Sugar Tech
DOI 10.1007/s12355-017-0552-4
RESEARCH ARTICLE
Epidemiology of Fusarium Diseases in Sugarcane: A New
Discovery of Same Fusarium sacchari Causing Two Distinct
Diseases, Wilt and Pokkah Boeng
R. Viswanathan1 • C. G. Balaji1 • R. Selvakumar1 • P. Malathi1 • A. Ramesh Sundar1
C. Naveen Prasanth1 • M. L. Chhabra2 • B. Parameswari2
Received: 30 June 2017 / Accepted: 5 September 2017
Ó Society for Sugar Research & Promotion 2017
Abstract Sugarcane, an important field crop, is cultivated
under tropical and subtropical regions around the world.
Fusarium sacchari causing wilt, is a stalk disease, inflicting
severe damage to the crop in India and other countries.
Similarly, pokkah boeng (PB) a foliar disease caused by
different species of Fusarium also infects the crop
throughout the world. In India, both the diseases occur in
different states in various sugarcane varieties. Although
both diseases occur independently in the field, we recorded
that they occur together in a plant. Hence, a detailed
investigation was conducted to characterize different
Fusarium isolates from wilt- and PB-affected sugarcane
varieties by sequencing TEF1-a gene. Gene sequencing of
48 isolates revealed that 44 were of F. sacchari and the
remaining four belonged to F. proliferatum. Of the four F.
proliferatum, three were associated with PB and one with
wilt. Almost all the 41 wilt-associated isolates belonged to
F. sacchari. Investigation carried out to identify Fusarium
isolates from the plants exhibiting both the wilt and the PB
in two varieties Co 0238 and MS 901 revealed that only F.
sacchari caused wilt and PB symptoms in both. Further,
several varieties showed progressive disease severity
through different phases of PB and that resulted in wilt
development. The results clearly established for the first
time that the same fungal pathogen systematically infects
sugarcane plant and exhibits both the diseases.
& R. Viswanathan
rasaviswanathan@yahoo.co.in
1
Division of Crop Protection, ICAR-Sugarcane Breeding
Institute, Coimbatore 641007, India
2
ICAR-Sugarcane Breeding Institute Regional Centre, Karnal
132001, India
•
Keywords Sugarcane
Wilt
Pokkah boeng

Fusarium sacchari, TEF1-a
Introduction
Wilt of sugarcane was recorded more than 100 years ago in
India, since then it caused enormous damage to cane cul-
tivation in the country (Viswanathan 2013). Recent studies
conducted at the Institute revealed occurrence of the dis-
ease in almost all the sugarcane growing states in the
country to varying intensities. Many of the popular vari-
eties under cultivation were affected by the disease (Vis-
wanathan 2012; Viswanathan et al. 2006). Detailed
characterization of the wilt-associated pathogen in the
country using cultural, morphological and molecular tools
clearly established that only Fusarium sacchari is the
causative organization of the disease (Poongothai et al.
2014a, b, 2015; Viswanathan et al. 2011, 2012). Earlier
studies in India reported that the disease occurs during
4–5 months or later in the crop (Agnihotri 1983; Rao and
Agnihotri 2000). However, studies of Viswanathan (2013)
clearly revealed that apart from its severe expression dur-
ing grand growth/maturity phases of the crop in the field,
wilt occurs during germination and tillering phases in
sugarcane. The same study very clearly demonstrated death
of settlings in sugarcane is due to wilt in the mother setts.
Studies of Viswanathan et al. (2015) also revealed wilt
development during germination phase in sugarcane.
Wakker and Went (1896) first observed and character-
ized pokkah boeng (PB) in sugarcane in Java, and the term
‘pokkah boeng’ is a ‘Javanese term’ that refers to mal-
formed or distorted top. The disease is one of the most
serious fungal diseases in most, if not all, sugarcane pro-
ducing areas of the world (Whittle and Irawan 2000). The
123

