1000 Biology MCQ With Helps - Frequently Examined Questions - N - A - 2008 - Singapore - Redspot Publications PTE LTD - 9789810517243 - Anna's Archive

Digitized by the Internet Archive
in 2022 with funding from

Kahle/Austin Foundation
https://archive.org/details/1000biologymcqwi0000unse
-
GCE ‘A’ LEVEL 1000 BIOLOGY MCQ WITH HELPS
ISBN 978 981 05 1724 3
First Published June 2012

All Rights Reserved.
© REDSPOT PUBLICATIONS PTE LTD

1160 Depot Road #01-01
Telok Blangah Industrial Estate
Singapore (109674)
Tel: 62721879
Fax: (65) 62700619
Email: redspot@singnet.com.sg
Website: www.redspotpublications.com
The launch of MCQ with HELPs is targetted at the GCE
‘A Level Biology Multiple Choice Questions examination candi-
dates.
Candidates are aware of the problems of choosing the right
answers, which often are similar to the other choices. How can
the candidates arrive at the one and only acceptable answer then?
MCQ with HELPs is the answer! It provides the reasons behind
the choice of each answer, guiding the candidates towards the
arrival of the correct choice.
MCQ with HELPs is classified topic-by-topic in a compre-
hensible fashion, according to the GCE ‘A’ Level Biology Syllabus.
The candidates thus enjoy the convenience of studying any par-
ticular topic.
MCQ with HELPs imparts additional knowledge outside the
textbook, facts which can be included in other sections of the ex-
amination, such as in essays or short questions.
The Author
4pp ee ae |
CONTENTS
ee ee
Cellular Functions
Cail OCrganciee 2)3
Biological Molecules ? 20
Enzymes P 34
Cell and Nuclear Division PEs
DNA and Genomics

DNA — Structure and Function P73
Protein Synthesis P 88
Gene Mutation and Chromosome Aberration ? 402
Genetics of Viruses and Bacteria P4415
Organisation and Control of Prokaryotic and

Eukaryotic Genome P 427
Genetic Basis for Variation ? 440
Cellular Physiology and Biochemistry

Photosynthesis P 459
Respiration Pa7a
Structure, Roles and Functions of Membrane ? 488
Homeostasis, Hormonal Control and Cell Signalling ? 201
(e) Nervous Control ? 242
Topic 7 Diversity and Evolution ? 228
Topic 8 Isolating, Cloning and Sequencing DNA ? 239
Topic 9 Applications of Molecular and Cell Biology ? 258
Answer Keys e 271

-
TOPIC 1 CELLULAR FUNCTIONS

ele 7
1(a) | Cell Organelles
ee
You should try to answer on your own before resorting to HELP.
Qi
Which one of the following organelles always
contains DNA? tain one or more dense bodies known as
A centriole nucleoli. Which one of the following correctly
describes the function of nucleoli?
B Golgi apparatus
A the formation of new DNA molecules
C lysosome
B the organisation of the spindle during
D mitochondrion nuclear division
C the replication of mitochondria following
HELP nuclear division
Mitochondrial DNA is located in the matrix D_ithe formation of ribosomes
or sornetimes attached to the inner mitochon-
drial membrane. The DNA encodes a similar
set of RNAs, #RINAs and essential mitochon- HELP
drial proteins. . The nucleolus is a suborganelle of the
nucleus. A region of one or more chromo-
somes in the nucleolus, called the nucleolar
(2 ee organiser, contains many copies of DNA
Which one of the following would exocrine cells which directs the synthesis of the rRNA. rRNAs
be expected to contain as a result of their func- are components of ribosomes which are
tion?
essential in protein synthesis.
A increased amounts of DNA
al
B increased amounts of rough endoplasmic (4
reticulum Which of the following cell structures contains
C increased numbers of lysosomes the highest concentration of RNA?
D large mitochondria A centriole B chromosome
C lysosome D nucleolus
HELP
Secretory cells always have abundant rER and HELP
Golgi apparatus. Newly made secretory pro- The nucleolar organiser is a region of one
teins are localised to the lumen of the rough or more chromosomes in the nucleolus which
ER. The proteins then migrate to the Golgi contains DNA copies that direct rRNA syn-
complex in the membrane-bound vesicles. thesis.
Level 1000 Biology MCQ with HELPs fs Frequently Examined Questions

Topic 1(a) Cell Organelles
Q5 Q6
Some fresh rat liver was homogenised and the Which of the following, A, B, C or D, correctly
suspension subjected to differential centrifuga- shows structures which are found in a eukary-
tion. The procedure is shown in the table be- otic cell? (f = present; X = absent)
low. nuclear
_ treatment sediment membranes mitochondria ribosomes
800 g for 10 minutes fraction 1 A x x x

B x J x
1
supernatant § J x x
J D J / J
2000 g for 15 minutes es TACUOM. 2
L HELP
supernatant A eukaryotic cell has a nuclear membrane
which envelopes the nucleus. Mitochondria
J
are present for the respiratory process, and
25000 g for 15 minutes Dee afraction 3 ribosomes are important in translation.
1
supernatant
1
Q7
105000g for 60 minutes ______, fraction 4
What distinguishes a
(g = gravitational force) prokaryotic cell from a eu-
Which one of the following represents the or- karyotic cell?
der in which the organelles were removed from A Prokaryotic cells have a
the suspension? cell wall and a nucleus.
[| sins [tac [ai [ast

mitochondria | lysosomes nuclei ribosomes
B_ Prokaryotic cells have
no membrane-bound
organelles.
lysosomes nuclei ribosomes mitochondria C_‘Prokaryotic cells have a
mitochondria | nuclei lysosomes ribosomes centriole.
nuclei mitochondria | lysosomes ribosomes D_‘Prokaryotic cells have
no ribosomes.
HELP HELP
The heaviest cell components will sediment Prokaryotic cells include
first and the least dense component last. This bacteria, and lack
result in the nuclei being removed first, fol- membrane-bound or-
lowed by mitochondria, lysosomes and lastly, ganelles, e.g. nuclear
the ribosomes.
membrane. Instead, the
nucleus is known as a
nucleoid.
Level 1000 Biology MCQ with HELPs Frequently Examined Questions

