Canadian Journal of Plant Pathology

ISSN: 0706-0661 (Print) 1715-2992 (Online) Journal homepage: www.tandfonline.com/journals/tcjp20

Cotton leaf curl Multan virus infecting Hibiscus

sabdariffa in China

Muhammad Arif, Wenzhong Lin, Lihuang Lin, Waqar Islam, Zhang Jie, Zifu
He, Zhenguo Du & Zujian Wu

To cite this article: Muhammad Arif, Wenzhong Lin, Lihuang Lin, Waqar Islam, Zhang
Jie, Zifu He, Zhenguo Du & Zujian Wu (2018) Cotton leaf curl Multan virus infecting
Hibiscus sabdariffa in China, Canadian Journal of Plant Pathology, 40:1, 128-131, DOI:
10.1080/07060661.2017.1389770

To link to this article: https://doi.org/10.1080/07060661.2017.1389770

Published online: 17 Nov 2017.

Submit your article to this journal

Article views: 298

View related articles

View Crossmark data

Citing articles: 1 View citing articles

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=tcjp20
Can. J. Plant Pathol., 2018
Vol. 40, No. 1, 128–131, https://doi.org/10.1080/07060661.2017.1389770

Disease report/Rapport des maladies

Cotton leaf curl Multan virus infecting Hibiscus sabdariffa in China

MUHAMMAD ARIF1, WENZHONG LIN1, LIHUANG LIN1, WAQAR ISLAM1, ZHANG JIE1, ZIFU HE2,
ZHENGUO DU1 AND ZUJIAN WU1

1
State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops, Fujian Province Key Laboratory of Plant Virology, Fujian
Agriculture and Forestry University, Fuzhou, Fujian, 350002, China
2
Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, Guangdong, 510640, China

(Accepted 26 September 2017)

Abstract: Cotton leaf curl Multan virus (CLCuMuV), in conjunction with cotton leaf curl Multan betasatellite (CLCuMuB), causes cotton leaf
curl disease in South Asia. CLCuMuV-CLCuMuB was first found in 2006 to be associated with a leaf curl disease of Hibiscus rosa-sinensis in
China. Recently, CLCuMuV-CLCuMuB has become prevalent in H. rosa-sinensis in the southern part of the country. Here, we identified
CLCuMuV-CLCuMuB in H. sabdariffa for the first time. To our knowledge, H. sabdariffa is the fourth seed-propagated plant in China to be
affected by CLCuMuV-CLCuMuB.

Keywords: begomovirus, cotton leaf curl disease, Cotton leaf curl Multan virus, Hibiscus sabdariffa

Résumé: Le virus de la frisolée du cotonnier de la région de Multan (CLCuMuV), en conjonction avec le betasatellite de la frisolée de la feuille
du cotonnier (CLCuMuB), cause la frisolée de la feuille du cotonnier dans le sud de l’Asie. CLCuMuV-CLCuMuB a été détecté pour la première
fois, en 2006, alors qu’il était associé à une frisolée d’Hibiscus rosa-sinensis en Chine. Récemment, CLCuMuV-CLCuMuB s’est répandu chez
Hibiscus rosa-sinensis dans le sud du pays. Ici, nous avons identifié CLCuMuV-CLCuMuB pour la première fois chez H. sabdariffa. À notre
connaissance, il s’agit de la quatrième espèce de plante propagée par semence en Chine qui est touchée par CLCuMuV-CLCuMuB.

Mots clés: bégomovirus, frisolée de la feuille du cotonnier, Hibiscus sabdariffa, virus de la frisolée du cotonnier de la région de Multan

Introduction Yunnan, Fujian and Jiangsu (Du et al., 2015; authors, per-
sonal observations). Besides H. rosa-sinensis, the virus
Cotton leaf curl disease has been reported in Africa, as well
complex was also detected in okra (H. esculentus) (Dong
as in several countries in Asia, such as Pakistan, India and
et al., 2012), cotton (Gossypium hirsutum) (Cai et al., 2010)
China (Sattar et al., 2013). In Asia, the disease is caused by a
and kenaf (H. cannabinus) (Tang et al., 2015) in
number of distinct begomoviruses, including Cotton leaf
Guangdong, Guangxi and Hainan provinces, respectively.
curl Multan virus (CLCuMuV), in conjunction with a dis-
Here, we report the first detection of CLCuMuV-CLCuMuB
ease-specific betasatellite, Cotton leaf curl Multan betasa-
in H. sabdariffa in Fujian province of China.
tellite (CLCuMB) (Sattar et al., 2013). CLCuMuV-
CLCuMuB were first identified to be associated with a
leaf curl disease of Hibiscus rosa-sinensis in Guangzhou, Materials and methods
Guangdong province of China in 2006 (Mao et al., 2008;
CLCuMuV-CLCuMuB detection and sequencing
Du et al., 2015). In recent years, this virus complex was
found to be prevalent in H. rosa-sinensis in many provinces Samples of leaves from symptomatic and healthy-appear-
of south China, including Guangdong, Guangxi, Hainan, ing H. sabdariffa shrubs were obtained in mid-September

