Journal of Fish Diseases 2002, 25, 201–207
Experimental susceptibility of different life-stages
of the giant freshwater prawn, Macrobrachium rosenbergii
(de Man), to white spot syndrome virus (WSSV)
R B Pramod Kiran1, K V Rajendran1, S J Jung2 and M J Oh2
1 Central Institute of Fisheries Education, Mumbai, India
2 Yosu National University, Yosu, Korea
Abstract
Studies were conducted by injecting/feeding white
spot syndrome virus (WSSV) derived from infected
shrimp, Penaeus monodon (Fabricius), to different
life-stages, namely post-larvae, juveniles, sub-adults
and adults of Macrobrachium rosenbergii (de Man).
The disease was also induced in brood stock, and
the eggs and larvae derived from these animals were
subsequently tested for WSSV infection. All the
stages except egg used for the experiment were
found WSSV positive in histopathology, cross
infection bioassay and polymerase chain reaction
(PCR) analysis. Experimentally infected post-larvae
and juveniles showed a high percentage of mortality
and an increased rate of cannibalism. The cumu-
lative mortality in post-larvae was up to 28%; with
28–40% cannibalism resulting in a maximum loss
of up to 68%. In juveniles, observed mortality and
cannibalism were 10–20% and 6.7–30.0%, respect-
ively, and the maximum loss recorded was 50%. In
sub-adults, mortality ranged from 2.8 to 6.7%,
cannibalism was up to 20% and the total loss was
up to 26.7%. Sub-adults and adults were found to
be more tolerant to the infection as evidenced by
the mortality pattern. A nested (two-step) PCR
resulted in a 570-bp product specific to WSSV in
all stages, except the eggs.
Keywords: white spot syndrome virus (WSSV),
freshwater prawn, Macrobrachium rosenbergii, his-
topathology, polymerase chain reaction.
Correspondence K V Rajendran, Central Institute of Fisheries
Education, J.P. Road, Versova, Andheri (W), Mumbai-400 061,
India
(e-mail: rajendrankv@hotmail.com)