Q8 Q10
Which of the following is present in all eukary- A piece of mammalian tissue was homogenised
otic cells? and subjected to differential centrifugation. Five
A cell wall subcellular fractions were investigated to deter-
mine their relative biochemical activity. The
B~ diploid nucleus
diagrams below, A, B, C and D, indicate the
C flagellum relative activity of certain biochemical processes
D membrane-bound organelles in these fractions.
A
HELP n
o
All eukaryotic cells have organelles that are &ie)

n
bound by membranes, whilst that of prokary- Oo
otes lack membranes. =
4
Activity Activity
Q9 Mitochondria
iRibosomes |
Ribosomes
Pancreas tissue from a freshly killed rat was re-
moved, placed in warm isotonic saline solution
and radioactively labelled amino acids were
added. At intervals after adding the amino ac-
ids, samples of the tissue were removed, sec-
tions cut and the sites of radioactivity deter-
mined.
Activity Activity
Which one of the following represents the or-
Lysosomes Nuclei
Mitochondria
der in which radioactivity appeared in or-
Lysosomes
Ribosomes
ganelles? ;
Ribosomes
smooth rough Which diagram indicates the

Golgi secretory
endoplasmic endoplasmic fraction with maximum hy-
apparatus vesicles
reticulum reticulum
drolytic enzyme activity?
rough smooth
Golgi secretory
endoplasmic endoplasmic
apparatus vesicles HELP
reticulum reticulum
C is chosen because the
rough smooth highest biochemical ac-
Golgi secretory
endoplasmic endoplasmic
apparatus vesicles tivity is observed in the
reticulum reticulum
lysosomes, which are
rough smooth membrane-bound or-
secretory Golgi
endoplasmic endoplasmic ganelles which contain
vesicles apparatus
reticulum reticulum enzymes that degrade
polymers into their mo-
nomeric sub-units.
HELP
The labelled amino acids are first assembled
into proteins in the rough ER, where the
ribosomes are located. They then migrate to
the Golgi apparatus for modification via the
smooth ER. The proteins are then assembled
_in secretory vesicles ready for secretion.
| Level 1000 Biology MCQ with HELPs Pa Frequently Examined Questions

|
Topic 1(a) Cell Organelles |
Q11 Q12
The diagram is an outline of the procedure for The diagram shows a generalised animal cell.
separation of cell components from a liver Which structure replicates during mitosis and
homogenate in 0.25 M sucrose at 0 °C. generates the spindle?
Homogenate
q Centrifuge at
600 g for 10 min
Precipitate X Supernatant
Centrifuge at
10 000 g for 10 min
Precipitate Y Supernatant
Centrifuge at HELP
150 000 g for 10 min
The centriole, D, is
a small cylindrical
Precipitate Z Supernatant particle which ra-
diates microtu-
What do X, Y and Z represent? bules in all direc-
tions, forming as-
ters. The centriole
itself is made of
a) cell walls mitochondria microtubules and
endoplasmic they duplicate dur-
reticulum and nuclei mitochondria ing interphase to
ribosomes form daughter
centrioles.
endoplasmic
reticulum and | mitochondria
ribosomes
nuclei
Q13
endoplasmic What is the site of enzyme synthesis in
nuclei mitochondria | reticulum and cells?
ribosomes A Golgi apparatus
B lysosome
C* ribosome
HELP
D smooth endoplasmic reticulum
During centrifugation, the cell components
move up or down the medium to the level
at which the density of the medium is equal HELP
to their own density. The nuclei, which have
Enzymes are proteins and protein
the highest density, precipitate first, followed
synthesis occurs in the ribosomes. The
by the next dense components, the mitochon-
Golgi apparatus processes cell ma-
dria and the ER and lastly, the ribosomes.
terials and transports them to other
parts of the cell or to the cell surface
membrane for secretion. The break-
down of structures and molecules
W Level 1000 Biology MCQ with HELPs Pg Frequently Examined Questions a

occurs in the lysosome. The smooth endo-

plasmic reticulum is the site of lipid and
Q16
steroid synthesis. The diagram below shows some of the struc-
tures in an animal cell.
Q14
The diagram shows the ultrastructure of a eu-
karyotic cell. Which organelle does not contain
nucleic acid?
Which one of the structures A, B, C or D, would

be involved in the final secretion of digestive
enzymes from this cell?
HELP
A shows a secretory vesicle which buds off
from the trans side of the Golgi complex
HELP after the secretory proteins are processed, it
A represents the Golgi vesicles, which do not will fuse with the plasma membrane and
contain nucleic acids, It is the site where secre- release its contents into the extra-cellular
tory proteins are first modified before they space.
are directed to their destination.
Q17
Q15 When a glycoprotein is being synthesised for
Some cellular organelles are bound by a single secretion from a cell, which route is it most
membrane, while other organelles have two likely to take?
membranes (envelopes) around them. Which
one of the following is correct? A Golgi apparatus — rough en-
single membrane two membranes doplasmic reticulum +4
smooth endoplasmic reticu-
tonoplast lysosome nucleus chloroplast lum
chloroplast lysosome _ | nucleus tonoplast Brough endoplasmic reticulum
nucleus chloroplast | lysosome tonoplast —+ Golgi apparatus +
nucleus lysosome chloroplast tonoplast smooth endoplasmic reticu-
lum
C rough endoplasmic reticulum
HELP — smooth endoplasmic
Both the tonoplast and lysosome are or- reticulum -» Golgi apparatus
ganelles which are bound by a single mem- D smooth endoplasmic reticu-
brane each, whilst the nucleus and chloro- lum -» Golgi apparatus +>
plast have 2 enveloping membranes. rough endoplasmic reticulum
WW Level 1000 Biology MCQ with HELPs g Frequently Examined Questions

