Sugar Tech (Jan-Mar 2011) 13(1):68–76
DOI 10.1007/s12355-011-0066-4
RESEARCH ARTICLE
Pathogenic and Molecular Confirmation of Fusarium sacchari
Causing Wilt in Sugarcane
R. Viswanathan • M. Poongothai • P. Malathi
Received: 3 November 2010 / Accepted: 5 December 2010 / Published online: 26 May 2011
Ó Society for Sugar Research & Promotion 2011
Abstract Wilt of sugarcane is a serious disease affecting
sugarcane production in many sugarcane growing regions.
Since the associated pathogen has not been clearly estab-
lished with the disease, detailed studies were conducted to
identify the fungal species by pathogenicity and molecular
variation. Selected 10 isolates of Fusarium associated with
sugarcane wilt were tested for their pathogenicity on the cv
Co 86032 and among them the isolates Fs 032 TN4L2 and
Fs 121 UP1 originated from Tamil Nadu and Uttar Pradesh,
respectively had shown severe disease and proved to be
more virulent. Also pathogen inoculation by plug method
combined with abiotic stress on selected sugarcane varie-
ties at Coimbatore, caused typical wilt symptoms in cvs Co
6304 and Co 86249 and partial symptoms on CoC 90063
and CoC 92061 under field conditions. However, disease at
endemic location in Gujarat the cvs Co 86002, Co 95020,
Co 97008, Co 98010 and Co 0323 exhibited typical wilt in
response to pathogen inoculation by plug method. Further
studies on molecular variation using specific RAPD and
ISSR markers were taken up to confirm the pathogenic
isolates of Fusarium. The molecular markers such as
1000 bp fragment of RAPD primer OPA13, 650 bp frag-
ment in ISSR1, 720 bp fragment in ISSR5 and 880 bp
fragment in ISSR9 very clearly demarcated pathogenic and
nonpathogenic isolates. The field and laboratory studies
very clearly confirmed that the wilt pathogenic isolates
belong to F. sacchari and this is the first attempt that
generated molecular markers which correlated with path-
ogenicity of F. sacchari isolates.
R. Viswanathan (&)  M. Poongothai  P. Malathi
Sugarcane Breeding Institute, Indian Council of Agricultural
Research, Coimbatore 641007, India
e-mail: rasaviswanathan@yahoo.co.in
123
Keywords Sugarcane wilt  Fusarium sacchari 
Pathogenicity  Molecular variation
Introduction
Wilt of sugarcane is a serious stalk disease in India and
other South Asian countries. Although wilt has been
associated with red rot in causing severe damage in dif-
ferent countries, wilt alone causes severe damage to certain
sugarcane varieties in India (Viswanathan and Padmanaban
2008). However, conflicting claims have been made
regarding the true causal organism of sugarcane wilt as
species of Fusarium, Cephalosporium and Acremonium by
different authors (Agnihotri and Rao 2002) and information
on the pathogen(s) involved and its variation, are not
clearly brought out. The pathogens associated with the
disease were recorded to be different from area to area and
between investigators. Butler and Khan (1913) were the
first to describe the disease in India and they identified the
pathogen as C. sacchari. A similar disease named as
‘‘Fusarium sett’’ or ‘‘Stem rot’’ was recorded by Bourne
(1922) in Barbados. Abbott (1932) also observed the dis-
ease in Louisiana. Gams (1971) who reviewed the taxon-
omy of C. sacchari also considered it as F. moniliforme var
subglutinans and coined a new combination as F. sacchari
(Butler) W. Gams to which both C. sacchari and F. mon-
iliforme var subglutinans were made synonyms. Later Ni-
renberg (1976) distinguished two varieties of F. sacchari
i.e., F. sacchari var sacchari and F. sacchari var subglu-
tinans, the former having mostly unseptate conidia in the
aerial mycelium, no sporodochia, while the latter with 1–3
septate conidia, macroconidia more commonly formed in
sporodochia. F. sacchari is also reported to be the causal
organism of pokkah boeng (Egan et al. 1997; Nirenberg
Sugar Tech (Jan-Mar 2011) 13(1):68–76 69

and O’Donnell 1998). Recent studies in Malaysia showed
that about 73% of the isolates recovered from pokkah bo-
eng infected canes are identified as three Fusarium species
in the Section Liseola viz. F. proliferatum, F. subglutinans
and F. sacchari and the other 27% belong to common
species of F. semitectum, F. equiseti and F. solani (Sid-
dique 2007).
Although various reports suggest that wilt is caused by
Fusarium, Singh and Singh (1974) reported isolation of
Acremonium implicatum and A. furcatum from wilt infec-
ted samples in subtropical India. They reported that fre-
quency of isolation of F. sacchari is more in roots and
internodal tissues while that of A. implicatum in the nodal
tissues. Hence they suggested that the former is a pathogen
of parenchymatous tissue and the latter of vascular tissues.