2002
Blackwell Science Ltd 201
Introduction
White spot syndrome virus (WSSV) causes the
most serious epizootic in cultured penaeid shrimp
(Wang, White, Redman & Lightner 1999). The
epizootic started in 1992, and spread through east
and south-east Asia, Indonesia and into India and
other shrimp growing countries of the region
(Nunan, Poulos & Lightner 1998). The WSSV is
a serious threat because it infects a wide spectrum of
crustaceans, some of which will not die as a result
of the virus, but act as carriers (Flegel 1996;
Rajendran, Vijayan, Santiago & Krol 1999).
Against this backdrop of the disastrous disease
outbreak in the marine shrimp culture system, the
giant freshwater prawn Macrobrachium rosenbergii
is widely considered as an alternative culture
species. The culture of this species has developed
rapidly in some tropical areas. Nevertheless, it is
found that the freshwater prawn is also susceptible
to WSSV infection to a certain extent (Peng, Lo,
Ho, Chang & Kou 1998). Rajendran et al. (1999)
provided the experimental proof for the suscepti-
bility of M. rosenbergii to WSSV and showed that
the virus does not cause serious mortality in the
adult stage of the prawn. Although Peng et al.
(1998) have detected WSSV in M. rosenbergii using
polymerase chain reaction (PCR), they did not
record the susceptibility of different life-stages in
terms of mortality and the histopathological
manifestation in the experimentally or naturally
infected prawn. With this background, the present
study was undertaken to determine the effect of
WSSV on different life-stages such as egg, larva,
post-larva, juvenile, sub-adult and adult of
M. rosenbergii through experimental infection and
 Journal of Fish Diseases 2002, 25, 201–207
the resultant mortality, histopathological manifes-
tations of the infection, cross-infection (bioassay)
analysis and PCR-based detection to verify the
infectivity. We have also attempted to find out
whether the virus would transmit vertically, by
experimentally challenging the brood stock prawn
and subsequently, analysing the eggs and larvae
derived from the brooder.
Materials and methods
Experimental animals
Early life-stages such as post-larvae, juveniles and
sub-adults of M. rosenbergii were procured from
the freshwater prawn hatchery of the Division of
Aquaculture, Central Institute of Fisheries Educa-
tion, Mumbai. Wild, adult prawns were collected
from Bhivandi, Maharashtra, India. For bioassay
studies, 60-day old Penaeus monodon (PCR negat-
ive stock) were collected from a farm with no
history of white spot infection and were main-
tained in the laboratory. All the stages of
M. rosenbergii and P. monodon used in the
experiment were tested for WSSV, prior to the
experimental infection.
Maintenance of prawns
Post-larvae were kept in 5-L glass aquaria with a
stocking density of five animals per litre and
juveniles in 30-L aquaria with two animals per
litre. Sub-adult groups were kept in 50-L plastic
tubs with a stocking density of one prawn per
litre. Adult prawns were kept in Fiberglass
Reinforced Plastic (FRP), tanks (300-L) (Kira
Equipment, India) with five animals in an experi-
mental unit. Brooders were kept in 300-L FRP
tanks for studies on eggs and larvae. Daily water
exchange (20–80%) was given in all the experi-
mental tanks. The post-larvae and juveniles were
fed with egg custard, and sub-adults and adults
with commercial pellet feed at the rate of 5%
body weight. Water temperature during the
experiment was between 18 and 21 C and pH
ranged from 7.5 to 8.5. Continuous aeration was
provided in the experimental facility.
For bioassay, shrimp were acclimatized for a week
and maintained in filtered sea water of 12& salinity.
Daily, 20–30% water exchange was given. The
animals were fed with pellet feed at the rate of 5%
body weight throughout the experimental period.