disease is reported to be caused by different species of
Fusarium such as F. sacchari, F. verticillioides, F.
andiyazi, F. subglutinans and F. semitectum in different
countries (Lin et al. 2014, 2015; McFarlane et al. 2009;
Nordahliawate et al. 2008; Taher Khani et al. 2013; Zain-
udin et al. 2009). In India, also PB occurs in all the sug-
arcane growing states with different disease severities
(Viswanathan 2012; Vishwakarma et al. 2013). Recently,
severe outbreak of PB was recorded in National
Hybridization Garden (NHG) of the Institute which houses
more than 600 sugarcane parental clones of diverse origin
to make biparental crossing. It was also found that apart
from independent occurrences of PB and wilt in these
different parental clones, there were also instances where
same cane is affected by both the diseases (Viswanathan
et al. 2014). Earlier also, Viswanathan (2013) recorded wilt
development after PB occurrences in sugarcane and he
opined that the same pathogen might cause both the dis-
eases in sugarcane. Hence, further studies were conducted
to characterize Fusarium spp. associated with wilt and PB
in sugarcane with an objective of does the same Fusarium
sp. cause both the diseases using conventional and
molecular tools. The studies established for the first time
that under Indian scenario, F. sacchari is the major cau-
sative agent of both wilt and PB and the same pathogen
causes the two diseases in a sugarcane plant.
Materials and Methods
Epidemiological Studies for Wilt and PB Expression
in Sugarcane Varieties
Observations were made on the status of PB in sugarcane
varietal collections maintained at the Institute during the
2015–2016 and 2016–2017 seasons. Occurrences of four
different phases of PB incidences viz., chlorotic, acute,
knife-cut and top rot phases were recorded up to grand
growth stages in the field. Simultaneously, appearance of
wilt symptoms in different PB-affected sugarcane varieties
was recorded. Pathogen isolation was made from both PB-
and wilt-affected tissues by following standard mycologi-
cal procedures. Selected isolates were subjected to Fusar-
ium sp. confirmation by PCR assays for termination
elongation factor 1-alpha (TEF1-a) gene amplification and
sequencing.
Termination Elongation Factor (TEF) Gene
Amplification and Sequencing
Genomic DNA was extracted from mycelial mats of
Fusarium isolates grown on potato dextrose broth for
7 days by using SDS extraction buffer. We found DNA
123
Sugar Tech
extraction by this method was better than CTAB method.
Primers targeting Translation elongation factor 1-alpha
(TEF1-a) gene (forward TCTGCCATCGAAACCCTCAC;
reverse GACGGTGACATAGTAGCGGG) were designed
from the conserved region of the gene, and PCR reactions
were performed in a 25 ll PCR reaction mixture. Ampli-
fication conditions for the TEF gene consisted of an initial
denaturation step of 5 min at 94 °C, followed by 35 cycles
of 94 °C for 1 min, 55 °C for 30 s, 72 °C for 1 min and a
final extension step of 10 min at 72 °C (Mastercycler
gradient, Eppendorf) followed by electrophoresis on 1.0%
agarose gels. PCR products were visualized by staining
with EtBr. PCR-amplified DNA fragments were purified
and sequenced. The sequences of 48 isolates were com-
pared with GenBank database using BLASTn.
Results
Expression of PB and Wilt Symptoms in Sugarcane
Appearance of PB symptoms in different varieties was
noticed 3 months after planting till 1 year or harvest of the
crop. At the time of disease notice, most of the varieties
exhibited chronic phase of the disease. However, we
observed disease progress in a different way such as pro-
gress of the disease from chronic phase of PB to systemic
yellowing followed by wilt in many varieties (Table 1).
During the chronic phase, only few leaves in the crown
region showed malformation with chlorotic patches and
fungal growth on the leaf lamina/sheath (Fig. 1a). Subse-
quently, the affected leaves one by one showed complete
yellowing and drying (Fig. 1b). This has resulted in sys-
temic yellowing and drying of leaves. Overall, now the
disease phase has changed to wilt from PB (Fig. 1c). The
process of such shift in the disease occurred between 4 and
8 months after planting in the field in the varieties such as
C 79218, Co 86002, Co 86027, Co 86032, Co 89003, Co
94008, Co 94012, Co 99004, Co 2000-10, Co 0238, CoC
671, CoC 90063, CoJ 72, BO 106 and MS 901 (Table 1).
The systemically disease-affected canes with foliage dry-
ing exhibited typical wilt symptoms of discolouration of
the stalk tissue with pith cavities. In case of the cv CoN
12074, downward and upward progress of Fusarium
infection and wilt from the shortened internodes of PB-
affected canes was observed (Fig. 2). Similar to systemic
infection of Fusarium from chronic phase of PB to wilt in
sugarcane, we made detailed studies on Fusarium infection
from knife-cut phase of wilt and top rot. In the cvs Co
87023 and MS 901, progress of wilt from knife-cut phase
was documented. These varieties exhibited knife-cut inju-
ries of various sizes accompanied by sprouting of axillary
buds. The knife cuts had a depth of up to 20 mm, and the
Sugar Tech