HELP Q1g9
The protein part of the glycoprotein is first A tadpole’s tail is gradually broken down dur-
synthesised in the rough ER, where the ribo- ing metamorphosis into an adult frog. Which
somes are situated. They then migrate through organelle increases in number in the cells of the
the smooth ER to the Golgi apparatus, where tail at this time?
the carbohydrate chain is added on to the
protein to form the glycoprotein. They are A centriole
then directed to their destination. B~ endoplasmic reticulum
C Golgi apparatus
Q18 D lysosome
The key below can be used to separate the
following cell organelles: HELP
nuclei, chloroplasts, mitochondria, ribosomes The components in the tail of the tadpole are
and lysosomes. taken up in pinocytotic vesicles, which then
(i) membrane with definite pores ............ V fuse with each other, forming larger vesicles,
which in turn fuse with the lysosomes and
(ii) inner membrane with stalked particles
are destroyed by the lysosomal enzymes.
BUaCneUT atcc ncn Ww
(iii) inner membrane folded into thylakoids
pier xX Q20
(iv) composed of one unit ............ Y Which of the following would be more promi-
(v) composed of one large and one small nent in a secretory cell than in a non-secretory
SUDALIL23/):...08 Z cell?
chloroplasts | lysosomes nucleus ribosomes mitochondria

chloroplasts | nucleus lysosomes mitochondria | ribosomes
mitochondria | ribosomes chloroplasts nucleus lysosomes
| nucleus mitochondria chloroplasts lysosomes ribosomes
HELP A Golgi apparatus

The nuclear membrane contains pores. The B= mitochondria
stalked particles in the mitochondria are re- C_pinocytotic vesicles
sponsible for electron transport during res-
D ribosomes
piratory process whilst the chloroplast pos-
sess thylakoid membranes where the light de-
pendent stage of photosynthesis occurs. HELP
Secretory cells always have abundant rER and
Golgi apparatus. Newly made secretory pro-
teins are localised to the lumen of the rough
ER. The proteins then migrate to the Golgi
complex via the smooth ER.
4 Level 1000 Biology MCQ with HELPs 2 49 Frequently Examined Questions

Q21 Q23
Which group of structures would be clearly seen From which cell organelle are nucleic acids
in a suitably stained plant cell under the light absent?
microscope?
A chloroplast B Golgi apparatus
A chloroplasts, mitochondria, nuclei and ri-
C mitochondrion D_sribosome
bosomes
B_ chloroplasts, nuclei, starch grains and vacu-
ole HELP
C endoplasmic reticulum, Golgi apparatus, Ribosomes contain ribosomal RNAs (ribo-
mitochondria and nuclei nucleic acids). Chloroplasts and mitochon-
dria contain circular DNA (deoxyribonucleic
D_ endoplasmic reticulum, ribosomes, starch
acid), similar to those found in prokaryotic
grains and vacuole
cells; this supports the theory of endosym-
biosis. The Golgi apparatus does not con-
HELP tain nucleic acids.
Only organelles which are larger than 0.2 mm

may be viewed under the light microscope, Q24
which excludes organelles like the mitochon-
dria, ribosomes, endoplasmic reticulum and A structure, consisting of two parts and having
Golgi apparatus. All the structures in option a diameter of 20 nm, is found attached to
B may be viewed under the light microscope. membranes in cells.
What is the structure?
Q22 A Golgi apparatus B_ lysosome
Which cell components, when appropriately C mitochondrion D _siribosome

stained, will be clearly visible under the high
power of the light microscope? HELP
The ribosome has a diameter of
lysosomes | mitochondria | ribosomes starch grains
about 20 nm and has two par's:
Jf o a small sub-unit and large sub-
J x unit. The nucleus is about 7 mm,
A "A the mitochondrion is about
2mm and smaller organelles like
x x NS
tal
ae
Sy
the Golgi apparatus and lyso-
some are smaller than 0.2 mm
since they cannot be seen under
HELP the light microscope.
Lysosomes and mitochondria will not be
clearly seen. Ribosomes are non-membra-
nous and may not be visible. As for starch Q25
granules, they are found within the chloro- Which organelles would be more prominent in
plasts and may be visible under a light a secretory cell than in a non-secretory cell?
microscope, when stained with iodine.
A Golgi bodies
B lysosomes
C mitochondria
D pinocytic vesicles
W Level 1000 Biology MCQ with HELPs ? 44 Frequently Examined Questions

Topic 1(a) Cell Organelles t
HELP Q28
A secretory cell would need secretory en- Stained animal tissue is viewed under the light
zymes and glycoproteins required in secre- microscope at X100 magnification. Which ob-
tions, which are produced by Golgi bodies. servation could be made?
A The cells had Golgi
Q26 bodies and mito-
chondria.
What is the order of size of cell components?
B_ The cytoplasm con-
largest ey smallest tained endoplasmic
reticulum and ribo-
A | mitochondria ribosomes starch grains nuclei somes.
B | nuclei chloroplasts mitochondria ribosomes
F ; ‘ j C The cytoplasm con-
C | ribosomes mitochondria chloroplasts starch grains tained many dense
D | starch grains mitochondria chloroplasts ribosomes granular bodies.
D_ The nuclear enve-
HELP lope was permeated
by pores.
Ribosomes tend to be one of the smallest
organelles in the cell. The mitochondrion is
HELP
quite large, but the nuclei and the chloro-
plasts are larger than it. From the table, it At 100 magnification, a light microscope
can be seen, that ribosomes is indicated as is unable to allow the ultrastructure of cells
the smallest cell structure in B and D. The to be seen, such as Golgi bodies, ER, ribo-
largest cell structure will have to be the nuclei. somes and nuclear pores. This is due to the
lower resolution of the microscope.
Q27
Cells without nucleoli die because they do not
Q29
possess Radioactive amino acids are supplied to a cell
that uses them to make insulin.
A centrioles and are unable to undergo cell
division.
B_ lysosomes and are unable to destroy worn
out organelles.
C mitochondria and are unable to obtain
energy.
D__sribosomes and are unable to manufacture
proteins. Which route will the radioactive amino acids
take?
HELP
————— last |
Nucleoli contain DNA that direct the synthe-
sis of rRNA, components of ribosomes which
are essential in protein synthesis.
GS
Db
Co
e Cos
be
hoc fs
Es
fs)
as En
Solent
Level 1000 Biology MCQ with HELPs 49 Frequently Examined Questions

