ONCOLOGY LETTERS 15: 4979-4987, 2018

MicroRNA‑124 acts as a tumor‑suppressive miRNA by

inhibiting the expression of Snail2 in osteosarcoma
JIANGHONG HUANG1,2*, YUJIE LIANG3,4*, MEIQUAN XU1,2,
JIANYI XIONG2, DAPING WANG1,2 and QIANG DING1

1
Department of Orthopedics; 2Shenzhen Key Laboratory of Tissue Engineering, Shenzhen Second People's Hospital,
The First Hospital Affiliated to Shenzhen University, Shenzhen, Guangdong 518035; 3Shenzhen Mental Health Center,
Shenzhen Kangning Hospital, Shenzhen Key Laboratory for Psychological Healthcare and Shenzhen Institute of
Mental Health, Faculty of Mental Health, Shenzhen University, Shenzhen, Guangdong 518003; 4Department of
Chemistry, The Chinese University of Hong Kong, Shatin, Hong Kong, SAR, P.R. China

Received June 14, 2017; Accepted December 21, 2017

DOI: 10.3892/ol.2018.7994

Abstract. The aim of the present study was to investigate the
clinical significance of hsa‑microRNA‑124‑3p (miR‑124) in
osteosarcoma (OS), and examine its role in cell growth and
invasion. Using a microRNA chip array, the expression of
miR‑124 was detected in samples of surgically resected OS
and matched against the levels of expression in tumor‑adjacent
normal tissues. The levels of miR‑124 were upregulated in
the OS cells through the transfection of miR‑124 mimics.
Cell proliferation and Transwell assays were performed to
determine cell proliferation and invasion; Reverse transcrip-
tion‑quantitative polymerase chain reaction, western blot
and luciferase assays were then used to detect the expression
of the target gene snail family zinc finger 2 (Snail2). The
expression of miR‑124 was significantly lower in the OS
tissues, compared with that in the tumor‑adjacent normal
tissues; and the expression of miR‑124 in the tumor tissues
was significantly associated with tumor size. miR‑124 directly
repressed the expression of Snail2, and resulted in a significant
inhibition of cell proliferation and invasion. In a mouse model,
the overexpression of miR‑124 significantly inhibited U2OS
cell proliferation and invasion. Taken together, miR‑124 was
associated with the adverse clinical and pathological features
observed in OS. It acted as a tumor suppressor to regulate the
Correspondence to: Dr Daping Wang or Dr Qiang Ding,
Department of Orthopedics, Shenzhen Second People's Hospital,
The First Hospital Affiliated to Shenzhen University, 3002 Sungang
West Road, Shenzhen, Guangdong 518035, P.R. China
E‑mail: dapingwang@qq.com
E‑mail: 163.dq@163.com
*
Contributed equally
Key words: microRNA‑124, osteosarcoma, tumor growth, cell
invasion, snail family zinc finger 2
proliferation and invasion of OS cells by targeting Snail2,
suggesting that miR‑124 may be key in the progression of OS.
Introduction
Osteosarcoma (OS) is one of the most common and life‑threat-
ening primary malignant tumors, particularly in children
and young adults (1,2). Although it is a rare malignant bone
neoplasm, its incidence has been reported to be increasing at
an annual rate of 1.4% over the last 25 years (3,4). Advances
in the diagnosis and treatment of other types of cancer have
markedly reduced OS incidence and mortality rates, however,
the 5‑year overall survival rate for OS remains low (4,5). This
may be attributed to its high recurrence rate, or its tendency to
rapidly destroy surrounding tissues and metastasize to other
tissues. As a result, patients with metastasized OS have <20%
chance of long‑term survival despite the use of neoadjuvant
chemotherapy (6). Previous studies report a lack of complete
understanding with regard to the initiation and development
of OS metastasis; the biological and pathological information
underlying these processes remain to be fully elucidated.
Therefore, in addition to investigating innovative treatments
for OS, its biological mechanisms require elucidation.
MicroRNAs (miRNAs) function as genetic modula-
tors, which regulate the translation from mRNA to protein
by targeting the 3'untranslated region (3'UTR) of cognate
targets (7). They are also involved in a wide range of biological
processes, including tumor cell migration, invasion, prolifera-
tion, cell cycle and apoptosis (8,9).
Increasing evidence has indicated that the dysregulation
of miRNAs contributes to the proliferation and invasion of
human cancer. A previous study, which compared the miRNA
expression profiles of human OS cell lines with those in clinical
samples, found that miRNA (miR)‑1, miR‑9, miR‑18a, miR‑18b,
miR‑126, miR‑133b, miR‑144, miR‑195 and miR‑451 were
decreased in cell lines and clinical samples, compared with
normal bone tissues (10‑12). This demonstrated that certain
miRNAs, including miR‑33a, miR‑150, miR‑497 and miR‑506,
act as tumor suppressors (13‑16). A number of previous studies
have identified that miRNAs may serve as biomarkers for
4980 HUANG et al: miR‑124 FUNCTIONS IN OS AND REGULATES THE SNAIL2 PATHWAY
cancer risk stratification, outcome prediction, and even clas-
sification of the severity of the cancer (17). The identification
of the miRNA molecule targets involved in tumor pathology
may also provide insights into OS prognosis and facilitate the
development of therapy for patients with OS (9).
To understand the biological functions of miRNA in OS,
the present study applied the model used in previous studies
using clinical samples of OS (18). The expression of miRNAs
was detected in samples of surgically resected OS and matched
to tumor‑adjacent normal tissues via a miRNA chip. Using
this miRNA chip, it was found that miR‑124 was markedly
downregulated in the OS tissues, compared with that in the
adjacent normal bone tissues. Previous clinical studies have
reported that miR‑124 dysregulation occurs in several types