Table 1 Fusarium isolates recovered from sugarcane and their identity after nucleotide BLAST analysis based on their TEF1-a gene sequences
S. no. Isolate Variety Location Year Species

Wilt-associated (stalk infecting) isolates

1. Fs419V1 Co 419 Vedapatti, Coimbatore 2014 F. sacchari
2. Fs740V11 Co 740 Vedapatti, Coimbatore 2015 F. sacchari
3. Fs775V17 (15/16) Co 775 Vedapatti, Coimbatore 2015 F. sacchari
4. Fs2174N32 Co 62174 NHG, Coimbatore 2016 F. sacchari
5. Fs219TN3 Co 7219 Vedapatti, Coimbatore 2015 F. sacchari
6. Fs219N39 Co 7219 NHG, Coimbatore 2016 F. sacchari
7. Fs002V21 Co 86002 Vedapatti, Coimbatore 2015 F. sacchari
8. Fs010V19-1 Co 86010 Vedapatti, Coimbatore 2015 F. sacchari
9. Fs010V19-2 Co 86010 Vedapatti, Coimbatore 2016 F. sacchari
10. Fs86032E2 Co 86032 Erode, Tamil Nadu 2015 F. proliferatum
11. Fs032G Co 86032 Bardoli, Gujarat 2004 F. sacchari
12. Fs86032E8 Co 86032 Erode, Tamil Nadu 2015 F. sacchari
13. Fs023N39 Co 87023 NHG, Coimbatore 2016 F. sacchari
14. Fs023V42 Co 87023 Vedapatti, Coimbatore 2016 F. sacchari
15. Fs003H1 Co 89003 Karnal, Haryana 2005 F. sacchari
16. Fs012N11 Co 94012 NHG, Coimbatore 2015 F. sacchari
17. Fs010V8 Co 98010 Vedapatti, Coimbatore 2015 F. sacchari
18. Fs0238N2 Co 0238 NHG, Coimbatore 2015 F. sacchari
19. FsJ70N29 CoJ 70 NHG, Coimbatore 2015 F. sacchari
20. FsJa270V12 CoJaw 270 Vedapatti, Coimbatore 2015 F. sacchari
21. FsJn151N40 CoJn 80151 NHG, Coimbatore 2015 F. sacchari
22. FsM121V23 CoM 88121 Vedapatti, Coimbatore 2015 F. sacchari
23. FsN071V22 CoN 05071 Vedapatti, Coimbatore 2015 F. sacchari
24. FsOr152V6 CoOr 03152 Vedapatti, Coimbatore 2015 F. sacchari
25. FsT201V24 CoT 8201 Vedapatti, Coimbatore 2015 F. sacchari
26. FsPB181N10 CoPb 09181 NHG, Coimbatore 2015 F. sacchari
27. FsS264 N17 CoS 97264 NHG, Coimbatore 2015 F. sacchari
28. FsS423N11 CoSe 92423 NHG, Coimbatore 2015 F. sacchari
29. FsSe422N3 CoSe 95422 Vedapatti, Coimbatore 2014 F. sacchari
30. FsSnk632N26 CoSnk 03632 NHG, Coimbatore 2016 F. sacchari
31. FsC218N38 C 79218 NHG, Coimbatore 2015 F. sacchari
32. FsC218N38 C 79218 Vedapatti, Coimbatore 2016 F. sacchari
33. FsE005T11 EB10005 Kottur, Thanjavur 2015 F. sacchari
34. FsIH41N15 ISH 41 NHG, Coimbatore 2015 F. sacchari
35. FsI100N9 ISH 100 NHG, Coimbatore 2015 F. sacchari
36. FsKAKK3 Kakhai Kannur, Kerala 2015 F. sacchari
37. FsLG04N22 LG 06604 NHG, Coimbatore 2015 F. sacchari
38. Fs901N16 MS 901 NHG, Coimbatore 2015 F. sacchari
39. Fs901V7* MS 901 Vedapatti, Coimbatore 2015 F. sacchari
40. Fs901V9* MS 901 Vedapatti, Coimbatore 2015 F. saccharia
41. FsSi-308T3 SI 308 Theni, Tamil Nadu 2015 F. sacchari
Pokkah boeng-associated (leaf infecting) isolates
42. Fs86027U3 Co 86027 Udumalpet, Tiruppur 2011 F. proliferatum
43. Fs0238N2 Co 0238 NHG, Coimbatore 2016 F. sacchari
44. Fspbj83N19 CoJ 83 NHG, Coimbatore 2016 F. sacchari
45. Fs901V6* MS 901 Vedapatti, Coimbatore 2015 F. saccharib
46. FsSi02P7 Si 2000-02 Palakudi, Thanjavur 2016 F. sacchari