HELP HELP
The amino acids are first carried to the ri- Ribosomes originate from the nucleolus and
bosomes, for protein manufacture. All pro- are important in the synthesis of proteins.
teins that enter the endoplasmic reticulum The lack of nucleoli results in the absence
are then passed through the Golgi appara- of ribosomes, and so the offspring cannot
tus in a strict sequence, followed by the exist.
secretory vesicles.
Q32.
Q30 Radioactively-labelled amino acids are intro-
How do mitochondria differ from chloroplasts? duced into a cell. In which cell structure will
A ATP is synthesised only in mitochondria. the radioactivity first appear?
B_ DNA is found only in chloroplasts.

C Membrane-bound enzymes are found only
in mitochondria.
D_ NADP is found only in chloroplasts.
HELP
Candidates must remember that NAD is found
in mitochondria, whereas NADP is found in
chloroplasts.
Q31
A strain of the African Clawed Toad, Xenopus HELP
laevis, exists in which there is only one nucleo-
lus in the nucleus of each cell instead of the A: secretory vesicles, B: Golgi body, C: rough
usual two. ER, D: nucleus.
When such animals are mated, approximately The outer membrane of the nucleus is con-
one quarter of the offspring have two nucleoli tinuous with the ER. The inner membrane
per nucleus, one half have one nucleolus per with protein acts as an anchoring point for
nucleus and one quarter have no nucleoli at all. the chromosomes during interphase. All pro-
Offspring without nucleoli die about four days teins produced by the ER are passed through
after hatching. the cis-Golgi network first. Note: If DNA is
labeled with a radioactive isotope, the rate
These offspring die because they do not pos- of disappearance from the DNA is the slow-
sess est as the DNA is very stable.
A mitochondria and are unable to obtain
energy.
B centrioles and are unable to undergo cell
Q33
division. What is the function of nucleoli?
C Golgi apparatus and are unable to secrete A the formation and breakdown of the
metabolites. nuclear membrane
D ribosomes and are unable to manufacture B_ the formation of centromeres

’ proteins. (ee) the formation of ribosomes
D_ the organisation of the spindle during
nuclear division
W Level 1000 Biology MCQ with HELPs ? 43 Frequently Examined Questions |

Topic 1(a) Cell Organelles 4
HELP Q36
When the nucleoli forms, spindle fibers dis- Which cell components, when appropriately
integrate and the centrioles replicate. The next stained, will be clearly visible under the high
stage is for the nuclear membrane to form power of the light microscope?
around the chromosomes.
endoplasmic
lysosomes chloroplasts
reticulum
Q34
When radioactively-labelled amino acids are J
taken up by pancreatic acinar (secretory) cells, x
what is the sequence of structures in which J
radioactivity will appear?
x
LTS Ege
ne,ae IST
A~ cytoplasm, endoplasmic reticulum, Golgi
apparatus HELP
B_ cytoplasm, lysosomes, endoplasmic reticu- Among the three organelles, the lysosomes
lum (the smallest at 0.1 — 1.0 “M) and the ER
cannot be seen with a light microscope. The
C lysosomes, nucleus, Golgi apparatus
chloroplast, being larger at 5 — 10 uM, is
D membrane, cytoplasm, nucleus visible high power up to 2000 magnifica-
tion.
HELP
The protein is synthesised in the cytoplasm Q37
by the ribosomes, and then translocated to
the endoplasmic reticulum lumen, and later The diagram shows the ultrastructure of a cell.
moved to the membrane stacks on the cis In which cell component is a newly synthesised
face of the Golgi complex, ready for pro- protein modified by adding carbohydrate?
cessing before secretion.
Q35
In eukaryotic cells, transcription occurs in the
nucleus.
In which other organelle does transcription
occur?
A endoplasmic reticulum
B Golgi apparatus
C mitochondrion
D ribosome
HELP
A is the Golgi apparatus that helps produce
HELP glycoproteins by adding carbohydrate to the
Transcription involves the formation of the protein molecule.
mRNA. It can occur in the nucleus, chloro-
plast and mitochondria.
‘\ Level 1000 Biology MCQ with HELPs p 14 Frequently Examined Questions

Q38 Q39
Diagram 1 shows a stage micrometer, on which What identifies a cell as a prokaryote?
the graduations are 0.1 mm apart, and an eye-
A The DNA is associated with protein.
piece graticule, as seen through a light micro-
scope. B The DNA is in a circular form.
Diagram 2 shows a section of plant tissue ~ C_ The DNA is in the form of a double spiral.
viewed at the same magnification. D The DNA is surrounded by a membrane
system.
HELP
ne iT Prokaryote has no true nucleus. It has single

circular DNA and there is a lack of histones.
0.1mm
Q40
diagram 1 The table gives the description of four membra-
nous structures in a cell.
Which structure is correctly matched to its
function?
Function Structure
Wali ki p | an organelle bounded by

a% ( MM C) q A tee | two membranes, the
1S ARIA (| protems | inner highly folded
diagram 2
a network of tubes and
What is the approximate total thickness of the B aerobic | sacs, each tube and sac
cell walls between X and Y? respiration | surrounded by a single
A 10 ym B 20 4m
| membrane
C 100 ym D 200 4m an organelle bounded by

one membrane,
€ | autophagy
containing hydrolytic
HELP | enzymes
In diagram 2, the distance between X and a stack of elongated,
Y is measured at 3 mm. In diagram 1, that lipid curved sacs, each sac
distance is equivalent to 5 fine graduations synthesis surrounded by a single
of the stage micrometer. Since 40 fine gradu- | membrane
ations is equal to 0.1 mm (100 #M), thus
5 fine graduations is approximately 10 “mM.
HELP
Option A: Packing of proteins is carried out
by Golgi body (a stack of elongated, curved
sacs, each sac surrounded by a single
membrane).
Option B: Aerobic respiration is carried out
by mitochondrion (an organelle bounded by
two membranes, the inner highly folded).