of cancer (18‑22), however, the roles of miR‑124 in human
OS have not been well clarified. Therefore, the present study
aimed to examine the biological functions and molecular
mechanisms of miR‑124 in OS, and discuss its future prospect
as a therapeutic biomarker of OS.
Gain‑of‑function studies showed that the upregulation
of miR‑124 in OS cells was significantly correlated with the
proliferation, invasion and tumor growth of OS cell lines.
miR‑124 significantly decreased tumor volume and weight
in vivo. Bioinformatics analysis predicted that snail family
zinc finger 2 (Snail2) may be a potential target of miR‑124. The
subsequent luciferase reporter assay suggested that miR‑124
directly targeted the Snail2 3'UTR. The present study provided
novel evidence that miR‑124 directly inhibited the expression
of Snail2. Therefore, miR‑124 inhibited the proliferation and
invasion of OS cells by repressing the expression of Snail2.
The results of the present study suggested that miR‑124
inhibited the proliferation and invasion of OS cells by down-
regulating Snail2, and that the downregulation of Snail2 was
essential for the miR‑124‑induced inhibited invasion of OS
cells.
Materials and methods
Clinical specimens, cell culture, and cell transfection. A
total of three paraffin‑embedded OS specimens and three
corresponding adjacent OS samples were obtained from
the Shenzhen Second People's Hospital, the First Hospital
Affiliated to Shenzhen University (Shenzhen, China) and
were used in accordance with the policies of the Hospital's
Institutional Review Board. The samples were selected from
patients who had not been previously treated with chemothera-
peutic drugs. All specimens were histologically and clinically
diagnosed at the Department of Orthopedics.
All diagnoses were confirmed via light microscopy. No
patient had received any antitumor treatments prior to the
biopsy. The U2OS and Saos‑2 human OS cell lines (Chinese
Academy of Sciences, Shanghai, China) were cultured in
Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo
Fisher Scientific, Inc., Waltham, USA) supplemented with 10%
fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific,
Inc.) and 1% penicillin‑streptomycin (100 U/ml penicillin and
100 µg/ml streptomycin) at 37˚C with 5% CO2.
The miR‑124 mimics and negative control duplex were
synthesized by Shanghai GenePharma Co., Ltd. (Shanghai,
China). The U2OS and Saos‑2 cells were seeded in 6‑well plates at
50% confluence 1 day prior to transfection. Lipofectamine 2000
reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to
perform transfection in the miR‑mimics group (cells transfected
with miR‑124 mimics) and miR‑control group (cells transfected
with negative control duplex). The transfection complexes were
prepared according to the manufacturer's protocol.
Cell proliferation assay. The effects of miR‑124 on U2OS
proliferation were assessed using a Cell Counting Kit‑8 (CCK‑8)
assay. Cells in the exponential phase were seeded in 96‑well
plates at a density of 1x103 cells per well. Following a 24‑h
growth period, the cells were cultured in DMEM with 100 nM
of either miR‑control or miR‑124 mimic. Following incubation
for 24, 36, 48, 60 or 72 h, the supernatant was removed and
10 µl CCK‑8 was added to each well. Following a 2‑h incubation
period at 37˚C, the absorbance was measured at a wavelength of
450 nm with a Thermoplate microplate reader (Rayto Life and
Analytical Science Co., Ltd., Shenzhen, China). Each group was
read three times, and an average was calculated.
Colony formation assay. For the colony formation assay,
the cells were inoculated onto 6‑well plates at a density of
200 cells/well. Following culture for 14 days, the cells were
transfected, and the colonies were fixed with methanol and
stained with 0.5% crystal violet. The colony number of each
group was then counted under an inverted optical microscope
(IX70; Olympus, Tokyo, Japan).
Transmembrane invasion assay. The U2OS cells were
transfected with miR‑124 or miR‑control for 12 h; the cells
(5x10 4 cells/500 µl) were then transferred into the upper
chamber of Millicell inserts with an 8‑µm pore size polypo-
rous membrane (EMD Millipore, Billerica, MA, USA) in
serum‑free DMEM. A low‑serum medium (0.5% FBS) was
added to the lower chambers as the chemoattractant. Cell inva-
sion was allowed to proceed for 24 h at 37˚C in the incubator.
Following incubation, those cells which had invaded through
the membrane were fixed with 10% paraformaldehyde for
30 min, stained with 0.5% crystal violet staining solution, and
images were captured for counting under a microscope using
a digital camera.
Luciferase activity assay. Primers were designed in
accordance with the GenBank query Snail2 gene mRNA
(N M_0 03068) sequence (https://www.ncbi.nlm.nih.
gov/nuccore/NM_003068). 3'UTR of a Snail2 from cDNA
A fragment of the 3'UTR of Snail2 was amplified from
the cNDA from U2OS cells via polymerase chain reaction
(PCR) using the following primers: Forward, 5'‑CCC​C TC​
GAG​GTG​ACG​CAA​TCA​ATG​T TT​ACT​CGA​ACA​G ‑3' and
reverse, 5'‑CGG​G CG​G CC​G CC​T TG​T TA​ACA​A AC​A AT​
TCT​TTG​TAC‑3' To run the reaction, 100 ng of cDNA, 1 µM
of each primer, 10 µl 10X Pfu buffer mix, 1 mM dNTPs
mixture, and 1 µl PrimeSTAR HS DNA Polymerase (Takara
Biotechnology Co., Ltd., Dalian, China) were mixture with
deionized water <50 µl, in thermocycler for 95˚C for 10 sec,
followed by 30 cycles of 95˚C for 5 sec, and 55˚C for 30 sec,
1 min at 68˚C, finally 7 min at 72˚C. Following digestion of
the PCR product with 0.5 µl XhoI and 0.5 µl NotI (Thermo
Fisher Scientific, Inc.) at 37˚C for 1 h, gel purification of the
 ONCOLOGY LETTERS 15: 4979-4987, 2018 4981