2002
Blackwell Science Ltd 202
R B Promod Kiran et al. WSSV in Macrobrachium
Experimental infection
White spot syndrome infected P. monodon were
collected from a shrimp farm, which recorded a
serious outbreak of the disease. The samples were
transported on ice and stored at 80 C until used.
The gills, stomach and epidermal layer collected
from frozen infected shrimp were used for challenge
trials according to the methods followed by
Takahashi, Itami, Kondo, Maeda, Fujii, Tomona-
ga, Supamattaya & Boonyaratpalin (1994) and
Rajendran et al. (1999). In the oral feeding trials,
the experimental animals were fed with macerated/
homogenized infected tissue ad libitum for 2 days
in the case of post-larvae, and 7 days (two feedings
per day at 5% body weight) for juveniles, sub-adults
and adults. For injection treatment, 1 g tissue was
homogenized in 1 mL PBS, centrifuged at 400 · g
for 10 min at 4 C, and the supernatant was filtered
through a 0.45-lm membrane filter, diluted using
PBS (1/10 v/v) and injected intramuscularly into
the abdominal segment (0.1% v/w of body). In all
injection treatments, only a single injection was
given to the experimental animal. Control animals
were given a single injection with sterile PBS. In
order to examine whether the pathogen would
transmit from mother to offspring, viral extract was
administered into the brooders in a single injection
and they were maintained till they spawned.
Subsequently, eggs and 2-day-old-larvae derived
from the experimentally infected brooders were
collected for PCR analysis.
Histopathology
The procedure described by Bell & Lightner (1988)
was followed in the histological studies. In the case of
post-larvae and juveniles, two animals each were
collected every week during the experiment and fixed
in Davidson’s fixative. In the case of adults and sub-
adults, freshly dead and moribund animals were
collected during the experiment, and various organs
were dissected out and fixed. The tissue sections were
stained with haematoxylin, counterstained with
eosin and observed under the microscope. The
photomicrographs were taken using a Lieca MPS 32
camera (Leica Microsystems, Wetzlar, Germany).
Cross-infection bioassay
For challenge bioassay, the tissue filtrates were
prepared according to the protocol described by
 Journal of Fish Diseases 2002, 25, 201–207
Takahashi et al. (1994) and Rajendran et al. (1999)
using the gills, stomach and epidermal tissues of the
experimentally infected prawns. The filtrate was
administered intramuscularly to healthy P. monodon.
Polymerase chain reaction
The various life-stages viz. egg, larvae and post-
larvae (whole) and soft tissues from the head of
juveniles, sub-adults and adults (100 mg approxi-
mately) of experimentally infected prawns were
homogenized in 200 lL of Tris-NaCl-EDTA
(TNE) buffer [50 mm Tris, 10 mm ehylenedi-
aminetetraacetic acid (EDTA), 1.5% NaCl;
pH 7.5] using a glass tissue homogeniser. The
homogenate was centrifuged at 400 · g for 10 min
at 4 C and the supernatant was used for the
isolation of DNA. The isolation of the nucleic acid
was carried out using the high pure PCR Template
Preparation Kit (Boehringer Mannheim, Indiana-
polis, USA). Tissue homogenates from an unin-
fected M. rosenbergii and a naturally infected
P. monodon were used as negative and positive
controls, respectively. The WSSV-specific primer
pairs, P1: 5¢- ATCATGGCTGCTTCACAGAC -
3¢; P2: 5¢- CGCTGGAGAGGACAAGACAT-3¢;
P3: 5¢- TCTTCATCAGATGCTACTGC -3¢; P4:
5¢- TAACGCTATCCAGTATCACG -3¢ reported
by Kimura, Yamano, Nakano, Momoyama, Hir-
aoka & Inouye (1996) were used for nested (two-
step) WSSV diagnostic PCR. Polymerase chain
reaction amplifications were performed in a final
volume of 20 lL of reaction mixture containing
50 mm KCl, 10 mm Tris–HCl, 1.5 mm MgCl2,
0.1% Triton X-100, 0.2 mm of each dNTPs,
15 pmol of each primer, 10 ng of template DNA
and 1 unit of Taq DNA Polymerase. The ampli-
fication was performed in a GeneAmp 2400
thermal cycler (Perkin Elmer, Norwalk, USA).
One microlitre of the post-PCR mixture using the
primer pair P1/P2 was used as the template for the
second PCR (same conditions as above) with the
primer pair P3/P4. The products were analysed on
1.5% agarose gel containing ethidium bromide and
visualized using a UV transilluminator.
Results
The details of each experiment and day-wise
mortality are given in the tables (Tables 1–4). All
the stages of M. rosenbergii except eggs used in the
experimental infection were found susceptible to