Option C: Autophagy is carried out by ly-

sosome (an organelle bounded by one
Q43
membrane, containing hydrolytic enzymes). In eukaryotic cells, nucleic acids are found in
organelles other than the nucleus.
Option D: Lipid synthesis is carried out by
smooth endoplasmic reticulum (a network of Which of the following is correct?
tubes and sacs, each tube and sac sur-
rounded by a single membrane). || chloroplast |ribosomes |mitochondrion
Q41
A lysosome measures 0.4 wm in diameter.
What is the diameter in nm?
DNA and
Ao} aeekin RNA
RNA
B 40 nm
C 400 nm RNA DNA |
D 4000 nm
HELP HELP
1} um = 1000 nm Ribosomes consist of ribosomal subunits that
comprises of ribosomal RNA and protein.
0.4 um = 0.4 x 1000 nm = 400 nm
Chloroplast and mitochondrion have ribo-
somes and a small amount of DNA that
Q42 programs the synthesis of some of their own
proteins.
What is the function of the smooth endoplas-
mic reticulum?
A aerobic respiration Q44
ee) intracellular digestion When a potassium ion (K*) passes from the soil
C synthesis of steroids into the vacuole of a root cell, it encounters
some cellular barriers. Which of the following
D_ transport of proteins
is the most direct path the K* would take
through these barriers?
HELP A Secondary cell wall — plasma membrane
Functions of the smooth endoplasmic reticu- — thylakoid
lum include: B_ Primary cell wall —» secondary cell wall
1. Synthesis of lipids e.g. steroids. — tonoplast
2. Involved in carbohydrate metabolism CG Primary cell wall — plasma membrane >
in. liver. tonoplast
3. Detoxification of drugs and other D_ Cell wall — plasma membrane - grana
poisons in liver.
4. Stores calcium ions necessary for
muscle contraction.
‘X Level 1000 Biology MCQ with HELPs 46 Frequently Examined Questions

HELP HELP
Pit Plasmodesmata Nucleic acids can be classified into DNA and
an RNA. Ribosomes consist of ribosomal sub-
vacuole
/ \amela units each comprises of ribosomal RNA and
Primary = protein.
cell wall
Secondary
cell wall
Plasma . : E a7
membrane
tonoplast
A sample of living cells from the pancreas in
supplied with amino acids containing the heavy
Plasmodesmata
Cytoso} isotope of nitrogen, *N.
Which structures in the cells from the pancreas
B i i ; :
ased on the above diagram, it can be seen would show the highest concentration of *N?
that the path of K~ from the soil into the
vacuole of a root cell is as follows: A centrioles and nuclear envelope
primary cell wall —» secondary cell wall — B_ endoplasmic reticulum and mitochondria
plasma membrane -» tonoplast > vacu- C lysosome and nucleus
ole XD ribosomes and Golgi body
Q45 HELP
What is the function of the Golgi Body? Ribosomes is the site for protein synthesis.
Ribosomes translate the genetic message,
A aerobic respiration carried by mRNA into the specific amino acid
B intracellular digestion sequence of a polypeptide chain. The pro-
tein modified in the rough endoplasmic
A formation of lysosomes :
Ze a a y reticulum is then transported to the Golgi
D transport of proteins body for further modifying, sorting and
packaging.
HELP
Functions of the Golgi Body include: Q48
1. Further modifying, SonC and pack- The diagram shows the organelles that can be
aging the secreted proteins into vesicles. seen with an electron microscope in a yeast cell.
Synthesis of secretory polysaccharides.
Formation of lysosomes.
Q46
From which cell organelle are nucleic acids
present?
A smooth endoplasmic reticulum
B- Golgi apparatus
@ ribosome
D secretory vesicles
glycogen
granule
| ‘N Level 1000 Biology MCQ with HELPs 2 17 Frequently Examined Questions |

How do animal and plant cells differ from the HELP

yeast cell? Ribosomes consist of riboso-
mal subunits each comprises
Animal cell Plant cell of ribosomal RNA and pro-
tein.
A | do not have free ribosomes have chloroplasts
; Chloroplast and mitochon-
have Golgi bodies do not have free ribosomes tise hive dbocomes anda
have centrioles do not store glycogen

small amount of DNA that
programs the synthesis of
store glycogen have Golgi bodies some of their own proteins.
There is an absence of DNA
and RNA in endoplasmic
HELP reticulum.
Golgi body
|
mitocho ts hak Q50
ms
Zo 4
The table gives the description of four membra-
ie nous structures in a cell. Which structure is
ribosomes A o
correctly matched to its function?
Function Structure
Tas

packing of | sacs, each tube and sac
proteins surrounded by a single
membrane
rough ee ae an organelle bounded by
endoplasmic | eareuon two membranes, the
glycogen aneulits inner highly folded
ranule we
ee an organelle bounded by
Centrioles is only found in animal cells. protein one membrane,
synthesis containing hydrolytic
Plant cells store starch and not glycogen.
enzymes
a stack of elongated,
Q49 lipid curved sacs, each sac
In eukaryotic cells, nucleic acids are found in synthesis surrounded by a single
organelles other than the nucleus. membrane
Which of the following is correct?
z chloroplast a aie ribosomes
DNA and RNA pe | RNA DNA and RNA