Table I. Primers used for reverse transcription‑quantitative polymerase chain reaction analysis and miR reverse transcription.

Name Sequence

miR‑124‑RT 5'‑GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATTC‑3'
miR‑124‑F 5'‑GCTTAAGGCACGCGG‑3'
miR‑124‑R 5'‑GTGCAGGGTCCGAGG‑3'
U6‑F 5'‑CTCGCTTCGGCAGCACATATACT‑3'
U6‑R 5'‑ACGCTTCACGAATTTGCGTGT‑3'
U6 snRNA‑RT 5'‑AAAATATGGAACGCTTCACGAATT‑3'
β‑actin‑F 5'‑ATATCGCTGCGCTGGTCGTC‑3'
β‑actin‑R 5'‑AGGATGGCGTAGGGAGAG‑3'
Snail2‑F 5'‑TGTTGCAGTGAGGGCAAGAA‑3'
Snail2‑R 5'‑GACCCTGGTTGCTTCAAGGA‑3'

miR, microRNA; F, forward primer; R, reverse primer; RT, loop primer for miR reverse transcription; snRNA, small nuclear RNA.

digested PCR product was ligated into the XhoI/NotI‑digested
pSiCHECK2 vector (Promega Corporation, Madison, WI,
USA) at 16˚C overnight. The resultant plasmid was named
pSiCHECK2‑Snail2 3'UTR wt. The mutations of the
three sites of perfect complementarity were introduced by
synthesizing the DNA mutation code; this was then ampli-
fied by PCR and cloned into the XhoI/NotI sites of the
psiCHECKTM‑2 vector (Promega Corporation) in order to
perform the luciferase assay. All PCR products were verified
by DNA sequencing. The U2OS cells were co‑transfected
with the pSiCHECK2 vectors containing the 3'UTR vari-
ants and either the miR‑124 mimic or the control miRNA.
Following transfection for 24 h, the Dual‑Luciferase Reporter
Assay system (Promega Corporation) was used to measure
luciferase activity via a thermoplate reader (Rayto Life and
Analytical Science Co., Ltd.) according to the manufacturer's
protocol. The firefly luciferase activity was then normalized
to the Renilla luciferase activity.
RNA extraction and reverse transcription‑quantitative (RT‑q)
PCR analysis. Total RNA was isolated from the U2OS cells
using the TRIzol reagent (Thermo Fisher Scientific, Inc.). The
RNA extract was then subjected to an RT reaction using the
M‑MLV reverse transcriptase (Takara Biotechnology Co.,
Ltd., Dalian, China); this was performed according to the
manufacturer's protocol. The miRNAs were reverse tran-
scribed using the sequence‑specific primers listed in Table I.
The PCR analysis was performed in an ABI 7500 cycler
(Applied Biosystems; Thermo Fisher Scientific, Inc.). The
cycling temperatures were as follows: Denaturing, 95˚C;
annealing, 60˚C; extension, 70˚C. In detail, the 20 µl PCR
reaction mixture included 2.0 µl RT product, 1 µl PCR each
primer, 10 µl Premix Ex Taq (Takara Biotechnology Co., Ltd.),
6 µl deionized water. These reaction mixtures were incubated
at 95˚C for 10 sec, followed by 40 cycles of 95˚C for 5 sec,
and 60˚C for 30 sec. All reactions were run in triplicate. The
relative expression levels of the target gene Snail2 were evalu-
ated based on the reference gene β‑actin with the principle of
SYBR‑Green technology. The relative expression of miR‑124
was detected using a SYBR PrimeScript miRNA RT‑qPCR
kit (Takara Biotechnology Co., Ltd.). This was performed
according to the manufacturer's protocol, using U‑6 as an
internal control. All data analyses were performed using the
2‑ΔΔCq method (23).
Western blot analysis. The U2OS cells, transfected for
48 h with either miR‑124 mimic or with miR‑control oligo-
nucleotide, were harvested and lysed in lysis buffer (1% SDS
containing 50 mM NaF, 1.5 mM Na3VO4 and 0.5 mM PMSF).
After determining the protein concentration using a bicincho-
ninic acid protein (BCA) assay kit (Pierce; Thermo Fisher
Scientific, Inc.). Equal quantities (50 µg) of total proteins
were separated on 12% SDS‑polyacrylamide gels and trans-
ferred onto a polyvinylidene fluoride membrane. Then the
membranes were blocked with TBST (TBS 0.1% Tween‑20)
containing 5% non‑fat dry milk, followed by immunoblotting
with primary antibodies against Snail2 (dilution, 1:1,000; cat.
no. sc‑166476; Santa Cruz Biotechnology, Inc., Dallas, TX,
USA) or GAPDH (dilution, 1:1,000; cat. no. sc‑47724; Santa
Cruz Biotechnology, Inc.) overnight at 4˚C. Membranes were
washed with TBST, incubated for 1 h at room temperature
with by horseradish‑peroxidase‑conjugated secondary anti-
body (dilution, 1:5,000; cat. no. W4021; Promega Corporation)
for 1 h, and visualized using an enhanced chemiluminescence
detection kit (Pierce; Thermo Fisher Scientific, Inc.). The
images were captured and visualized via chemiluminescence.
In vivo tumor growth model. To determine the in vivo
tumorigenicity, subcutaneous animal models were estab-
lished. A total of 18 male BALB/c athymic nude mice, aged
4‑6 weeks, body weight 15‑20 g were purchased from Vital
River Laboratories Co., Ltd. (Beijing, China), provided with
sterilized water and food, and housed in standard lab condi-
tions with 12 h light/dark cycles. The procedures for the care
and use of animals followed the guide for the Care and Use
of Laboratory Animals (24) and experimental protocols were
approved by the Animal Care and Use Ethics Committee of
Shenzhen University. The mice were randomly divided into
three groups (n=6 per group) according to the injected cells.
Following lentivirus infection and selection, the U2OS cells
found to stably express miR‑124 (miR‑124) and empty vector
cells (miR‑NC) were washed and re‑suspended with PBS;
4982 HUANG et al: miR‑124 FUNCTIONS IN OS AND REGULATES THE SNAIL2 PATHWAY