123
 Sugar Tech

Table 1 continued
S. no. Isolate Variety Location Year Species

47. FsSi-308T6 SI 308 Andipatti, Theni 2015 F. proliferatum

48. Fs28NGK7 28NG263 Kannur, Kerala 2015 F. proliferatum
a b
* Different isolates from same plant exhbiting wilt and pokkah boeng Fusarium isolated from affected root, Fusarium isolated from affected
leaf sheath

Fig. 1 Stage shift of foliage infection to systemic wilt in sugarcane cv CoC 671. a Pokkah boeng phase, b leaves in the crown showing infection
and discolouration and c affected plants show systemic yellowing of leaves

cavities on the stalks occupied almost entire core tissues. In
many canes, such bud sprouts appeared as branched canes
with robust growth (Fig. 3a, b). In such cane stalks also, we
witnessed progress of wilt from the affected internode
(Fig. 4). Pathogen isolation has been made from affected
tissues of leaf lamina, spindle tissue with top rot, stalks,
roots, leaf sheath etc. from many varieties to confirm the
pathogen association (Fig. 5). Shift in disease development
from PB phase to systemic wilt in sugarcane has not been
described earlier, and it is the first such report on occur-
rence of both diseases together in this crop.
PCR Assays and Identifying Associated Fusarium
sp.
PCR assays conducted with TEF1-a gene primers specifi-
cally amplified predicted 496-bp amplicons from the
purified Fusarium isolates. Both stalk and leaf isolates of
Fusarium from the cvs Co 0238 and MS 901 exhibited
amplicons of 496 bp in the gel (Fig. 6). Similarly, a set of
44 Fusarium isolates from stalk and leaf were subjected to
PCR assays and confirmed amplification of the PCR
product. Further studies were conducted to sequence the
amplicons to identify the associated Fusarium sp. with the
two diseases. Sequencing of the amplicons and BLASTn
results of the isolates revealed that of the 48 isolates, 44
belonged to F. sacchari and four belonged to F. prolifer-
atum (Table 1). The molecular assays very clearly estab-
lished that most of the wilt- and PB-associated isolates
belonged to F. sacchari. Among the 41 isolates from the
stalk tissues of different sugarcane varieties, 40 were F.
sacchari and only one isolate from Erode was found to be
F. proliferatum. Of the seven PB-associated Fusarium, four
were found to be F. sacchari and three F. proliferatum.
Three isolates of F. proliferatum associated with PB were
originated from Theni and Tiruppur Districts in Tamil
Nadu and Kannur in Kerala. Similarly, another F. prolif-
eratum isolate associated with wilt in Co 86032 was iso-
lated from Erode District. These studies indicated that all
the pathogenic isolates associated with wilt or PB from
Coimbatore belonged to F. sacchari. Both stalk and leaf
isolates of Fusarium from the cvs Co 0238 and MS 901
were found to be F. sacchari. The study also established
that almost all the wilt-associated pathogenic fungal iso-
lates from diverse locations in the country belonged to F.
sacchari.