2002
Blackwell Science Ltd 203
R B Promod Kiran et al. WSSV in Macrobrachium
WSSV. However, the degree of susceptibility
showed variation among different life-stages of the
prawn. Presence of white spots on the carapace was
found to be of consistent occurrence in all stages,
but was more prominent in adults (Figs 1a–c).
Penaeus monodon used for a comparative analysis
showed 100% mortality in 5–7 days. Histological
sections of different target tissues from the repre-
sentative samples of experimental animals showed
the characteristic features of WSSV infection in
penaeid shrimp.
Post-larvae were found weak and lethargic at
5 days post-infection feeding and the first mortality
was observed on the same day (Table 1). In 15 days
of experiment, cumulative mortality reached 28%
in one experimental tank. Dead and moribund
larvae revealed very tiny white spots on the carapace
upon observation under the microscope. A signifi-
cant observation made in the experiment was the
increased cannibalism among the experimentally
infected animals. While the cannibalism observed in
control aquaria was 4%, the experimentally infected
animals showed 28–40% cannibalism.
Out of the 50 juveniles kept in four aquaria, the
first mortality was recorded 5 days post-infection in
one aquarium (Table 2). Cumulative mortality
ranged from 10 to 20% in different experimental
aquaria during the 15-day experiment. Cannibalism
in the experimental aquaria ranged from 6.7 to
30.0%. The control animals were found healthy
and no cannibalism was observed in this group.
In sub-adults, the first mortality was observed on
the seventh day post-infection feeding. In the
15 days of experiment, cumulative mortality
observed in different experimental tanks ranged
from 2.8 to 6.7% and the observed cannibalism was
20% (Table 3).
In the case of adults, intramuscularly injected, the
first signs of infection, such as weakness and
lethargy, were observed after 15 days. The first
mortality was observed on the 18th day post-
injection. However, during the 10–15 days of
infection, exuvia (carapace) of the moulted animals
showed white spots and streaks characteristic of
WSSV infection. No other external manifestation or
behavioural change was noticed during the experi-
mental period. In the case of per os infection con-
tinuously for 7 days, first mortality was observed for
24 days post-feeding. The animals were otherwise
healthy throughout the 30-day experimental period
(Table 4). In this case also, the carapace of moulted
animals showed prominent white spots/patches.
 Journal of Fish Diseases 2002, 25, 201–207 R B Promod Kiran et al. WSSV in Macrobrachium

Figures 1 Photomicrographs of carapace and tissue sections from experimentally infected freshwater prawn, M. rosenbergii: (a) Carapace
of adult prawn showing white spots; (b) white spots on the carapace of post-larva (·100); (c) white spots on the carapace of juvenile
(·100); (d) subcuticular ectodermal layer and connective tissue of the gut of juvenile showing hypertrophied nuclei with marginated
chromatin (arrow heads) and deeply stained basophilic intranuclear inclusions (arrows) (H&E, ·1000); (e) gut wall of post-larva
showing intranuclear inclusions (H&E, ·400).

Table 1 Details of the mortality pattern and cannibalism in post-larvae of Macrobrachium rosenbergii as result of experimental infection
by WSSV

Initial Day-wise mortality (no.) Cumulative mortality

stock Cannibalism
Aquaria/tank (no.) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 No. % (no.)

Experiment 1 25 0 0 0 0 1 3 0 0 0 0 1 0 1 1 0 7 28 10
Experiment 2 25 0 0 0 0 1 2 1 0 0 0 1 0 0 0 0 5 20 9
Experiment 3 25 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 3 12 7
Control 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1

histological manifestations similar to that found

Histopathology
in spontaneously infected penaeid shrimp
Post-larvae, juveniles, sub-adults and adults of the (Wongteerasupaya, Vickers, Sriurairatana, Nash,
experimentally infected M. rosenbergii showed Akarajamorn, Boonsaeng, Panyim, Tassanakajon,

2002
Blackwell Science Ltd 204
 Journal of Fish Diseases 2002, 25, 201–207 R B Promod Kiran et al. WSSV in Macrobrachium

Table 2 Details of the mortality pattern and cannibalism in juveniles of Macrobrachium rosenbergii as a result of experimental infection
by white spot syndrome virus (WSSV)

Initial Day-wise mortality (no.) Cumulative mortality

stock Cannibalism
Aquaria/tank (no.) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 No. % (no.)

Experiment 1 15 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 13 1
Experiment 2 15 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 3 20 3
Control 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Experiment 3 10 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 10 3
Experiment 4 10 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 20 2
Control 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Table 3 Details of the mortality pattern and cannibalism in sub-adults of Macrobrachium rosenbergii as a result of experimental
infection by white spot syndrome virus (WSSV)

Initial Day-wise mortality (no.) Cumulative mortality

stock Cannibalism
Aquaria/tank (no.) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 No. % (no.)

Experiment 1 30 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 2 6.7 6
Control 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
Experiment 2 35 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2.8 0
Control 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Table 4 Details of the mortality pattern in adults of Macrobrachium rosenbergii as a result of experimental infection by white spot
syndrome virus (WSSV)

Day-wise mortality (no.)