Figure 1. Histologic assessment of adjacent normal bone tissues and OS tissues. Adjacent normal tissues: (A) Photomicrograph showing normal bone tissue and
connective tissue cells consistent and neatly arranged. Arrow shows the interface between bone and connective tissue. (B) Photomicrograph showing normal
cartilage osteogenesis (arrow), connective tissue and osteogenic tissue structure are normal. (C) Mature osteoblasts, connective tissue was closely arranged.
arrow shows the interface between mature osteoblasts and connective tissue. OS tissues: (D) Photomicrograph showing necrotic tissue (arrow), different
sizes of surrounding, darker staining and pathological mitosis. (E) Photomicrograph showing cells with deformed polykaryocytes, pathological mitosis and
surrounded by malignancies into the spindle cells (arrow). (F) Photomicrograph showing tumor‑producing osteoid (arrows) and pleomorphic osteoblasts.
Hematoxylin and eosin staining (magnification, x40). OS, osteosarcoma.

1x106 cells (200 µl) were then subcutaneously injected into the
dorsal flank of the nude mice. The mice were monitored daily
for 1 month following injection, and the size of the xenografted
OS tissues and the tumor formation rate of the three groups
were compared. After 22 days, the mice were sacrificed and
the tumors were dissected and weighed.
Bioinformatics and statistical analysis. The miRNA targets
predicted by computer‑aided algorithms were obtained from
TargetScan (http://www.targetscan.org). Statistical analysis
was performed using SPSS 17.0 software (SPSS, Inc., Chicago,
IL, USA). All data are presented as the mean ± standard devia-
tion. Statistical differences were measured using one‑way
analysis of variance and Student's t‑test. P<0.05 was consid-
ered to indicate a statistically significant difference.
Results
miR‑124 is downregulated in human OS. The total RNAs
isolated from three paired OS and adjacent normal colorectal
tissues were analyzed via a miRNA array. The relative
changes in the expression levels were indicated by a color
code. However, a limitation of the miRNA array was that only
a small quantity of samples was used; from a clinical perspec-
tive, it may be difficult to obtain biopsies from patients who
have not previously treated with chemotherapeutic drugs.
The histological assessment of adjacent normal bone tissues
and OS tissues is shown in Fig. 1. Notably, of the miRNA
array results, miR‑124 was one of the most frequently down-
regulated miRNAs in human OS. miR‑124 was expressed at
significantly lower levels in the OS tissues, compared with the
adjacent normal tissues, as shown in Fig. 2.
Overexpression of miR‑124 inhibits the proliferation and
invasion of OS cells. The clinical results suggested that
miR‑124 was significantly downregulated; therefore, it was
hypothesized that this downregulation of miR‑124 may
contribute to the progression of OS. Accordingly, the over-
expression of miR‑124 in OS‑adjacent normal tissues may
inhibit the malignant phenotype of OS cells. To examine the
function of miR‑124 in the cell model, miR‑124 mimics and
negative control miR‑124 were transiently transfected into
the OS cell line, and the rates of proliferation and invasion
were evaluated. The overexpression of miR‑124 in U2OS
and Saos‑2 cells demonstrated a smaller number of colonies
and had a lower clonogenic capability (Fig. 3). The CCK‑8
assay indicated lower cell proliferation rates in the Saos‑2
and U2OS cells when overexpressing miR‑124 (Fig. 4).
Therefore, these results indicated that miR‑124 significantly
reduced cell proliferation and clonogenicity. In addition,
miR‑124 inhibited the invasion of human OS cells. The rela-
tive crystal staining in the miR‑124 group was significantly
slower, compared with that in the control group (Fig. 5A);
this suggested that the number of invaded cells through the
polyporous membrane was significantly lower in the miR‑124
group, compared with that in the control group (Fig. 5B and
C).
Overexpression of miR‑124 inhibits OS tumor formation in vivo.
To confirm that the biological effects of miR‑124 observed
in the cultured cells are relevant to OS growth and invasion
in vivo, and to further confirm whether miR‑124 inhibits tumor
growth, a BALB/c mouse OS xenograft model was established
using the U2OS OS cell line. miR‑124 and the control cells
were subcutaneously inoculated into BALB/C athymic nude
mice and U2OS tumor cells were subcutaneously injected into
the neck. As shown in Fig. 6A, the tumors formed by miR‑124
cells grew more slowly than those formed by the vector control
cells following inoculation. Additionally, the difference in the
average tumor volume between the experimental and control
 ONCOLOGY LETTERS 15: 4979-4987, 2018 4983