fe[ pwn [=]ow i
|_|awa [vn
‘\ Level 1000 Biology MCQ with HELPs v 48 Frequently Examined Questions
HELP
Q52
Aerobic respiration is carried out by the mi-
tochondrion. Mitochondrion is surrounded by The table gives the description of four membra-
nous structures in a cell. Which structure is
an envelope of two membranes, the inner
correctly matched to its function?
being folded to form cristae.
Function Structure
Q51 an organelle bounded by
packing of
The diagram shows the components that can be two membranes, the
proteins
seen with an electron microscope in a mitochon- inner highly folded
drion. a stack of elongated,
aerobic curved sacs, each sac
respiration surrounded by a single
membrane
an organelle bounded by
protein one membrane,
synthesis containing hydrolytic
enzymes
lipid sacs, each tube and sac
synthesis surrounded by a single
membrane
A C E HELP
4,Z| outer inner intermembrane Synthesis of
crista lipids e.g. ste-
membrane membrane | space
roid is carried
outer inner out by the
crista thylakoid space
membrane membrane smooth en-
‘outer inner intermembrane doplasmic
cisternae reticulum
membrane membrane space
which consists
outer inner intermembrane of a network
stroma
membrane membrane space of tubes and
sacs.
HELP
Inner membrane Crista :
Level 1000 Biology MCQ with HELPs ” 49 Frequently Examined Questions

TOPIC 1 CELLULAR FUNCTIONS
1(b) Biological Molecules
Ly
Q1 Q3
A peptide bond is formed between The secondary order of protein structure is
A an aldehyde group and an amino group. A the sequence of amino acids in the
Ban aldehyde group and a carboxyl group. polypeptide chain.
C an aldehyde group and an ester group. B~ the formation of peptide bonds between
amino acids.
D a carboxyl group and an amino group.
C_ the coiling of the polypeptide chain.
D’ the folding of the coiled polypeptide chain.
HELP
The peptide bond is the chemical bond that
connects 2 amino acids in a polymer, and HELP
is formed between the amino group of one The structures adopted by polypeptides can
amino acid and the carboxyl group of an- be divided into 4 levels of organisation: the
other through the process of condensation. primary, secondary, tertiary and quaternary
structures. The secondary structure pertains
to the folding of parts of the polypeptide
Q2 chains into regular structure, such as @-
A sequence of amino acids may end in either helices and #-pleated sheets.
an amino group (—NH,) or a carboxyl group
(—COOH). What is the theoretical number of
chemically different dipeptides that may be Q4
assembled from 20 different amino acids? How many fatty acid molecules are normally
A 40 present in a fat or oil molecule?
B80 Ay 1
Cc /160 Bre 2
D 400 Cc 3
D 4
HELP
A dipeptide is made up of 2 amino acids HELP
which may be same or different. The total The typical storage forms of fatty acids in
possible number of different dipeptides that cells are triacylgylcerols, which is formed from
may be assembled from 20 different amino one molecule of glycerol by esterification of
acids will thus be 20° = 20? = 400. fatty acids to each of the 3 hydroxyl groups:
HOCH, — CH(OH) — CH,OH.
‘X Level 1000 Biology MCQ with HELPs ? 99 Frequently Examined Questions

Topic 1(b) Biological Molecules
Q5 Q7
Which one of the following combinations of Polysaccharides are synthesised in plants by the
statements is true of polysaccharides in living process of
organisms?
A condensation. B glycolysis.
They They form They form
C hydrolysis. D oxidation.
provide storage supporting
energy compounds structures
A No No Yes HELP
B No No No Polysaccharides are built of monomeric sac-
charide (sugar) sub-units. During the linkage
C Yes No No
of 2 monosaccharides, a carbon atom of
D Yes Yes Yes one sugar molecule reacts with a hydroxyl
group of another, resulting in the loss of H,O.
This process is condensation.
HELP
Polysaccharides are made of monomeric sac-
charide (sugar) sub-units. They play impor- Qs
tant roles as energy storage molecules within Which one of the following reactions results in
the cell and as structural components on the the conversion of amino acids to proteins?
outer cell surface of or between cells.
A condensation B deamination
C hydrolysis D __ phosphorylation
Q6
An amino acid molecule has the following struc-
ture: HELP
Amino acids are linked together by peptide
bonds, which are formed between the amino
group of one amino acid and the carboxyl
group of another. This process is by conden-
sation, releasing a molecule of water.
Which two of the groups combine to form a Q9

peptide link? Most polysaccharides are composed of chains
AY -ivand 2 of condensed
B 1 and 3 A cellulose units.
Gee2- and 3 B_sihexose_ units.
Der2-and.4 C pentose units.

D sucrose units.
HELP
The peptide bond is the chemical bond that
connects 2 amino acids in a polymer, and Polysaccharides are built of monomeric sac-
is formed between the amino group of one charide (sugar) sub-units. Many polysaccha-
amino acid and the carboxyl group of an- rides, like starch and cellulose, are composed
other through the process of condensation. of hexose units.
W Level 1000 Biology MCQ with HELPs f 24 Frequently Examined Questions