Initial
Tank stock (no.) 0–5 5–10 10–15 15–20 20–25 25–30

Experiment 1 (i.m) 5 0 0 0 1 0 0
Experiment 2 (i.m) 5 0 0 0 0 0 0
Control 5 0 0 0 0 0 0
Experiment 3 (per os) 5 0 0 0 0 1 0
Control 5 0 0 0 0 0 0

i.m: intra muscular injection.

Withyachumnarnkul & Flegel 1995; Wang, Tang,
Kou & Chen 1997). However, severity of degen-
eration and number of viral inclusions in the target
tissues were far less than that seen in penaeid
shrimp. Gill lamellae showed intranuclear inclu-
sions, hypertrophied nuclei, chromatin margination
and karyorhexis. The cuticular ectodermal layer of
the gut showed a large number of variably sized,
deeply stained basophilic intranuclear inclusions
(Fig. 1d, e). Marked nuclear hypertrophy and
chromatin margination were also observed.
Bioassay
Healthy uninfected P. monodon on injection with
the tissue filtrate prepared from the experimentally
infected prawn tissues, showed the typical signs of
WSSV infection at 10 days post-injection. Simi-
larly, the animals which were challenged by feeding
infected prawn tissue, also showed the typical signs
at 10 days post-infection. Animals were found weak
and lethargic, and carapace showed heavy white
spots. Cumulative mortality reached 100% by
20 days post-infection in all experimental groups.
However, control animals in both the groups did
not show any signs of the disease.
Polymerase chain reaction
Electrophoresis of the PCR products of the first step
amplification did not reveal the presence of viral
DNA (expected 982 bp product) in any of the

2002
Blackwell Science Ltd 205
 Journal of Fish Diseases 2002, 25, 201–207
Figure 2 Nested PCR assay on DNA from different life stages of freshwater prawn, M. rosenbergii, experimentally infected with white
spot syndrome virus (WSSV). Agarose gel electrophoresis of the nested PCR products showing the amplification pattern. Lane 1: 1 kb
DNA marker (Bioneer Co., Chungbuk, Korea); Lane 2: negative control (uninfected M. rosenbergii); Lane 3: positive control (naturally
infected P. monodon); Lanes 4–9: egg, larva, post-larva, juvenile, sub-adult and adult, respectively. Arrowhead indicates the amplicon in
the second step PCR (570 bp) of the WSSV.
life-stages of M. rosenbergii. However, in the nested
(second step) PCR, clear amplification was observed
in larvae, post-larvae, juveniles, sub-adults and
adults, and the PCR product of 570 bp was
detected (Fig. 2). However, eggs derived from
experimentally challenged brooders did not show
any amplification.
Discussion
Investigations to find the susceptibility of various
aquatic crustaceans including freshwater prawn to
WSSV have been carried out by many workers (Lo,
Ho, Peng, Chen, Hsu, Chiu, Chang, Liu, Su, Wang
& Kou 1996; Chang, Chen & Wang 1998;
Kanchanaphum, Wongteerasupaya, Sitidilokratana,
Boonsaeng, Panyim, Tassanakajon, With-
yachumnarnkul & Flegel 1998; Peng et al. 1998;
Wang, Lo, Chang & Kou 1998; Rajendran et al.
1999). However, the susceptibility of different life-
stages of the prawn to WSSV through experimental
infection has not been investigated in terms of
pathogenicity of the virus and the resultant mor-
tality. The present study, using various life-stages of
M. rosenbergii, showed that all the stages in the life
cycle of freshwater prawn are susceptible to WSSV.
It also provides conclusive evidence for the suscep-
tibility through mortality of the experimentally
infected animals, histopathological manifestations,
cross-infection bioassay and PCR based detection.
It has been observed that early life-stages such as
post-larvae and juveniles are more susceptible than
the late stages, as they showed increased percentage
of mortality in a short period of time. Cannibalism
is a common phenomenon in freshwater prawn,
especially during moulting (Sandifer & Smith
1985; Brock 1993). During the present study, it