Figure 2. miR‑124 is downregulated in human OS. Expression profiling of miRs in human OS specimens and normal OS‑adjacent tissues. Red indicates that
the level of gene expression is higher than the median, and green indicates that the level is lower than the median. miR, microRNA; OS, osteosarcoma.

Figure 3. Colony formation assay of miR‑124 mimic‑ and miR negative control‑transfected U2OS and Saos‑2 cells. Colonies were stained with crystal violet in
the colony formation assay for 14 days. (A) Representative micrographs of colony formation of U2OS cells. (B) Quantitative analysis of the number of U2OS
colonies. (C) Quantitative analysis of the number of Saos‑2 colonies. Magnification, x200. **P<0.01, compared with cells transfected with the miR‑control.

group of animals continued to increase, being two‑fold higher at compared with those of the control group (Fig. 6B). These data
the experimental endpoint (22 days; Fig. 6A and B). Decreases indicated a significant reduction in tumor volume in the miR‑124
in the sizes and weights of the tumors excised from animals transfected cells, compared with the mock control group and the
in the miR‑124‑overexpression group were also observed, miR‑control group (P<0.01; Fig. 6B).
4984 HUANG et al: miR‑124 FUNCTIONS IN OS AND REGULATES THE SNAIL2 PATHWAY

Figure 4. Overexpression of miR‑124 inhibits OS cell growth. (A) CCK‑8 assay showed that miR‑124 mimic U2OS cells grew more slowly, compared with cells trans-
fected with miR‑control. (B) CCK‑8 assay showed that miR‑124 mimic Saos‑2 cells grew more slowly, compared with cells transfected with the miR‑control. All data
are shown as the mean ± standard deviation. **P<0.01 vs. cells transfected with the miR‑control. miR, microRNA; OS, osterosarcoma; CCK‑8, Cell Counting Kit‑8.

Figure 5. miR‑124 significantly suppresses U2OS cell and Saos‑2 cell invasion. (A) Representative micrographs of transmembrane invasion of U2OS cells on
the outer membrane (magnification, x200). Quantitative analysis of average numbers of invading (B) U2OS cells and (C) Saos‑2 cells from three randomly
selected visual fields. U2OS cells and Saos‑2 cells were transfected with 100 nM of either miR‑124 mimics or miR‑control for 12 h, and then 5x104 cells/500 µl
were plated in the top chamber. Low‑serum medium (0.5% FBS) was added to the lower chamber. Following incubation for 24 h at 37˚C, the cells on the lower
surface were fixed with 10% paraformaldehyde for 30 min, stained with crystal violet staining solution, and images were captured with a digital camera. miR,
microRNA; **P<0.01, compared with cells transfected with the miR‑control.

Snail2 is a direct target of miR‑124. miRNA functions in
the post‑transcriptional regulator of gene expression by
targeting the 3'UTR of mRNAs; therefore, the present study
used the miRNA target prediction database TargetScan
(http://www.targetscan.org/) to identify the miR‑124 target for
further computational analyses. As predicted by the TargetScan
database, miR‑124 contains three potential target sites in the
Snail2 3'UTR region. These binding sites (positions 439‑446,
639‑645 and 843‑849) are highly conserved in mammals
(Fig. 7A). To examine the association between miR‑124
and Snail2, it was necessary to first identify the function of
miR‑124 on the Snail2 3'UTR. The full length wild‑type Snail2
mRNA 3'UTR was cloned into the downstream of the Renilla
luciferase gene in the psiCHECK‑2 vector, using the firefly
luciferase coding gene as an internal control. A dual‑luciferase
reporter assay presented changes in relative luciferase activity
in each group following transfection. The luciferase activity
was significantly decreased in the group co‑transfected with
the pSiCHECK2‑Snail2 3'UTR wt and miR‑124, compared
with the other groups (P<0.01; Fig. 7B). The mutation of the
three binding positions resulted in reporter activity recovery
in two OS cells. These results indicated that miR‑124 directly
targeted Snail2 mRNA via the putative binding sites in the
three positions of the Snail2 3'UTR, suggesting that the
 ONCOLOGY LETTERS 15: 4979-4987, 2018 4985

Figure 6. Silencing of miR‑124 inhibits osteosarcoma tumor formation in vivo. (A) Tumor formation was evidenced by tumor growth rates in three groups;
tumors in the miR‑124 group were smaller than those in the control group. (B) Analysis of tumor weights. **P<0.01, compared with cells transfected with the
miR‑control; miR, microRNA; NC, negative control (empty vector).