Q10 Q12
Which one of the following types of bond is Five disaccharides were each hydrolysed with
principally concerned in maintaining the dilute acid, and the purified products were
alpha-helix shape of secondary protein struc- separated by one-dimensional chromatography.
ture? The final chromatogram is shown in the dia-
A disulphide bonds gram below.
B ester bonds
C hydrogen bonds
D peptide bonds
HELP
The C=O and N-H groups in peptide bonds
of different amino acids hydrogen bond at
regular intervals to from the a@ -helical struc-
ture of proteins.
If spot 1 represents the products obtained from
the hydrolysis of sucrose, which one of the
Ql1 following indicates the results obtained from the
hydrolysis of lactose and maltose?
Benedict’s test was performed on a 20 cm’
sample of four fruit syrups. A second 20 cm* lactose maltose
sample of each was then hydrolysed and tested A 2 3
with Benedict’s solution. The table shows the
B Z o
masses of precipitate formed.
GC 5 2
Which syrup contains the greatest mass of
non-reducing sugar? D 5 3
mass of total mass of

precipitate before precipitate after HELP
syrup hydrolysis / mg hydrolysis / mg
Sucrose is a disaccharide of glucose and
Aw 25 Bo fructose. Lactose is composed of glucose and
B 50 70 galactose, whilst maltose comprises of 2
molecules of glucose. The common sugar is
C 55 55
thus glucose.
D vhs) 85
HELP
Q13
Which one of the following molecules contains
The relative mass of non-reducing sugar is
amino acids?
obtained from the difference between the
mass of precipitate before hydrolysis and the A ascorbic acid B_cellulose
total mass of precipitate after hydrolysis. It C collagen D _ galactose
can be calculated that the difference is
greatest in syrup A — 30 mg. For syrup B
it is 20 mg, for syrup C it is 0 mg and for HELP
syrup D it is 10 mg. Collagen is the major protein in the extra-
cellular spaces of connective tissue. The type
of collagen in the connective tissue forms
insoluble fibres with very high tensile strength.
Level 1000 Biology MCQ with HELPs ? 99 Frequently Examined Questions

Topic 1(b) Biological Molecules |
Q14 Q16
Which one of the following is a characteristic The helical form of a polypeptide chain is due
of saturated fats which distinguishes them from to the presence within the molecule of
unsaturated fats?
A covalent bonds.
A They do not contain glycerol.
B_ disulphide bonds.
B_ They contain a high proportion by mass of
C __ glycosidic bonds.
oxygen.
D hydrogen bonds.
C They contain only unbranched fatty acids.
D_ They have no double bonds between their HELP
carbon atoms.
Every C=O and N-H group in the peptide
bonds can participate in a hydrogen bond,
HELP contributing to the a@-helical structures of
The maximum number of bonds a single car- proteins.
bon can form is 4. Saturated fats imply that
all the carbon atoms in the compound are
already bound to 4 other compounds or to
Oi
another carbon atom. Unsaturated fats have Which of the following is a complex of globular
double bonds between carbon atoms. protein with non-proteinaceous material?
A collagen Begg albumen
Q15 C haemoglobin D fibrinogen
The diagram shows a molecular structure.
HELP
Haemoglobin is a globular protein that binds
to a non-proteinaceous substance, haem,
which actually carries the oxygen. This
material is known as a prosthetic group and
influences the shape of the polypeptide.
What is the structure enclosed by a box?

A an amino acid
Q18
What does a haemoglobin molecule contain?
Ba glycosidic bond
A four iron (Fe?*) ions attached to each haem
Ca nucleotide
f group
Da peptide bond
B- four oxygen molecules attached to each
haem group
HELP C four polypeptide chains each with four
The peptide bonds is the chemical bond which attached haem groups
connects 2 amino acids in a polymer, and D_ four polypeptide chains each with one
is formed between the amino group of one attached haem group
amino acid and the carboxyl group of an-
other through condensation.
HELP
One haemoglobin molecule contains four
polypeptide chains, each containing one
haem group. Each haem group has one Fe?*
ion attached to it.
WW’ Level 1000 Biology MCQ with HELPs 23 Frequently Examined Questions
Q1g9 HELP
The C=O and N-H groups in peptide bonds
Which of the following does not contain amino
participate in hydrogen bonding, which con-
acids? tributes to the q@-helix structure of proteins.
A carbonic anhydrase
B_ glycogen
Q22
C haemoglobin
The diagram shows part of a polysaccharide
D insulin
chain.
HELP CH,OH CH,OH

Glycogen is the most common form of stor- H OH 4H Oy
age carbohydrate in animal cells, and is a
Z. H H d
ars Ate H ae Hs/ 4
very long, branched polymer of glucose. It
is stored mainly in the liver and muscles.
H OH H OH
Q20 What type of bond is X?
The diagram shows a carbohydrate. A aC B =

CH,OH CH,OH
O
Gy Sige pet
H
What is the name of the bond which links the

two units? HELP
A a glycosidic bond The bond is a glycosidic bond, —C-O-—C-
Ba hydrogen bond which links monosaccharides together, form-
ing the polysaccharides that constitute sugar
C an oxygen bond
molecules.
Da peptide bond
HELP
Q23
1 cm‘ of solution X is mixed with an equal
A glycosidic bond links monosaccharides to-
volume of 5% sodium hydroxide solution in a
gether; and is formed when the carbon atom
test-tube. When two drops of 1% copper sul-
of a sugar molecule reacts with the hydroxyl
phate solution are added, a purple colour is
group of another, resulting in the loss of water.
produced.
What does solution X contain?
Q21 A amino acids
Which type of bond maintains the a@-helix B __ glycolipids
shape of secondary protein structure?
C lipids
A disulphide B ester
D proteins
C hydrogen D peptide
‘\ Level 1000 Biology MCQ with HELPs P24 Frequently Examined Questions
HELP
Q26
This is a test for proteins. A positive result
How many different polypeptides, each consist-
of purple colour shows the presence of pro-
ing of r amino acids, can be made if the num-
teins in the solution.
ber of different amino acids available is n?
Io Tl B Te
Q24 G nr D on
In which column are the statements correctly
applied to cellulose and sucrose? (/ =correct;
X =incorrect; su=sucrose; ce=cellulose) HELP
Since there are n dif-
ferent amino acids, the
number of different
polypeptides that can
be formed, each with
r amino acids, is n’.
It produces monosaccharides
on complete hydrolysis
Q27
HELP
What is the theoretical number of chemically
Sucrose is a non-reducing disaccharide which different dipeptides that may be assembled from
is composed of the monosaccharides, glu- 12 different amino acids?
cose and fructose, linked together by a
glycosidic bond. Cellulose is a long-chained A 24 Bae
polymer of glucose, linked by glycosidic Co 144 D 400
bonds.
HELP
Q25 Mathematically, the number of different com-
Which property of proteins enables them to act binations of two amino acids is 12? = 144.
as pH buffers?
A They are soluble. Q28
B They contain carboxyl and amino groups. Which molecule contains amino acids?
C They have a high molecular mass. ADP rATE B_ cellulose
D They possess both secondary and tertiary C glycogen D haemoglobin
structures.
HELP
HELP
ATP (Adenosine triphosphate) contains an
Proteins can exist as buffers by resisting dras- adenine nitrogenous base, a ribose monosac-
tic changes in pH. This is because they charide and a triphosphate group. Glycogen
possess the groups -NH and -COOH which and cellulose are carbohydrates. Haemoglo-
act as buffer pairs which either accept H* bin is a protein which is made up of amino
or OH- ions from the solution, and maintain acids.
its pH.