Correspondence to: Zujian Wu. E-mail: wuzujian@126.com

© 2017 The Canadian Phytopathological Society

Published online 17 Nov 2017

Cotton leaf curl virus on Hibiscus
2015, where a stunting disease was found in a garden of
Fujian Agriculture and Forestry University, Fuzhou,
Fujian province, China. About 70% of the plants were
affected. Upon close observation, additional symptoms,
including vein swelling, leaf curling and yellowing, were
observed. Conspicuous enations on the veins were
observed on the undersides of some leaves as shown in
Fig. 1. These symptoms suggested that the plants might
have been infected by a begomovirus. Three samples
each from healthy and symptomatic shrubs were col-
lected. DNA was extracted using the CTAB procedure
(Biswas et al., 2013). The degenerate primer pair AV494/
Dep3 (5ʹ-GANGSATGHGTRCADGCCATATA-3ʹ/5ʹ-
GCCYATRTAYAGRAAGCCMAG-3ʹ), which amplifies
a conserved 570-bp region on the begomovirus, was
used to confirm the presence of a begomovirus in the
symptomatic samples (He et al., 2007). The PCR ampli-
con was electrophoresed at 5 V cm−1 through 1% (w/v)
agarose gels in 1× Tris Acetic acid EDTA (TAE) electro-
phoresis buffer. The PCR band of the expected size were
recovered, purified, ligated to a T vector (pMD18-T,
TAKARA, Dalian, China) and transformed to E. coli
DH5α. After growing overnight on Luria-Bertani (LB)
agar plates supplemented with 50 µg mL−1 of ampicillin
at 37°C, three positive colonies were randomly selected
and sequenced for each transformation. A primer pair
specific to CLCuMuV (CLCuMuVF and CLCuMuVR
5ʹCAACAGGCATGGACAAACAG3ʹ and 5ʹ-CCAAT
ACGATGGGTCAAACC-3ʹ) was used to confirm the
presence of CLCuMuV in symptomatic H. sabdariffa.
To sequence CLCuMuV and CLCuMuB infecting H.
sabdariffa, rolling circle amplification (RCA) was con-
ducted to enrich circular DNAs. The circular DNAs were
amplified using β01/02 (Briddon et al., 2002) or a back-
to-back primer pair designed based on the 570-bp
Fig. 1 (Colour online) Symptoms exhibited by Hibiscus sabdariffa from which Cotton leaf curl Multan virus (CLCuMuV) and its associated
satellite Cotton leaf curl Multan betasatellite (CLCuMuB) were detected by PCR. (Left) healthy H. sabdariffa leaf; (right) diseased leaf.
129
sequences obtained above. The fragments obtained from
the PCR were cloned by using a T-vector (pMD18-T,
TAKARA, Dalian, China). Three colonies each for
CLCuMuV and CLCuMuB were submitted to Beijing
Genomics Institute (BGI, Shenzhen, China) for Sanger
sequencing and the sequences were assembled using
DNASTAR Lasergene 10 (DNASTAR Inc.). For both
CLCuMuV and CLCuMuB, a consensus sequence each
was deposited in GenBank. The accession numbers
KY992859 and KY992858 have been assigned to
CLCuMuV and CLCuMuB, respectively.
Phylogenetic analysis
To understand the origin of the CLCuMuV-CLCuMuB
infecting H. sabdariffa, related viral sequences were
retrieved from the NCBI non-redundant nucleotide data-
base. Phylogenetic trees were constructed using the
aligned viral sequences. The trees were inferred using
the Neighbour-joining method. The bootstrap consensus
tree inferred from 1000 replicates was taken to represent
the evolutionary history of the taxa analysed (Felsenstein,
1985). Evolutionary analyses were conducted in MEGA7
(Kumar et al., 2016).
Results and discussion
A degenerate PCR was conducted to amplify a conserved
region on the genome of the suspected begomovirus
infecting H. sabdariffa. PCR amplicons of the expected