Figure 7. Prediction and validation of Snail2 as a target of miR‑124. (A) Diagram illustrating the hypothetical duplexes formed by interactions between the
binding sites in human and mouse miR‑124 (top) and the Snail2 3'UTR (bottom). The seed recognition sites and mutation of the binding site are shown; all
nucleotides in these regions were highly conserved across species, including humans and mice. (B) Analysis of the reporter activity in U2OS cells and Saos‑2
was performed to confirm whether miR‑124 directly targeted the predicted three binding sites in the Snail2 3'UTR and negatively regulates the expression of
Snail2. (C) Reverse transcription‑quantitative polymerase chain reaction analysis of the expression levels of Snail2 in U2OS cells treated with control mimic
or miR‑124 mimic. (D) Western blot analysis of the effect of miR‑124 on the protein expression of Snail2 in U2OS cells. miR, microRNA; UTR, untranslated
region; wt, wild‑type; *P<0.05, **P<0.01, compared with cells transfected with the miR‑control.

suppression was recovered by mutating the miR‑124 binding
site in the UTR region. The effect of miR‑124 on the expression
of Snail2 was further analyzed using RT‑qPCR and western
blot analyses. Western blot analysis was performed in order
to determine the protein expressions of Snail2 and GAPDH.
RT‑qPCR analysis was used to detect the expression of Snail2
and β ‑actin at the mRNA levels. The expression of Snail2
was attenuated in the miR‑124‑transfected group, compared
with that in the NC and control groups. As shown in Fig. 7C
and D, the expression of Snail2 was decreased at the mRNA
and protein levels in the miR‑124‑transfected group, compared
with either the blank control group or the empty miR control
group (P<0.05).
Discussion
MicroRNAs are important epigenetic regulators of gene
expression at the posttranscriptional level and are involved in
4986 HUANG et al: miR‑124 FUNCTIONS IN OS AND REGULATES THE SNAIL2 PATHWAY
basic biological processes, including cell proliferation, differ-
entiation and apoptosis. In accordance with this, deregulated
miRNA expression has been implicated in several diseases; for
example, it is important in the development and progression
of human malignancies. Several miRNAs have been linked to
OS, however, their role in the regulation of OS remains to be
fully elucidated.
miR‑124 is the most abundant, well‑conserved specific
miRNA expressed in brain tissue, however, it has also been
observed to be involved tumors, including gastric cancer, breast
cancer, nasopharyngeal carcinoma and hepatocellular carci-
noma, where it is considered one of the expression‑silenced
miRNAs (25‑27). In the present study, it was demonstrated that
miR‑124 was downregulated in OS, suggesting that miR‑124
functions as a tumor suppressor. Substantial evidence has shed
light on the importance of miR‑124 in the development and
progression of other types of cancer. However, the involvement
of miR‑124 in human OS remains to be fully elucidated. The
present preliminary study examined human OS tissues and
normal tissues from different patients, using the human Saos‑2
and U2OS OS cell lines. Gain‑of‑function experiments were
performed using miR‑124 mimic transfection. Quantitative
cell invasion assays were performed, and cell proliferation was
examined via CCK‑8. The miR‑124 mimics inhibited OS cell
proliferation and invasion. The results suggested that miR‑124
was involved in regulating the proliferation and invasion of
U2OS and Saos‑2 human OS cells. Therefore, the regulation
of OS cell invasion and migration by miR‑124 may be associ-
ated with the expression of important genes involved in OS
cell invasion. The present study also investigated the possible
regulation of target gene expression by miR‑124 and noted that
miR‑124 has three conserved binding sites on the 3'UTR of
transcription factor Snail2 mRNA. Based on these findings, it
was hypothesized that miR‑124 directly targets Snail2 mRNA.
Snail2 is an alias for the Slug gene in humans. Snail2 is
a member of the Snail C2H2‑type zinc‑finger transcriptional
repressor protein family. This gene shares homologies with
other species, including mice, rats, zebrafish, frogs and flies.
Snail2 is known to stimulate angiogenesis, cell proliferation
and invasion in human tumor malignancies, including OS,
where it primarily promotes the epithelial‑mesenchymal
transition (EMT) in tumor progression and metastasis (28‑30).
Evidence has shown that the transcription factors involved in
the EMT are significant in OS (31‑33). Therefore, it is feasible
to hypothesize that miR‑124 targets certain important tran-
scription factors in OS.
The results of the present study supported the hypothesis
that miR‑124 directly targets the Snail2 gene in human OS. The
transfection of OS cells with miR‑124 mimics suppressed the
expression of Snail2. To determine whether miR‑124 targets