They found higher frequency of A. implicatum in the nodal
tissues, but does not prove that this pathogen gets trapped
in the nodal tissues because of anastomosis of vascular
strands. Additionally F. oxysporum has also been reported
as a causal organism of sugarcane wilt (Waraitch 1981).
It is clear that no systematic study has been done to sort
out the confusion on wilt pathogenicity in sugarcane.
Hence we have initiated detailed investigation on the
pathogen variability (Viswanathan et al. 2006). We failed
to recover Acremonium from nodal tissues from various
cane samples from tropical and subtropical regions and
only Fusarium could be recovered from both nodal and
internodal tissues. Hence further studies were conducted to
establish the identity the pathogen diversity of fungi
causing wilt in sugarcane and also parallel studies were
conducted to compare the pathogenic vs non pathogenic
Fusarium recovered from sugarcane stalk. Results of
pathogenic and molecular variation separated pathogenic
F. sacchari isolates from non-pathogenic F. proliferatum,
F. napiforme and F. subglutinans isolates and our studies
proved F. sacchari as the pathogen associated with sug-
arcane wilt for the first time.
Materials and Methods
Fungal Cultures and Pathogenicity Studies
Fifty of 262 of the Fusarium isolates recovered from wilt
infected sugarcane stalks collected from different states
were selected for molecular analysis. Fifty isolates
(Table 1) that belonged to different geographical location
and that differed extensively in its cultural and morpho-
logical characters viz., colour of the mycelium, arrange-
ment of spores, septation and shape of macroconidia were
selected for molecular studies. The standard plug method
used for inoculating Colletotrichum falcatum, red rot
pathogen in sugarcane (Viswanathan 2010) was followed
to inoculate and assess pathogenicity of Fusarium sp iso-
lates collected from different regions. In 8 months old
standing canes, a bore-hole was made at the third internode
from the base using a red rot inoculator and placed a
mycelial plug or 2–3 drops of spore suspension in the bore-
hole. Afterwards the bore-hole was replaced with the tissue
core in the inoculator and sealed the injury with plastic
clay.
Pathogen Inoculation on Cut Canes
Six month old canes (cv Co 86032) consisting of seven
internodes were inoculated with ten representative isolates

Table 1 List of 50 Fusarium isolates used in molecular studies

S. No State Isolates No. of isolates

1 Andhra Pradesh Fs 805 AP1L1, Fs 805 AP2L1, Fs 805 AP3L2, Fs 032 AP1L1, Fs 032 AP2L2, 9
Fs 009 AP, FsV 048 AP1, FsV 048 AP2, FsV 048 AP3
2 Arunachal Pradesh Fs LC ArP1 1
3 Assam Fs LC A1, Fs LC A2 2
4 Bihar FsBln 173 B1, FsBln 173 B2, FsBln 175 B1, FsBln 175 B2, FsBln 176 B1 5
5 Gujarat Fs 006 G1, Fs 006 G2, Fs 010 G, FsSi 071 G, FsV 102 G 5
6 Kerala FsNG 159K, FsNG 159 K4, Fs BT K1, Fs BT K2 4
7 Madhya Pradesh FsJn 964 MP1 1
8 Maharashtra Fs 032 M1L1, Fs 032 M2L2, Fs 012 M2 3
9 Orissa FsA 085 O1, FsA 085 O2, FsA 085 O3, FsA 085 O6 4
10 Punjab Fs 003 P1L1, Fs 003 P5L1, Fs 003 P6L2, Fs 120 P3 4
11 Tamil Nadu Fs 032 TN3L1, Fs 032 TN4L2, FsAVT 153 TN2, FsC 062 TN1, FsV 101 TN3L3, 10
Fs 032 TN8L4, Fs 003 TN, FsSi 071 TN1, Fs SF TN1, Fs 047 TN
12 Uttar Pradesh Fs 121 UP1 1
13 Haryana Fs 003 H1 1

123
70
viz., Fs 006 G1, Fs 805 AP2L1, FsA 085 O1, Fs 003 P1L1,
Fs 032 TN4L2, Fs 032 TN3L1, Fs 121 UP1, Fs 032 M2L2,
FsBln 176 B1 and Fs 003 H1 using a red rot inoculator.
Third internode was inoculated with spore suspension from
ten isolates separately. Three such canes were inoculated
for each isolate. The cut ends were sealed with molten wax
and progressive symptoms were recorded after 8 and
15 days.