size (about 570 bp) were obtained from symptomatic but
not from asymptomatic plant samples. A BlastN search of
the NCBI non-redundant nucleotide database revealed
more than 99% identity of the PCR amplicons to a
corresponding fragment of CLCuMuV occurring in
M. Arif et al.
100
100
89
100
91
100
100
100
100
92
95
51
100
Fig. 2 Phylogenetic relationships of the newly identified Cotton leaf curl Multan virus (CLCuMuV) affecting H. sabdariffa (black
and thickened line) with other CLCuMuV. The numbers near the branches indicate the percentage of bootstrap replicates supporting
the branch. Nodes with bootstrap supports (BP) < 50% are collapsed. Virus isolates are presented according to the latest guidelines
(talk.ictvonline.org/ictv_wikis/m/files_gemini/5120.aspx) and their accession numbers in NCBI are provided in brackets.
China (JX861210) (Du et al., 2015). PCR using a primer
pair designed according to the obtained sequence was
used to confirm the presence of CLCuMuV from 10
other symptomatic samples. PCR fragments of the
expected size (197 bp) were obtained from all 10 samples
(data not shown). In contrast, no PCR amplicon was
obtained from asymptomatic plant samples. These results
indicated that the H. sabdariffa showing begomovirus-
like symptoms might have been caused by CLCuMuV.
Full-length CLCuMuV and CLCuMuB infecting H.
sabdariffa were obtained by PCR as described in the
Materials and methods. Sequence analysis revealed that
the CLCuMuV and CLCuMuB isolates were more than
99% identical to their counterparts occurring in China,
but shared a nucleotide sequence identity of less than
94% with those found in South Asia. In phylogenetic
trees constructed with the aligned genomic sequences of
130
91 CLCMuV-[PK:Mul:06] (EU365616)
CLCMuV-[PK:Mul:Mos3:06] (EU384574)
CLCMuV-[IN:Sir:99] (AY765254)
100 CLCMuV-[IN:Hib2:11] (JN880418)
CLCMuV-[IN:Hib1:11] (JN807763)
98 CLCMuV-[PK:Mul:Dar3:06] (EU365614)
CLCMuV-[PK:Mul:Dar4:06] (EU365615)
CLCMuV-[PK:Mul:Hir2:06] (FJ218487)
100 CLCMuV-[PK:Mul:Hir:06] (FJ218486)
CLCMuV-[IN:Sri:CLR07:10] (JN678803)
79 CLCMuV-[CN:Fz1:Hib:12] (JX861210)
CLCMuV-[CN:Fz03:Sab:15] (AKY992859)
CLCMuV-[CN:SM01:Hib:15] (KU245932)
100 CLCMuV-[PK:Yaz62:95] (AJ002447)
CLCMuV-[PK:DGK26:95] (AJ002458)
CLCMuV-[PK:Fai:31cf:92] (AJ496287)
CLCMuV-[PK:Fai:33af:92] (AJ496461)
100 CLCMuV-[PK:Mul:Lat:06] (EU384573)
CLCMuV-[IN:Sri:CLR11:10] (JN678804)
CLCMuV-[PK:Mul311:Okr:96] (AJ002459)
CLCMuV-[PK:Mul:H65-1:97] (AJ132430)
CLCMuV-[IN:pap:10] (JN558352)
CLCMuV-[IN:Lud:99] (AY765257)
100 CLCMuV-[IN:His:99] (AY765253)
CLCMuV-[IN:ND:99] (AY765256)
CLCuMuV (Fig. 2) and CLCuMuB (Fig. 3), CLCuMuV
occurring in China, including the new isolate identified
here, formed a monophyletic clade together with a few of
their counterparts occurring in South Asia. However,
Chinese CLCuMuV formed a distinct branch within this
clade. Similarly, CLCuMuB occurring in China, includ-
ing the new isolate identified here, clustered and formed a
monophyletic clade relative to their counterparts from
South Asia.
In summary, we identified a new host of CLCuMuV.
To our knowledge, H. sabdariffa is the sixth malvaceous
plant species and the fourth seed-propagated malvaceous
plant species to be infected by CLCuMuV in China.
Moreover, H. sabdariffa is the first seed-propagated
plant found to be infected by CLCuMuV in Fujian pro-
vince. The increasing number of malvaceous plants, par-
ticularly the seed-propagated malvaceous plants found to
Cotton leaf curl virus on Hibiscus 131

