy, 1864) and predicted a sister relationship
to the genus Lethocerus. Choi et al. (2021) constructed a maximum likelihood tree
in which the three mitochondrial genomes of K. deyrolli from South Korea, China,
and Japan were grouped. They proposed that Lethocerus, Belostomatidae, Nepoidea,
Nepomorpha, and Heteroptera represented strong, monophyletic groups (Choi et al.
2021). This is also evident in Stoianova et al.’s (2020) phylogenetic analysis (see their
Fig. 1). According to the description and morphological identification of Goodwyn
(2006), L. indicus and K. deyrolli are distinctly different. In the previous study, we dis-
covered K. deyrolli to only be distributed in central Vietnam, on the basis of its mor-
phological characteristics (Vu 2000, 2011). In this study, we only focused on studying
the populations of Lethocerus spp. distributed in northern and southern Vietnam.
Through morphological identification, we determined that all sampled populations
belong to L. indicus. Additional studies may be needed to clarify the species status of
giant water bugs, especially populations in central Vietnam.

Conclusions
Giant water bug populations were collected from four locations, including Laos
(L1) Vientiane Capital: Pak Ngum district, Pak Ngum village, and (L2) Savannakhet
province: Dong Khone district, Nong Hai village; and Vietnam (C1) Vinh Phuc prov-
ince in the North: Tu Du commune, Lap Thach district, and (C2) Long An province in
the South: Duc Lap Thuong commune, Hoa Duc district, Long An province. Analysis
of the COI gene sequence of these four giant water bug populations showed that there
are nine distinct nucleotide positions among them. The genetic distances between the
four populations were very small in the range of 0.2% to 1.1%, and they formed a
clade in the phylogenetic tree. The four populations studied all belong to the same
species, L. indicus.

Acknowledgments
This study was funded in part by the Japan NAGAO Foundation. We express our
gratitude to Professor Robert Sites, University of Missouri, Columbia, Missouri,
U.S.A., for his valuable scientific comments and help with improving the language of
the manuscript. Thanks are due to the valuable comments of anonymous reviewers
8 THE PAN-PACIFIC ENTOMOLOGIST Vol. 98(3)

who also helped to improve the quality of the manuscript. Vu Quang-Manh would
like to express his deep gratitude to Professor Robert L. Smith, University of Arizona,
Tucson, Arizona, U.S.A., for the long-term cooperation in research on giant water
bugs in Vietnam and in the United States.

Literature Cited
Bali, H., S. Singh & S. Sharma. 1984. Studies on the biological control of two common
vector snails of Punjab by predatory insects. Journal of the Bombay Natural History Society
81:216–219.
Butenandt, A. & N. Tam. 1957. Ueber einen geschlechtsspezifischen Duftstoff der Wasserwanz
Belostoma indica Vitalis (Lethocerus indicus Lep.). Hoppe-Seyler’s Zeitschrift für Physiolo-
gische Chemie 308:277–283.
Choe, J. C. & B. J. Crespi. 1977. The Evolution of Social Behavior in Insects and Arachnids. Cambridge
University Press, U.K., 514 pp.
Choi, E. H., S. Y. Baek, A. Akintola, B. Park, J. Hwang, G. Kim, C. R. Shin & U. W. Hwang.
2021. The mitochondrial genome of a giant water bug Lethocerus deyrollei (Hemiptera:
Belostomatidae) from South Korea. Mitochondrial DNA Part B, Resources 6(3):1001–1003.
DOI: https://doi.org/10.1080/23802359.2021.1893616
Devi, K. M., T. Shantibala & H. Debaraj. 2016. The first complete mitochondrial genome of a
Belostomatidae species, Lethocerus indicus. Gene 591(1):108–118. DOI: https://doi.
org/10.1016/j.gene.2016.07.004
Distant, W. L. 1906. The Fauna of British India Including Ceylon and Burma, Rhynchota, Vol. III:
Heteroptera – Homoptera. Taylor & Francis, London, 242 pp.
Food and Agriculture Organization of the United Nations (FAO). 2009. Introduction of Insect Breeding
to Family-Based Farms in the Outskirts of Vientiane, Laos. United Nations Laos, Vientiane, 37 pp.
Gojobori, T., E. N. Moriyama & M. Kimura. 1990. Molecular clock of viral evolution, and the neu-
tral theory. Proceedings of the National Academy of Sciences of the United States of America
87(24):10015–10018.
Goodwyn, P. 2006. Taxonomic revision of the subfamily Lethocerinae Lauck & Menke (Heteroptera:
Belostomatidae). Stuttgarter Beitrage zur Naturkunde, Serie A (Biologie) 695:1–71.
Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Window 95/98/NT. Nucleic Acids Symposium Series 41:95–98.
Hebgaard, M. B., N. M. Anderser & J. Damgaard. 2004. Phylogeny of the true water bugs
(Nepomorpha: Hemiptera-Heteroptera) based on 16S and 28S rDNA and morphology.
Systematic Entomology 29(4):488–508. DOI: https://doi.org/10.1111/j.0307-6970.2004.00254.x
Ichikawa, N. 1988. Male brooding behavior of the giant water bug Lethocerus deyrollei Vaillefroy
(Heteroptera: Belostomatidae). Journal of Ethology 6:121–127.
Japan Environment Agency. 2000. Threatened Wildlife of Japan - Red Data Book, 2nd Edition. Japan
Wildlife Research Center, Tokyo, 123 pp. (in Japanese with English Summary).
Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura. 2018. MEGA X: molecular evolutionary
genetics analysis across computing platforms. Molecular Biology and Evolution 35(6):
1547–1549.
Laos. 2008. Decision No. 0070/ກປ. Decision on the Adoption of the List of Aquatic and Wild Animals,
Class III. Ministry of Agriculture and Forestry, Minister Sy Ta Heng Raxaphon (in Lao.)
Mukai, Y., N. Baba & M. Ishii. 2005. The water system of traditional rice paddies as an important
habitat of the giant water bug, Lethocerus deyrollei (Heteroptera: Belostomatidae). Journal of
Insect Conservation 9(2):121–129.
Nakasako, J., H. Okuyama, S.-Y. Ohba & J.-I.Takahashi. 2022. Complete mitochondrial DNA
sequence of the giant water bug Kirkaldyia deyrolli (Hemiptera: Belostomatidae). Mitochon-
drial DNA Part B 5(3):3739–3740.
Nakorn, P., T. Chairat, T. Issara, J. Piangpen, P. Warayutt & S. Weerachai. 2022. Genetic variation of the
giant water bug Lethocerus indicus (Lepeletier and Serville, 1825) (Hemiptera: ­Belostomatidae)
collected from natural habitats in northeastern Thailand. Aquatic Insects Early View:
1–12. DOI: https://doi.org/10.1080/01650424.2022.2035399
2022 LETHOCERUS INDICUS IN VIETNAM AND LAOS 9