2002
Blackwell Science Ltd 206
R B Promod Kiran et al. WSSV in Macrobrachium
was found that there was a significant increase in the
cannibalistic rate among the post-larval and juvenile
stages. Horizontal transmission through cannibal-
ism plays a significant role in disease dissemination
of WSSV. The observed mortality, which can be
attributed to the WSSV infection and the canni-
balism together, represent a high percentage of loss
in the post-larval stage (68%). Therefore, the
present study demonstrates that WSSV infection
in post-larval and juvenile stages, in which the
percentage of mortality and cannibalism is high, can
be very critical in determining the success of
hatchery operations.
The sub-adults and adults were found more
tolerant than the early larval stages, as the cumu-
lative mortality in sub-adult animals was found to
be 10%. Besides, cannibalism was also found to be
less when compared with the early larval stages.
Nevertheless, the experimentally infected animals
showed distinct white spots on the carapace and
marked histopathological manifestations in the
target tissues. In the case of adults, which were
intramuscularly injected with the viral extract, the
severity was found to be greater when compared
with the animals which were given infection per os.
Although the adult stage showed pronounced white
patches on the carapace, the mortality pattern
indicated that this stage can tolerate the viral
infection to a large extent. This is in accordance
with the observations made by Rajendran et al.
(1999). Eggs derived from experimentally chal-
lenged brooders did not show any WSSV infection.
However, the larvae hatched out of these eggs were
found positive for WSSV infection in two-step
PCR. As the eggs were found negative for the
presence of WSSV, it is presumed that the larvae
might have infected through contaminated water.
 Journal of Fish Diseases 2002, 25, 201–207
Nevertheless, repeated experiments using many
brooders are required to prove the existence or
non-existence of vertical transmission.
It can be concluded that, except the post-larval
and juvenile stages, all other life-stages of
M. rosenbergii are tolerant to WSSV. Besides the
mortality pattern exhibited by the experimentally
infected prawns, cross infection bioassay and histo-
pathological manifestation also indicated the in-
creased tolerance of M. rosenbergii. The results
obtained in the bioassay involving experimentally
infected M. rosenbergii and P. monodon showed that
cumulative mortality in infected P. monodon reached
100% only by the 20th day post-infection. This
delay in the mortality might be because of the low
levels of virus in M. rosenbergii. Histopatho-
logical observations also corroborate the fact that
the number of viral inclusions and the severity of
cellular destruction in the target tissues of
M. rosenbergii were far less than that seen in infected
P. monodon.
Acknowledgements
The authors are thankful to the Director, Central
Institute of Fisheries Education, Mumbai, for
providing facilities for the research work. Thanks
are also due to Dr C. S. Purushothaman for his
critical reading of the manuscript.
References
Bell T.A. & Lightner D.V. (1988) A Handbook of Normal
Penaeid Shrimp Histology. World Aquaculture Society, Baton
Rouge, LA.
Brock J.A. (1993) A synopsis of pathology, diseases, and
production problems of cultured Macrobrachium, with an
emphasis on experiences in Hawaiian prawn farming. In: CRC
Handbook of Mariculture I, Crustacean Aquaculture (ed. by
J.P. Mcvey), pp. 361–392. CRC Press Inc., FL.
Chang P.S., Chen H.C. & Wang Y.C. (1998) Detection of white
spot syndrome associated baculovirus in experimentally
infected wild shrimp, crab, lobsters by in situ hybridization.
Aquaculture 164, 233–242.
Flegel T.W. (1996) A turning point for sustainable aquaculture:
the white spot virus crisis in Asian shrimp culture. Aquaculture
Asia 1, 29–34.
Kanchanaphum P., Wongteerasupaya C., Sitidilokratana N.,
Boonsaeng V., Panyim S., Tassanakajon A.,
Withyachumnarnkul B. & Flegel T.W. (1998) Experimental
transmission of white spot syndrome virus (WSSV) from crabs