95 CLCuMuB-[PK:Burewala:Gos:11] (HF567946)
88 CLCuMuB-[PK:Lu10:Gos:10] (AM774311)
89 CLCuMuB-[CN:SM01:Hib:15] (KU254610)

100 CLCuMuB-[IN:Bathinda:Gos:09] (JF502377)

51
CLCuMuB-[IN:Fazilka:Gos:12] (JF502374)

100 95 CLCuMuB-[PK:SAZ261:Gos:16] (LN867449)

CLCuMuB-[PK:AS10:Gos:15] (HE965449)
CLCuMuB-[PK:RM77:Gos:17] (LN811063)

98 CLCuMuB-[PK:RCmB6:Gos:12] (LK995399)
CLCuMuB-[PK:Pun10:Gos:09] (EU384586)

CLCuMuB-[CN:FC2:Ros:12] (HQ455351)
100
CLCuMuB-[CN:GX01:Gos:12] (JQ317604)
60
CLCuMuB-[CN:Fz1:Hib:12] (JX861211)
77
CLCuMuB-[CN:SM01:Hib:15] (KU254610)
68
CLCuMuB-[CN:Fz03:Sab:15] (KY992858)
CLCuMuB-[CN:Fuzhou02:Hib:15] (KX523679)

Fig. 3 Relationship of the Fujian isolate of Cotton leaf curl Multan betasatellite (CLCuMuB, black and thickened line) with other
CLCuMuBs. The numbers near the branches indicate the percentage of bootstrap replicates supporting the branch. Nodes with
bootstrap supports (BP) < 50% are collapsed. CLCuMuB isolates are presented according to the latest guidelines (talk.ictvonline.
org/ictv_wikis/m/files_gemini/5120.aspx) and their accession numbers in NCBI are provided in brackets.

be infected by CLCuMuV in China, underscores the
potential threat of this virus to malvaceous plants in
south Asia as well as outside of the region.
Funding
This study was supported by funding from State Tobacco
Monopoly Administration [110201601024(LS-04)], Natural
Science Foundation of China [31301642] and FAFU funds
for innovation and development [CXZX2016132],
[KFA17130A].
References
Biswas C, Dey P, Satpathy S, Sarkar SK, Bera A, Mahapatra BS.
2013. A simple method of DNA isolation from jute (Corchorus
olitorius) seed suitable for PCR-based detection of the pathogen
Macrophomina phaseolina (Tassi) Goid. Lett Appl Microbiol.
56:105–110.
Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG. 2002.
Universal primers for the PCR-mediated amplification of DNA β. Mol
Biotechnol. 20:315–318.
Cai JH, Xie K, Lin L, Qin BX, Chen BS, Meng JR, Liu YL. 2010.
Cotton leaf curl Multan virus newly reported to be associated with cotton
leaf curl disease in China. Plant Pathol. 59:794–795.
Dong D, Zhu YH, He ZF, Chai ZX, She XM, Luo FF. 2012. Molecular
characterization of Cotton leaf curl Multan virus and the associated satellite
DNA infecting okra in Guangdong. J South China Agric Univ. 33:33–39.
Du ZG, Tang Y, He ZF, She X. 2015. High genetic homogeneity points to
a single introduction event responsible for invasion of Cotton leaf curl
Multan virus and its associated betasatellite into China. Virol J. 12:163.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using
the bootstrap. Evolution. 39:783–791.
He ZF, Yu H, Mao MJ, Luo FF, Lin YH, Wang ST. 2007. Tomato
yellow leaf curl disease in Guangdong is caused by Tomato leaf curl
Taiwan virus. Chin J Agric Biotech. 4:127–131.
Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary
Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol.
33:1870–1874.
Mao MJ, He ZF, Yu H, Li HP. 2008. Molecular characterization of Cotton
leaf curl Multan virus and its satellite DNA that infects Hibiscus rosa-
sinensis. Chin J Virol. 24:64–68.
Sattar MN, Kvarnheden A, Saeed M, Briddon RW. 2013. Cotton leaf
curl disease – an emerging threat to cotton production worldwide. J Gen
Virol. 94:695–710.
Tang YF, He ZF, Du ZG, She XM, Lan GB. 2015. Detection and identi-
fication of the pathogen causing kenaf (Hibiscus cannabinus) leaf curl
disease in Hainan Province of China. Acta Phytopathol Sin. 45:561568.