Snail2 directly, reporter assays were performed. According
to the results of the dual‑luciferase reporter system, miR‑124
decreased the activity of a luciferase reporter fused to the
Snail2 3'UTR, suggesting that miR‑124 inhibits the reporter
activity of gene expression by targeting the Snail2 3'UTR in
OS cells. This supports the hypothesis that Snail2 serves as
a candidate target gene of miR‑124. The present study used
western blot analysis and RT‑qPCR analyses for the expression
of Snail2 in order to further validate the role of Snail2 as a target
for miR‑124. As Snail2 has traditionally been implicated in
promoting EMT in the various systems of tumor progression,
it is of note in the described mechanism that miR‑124 appears
to be necessary for repressing the expression of Snail2. This
inhibition, in turn, decreases the EMT level localized at the
cell membrane, including the level of β‑catenin, and reduces
OS invasion. This role of miR‑124/Snail2 may assist in the
development of novel anti‑metastatic therapeutics for OS and
improve the understanding of EMT mechanisms in the OS
systems.
The present study provided information on the function of
miR‑124 in OS and suggested that miR‑124 may offer potential
as a novel therapy for OS. However, the mechanism under-
lying the inhibition induced by miR‑124 on OS remains to be
fully elucidated, as miR‑124 has multiple targets in addition
to Snail2. For example, there is evidence that miR‑124 targets
the expression of integrin αV to inhibit human hepatocellular
carcinoma invasion (34). In addition, Snail2 is affected by other
miRNAs (31,35). It may be meaningful to examine the effects
of other miRNAs and proteins with regard to OS (36). The
preliminary experiments in the present study suggested a role for
miR‑124 as a suppressor of miRNA in human OS cells, resulting
in the suppression of tumor cell proliferation and invasion.
Further experiments are recommended to investigate the role of
miR‑124 in OS with a focus on the EMT process.
miR‑124 may also be established as an OS biomarker.
Therefore, novel and improved diagnostic and prognostic
molecular targets are necessary, particularly for patient groups
with a high risk for OS progression, recurrence and metastasis.
In conclusion, the findings of the present study revealed
that miR‑124, which was downregulated in OS, functioned as
a protective miRNA by attenuating OS cell proliferation and
invasion. Furthermore, the potential mechanism may involve
regulating the Snail2 pathway, providing novel insights into the
molecular mechanisms underlying the progression of OS and
potential therapeutic targets towards a novel treatment for OS.
Acknowledgements
The present study was financially supported by grants
from the Shenzhen R & D Funding Project (grant nos.
JCYJ20140414170821318, JCYJ20170306092315034 and
CXZZ20140813160132596), the Natural Science Foundation
of Guangdong Province, China (grant no. 81572198),
Guangdong Province Science and Technology Project (grant
no. 2017A020215116), Guangdong Province Medical Research
Fund Project(grant no. A2017189) and the Fund for High Level
Medical Discipline Construction of Shenzhen University
(grant no. 2016031638).
Competing interests
The authors declare that they have no competing interests.
References
1. Durfee RA, Mohammed M and Luu HH: Review of osteosarcoma
and current management. Rheumatol Ther 3: 221‑243, 2016.
2. Mirabello L, Troisi RJ and Savage SA: International osteosar-
coma incidence patterns in children and adolescents, middle ages
and elderly persons. Int J Cancer 125: 229‑234, 2009.
3. Ottaviani G and Jaffe N: The epidemiology of osteosarcoma.
Pediatric and adolescent osteosarcoma, Springer, pp3‑13, 2009.
 ONCOLOGY LETTERS 15: 4979-4987, 2018
4. Mirabello L, Troisi RJ and Savage SA: Osteosarcoma incidence
and survival rates from 1973 to 2004: Data from the Surveillance,
Epidemiology, and End Results Program. Cancer 115: 1531‑1543,
2009.
5. Lamplot JD, Denduluri S, Qin J, Li R, Liu X, Zhang H, Chen X,
Wang N, Pratt A, Shui W, et al: The current and future therapies
for human osteosarcoma. Curr Cancer Ther Rev 9: 55‑77, 2013.
6. Carrle D and Bielack SS: Current strategies of chemotherapy in
osteosarcoma. Int Orthop 30: 445‑451, 2006.
7. Krol J, Loedige I and Filipowicz W: The widespread regulation
of microRNA biogenesis, function and decay. Nat Rev Genet 11:
597‑610, 2010.
8. Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and
function. Cell 116: 281‑297, 2004.
9. Calin GA and Croce CM: MicroRNA signatures in human
cancers. Nat Rev Cancer 6: 857‑866, 2006.
10. Namløs HM, Meza‑Zepeda LA, Barøy T, Østensen IH,
Kresse SH, Kuijjer ML, Serra M, Bürger H, Cleton‑Jansen AM
and Myklebost O: Modulation of the osteosarcoma expression
phenotype by microRNAs. PLoS One 7: e48086, 2012.
11. Li JP, Liu LH, Li J, Chen Y, Jiang XW, Ouyang YR, Liu YQ,
Zhong H, Li H and Xiao T: Microarray expression profile of long