Field Inoculation at Coimbatore
During 2008–2009 planting season the following varieties
viz., Co 419, Co 6304, Co 86032, Co 86249, CoC 90063,
CoC 671 and CoC 92061 were inoculated by plug method
with pathogen isolate Fs 032 TN4L2 by eighth month after
planting. Before and after pathogen inoculation drought
was imposed to favour disease development. More than 30
canes were subjected to pathogen inoculation in each
variety. The inoculated canes were evaluated for external
and internal symptoms at a periodical interval of 15 days.
Field Inoculation Under Endemic Location (Gujarat)
In Gujarat, 8 months old canes were inoculated by plug
method at an endemic location, Chalthan, Surat District
during 2007–2008 season. The varieties Co 0323, Co 0409,
Co 86032, Co 95020, Co 98010 and genotypes 94764,
985117, 987006 and 9851105 were inoculated with the
isolate Fs032G1 as spore suspension. The inoculated canes
were evaluated after 3 months. Intensity of pigmentation
and pithiness were recorded after splitting open the inoc-
ulated canes. The canes showing typical wilt were sub-
jected to reisolation of the pathogen and for molecular
characterization.
Confirmation of Pathogenic Wilt Isolates Through
Molecular Studies
A total of ten Fusarium isolates were used to confirm
pathogenicity with molecular markers and the details of the
isolates used in the study are as follows: five isolates col-
lected from the cvs Co 86002 (Fs002G1), Co 86032
(Fs032G1, Fs032G2, Fs032G) and Co 95006 (Fs006G1) in
wilt endemic areas, an avirulent (Fs032TN1L1) and a
virulent (Fs032TN4L2) isolates from the cv Co 86032 in
non-endemic region and recovered isolates of Fs032G,
Fs032TN1L1 and Fs032TN4L2 after artificial inoculation
from cane tissues of the cv Co 86032.
DNA Extraction from Wilt Pathogen(s)
The fungal cultures were grown on potato dextrose broth
(Himedia, Mumbai) by inoculating 200 ll of spore
123
Sugar Tech (Jan-Mar 2011) 13(1):68–76
suspension prepared from actively growing mycelia in
90 ml of broth. The culture flasks were placed stationary
and incubated at room temperature (*28°C) for
7–10 days. The fungal mat was filtered through cheese
cloth, blotted dry with sterile filter paper towels, and used
immediately for DNA extraction. Template DNA for PCR
was isolated by the method of DuTeau and Leslie (1991).
The mycelial mat (0.25 g) was ground in liquid nitrogen to
a fine powder and suspended with equal volume (1 ml) of
SDS buffer and further steps followed as per the routine
laboratory protocol. The final DNA pellet was washed
twice with 70% ethanol and suspended in TE buffer and
assessed for the purity and concentration before molecular
analysis.
Among the 34 sets of RAPD primers, OPA13 (50 -30 -
CAGCACCCAC), was selected based on its delineation of
F. sacchari from other Fusaria. Similarly among the 18
pairs of ISSR primers ISSR 5 and ISSR9 (Table 2) gave
clear demarcation of F. sacchari from others (Poongothai
2010). Hence these markers were used to confirm the
sugarcane wilt associated Fusarium grouping.
Random Amplified Polymorphic DNA Assays
RAPD reactions were typically performed in a total volume
of 25 ll, containing 19 PCR Buffer, 0.2 mM of each
dNTP, 3 mM MgCl2, 0.5 lM of a single RAPD primer
(Operon Technologies Ltd), 25 ng of genomic DNA tem-
plate, and 1 unit of Taq DNA polymerase. Amplification
was performed in a thermal cycler (Mastercycler gradient,
Eppendorf) programmed for 40 cycles (1 min at 94°C,
1 min at 36°C, and 2 min at 72°C) using the fastest
available transitions between each temperature. Initial
denaturation and final extension were at 94 and 72°C for
5 min, respectively. Amplified products were analyzed by
electrophoresis in 1.5% agarose gels.
Table 2 List of ISSR primers used with their sequences
Primer Sequence 50 –30 Annealing
pair temperature (°C)
ISSR1
SSR1 TGCTGTGTATGGATGGATGG 57
SSR1R CATGGTCGATAGCTTGTCTCAG
ISSR5
SSR5 GTGGACGAACACCTGCATC 57
SSR5R AGATCCTCCACCTCCACCTC
ISSR9
SSR9 GGTAGGAAATGACGAAGCTGAC 57
SSR9R TGAGCACTCTAGCACTCCAAAC
Sugar Tech (Jan-Mar 2011) 13(1):68–76 71

Analysis of Inter Specific Spacer Region formation. Overall, this result indicted the variation in
pathogenic characters among the isolates.
Three pairs of simple sequence repeat (SSR) primers (1st
Base, Malaysia) were used to amplify ISSR region.