2002
Blackwell Science Ltd 207
R B Promod Kiran et al. WSSV in Macrobrachium
to shrimp Penaeus monodon. Diseases of Aquatic Organisms 34,
1–7.
Kimura T., Yamano K., Nakano H., Momoyama K., Hiraoka M.
& Inouye K. (1996) Detection of penaeid rod-shaped DNA
virus (PRDV) by PCR. Fish Pathology 31, 93–98.
Lo C.F., Ho C.H., Peng S.E., Chen C.H., Hsu H.C., Chiu Y.L.,
Chang C.F., Liu K.F., Su M.S., Wang C.H. & Kou G.H.
(1996) White spot syndrome baculovirus (WSBV) detected in
cultured and captured shrimp, crabs and other arthropods.
Diseases of Aquatic Organisms 27, 215–225.
Nunan L.M., Poulos B.T. & Lightner D.V. (1998) The detec-
tion of white spot syndrome virus (WSSV) and yellow head
virus (YHV) in imported commodity shrimp. Aquaculture
160, 19–30.
Peng S.E., Lo C.F., Ho C.H., Chang C.F. & Kou G.H. (1998)
Detection of white spot baculovirus (WSBV) in giant fresh-
water prawn, Macrobrachium rosenbergii, using polymerase
chain reaction. Aquaculture 164, 253–262.
Rajendran K.V., Vijayan K.K., Santiago T.C. & Krol R.M.
(1999) Experimental host range and histopathology of white
spot syndrome virus (WSSV) infection in shrimp, prawns,
crabs and lobsters from India. Journal of Fish Diseases 22,
183–191.
Sandifer P.A. & Smith T.I.J. (1985) Freshwater prawn. In:
Crustacean and Mollusk Aquaculture in the United States (ed. by
J.V. Huner & E.E. Brown), pp. 63–125. AVI Publishing Co,
Inc., Westport.
Takahashi Y., Itami T., Kondo M., Maeda M., Fujii R.,
Tomonaga S., Supamattaya K. & Boonyaratpalin S. (1994)
Electron microscopic evidence of bacilliform virus infection in
kuruma shrimp (Penaeus japonicus). Fish Pathology 29,
121–125.
Wang Y.C., Lo C.F., Chang P.S. & Kou G.H. (1998) Experi-
mental infection of white spot baculovirus in some cultured
and wild decapods in Taiwan. Aquaculture 164, 221–231.
Wang C.S., Tang K.F.J., Kou G.H. & Chen S.N. (1997) Light
and electron microscopic evidence of white spot disease in the
giant tiger shrimp, Penaeus monodon (Fabricius), and kuruma
shrimp, Penaeus japonicus (Bate), cultured in Taiwan. Journal
of Fish Diseases 20, 323–331.
Wang Q., White B.L., Redman R.M. & Lightner D.V. (1999)
Per os challenge of Litopenaeus vannamei postlarvae and
Farfantepenaeus duorarum juveniles with six geographic
isolates of white spot syndrome virus. Aquaculture 170,
179–194.
Wongteerasupaya C., Vickers J.E., Sriurairatana S., Nash G.L.,
Akarajamorn A., Boonsaeng V., Panyim S., Tassanakajon A.,
Withyachumnarnkul B. & Flegel T.W. (1995) A non-occlu-
ded, systemic baculovirus that occurs in cells of ectodermal
and mesodermal origin and causes high mortality in the black
tiger prawn Penaeus monodon. Diseases of Aquatic Organisms
21, 69–77.
Received: 1 September 2001
Accepted: 19 November 2001