123
Sugar Tech
Fig. 2 Development of typical wilt in stalks of sugarcane cv CoN
12074 from pokkah boeng-affected internode. The shortened intern-
odes are encircled
Discussion
Initially, Gibberella fujikuroi (Sawada) was reported as the
PB-associated pathogen (Sheldon et al. 1904). Later, in
Java, Bolle (1927) reported F. verticillioides (F. monili-
forme) as the causative pathogen. In the recent decades,
association of several species of Fusarium, including F.
verticillioides (Martin et al. 1989; Mohammadi et al.
2012), F. sacchari (Nordahliawate et al. 2008), F. prolif-
eratum and F. subglutinans (Taher Khani et al. 2013), F.
verticillioides or F. subglutinans (McFarlane and
Rutherford 2005), F. verticillioides and G. fujikuroi (Gi-
atgong 1980), F. sacchari, F. proliferatum and F. andiyazi
(Govender et al. 2010) and F. verticillioides and F. pro-
liferatum (Lin et al. (2014), was reported as the causal
agents of PB.
Nordahliawate et al. (2008) studied F. sacchari associ-
ated with PB throughout Peninsular Malaysia and identified
the causal organism using morphological characteristics.
They also established pathogenicity of F. sacchari based
on Koch’s postulates. Recently, Taher Khani et al. (2013)
categorized Fusarium spp. associated with PB in Iran into
F. verticillioides, F. proliferatum, F. subglutinans and F.
semitectum with 55, 21.5, 17.6 and 5.9% frequencies,
respectively. Their pathogenicity studies with these fungi
indicated that all the isolates were pathogenic to sugarcane
except isolates of F. semitectum. Among the pathogenic
isolates, F. proliferatum was less pathogenic than F. ver-
ticillioides and F. subglutinans. This is the first report of
the pathogenicity of F. proliferatum on sugarcane in the
world. Recently, Rosas-Guevara et al. (2014) reported
association of F. verticillioides and F. proliferatum with
sugarcane PB samples collected from four states of Mexico
and characterized that 95.7% of the 70 isolates as F. pro-
liferatum and the rest 4.3% as F. verticillioides.
In India, PB was first recorded during 1930s and 1940s.
Severe incidences of the disease were reported from
Maharashtra, and subsequently, PB was reported from
other states like Assam, Karnataka, Uttar Pradesh, Gujarat,
Madhya Pradesh and Andhra Pradesh (Patil et al. 2007;
Viswanathan 2012). Vishwakarma et al. (2013) recently
reported that the PB severity increased in the country based
on detailed surveys during 2007–2013. PB has been
reported as a major threat in sugarcane cultivation in China
(Lin et al. 2014). Studies of Govender et al. (2010) in South
Africa revealed that PB-associated F. sacchari caused
characteristic bend symptoms in sugarcane stalks. Simi-
larly, findings of Taher Khani et al. (2013) revealed that
Fusarium spp. isolated from PB-affected leaves caused
mild-to-moderate symptoms on the stalks as reddish purple
discolouration in Iran. Earlier studies of Nordahliawate
et al. (2008) found that only isolates of F. sacchari caused
PB in sugarcane in pathogenicity studies in Malaysia and
isolates of F. proliferation and F. subglutinans were not
pathogenic. They also found that F. sacchari inoculation
caused death of pathogen-inoculated plants. In these stud-
ies, although they did not explore the possibility of wilt
development in sugarcane stalks by the PB-associated
Fusarium, the results showed damages caused by the fun-
gal isolates on the stalk tissues. Probably here also the
plants may have apparent systemic infection caused by F.
sacchari as seen under Indian conditions.
It is well known that acute phase of PB causes death of
apical meristem accompanied by dead heart symptoms in
123

Fig. 3 Pokkah boeng-affected
canes exhibit knife-cut
symptoms (encircled) and
axillary shoots from bud
sprouts. a cv MS 901, b cv Co
87023
the whorl. Such damages during grand growth phase of the
crop lead to top rot symptoms accompanied by sprouting of
axillary buds in the top nodes (Viswanathan 2013). We also
witnessed under field conditions that the pathogen causing
top rot symptoms further invades stalk tissues systemically
and causes typical wilt symptoms on the top internodes.
This clearly indicates that the same F. sacchari isolate
causes PB at first and then depending on the prevailing
environment and/or host variety causes wilt. Earlier, Vis-
wanathan et al. (2014) reported inoculation of Fusarium
isolates associated with PB from the varieties Co 8371, Co
99004 and CoC 671 caused systemic yellowing of leaves
suggesting that inoculated pathogen from the crown region
progressed into stalk and caused yellowing of leaves as has
been witnessed in the present study. Furthermore, planting
of wilt-affected seed canes results in systemic infection of
the pathogen in the plant and first exhibited PB symptoms,
subsequently wilt during grand growth phases. This was
validated by planting of wilt-affected canes of the cv MS
123
Sugar Tech
901 which displayed occurrence of both wilt and PB dis-
eases in the field. We established that the pathogen isolates
from the symptomatic stalk, root and leaf sheath tissues
were found to be the same F. sacchari. Similarly, in this
study we also found the cause of both wilt and PB by the
same F. sacchari in the cv Co 0238. After recovery of PB
symptoms, remnants of the pathogen infection/damage can
be seen as knife-cut and ladder-like damages in the stalks
(Patil 2002, Whittle and Irawan 2000). However, no reports
are available on stalk infection of the pathogen from such
knife cut-damaged tissues as well as from the top rot-af-
fected canes. The present study revealed that many sug-
arcanes cvs Co 0238, MS 901, CoJ 83, CoC 671, Co 94012,
Co 62174, ISH 100 etc. exhibited partial or complete
wilting of canes after PB occurrence (Table 1).
Earlier different causative agents were reported to cause
sugarcane wilt in India. Detailed studies conducted earlier
at the Institute clearly established that F. sacchari is the
causative agent of wilt. This was done based on
Sugar Tech