Plug Method Inoculation at Coimbatore
Amplification reactions contained 19 PCR buffer, 1U Taq
polymerase, 0.2 mM each dNTP, 2 mM MgCl2, 0.5 lM
Of the seven varieties Co 419, Co 6304, Co 86032, Co
each primer and 25 ng of genomic DNA per 25 ll of
86249, CoC 90063, CoC 92061 and CoC 671 inoculated
reaction mixture. PCR reaction was performed in a ther-
during the year 2008–2009, the cvs Co 419 and CoC 92061
mocycler (Mastercycler gradient, Eppendorf). Initial
were found to be most susceptible followed by Co 6304
denaturation of 94°C for 4 min was followed by 35 cycles
(Fig. 1). Drought at pre and post inoculation period highly
of 94°C for 30 s, 57°C for 1 min (primer annealing), and
influenced the disease incidence. Variation in symptom
72°C for 1 min (primer extension) with a final extension of
development was high under normal conditions followed
7 min at 72°C. The amplified fragments were run on 1.5%
by drought (late drought) and complete drought conditions.
agarose gel.

Plug Method Inoculation Under Endemic Location

Results
In Vitro Inoculation on Cut Canes
The pathogenicity of the Fusarium isolates was recorded as
number of nodes crossed from the point of inoculation and
nature of wilt lesion on intermodal tissues. Among the
isolates, Fs 032 TN4L2 and Fs 121 UP1 were found to be
virulent compared to other isolates. The isolates moved 3–4
nodes by eighth day in both directions. The other isolates
Fs032TN3L1, FsBln176B1, Fs003H1, Fs805AP2L1, and
Fs006G1 also transgressed three nodes by 15 days indi-
cating their pathogenicity (Table 3). Similarly the isolates
Fs032TN4L2, Fs032TN3L1 and Fs006G1 caused severe
cavity formation in internodes, a typical disease symptom
and other isolates caused varying levels of pith cavity
Inoculated canes of cvs Co 95020, Co 98010 and Co 0323
showed typical wilt symptoms with boat shaped cavity
formation, pink discolouration and dehydration of the
canes (Fig. 2). The cv Co 86032 and genotype 94764
exhibited delayed symptoms of nodal discolouration and
pith formation. The wilt positive cultivars were subjected
to reisolation of the pathogen and characterization. Patho-
gen reisolation resulted in recovery of wilt pathogen with
similar molecular characters as that of original inoculum.
Inoculated canes in the subsequent year also showed pink
discolouration with boat shaped cavity formation in canes
at Chalthan (Data not shown). The results very clearly
evidenced that the disease can be induced in endemic
location by plug method without subjecting the plants to
different abiotic stresses. The varieties showed very clear

Table 3 Progress of wilt symptoms in cut canes of cv Co 86032 after inoculation of ten different Fusarium isolates by plug method
Isolates No. of nodes crossed (days) Nature of disease/lesion
Top Bottom Internodal discolouration (days) Pith formation (days) Cavity (days)
8 15 8 15 8 15 8 15 8 15

Fs 006 G1 1 3 1 3 - ?? - ? ?? ???
Fs 805 AP2L1 3 2 1 2 ? ?? - ? ?? ??
FsA 085 O1 1 2 - 1 - - - - ??? ?
Fs 003 P1L1 1 1 1 - - - - - ?? ?
Fs 032 TN4L2 4 4 3 4 ??? ??? ?? ?? ??? ???
Fs 032 TN3L1 1 3 1 3 ?? ?? ? ?? ??? ??
Fs 121 UP1 3 3 3 3 ? ? - ? ?? ??
Fs 032 M2L2 1 - 2 1 ?? ? - - ?? ??
FsBln 176 B1 1 1 2 5 ?? ? - ? ?? ?
Fs 003 H1 1 3 1 3 - ? - ? ? ??
? reddish orange pigmentation, pith formation:\0.3 cm, width:\0.5 cm; ?? reddish brown pigmentation, pith formation: 0.31–0.7 cm, width:
0.51–0.8 cm; ??? dark brown pigmentation, pith formation: 0.81–1 cm, width: [1 cm; – no symptoms

123
72
Fig. 1 Reproduction of typical
wilt symptoms in sugarcane
varieties at Coimbatore. Arrow
marks indicate the site of
pathogen inoculation
variation in their susceptibility and disease resistant vari-
eties remained symptoms free in endemic location.