noncoding RNAs in human osteosarcoma. Biochem Biophys Res
Commun 433: 200‑206, 2013.
12. Hu H, Zhang Y, Cai XH, Huang JF and Cai L: Changes in
microRNA expression in the MG‑63 osteosarcoma cell line
compared with osteoblasts. Oncol Lett 4: 1037‑1042, 2012.
13. Gai P, Sun H, Wang G, Xu Q, Qi X, Zhang Z and Jiang L: miR‑22
promotes apoptosis of osteosarcoma cells via inducing cell cycle
arrest. Oncol Lett 13: 2354‑2358, 2017.
14. Li CH, Yu TB, Qiu HW, Zhao X, Zhou CL and Qi C: miR‑150
is downregulated in osteosarcoma and suppresses cell prolifera-
tion, migration and invasion by targeting ROCK1. Oncol Lett 13:
2191‑2197, 2017.
15. Yao J, Qin L, Miao S, Wang X and Wu X: Overexpression of
miR‑506 suppresses proliferation and promotes apoptosis of
osteosarcoma cells by targeting astrocyte elevated gene‑1. Oncol
Lett 12: 1840‑1848, 2016.
16. Zhang J, Wang D, Xiong J, Chen L and Huang J: MicroRNA‑33a‑5p
suppresses growth of osteosarcoma cells and is downregulated in
human osteosarcoma. Oncol Lett 10: 2135‑2141, 2015.
17. Li S, Gao Y, Wang Y, Wang K, Dai ZP, Xu D, Liu W, Li ZL,
Zhang ZD, Yang SH and Yang C: Serum microRNA‑17 func-
tions as a prognostic biomarker in osteosarcoma. Oncol Lett 12:
4905‑4910, 2016.
18. Novello C, Pazzaglia L, Cingolani C, Conti A, Quattrini I,
Manara MC, Tognon M, Picci P and Benassi MS: miRNA
expression profile in human osteosarcoma: Role of miR‑1 and
miR‑133b in proliferation and cell cycle control. Int J Oncol 42:
667‑675, 2013.
19. Li X, Fan Q, Li J, Song J and Gu Y: MiR‑124 down‑regulation is
critical for cancer associated fibroblasts‑enhanced tumor growth
of oral carcinoma. Exp Cell Res 351: 100‑108, 2017.
20. Hao C, Xu X, Ma J, Xia J, Dai B, Liu L and Ma Y: MicroRNA‑124
regulates the radiosensitivity of non‑small cell lung cancer cells
by targeting TXNRD1. Oncol Lett 13: 2071‑2078, 2017.
21. Zhao Y, Ling Z, Hao Y, Pang X, Han X, Califano JA, Shan L
and Gu X: MiR‑124 acts as a tumor suppressor by inhibiting the
expression of sphingosine kinase 1 and its downstream signaling
in head and neck squamous cell carcinoma. Oncotarget 8:
25005‑25020, 2017.
4987
22. Li SL, Gao HL, Lv XK, Hei YR, Li PZ, Zhang JX and Lu N:
MicroRNA‑124 inhibits cell invasion and epithelial‑mesen-
chymal transition by directly repressing Snail2 in gastric cancer.
Eur Rev Med Pharmacol Sci 21: 3389‑3396, 2017.
23. Livak KJ and Schmittgen TD: Analysis of relative gene expression
data using real‑time quantitative PCR and the 2(‑Delta Delta C(T))
method. Methods 25: 402‑408, 2001.
24. National Research Council: Guide for the Care and Use of
Laboratory Animals. National Academy Press, Washington, DC,
1996.
25. Sun AG, Wang MG, Li B and Meng FG: Down‑regulation of
miR‑124 target protein SCP‑1 inhibits neuroglioma cell migra-
tion. Eur Rev Med Pharmacol Sci 21: 723‑729, 2017.
26. Li Z, Wang X, Li W, Wu L, Chang L and Chen H: miRNA‑124
modulates lung carcinoma cell migration and invasion. Int J Clin
Pharmacol Ther 54: 603‑612, 2016.
27. Zhang F, Wang B, Long H, Yu J, Li F, Hou H and Yang Q:
Decreased miR‑124‑3p expression prompted breast cancer cell
progression mainly by targeting beclin‑1. Clin Lab 62: 1139‑1145,
2016.
28. Yang T, Chen M and Sun T: Simvastatin attenuates TGF‑ β1‑
induced epithelial‑mesenchymal transition in human alveolar
epithelial cells. Cell Physiol Biochem 31: 863‑874, 2013.
29. Villarejo A, Cortés‑Cabrera A, Molina‑Ortiz P, Portillo F and
Cano A: Differential role of Snail1 and Snail2 zinc fingers in
E‑cadherin repression and epithelial to mesenchymal transition.
J Biol Chem 289: 930‑941, 2014.
30. Mathsyaraja H and Ostrowski MC: Setting Snail2's pace during
EMT. Nat Cell Biol 14: 1122‑1123, 2012.
31. Zhang D and Liu S: SOX5 promotes epithelial‑mesenchymal
transition in osteosarcoma via regulation of Snail. J BUON 22:
258‑264, 2017.
32. Xiao JN, Yan TH, Yu RM, Gao Y, Zeng WL, Lu SW, Que HX,
Liu ZP and Jiang JH: Long non‑coding RNA UCA1 regulates
the expression of Snail2 by miR‑203 to promote hepatocellular
carcinoma progression. J Cancer Res Clin Oncol 143: 981‑990,
2017.
33. Sun Z, Hu W, Xu J, Kaufmann AM and Albers AE: MicroRNA‑34a
regulates epithelial‑mesenchymal transition and cancer stem cell
phenotype of head and neck squamous cell carcinoma in vitro.
Int J Oncol 47: 1339‑1350, 2015.
34. Cai QQ, Dong YW, Wang R, Qi B, Guo JX, Pan J, Liu YY,
Zhang CY and Wu XZ: MiR‑124 inhibits the migration and
invasion of human hepatocellular carcinoma cells by suppressing
integrin αV expression. Sci Rep 7: 40733, 2017.
35. Yu Z, Zhang Y, Gao N and Wang X: Overexpression of miR‑506
inhibits growth of osteosarcoma through Snail2. Am J Transl
Res 7: 2716‑2723, 2015.
36. Diaz‑Lopez A, Moreno‑Bueno G and Cano A: Role of microRNA
in epithelial to mesenchymal transition and metastasis and
clinical perspectives. Cancer Manag Res 6: 205‑216, 2014.
This work is licensed under a Creative Commons
Attribution-NonCommercial-NoDerivatives 4.0
International (CC BY-NC-ND 4.0) License.