National Institute of Biological Resources (NIBR). 2018. Endangered Wildlife at a Glance. Seoul
(in Korean).
Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York, 505 pp.
Nguyen, C. T. 1928. Notes sur les insects comestibles au Tonkin. Bulletin Économique de l’Indochine,
3l-e nouv. Ser., 198:735–744.
Ohba, S.-Y. 2017. Paternal care behaviour of the giant water bug Kirkaldyia deyrolli (Heteroptera:
Belostomatidae) against ants: Paternal care by the giant water bug. Ecological Entomology
42:402–410. DOI: https://doi.org/10.1111/een.12398
Ohba, S.-Y. 2018. Ecology of giant water bugs (Hemiptera: Heteroptera: Belostomatidae).
Entomological Science 22(1):6–20. DOI: https://doi.org/10.1111/ens.12334
Packard, L.-A.-T. 2003. Bug juice. Nature History 3:63–64.
Pemberton, R. 1988. The use of Thai giant water bug Lethocerus indicus as human food in California.
The Pan-Pacific Entomologist 64:81–82.
Pham, Q. M., X. H. Le & D. S. Pham. 2000. Some reproductive and developmental characteristics of
giant water bug Lethocerus indicus (Lepeletier et Seville, 1775). Academia Journal of Biology
4:62–66 (in Vietnamese with English summary).
Phommavongsa, S. 2017. Study on Species Status, Habitats and Nutritional Behavior of Giant Water
Bug (Lethocerus sp.) in the Vientiane Capital Area, Lao People’s Democratic Republic. M.Sc.
Thesis, Hanoi National University of Education (HNUE), Vietnam. 85 pp. (in Vietnamese
with English summary).
Phommavongsa, S., P. H. A. Nguyen & Q. M. Vu. 2021. Study on natural habitat of Lethocerus
indicus (Lepeletier et Seville, 1775) (Hemiptera: Belostomatidae) contributes to the conser-
vation of rare water insects listed in the Vietnam Red Data Book. HNUE Journal of science,
Natural Sciences 66(4F):128–136. DOI: https://doi.org/10.18173/2354-1059.2021-0075 (in
Vietnamese with English summary).
Randall, T. S. & A. S. James. 1995. True Bugs of the World (Hemiptera - Heteroptera). Cornell Uni-
versity Press, 225 pp.
Ribeiro, J. R. I., S.-Y. Ohba, D. Pluot-Sigwalt, F, Stefanello, B. S. Wenjun, E. Solange & E. G.
Meyin-A-Ebong. 2018. Phylogenetic analysis and revision of subfamily classification of
Belostomatidae genera (Insecta: Heteroptera: Nepomorpha). Zoological Journal of the Linne-
an Society 182(2):319–359.
Sareein, N., J. H. Kang, S. W. Jung, C. Phalaraksh & Y. J. Bae. 2019. Taxonomic review and distribu-
tion of giant water bugs (Hemiptera: Belostomatidae: Lethocerinae) in the Palearctic, Orien-
tal, and Australian Regions. Entomological Research 49(10):462–473.
Smith, R. 2003. On the scent: The trail of giant water bug leads from Arizona to Vienam. Nature
History 3:60–62.
Stoianova, D., N. Simov, Q. M. Vu, D. M. Nguyen & S. Grozeva. 2020. New data on karyotype,
spermatogenesis and ovarian trophocyte ploidy in three aquatic bug species of the families
Naucoridae, Notonectidae, and Belostomatidae (Nepomorpha, Heteroptera). Comparative
Cytogenetics (1):139–156. DOI: https://doi.org/10.3897/CompCytogen.v14i1.48709
Tamura, K., J. Dudley, M. Nei & S. Kumar. 2013. MEGA6: Molecular Evolutionary Genetics Anal-
ysis (MEGA) software version 6.0.6.
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin & D. G. Higgins. 1997. The CLUSTAL_X
windows interface: flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Research 25:4876–4882.
Thompson, J. D., D. G. Higgins & T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific ­