Confirmation of Pathogenicity Through Molecular
Studies
RAPD markers OPA13, ISSR markers 1, 5 and 9 have
brought out a clear variation in the molecular profile of
pathogenic and non pathogenic Fusarium isolates. A band
of *1000 bp amplified by RAPD primer OPA 13 was used
to demarcate the virulent and avirulent pathotypes and
presence of this 1000 bp fragment in RAPD confirmed that
the isolate is virulent (Fig. 3a). Similarly absence of a
650 bp fragment to ISSR1 primer confirmed that the isolate
is non pathogenic and presence of a 720 bp fragment in
ISSR5 confirms that the isolate is pathogenic. Additionally
presence of a 880 bp fragment in ISSR9 further confirmed
that the isolate is virulent (Figs. 3b, 4). In IGS-RFLP
banding pattern of 1400 ? 900 ? 400 bp fragments were
observed with XhoI restriction in all the virulent patho-
types. Scaling up of this result with the molecular studies
of 50 isolates revealed that non pathogenic Fusarium iso-
lates were grouped out in a separate cluster (group B) and
pathogenic isolates were grouped together (group A) in the
dendrogram generated by RAPD and ISSR studies (Data
not shown). Molecular profile of non pathogenic isolates
further confirmed that non pathogenic isolates in group B
were of different species of Fusarium viz., F. verticillio-
ides, F. proliferatum and F. napiforme (Data not shown).
Pathogenic isolates collected from endemic location
such as Fs002G1, Fs006G1, Fs032G1, Fs032G2 and
Fs032G, weakly pathogenic (Fs032TN1L1) and highly
pathogenic (Fs032TN4L2) isolates from Tamil Nadu, a
non-endemic region, recovered cultures of Fs032TN1L1,
Fs032TN4L2 and Fs032G1 after artificial inoculation when
screened with ISSR5 primer showed that seven of them
123
Sugar Tech (Jan-Mar 2011) 13(1):68–76
have similar polymorphic profile. The non pathogenic
isolate and its recovered culture from sugarcane after
artificial inoculation showed absence of a 720 bp fragment.
Comparison of this result with molecular data of 50 isolates
showed absence of 720 bp fragment in 12 of 50 isolates
(Fig. 4). Majority of these isolates Fs 805 AP1L1, FsV 048
AP3, Fs 032 AP2L2, FsBln 175 B1, FsBln 175 B2, Fs 012
M1, Fs 003 TN clustered in group B of dendrogram further
confirmed that they represent non pathogenic profile of
isolates other than F. sacchari. However, F. sacchari iso-
lates that exhibited non pathogenic profile viz., Fs LC A1,
Fs 010 G, FsC 063 TN1 and Fs NG 159 K1 were grouped
in the cluster A which comprised all F. sacchari isolates
(Data not shown).
Discussion
Conflicting claims have been made regarding the true
causal organism of sugarcane wilt as species of Fusarium,
Cephalosporium and Acremonium by different authors.
Even though the disease was recorded long back with
substantial loss to sugarcane production, information on the
pathogen(s) involved and its variation, are not clearly
brought out. Association of C. sacchari (Butler and Khan
1913), Fusarium sp. (Abbott 1932; Luthra 1936), F. mon-
iliforme (Gibberella fujikuroi) (Mc Rae 1932), C. sacchari
along with Fusarium sp. (Bourne 1933), F. oxysporum
(Waraitch 1981), Acremonium implicatum, A. furcatum and
A. kiliense (Singh and Singh 1974; Sattar and Ali 1981)
were reported. Several workers (Martin-Leake 1944; Pad-
wick 1942; Rafay 1952; Subramaniam and Chona 1938)
considered that C. sacchari and F. moniliforme var subg-
lutinans are similar to each other, as the perfect stage for
both is G. fujikuroi. They also opined that several isolates
of F. moniliforme var subglutinans produce only
Sugar Tech (Jan-Mar 2011) 13(1):68–76
Fig. 2 Reproduction of typical wilt symptoms in sugarcane variety
Co 98010 at endemic location (Gujarat). a Fusarium sacchari
Fs032G1 inoculated cane showing typical symptoms of tissue
discolouration and pithiness of wilt. Arrow indicate point of
inoculation. b Reisolation of the pathogen from artificially inoculated
canes
Fig. 3 Confirmation of wilt pathogenicity of Fusarium in sugarcane
with molecular markers. a Discrimination of pathogenic and non
pathogenic isolates by RAPD marker OPA13M-High range ruler,
Lanes 1–10 amplification of genomic DNA from Fusarium isolates 1
Fs002G1, 2 Fs006G1, 3 Fs032G1, 4 Fs032G2, 5 Fs032G, 6
Fs032TN1L1, 7 Fs032TN4L2, 8 Fs032TN1L1 (recovered after
artificial inoculation), 9 Fs032TN4L2 (recovered after artificial
inoculation), 10 Fs032G1 (recovered after artificial inoculation).