Fig. 5 Recovery of Fusarium from the tissues exhibiting both

pokkah boeng and wilt after top rot in the same cane of the sugarcane
cv Co 86027

Fig. 4 Progress of wilt from pokkah boeng-affected internode with

knife-cut phase (encircled) in sugarcane stalks (cv Co 87023)

pathogenicity studies and Koch’s postulates (Viswanathan

et al. 2011). The pathogenicity studies were also supported
by specific RAPD and ISSR markers to confirm the isolates
associated with pathogenicity in sugarcane. Subsequently,
detailed morphological characterization of more than 100
isolates originated from 13 major sugarcane growing states
revealed that majority of them belonged to F. sacchari
Fig. 6 Amplification of 496 bp TEF1-a gene fragment of Fusarium
(Poongothai et al. 2014b). Characterizing a subset 50 of the sacchari isolates from the sugarcane cv MS 901
117 isolates through different molecular markers such as

123

RAPD, ISSR, IGS-RFLP and ITS sequencing clearly
established that majority of the isolates belonged to F.
sacchari. The F. sacchari isolates grouped together in
different phylogenetic tree, and other species such as F.
proliferatum, F. verticillioides, F. napiforme and F. subg-
lutinans separated in a different cluster. The present study
with TEF1-a gene sequencing confirmed that F. sacchari is
associated with wilt in different states in the country.
TEF gene has become the marker of choice as a single-
locus identification tool in Fusarium. This gene appears to
be consistently single copy in Fusarium, and it shows a
high level of sequence polymorphism among closely rela-
ted species, even in comparison to the intron-rich portions
of protein-coding genes such as calmodulin, beta-tubulin
and histone H3 (Geiser et al. 2004). Due to these attributes,
TEF1-a gene was found to be a useful genetic marker for
phylogenetic and taxonomic studies in different Fusarium
spp. McFarlane et al. (2009) earlier identified F. sacchari
isolates associated with sugarcane by sequencing TEF1-a
fragments. In this study, we have clearly demonstrated the
use of TEF1-a as a marker to identify F. sacchari and F.
proliferatum associated with PB and wilt in sugarcane
under Indian conditions. However, earlier studies at the
Institute to characterize * 79 isolates associated with PB
in sugarcane based on ITS sequencing indicated that
majority of them matched to Gibberella moniliformis fol-
lowed by G. sacchari, G. thapsina, G. intermedia, F.
oxysporum, F. pseudoanthophilum, F. subglutinans,
Fusarium sp. and Gibberella sp. (Scindiya 2013). This
study also revealed that ITS genome sequencing and their
comparison with database sequences do not give reliable
grouping of the isolates. The species names for the sub-
mitted sequences in the database were not authenticated;
hence, depending on such grouping may lead to erroneous
conclusions.
Economic damages caused by wilt and PB in sugarcane
have been documented in different decades in the past
(Agnihotri 1983, 1996; Agnihotri and Rao 2002; Vish-
wakarma et al. 2013; Viswanathan 2012, 2013). Wilt
affected many ruling varieties in different states to varying
intensities (Viswanathan et al. 2006, 2012). Epidemiolog-
ical aspects such as infestation of different insect pests and
abiotic factors were reported to influence wilt development
in sugarcane varieties (Viswanathan 2013). Earlier it was
presumed that both the diseases occur in sugarcane during
different growth phases in the past; however, the present
study discovered that same plant exhibits both the diseases
together, inflicted by the same pathogen. The new finding
on the role of Fusarium associated with PB in causing wilt
has not been reported elsewhere. The recent widespread
occurrences of these diseases in different states in the
country may be due to the cause of these two diseases by
the same fungal pathogen. Availability of the crop
123
Sugar Tech
throughout the year may facilitate infection of the crop, and
the crop phase and prevailing weather may decide severity