gap penalties and weight matrix choice. Nucleic Acids Research 22(22):4673–4680. DOI:
https://doi.org/10.1093/nar/22.22.4673.
Vu, D. D., T. V. T. Tran, K. L. Phan, M. T. Nguyen, T. T. H. Nguyen, T. H. Nguyen & K. L. Phan.
2020. Using ITS-rDNA and MATK gene nucleotide sequences for identification ginseng
species in Panax in Phu Xai Lai Leng, Ky Son, Nghe An. Journal of Biotechnology 18(1):
75–85.
Vu, Q. M. 1992. Lethocerus indicus (Lep.et Ser., 1775), pp. 386–387. In: T. N. Dang, K. Tran, H. H.
Dang, C. Nguyen, N. T. Nguyen, H. Y. Nguyen & T. C. Dang (Eds.). The Vietnam Red Data
10 THE PAN-PACIFIC ENTOMOLOGIST Vol. 98(3)

Book I Animalia. Science And Technology Publishing House, Hanoi, 515 pp. (in Vietnamese
with English summary).
Vu, Q. M. 1997. Giant water bug Lethocerus indicus (Lep.et Ser., 1775) in natural and human-impacted
ecosystems of Vietnam. Forestry Journal 9:30–32 (in Vietnamese with English summary).
Vu, Q. M. 2000. Morphological and structural characteristics of Lethocerus indicus (Lepeletier et
Serville, 1775) in Vietnam, pp. 414-418. In: B. Nguyen, T. B. Le, N. D. Nguyen, D. H. Nguyen,
T. K. N. Nguyen, V. S. Cao, V. V. Vu & Q. H. Truong (Eds.). Problemes of Basic Research in
Biology: Proceedings National Conference on Biology. Hanoi National University Publishing
House, Hanoi, 650 pp. (in Vietnamese with English summary).
Vu, Q. M. 2006. On the DNA extraction from the giant water bugs Lethocerus sp. (Belostomtidae:
Lethocerinae) for molecular genetics analysis. HNUE Journal of Science 4:159–166.
Vu, Q. M. 2007. Lethocerus indicus (Lep.et Ser., 1775), pp. 453–454. In: N. T. Dang, K. Tran, H. H.
Dang, C. Nguyen, N. T. Nguyen, H. Y. Nguyen & T. D. Dang (Eds.). The Vietnam Red Data
Book I Animalia. Science And Technology Publishing House, Hanoi, 515 pp. (in Vietnamese
with English summary).
Vu, Q. M. 2011. A record of new species giant water bug Kirkaldyia deyrolli (Vuillefroy, 1864) (Letho-
cerinae, Belostomatidae) for the fauna of Vietnam, pp. 206–213, In: X. C. Le, M. H. Tran &
H. T. Ta (Eds.). Scientific Report on Ecology and Biological Resources: Fourth National Scien-
tific Conference. Agriculture Publishing House, Hanoi, 1899 pp. (in Vietnamese with English
summary).
Vu, Q. M., T. H. Nguyen, S. Phommavongsa & T. M. Ha. 2021. Species status of ragworm pop-
ulations (Nereididae: Tylorrhynchus sp.) exploited as a human specialty based on their
molecular analyses and their distribution in the northern coast of Vietnam. Comptes rendus de
l’Académie bulgare des Sciences 75(4):545–553.
Vu, Q. M., S. Phommavongsa, T. N. Nguyen, P. H. A. Nguyen & T. H. Chu. 2021. A design of the
teaching and learning activities for behavorial ecology of the zoology curriculum of hanoi
national university of education. Ho Chi Minh city University of Education, Journal of Science
18(8): 1485–1494 (in Vietnamese with English summary).
Wisoram, W., P. Saengthong, & L. Ngernsiri. 2013. Meiotic chromosome analysis of the giant water bug,
Lethocerus indicus. Journal Insect Science 13:39. DOI: https://doi.org/10.1673/031.013.3901.

Received 23 Mar 2022; accepted 23 June 2022. Publication date xx

Subject editor Michael Forthman
 NUMBER 1 OF 1

AUTHOR QUERIES
DATE 08/08/2022
JOB NAME PPE
ARTICLE 2022-12
QUERIES FOR AUTHOR Sakkouna Phommavongsa et al.

There are no queries.