73
microconidia in normal culture and may be referred to as
Cephalosporium sp. Agnihotri and Singh (1989) also
encountered such isolate of F. moniliforme var subglutin-
ans which hardly produces septate conidia under normal
conditions. Probably due to such conditions, F. monili-
forme var subglutinans was wrongly identified as C. sac-
chari. These confusions have been sorted out by the studies
of Gams (1971) and Nirenberg (1976). They have estab-
lished that F. sacchari causes sugarcane wilt. However,
further studies to establish the associated pathogen with the
disease, pathogenicity and pathogenic variation are com-
pletely lacking. Overall, previous studies showed that
Fusarium sp is associated with sugarcane wilt except few
reports on Acremonium. Species of Acremonium are com-
mon in substrates such as soil, plant debris, and rotting
mushrooms. Also we failed in our earlier studies to recover
Acremonium from nodal tissues from various cane samples
from tropical and subtropical regions and only Fusarium
were recovered from both nodal and internodal tissues
(Viswanathan et al. 2006). Cultural and morphological
characteristics of majority of 263 isolates from different
regions revealed that F. sacchari is the most commonly
isolated wilt fungi in sugarcane. Similarly molecular
studies using RAPD/ISSR markers, IGS-RFLP and ITS
sequencing also established that most of the Fusarium
recovered from wilted sugarcane are F. sacchari except a
few which belonged to F. verticillioides, F. proliferatum
Lanes 6 and 8 were found to be non pathogenic. b. Discrimination of
pathogenic and non pathogenic isolates by ISSR markers M High
range ruler, Lanes 1–9 represent amplification of genomic DNA from
pathogens isolated from varieties: 1 Fs002G1, 2 Fs006G1, 3
Fs032G1, 4 Fs032G2, 5 Fs032TN1L1, 6 Fs032TN4L2, 7
Fs032TN1L1 (recovered after artificial inoculation), 8 Fs032TN4L2
(recovered after artificial inoculation), 9 Fs032G1 (recovered after
artificial inoculation), 5 and 7 were found to be non pathogenic
123
74
Fig. 4 Comparison of pathogenic markers identified with ISSR5
molecular profile of 50 different isolates. a. Polymorphic profile of 50
Fusarium isolates to ISSR primer 5 on a 1.5% agarose gel. Lanes
1–50 represent Fusarium isolate: 1 FsSi 071 G, 2 FsV 102 G, 3 Fs 010
G, 4 Fs 006 G1, 5 Fs 006 G2, 6 Fs 805 AP1L1, 7 Fs 805 AP2L1, 8 Fs
032 AP1L1, 9 Fs 805 AP3L2, 10 FsV 048 AP1, 11 FsV 048 AP2, 12
FsV 048 AP3, 13 Fs 032 AP2L2, 14 Fs 009 AP, 15 FsA 085 O1, 16
FsA 085 O2, 17 FsA 085 O3, 18 FsA 085 O6, 19 Fs 003 P1L1, 20 Fs
003 P5L1, 21 Fs 003 P6L2, 22 Fs 120 P3, 23 Fs 003 H1, 24 Fs 121
UP1, 25 FsJn 964 MP1, 26 Fs LC A1, 27 Fs LC A2, 28 Fs LC ArP1,
29 FsBln 173 B1, 30 FsBln 173 B2, 31 FsBln 175 B1, 32 FsBln 175
B2, 33 FsBln 176 B1, 34 Fs 032 M1L1, 35 Fs 032 M2 L2, 36 Fs 012
M1, 37 FsNG 159 K1, 38 FsNG 159 K4, 39 Fs BT K1, 40 Fs BT K2,
41 Fs 032 TN3L1, 42 Fs 032 TN4L2, 43 FsC 063 TN1, 44 FsAVT
and F. napiforme (Poongothai 2010). Further studies were
made to confirm the Fusarium isolates recovered from
wilted canes using molecular tools.
Plug method of inoculation is a well established tech-
nique to reproduce red rot caused by C. falcatum, a stalk
pathogen. Hence scientists who worked on sugarcane wilt
also attempted the same method to induce wilt (Mohanraj
and Alexander 1984; Singh and Singh 1974). Sattar and Ali
(1981) inoculated wilt pathogens on cut canes by the
method of spore suspension. The present study of pathogen
inoculation combined with drought under field conditions
revealed reproduction of typical wilt symptoms in cvs Co
6304, Co 86249, CoC 90063 and CoC 92061. Weakening
of the host tissue by an abiotic factor like drought favours
pathogen entry in some cultivars in inducing the disease.
This situation reflects the observations made during disease
surveys, where pre-monsoon drought followed by water-
logging in the field during monsoon increases the wilt
severity in India (Viswanathan, unpublished). Similarly
123
Sugar Tech (Jan-Mar 2011) 13(1):68–76
153 TN2, 45 FsV 101 TN3L3, 46 Fs 032 TN8L4, 47 Fs 003 TN, 48
FsSi 071 TN1, 49 Fs SF TN1, 50 Fs 047 TN, M Genei high range
ladder, b M high range ruler, Lanes 1–9, Polymorphic profile of
Fusarium isolates to ISSR primer 5. 1 Fs002G1, 2 Fs006G1, 3
Fs032G1, 4 Fs032G2, 5 Fs032G, 6 Fs032TN4L2, 7 Fs032TN1L1, 8
Fs032TN4L2 (recovered after artificial inoculation), 9 Fs032G1
(recovered after artificial inoculation). Lane 7 was non pathogenic.