of the disease. However, further studies are required on
influence of host resistance and role of environmental
conditions favouring stage shift from PB to wilt in sugar-
cane in different agro-climatic conditions in the country.
Acknowledgements The authors are grateful to the Directors of the
Institute for providing facilities and acknowledge Dr. R. Jothi, Shri K.
Manivannan and Shri. R. Nithyanandan for their technical support in
carrying out field and laboratory studies. The research work was
partly supported by ICAR under Outreach project on PHYTOFURA.
Compliance with Ethical Standards
Conflict of interest The authors declare that they have no conflict of
interest
Funding This study was partly funded by Outreach project of ICAR,
ALCOCERA.
Ethical Standard This article does not contain any studies with
human participants or animals performed by any of the authors.
References
Agnihotri, V.P. 1983. Diseases of Sugarcane, 363. New Delhi:
Oxford and IBH publishing Co.
Agnihotri, V.P. 1996. Current sugarcane disease scenario and
management strategies. Indian Phytopathology 49: 109–126.
Agnihotri, V.P., and G.P. Rao. 2002. A century status of sugarcane
wilt in India. In Sugarcane Crop Management, ed. S.B. Singh,
G.P. Rao, and S. Eswaramoorthy, 145–160. Houston, USA:
SciTech Publishing LLC.
Bolle, P.C. 1927. Een onderzock de oorzaak van pokah boeng en top
rot. Arch. Suikerind Ned-Indie II 35: 589–609.
Geiser, D.M., M.M.J. Nez-Gasco, S. Kang, I. Makalowska, N.
Veeraraghavan, T.J. Ward, N. Zhang, G.A. Kuldau, and K.
O’Donnell. 2004. FUSARIUM-ID v. 1.0: A DNA sequence
database for identifying Fusarium. European Journal of Plant
Pathology 110: 473–479.
Giatgong, P. 1980. Host index of plant diseases in Thailand, 2nd ed.
Bangkok, Thailand: Dept. of Agriculture, Ministry of Agricul-
ture and Cooperatives.
Govender, P., S.A. McFarlane, and R.S. Rutherford. 2010. Fusarium
species causing pokkah boeng and their effect on Eldana
saccharina Walker (Lepidoptera: Pyralidae). Proceedings of
South African Sugar Technologists Association 83: 267–270.
Taher Khani, K., A. Alizadeh, R.F. Nejad, and A.S. Tehrani. 2013.
Pathogenicity of Fusarium proliferatum, a new causal agent of
pokkah boeng in sugarcane. Proceedings of the International
Society of Sugar Cane Technologists 28: 317–324.
Lin, Z., S. Xu, Y. Que, J. Wang, J.C. Comstock, J. Wei, P.H. McCord,
B. Chen, R. Chen, and M. Zhang. 2014. Species-specific
detection and identification of Fusarium species complex, the
causal agent of sugarcane pokkah boeng in China. PLoS ONE 9
(8): e104195.
Lin, Z., Y. Zhang, Y. Que, R. Chen, B. Chen, and M. Zhang. 2015.
Characterization of Fusarium verticillioides isolates from
pokkah boeng on sugarcane and the disease incidence in field.
Journal of Microbiology and Experimentation 2 (5): 00061. doi:
10.15406/jmen.2015.02.00061.
Sugar Tech
Martin, J., H. Handojo, and C. Wismer. 1989. Pokkah boeng.
Diseases of sugarcane: Major diseases, 157–168. New York:
Elsevier.
McFarlane, S., and R. Rutherford. 2005. Fusarium species isolated
from sugarcane in KwaZulu-Natal and their effect on Eldana
saccharina (Lepidoptera: Pyralidae) development in vitro. Pro-
ceedings of South African Sugar Technologists Association 79:
120–124.
McFarlane, S.A., P. Govender, and R.S. Rutherford. 2009. Interac-
tions between Fusarium species from sugarcane and the stalk
borer, Eldana saccharina (Lepidoptera: Pyralidae). Annals of
Applied Biology 155: 349–359.
Mohammadi, A., R.F. Nejad, and N.N. Mofrad. 2012. Fusarium
verticillioides from sugarcane, vegetative compatibility groups
and pathogenicity. Plant Protection Sciences 48: 80–84.
Nordahliawate, M., M. Izzati, A. Azmi, and B. Salleh. 2008.
Distribution, morphological characterization and pathogenicity
of Fusarium sacchari associated with pokkah boeng disease of
sugarcane in Peninsular Malaysia. Pertanika Journal of Tropical
Agricultural Science 31: 279–286.
Patil, A.S., H. Singh, S.R. Sharma, and G.P. Rao. 2007. Morphology
and pathogenicity of isolates of Fusarium moniliforme causing