Eight of the nine isolates have similar profile and the non pathogenic
isolate differed from other pathogenic isolates by the absence of a
720 bp fragment. Comparison of this result with molecular data of 50
isolates showed that 12 of 50 isolates corresponding to lanes 3, 6, 12,
13, 19, 26, 31, 32, 36, 37, 43, 48 and 50 exhibited absence of 720 bp
fragment
inoculation of wilt isolates in the wilt endemic region
established that the isolates are pathogenic on many cul-
tivars. This proved that pathogen entry is favoured by
existing climatic conditions and other environmental fac-
tors prevailing there in governing the disease build up.
Further studies are needed to identify the key factors
enhancing the disease severity in endemic situations.
The pathogenic variation among ten isolates differed
significantly on a susceptible cultivar. The differences
could be due to varying behavior of the susceptible cv Co
86032 to the isolates or lack of specific environment/abi-
otic stress factor(s) in the treated conditions. Koch’s pos-
tulate is proved by isolation of the pathogen from infected
canes and reproduction of the disease by artificial inocu-
lation of the isolated pathogen. Reisolation of the patho-
genic and nonpathogenic isolates from the artificially
inoculated canes and molecular characterization using
RAPD and ISSR markers confirmed that variation in
molecular profile of the isolates correlated with
Sugar Tech (Jan-Mar 2011) 13(1):68–76
pathogenicity and taxonomy. Clustering of Fusarium iso-
lates in RAPD, IGS-RFLP and ISSR revealed that isolates
that belonged to species of F. moniliforme, F. proliferatum,
F. napiforme or F. subglutinans were non pathogenic or
less virulent (Poongothai 2010). However, certain strains of
F. sacchari were also non pathogenic on sugarcane. Exis-
tence of non-pathogenic Fusaria is also common in many
other wilt pathogens. Ma et al. (2010) work on transposable
elements points out that mobile chromosomes convert non
pathogenic strain into a pathogenic one. This points out the
reason for several workers were unable to reproduce the
disease and wilt develops suddenly in an environment.
The study on pathogenicity clearly points out that once
the pathogen gets access into the host, it causes severe
damage to the crop. But pathogen entry into the host
remains a mystery. Under favourable environmental con-
ditions, the pathogen enters the plant system and causes
severe losses. Plug method of inoculation proved as the
best to induce the disease but disease could not be repro-
duced satisfactorily earlier by several workers. Our finding
resolves the problem in reproducing the disease in the field
by imposing abiotic stresses on the crop in non endemic
zones also. Further studies on pathogenic variability would
characterize the pathogen into more meaningful groups.
The present study solved nearly 100 year old confusions
that existed on the causative agent of sugarcane wilt.
Macroconidia production is a key factor that separates the
genus Fusarium and Acremonium. Mere observation of
growth character or conidia lead to wrong diagnosis of the
pathogen as some mutated strains of Fusarium are also
slow in growth as Acremonium and macroconidia produc-
tion is sparse that is probably overlooked by the earlier
workers. During the current season, sudden outbreak of
pokkah boeng across the country was noticed on several
varieties. It was found that Fusarium sp associated with
pokkah boeng also causes stalk infections and produces
wilt on some varieties (Viswanathan, unpublished). Hence,
further studies are in progress using molecular tools to
characterize Fusarium associated with pokkah boeng, a
foliar disease along with wilt causing stalk pathogens. In
this regard, report from Malaysia by Siddique (2007) also
suggests that F. sacchari is one of the major Fusarium spp.
associated with pokkah boeng. It is expected that further
studies would bring a new dimension on the Fusaria
associated with pokkah beong and wilt and epidemiology
of wilt in sugarcane, especially on survival of F. sacchari
and its possible manifestation as foliar as well as stalk
disease.
Acknowledgments The authors grateful to Dr. N. Vijayan Nair, the
Director of the Institute, for providing facilities and encouragement.
Financial support received from ICAR, New Delhi as Network Pro-
ject is also acknowledged.
75
References
Abbott, E.V. 1932. Seed rots of sugarcane in Louisiana. In
Proceedings of International Society for Sugar Cane Technol-
ogists, 4th Congress Bulletin, 48: 1–2.
Agnihotri, V.P., and G.P. Rao. 2002. A century status of sugarcane
wilt in India. In Sugarcane crop management, ed. S.B. Singh,
G.P. Rao, and S. Eswaramoorthy, 145–160. Houston, TX:
SciTech Publishing LLC.
Agnihotri, V.P., and R.P. Singh. 1989. Sugarcane wilt current status.
In Prospective in plant pathology, ed. V.P. Agnihotri, N. Singh,
H.S. Chaube, U.S. Singh, and T.S. Dwivedi, 227–237. New
Delhi, India: Today and Tomorrow’s Printers and Publishers.
Bourne, B.A. 1922. Researches on the root diseases of sugarcane.
Barbados: Advocate Co. Ltd., 1–17.
Bourne, B.A. 1933. Sugarcane breeding experiments. Annual
Research Report for the Florida Agricultural Experiment
Stations, Florida, 180–181.
Butler, E.J., and A.H. Khan. 1913. Some new sugarcane diseases. Part
I, wilt. Memoirs of the Department of Agriculture in India,
Botanical Series 6: 180–190.
DuTeau, N.M., and J.F. Leslie. 1991. A simple, rapid procedure for
the isolation of DNA for PCR from Gibberella fujikuroi
(Fusarium section Liseola). Fungal Genetics Newsletter 38: 72.
Egan, B.T., R.C. Magarey, and B.J. Croft. 1997. Sugarcane. In Soil
borne diseases of tropical crops, ed. R.J. Hillocks, and J.M.
Walker, 277–302. Wallingford, Oxon: CAB International.
Gams, W. 1971. Cephalosporium-artige Schimmelpilze (Hyphomyce-
tes). Stuttgart, Germany: Gustav Fischer Verlag.
Luthra, J.C. 1936. Some new diseases of sugarcane discovered in the
Punjab. International Bulletin of Plant Protection 10: 261–262.
Ma, L., H.C. van der Does, K.A. Borkovich, Coleman, et al. 2010.
Comparative genomics reveals mobile pathogenicity chromo-
somes in Fusarium. Nature 464: 367–373.
Martin-Leake, H. 1944. Red rot of the sugarcane. International Sugar
Journal 46(541): 7–8.
Mc Rae, W. 1932. Report of the imperial mycologist. Scientific
reports of the Imperial Institute of Agricultural Research, Pusa,
28–36.
Mohanraj, D., and K.C. Alexander. 1984. A qualitative numerical
index for rating severity in sugarcane wilt. Indian Journal of
Sugar Crops 10: 19–20.
Nirenberg, H.I. 1976. Untersuchungen über die morphologische und
biologische Differenzierung in der Fusarium Sektion Liseola.
Mitteilungen aus der Biologischen Bundesanstalt Für Land- und
Forstwirtschaft (Berlin—Dahlem), vol. 169, 1–117.
Nirenberg, H.I., and K. O’Donnell. 1998. New Fusarium species and
combinations within the Gibberella fujikuroi species complex.
Mycologia 90: 434–458.
Padwick, G.W. 1942. Scientific reports of the Indian Agricultural
Research Institute, New Delhi, 1940–1941.
Poongothai, M. 2010. Cultural, morphological, molecular and path-
ogenic characterization of pathogen(s) causing sugarcane wilt in
India. PhD Thesis, Bharathiyar University, Coimbatore, India.
Rafay, S.A. 1952. Wilt disease of sugarcane. Sugarcane Research
Station, Pusa, Bihar (India) Science Bulletin, 2, 30.
Sattar, M.A., and S. Ali. 1981. Etiology of wilt disease of sugarcane.
Sugarcane Pathologists’ Newsletter 26: 35–37.
Siddique, S.N. 2007. Pathogenicity and aethiology of Fusarium
species associated with pokkah boeng disease on sugarcane.
Thesis, University of Malaysia, Malaysia.
Singh, K., and R.P. Singh. 1974. Involvement and pathogenicity of
Acremonium in wilt syndrome of sugarcane. Sugarcane Pathol-
ogists’ Newsletter 11(12): 24–25.
123
76
Subramaniam, L.S., and B.L. Chona. 1938. Notes on Cephalosporium
sacchari causal organism of sugarcane wilt. Indian Journal of
Agricultural Sciences 8: 189–190.
Viswanathan, R. 2010. Plant disease: Red rot of sugarcane. New
Delhi: Anmol Publishers, India.
Viswanathan, R., and P. Padmanaban. 2008. Hand book on sugarcane
diseases and their management, 80. Sugarcane Breeding Insti-
tute, Coimbatore, India.
123
Sugar Tech (Jan-Mar 2011) 13(1):68–76
Viswanathan, R., P. Malathi, A. Ramesh Sundar, M. Poongothai, and
N. Singh. 2006. Current status of sugarcane wilt in India. Sugar
Cane International 24(4): 1–7.
Waraitch, K.S. 1981. Wilt disease in Co 1148 in Punjab and
assessment of losses caused by it. Indian Sugar 31: 37–40.