pokkah boeng of sugarcane in Maharashtra. In Microbial
diversity: Modern trends, ed. R.C. Ram, and A. Singh,
234–263. New Delhi: Daya Publishers.
Patil, A.S. 2002. Pokkah boeng and pineapple disease research
progress in India. In Sugarcane Crop Management, ed. S.B.
Singh, G.P. Rao, and S. Eswaramoorthy, 161–195. Houston,
USA: SciTech Publishing LLC.
Poongothai, M., R. Viswanathan, P. Malathi, and A. Ramesh Sundar.
2014a. Sugarcane wilt: Pathogen recovery from different tissues
and variation in cultural characters. Sugar Tech 16: 50–66.
Poongothai, M., R. Viswanathan, P. Malathi, and A. Ramesh Sundar.
2014b. Fusarium sacchari causing sugarcane wilt: variation in
morphological characteristics of the pathogen. International
Sugar Journal 116: 54–63.
Poongothai, M., R. Viswanathan, P. Malathi, A. Ramesh Sundar, C.
Naveen Prasanth, and C.G. Balaji. 2015. Genetic relatedness
among Fusarium populations associated with sugarcane wilt in
India: bridging molecular variability and phylogenetic diversity.
Journal of Sugarcane Research 5 (1): 33–48.
Rao, G.P., and V.P. Agnihotri. 2000. Wilt. In A guide to sugarcane
diseases, ed. P. Rott, R. Bailey, J.C. Comstock, B. Croft, and S.
Saumtally, 193–197. Montpellier: CIRAD/ISSCT.
Rosas-Guevara, V., M. Hernández-Arenas, R. Miranda-Marini, E.
Bravo-Mosqueda, and A. Berriozabal-Onofre. 2014. Identifica-
tion and morphological variability of pokkah boeng (Fusarium
spp) on sugar cane, in Mexico. Investigación Agropecuaria 11
(2): 119–126.
Scindiya, M. 2013. Molecular characterization of Fusarium species
associated with wilt and pokkah boeng/top rot diseases of
sugarcane. M. Phil thesis, 105, Coimbatore: Bharathiar University.
Sheldon, J.L. 1904. A corn mold (Fusarium moniliforme). New
Agricultural Experiment Station, Annual Report 17: 23–32.
Vishwakarma, S.K., P. Kumar, A. Nigam, A. Singh, and A. Kumar.
2013. Pokkah Boeng: An emerging disease of sugarcane.
Journal of Plant Pathology and Microbiology 4 (3): 1000170.
Viswanathan, R. 2012. Sugarcane diseases and their management,
140. Coimbatore: Sugarcane Breeding Institute.
Viswanathan, R. 2013. Status of sugarcane wilt: One hundred years
after its occurrence in India. Journal of Sugarcane Research 3
(2): 86–106.
Viswanathan, R., P. Malathi, A. Ramesh Sundar, M. Poongothai, and
N. Singh. 2006. Current status of sugarcane wilt in India. Sugar
Cane International 24 (4): 1–7.
Viswanathan, R., P. Malathi, A. Annadurai, C. Naveen Prasanth, and
M. Scindiya. 2014. Sudden occurrence of wilt and pokkah boeng
in sugarcane and status of resistance in the parental clones in
national hybridization garden to these diseases. Journal of
Sugarcane Research 4 (1): 62–81.
Viswanathan, R., M. Poongothai, and P. Malathi. 2011. Pathogenic
and molecular confirmation of Fusarium sacchari causing wilt in
sugarcane. Sugar Tech 13: 68–76.
Viswanathan, R., M. Poongothai, P. Malathi, and C. Naveen Prasanth.
2015. Sugarcane wilt: Simulation of pathogenicity through
different methods and environments. International Sugar Jour-
nal 117: 286–293.
Viswanathan, R., M. Poongothai, P. Malathi, and A. Ramesh Sundar.
2012. Sugarcane wilt: New insights into the pathogen identity,
variability and pathogenicity. In Functional plant science and
biotechnology 6 Special Issue 2, ed. R. Viswanathan, and A.R.
Sundar, 30–39. Ikenobe, Japan: Global Science Books.
Wakker, J.H., and F.A.F.C. Went. 1896. Overview of the diseases of
sugarcane in Java. Arch. Suikerind. Ned. Indie IV: 427–435.
Whittle, P., and L. Irawan. 2000. Pokkah boeng. In A guide to
sugarcane diseases, ed. P. Rott, R.A. Bailey, J.C. Comstock, B.J.
Croft, and A.S. Saumtally, 136–140. Montpellier: CIRAD/
ISSCT.
Zainudin, N.A.I.M., N.A. Ismail, N.M.I.M. Nor, A.A. Razak, S.N.M.
Siddique, and B. Salleh. 2009. Nitrate non-utilizing mutants and
vegetative compatibility groups of Fusarium proliferatum and F
sacchari isolated from rice in the peninsular Malaysia and
Kalimantan, Indonesia. Journal of Plant Protection Research 49
(2): 229–235. doi:10.2478/v10045-009-0035-z.
123