||
Q29 Q31
How many fatty acid residues are normally The helical form of a polypeptide chain is due
present in a phospholipid molecule? to the presence within the molecule of
a! 1 ey! A disulphide bonds.
Cc 3 D 4 B glycosidic bonds.
C hydrogen bonds.
HELP D peptide bonds.
One phospholipid molecule consists of one
phosphate group and two fatty acids joined HELP
to one glycerol molecule.
The helical form is a secondary structure of
protein, resulting from a hydrogen bond be-
Q30 tween every 4" peptide bond.
The following statements describe three orders

of structure of the insulin molecule. Q32
1 The molecule consists of two polypeptide Which molecule contains peptide bonds?
chains joined and folded around one an-
other. A ATP B collagen
2 The sequence and number of amino acids C DNA D_maltose

in each polypeptide chain is known.
3 The amino acids in each chain are coiled HELP
into q@-helix and held in position by hy-
Peptide bonds can be found in proteins and
drogen bonds. collagen is the only protein among all the
Which order is described by each statement? options.
statement 1 statement 2 statement 3
A _ primary secondary tertiary Q33
B primary tertiary secondary Which of the following is a polysaccharide
C tertiary secondary primary present in human muscle?
D tertiary primary secondary A amylose
B_collagen
HELP C glycogen
The primary structure is a specific sequence D myoglobin
of amino acids. The secondary structure is
a result of hydrogen bonds at regular inter-
vals along the polypeptide backbone. Two HELP
types of secondary structure are the aq -helix
ee animal starch, stored
and the £-pleated sheets. The tertiary struc- yeoy inliver and muscle
ture includes the folding of regions within the plant, component
same polypeptide and quaternary structure
refers to 2 or more polypeptide chains joined fibrous protein, with
Collagen
and folded around one another. In this structural functions
question, tertiary structure refers to what is foundinblood
known as the quaternary structure.
Level 1000 Biology MCQ with HELPs P26 Frequently Examined Questions
Q34 What is formed when a large number of these

molecules are condensed?
A student was asked to identify the two com-
pounds in each of three test-tubes. The table A amylose Pecans
shows the results of the student’s tests. C phospholipid D protein
reagent added to test-tube HELP

—
fect sodium hydroxide __Benedict’s iodine in The iclecule shown isac
+ copper sulphate solution potassium iodide
ee Rea neta glucose. £ glucose ditfers
blue ine nlack in that the OH group of
carbon 1 (the rightmost
blue-black carbon) is above the plane
Which conclusion is consistent with the results? of the ring instead of below it. The monomer
A Egg white and sucrose had been placed in of amylose is @ glucose while that of
tube X. cellulose is # glucose. Phospholipid is not
B Maltose and starch had been placed in tube a polymer and proteins are formed from
T. amino acids.
C Maltose and sucrose had been placed in C Hn S - Q

tube X. O O O O
D Starch and sucrose had been placed in tube

Y. Starch: 1-4 linkage of a glucose
A purple colour for the Biuret test (sodium

hydroxide + copper sulphate) indicates the
presence of a protein like albumin found in Cellulose: 1-4 linkage of 8 glucose
egg white. A blue colour indicates that a
protein is absent. A brick red precipitate with
Benedict’s solution indicates the presence of Q36
a reducing sugar like maltose. Sucrose, a
non-reducing sugar, would give a negative At which levels of protein structure do hydro-
result, which is blue colour. lodine in potas- phobic interactions occur?
sium iodide turns blue-black when there is A primary, secondary and tertiary
starch and remains brown in the absence of ; d
starch B primary, secondary, tertiary and quaternary
C tertiary and quaternary
Q35 D quaternary only
The diagram shows two molecules. HELP
CH.OH CH2OH Tertiary structure: Polypeptide chain bends and

folds. Maintained by the interactions of ionic,
O 0 hydrogen and disulphide bonds, and hydro-
phobic interactions.
OH OH Quaternary structure: highly complex proteins
OH OH OH OH consisting of an aggregation of polypeptide
chains held together by hydrophobic interac-
OH OH tions and hydrogen and ionic bonds.
‘N’ Level 1000 Biology MCQ with HELPs P o7 Frequently Examined Questions |
Topic 1(b) Biological Molecules ¢
Q37 Which type of bond is formed when these

molecules react to form a larger molecule?
The graph shows the effect of pH on the struc-
A __ glycosidic B_ _ hydrophilic
ture of a protein which consists entirely of
repeating residues of one amino acid. C hydrogen D peptide
a-helix
HELP
The diagram is obviously a glucose structure
with a 6-membered pyranose ring. The bond
formed is between the 1* and 4" carbon
increasing elements, hence forming a glycosidic bond.
symmetry
Q39
random coil
The diagram shows a molecule.
OM2 4°" 6 (610 1214 - O

pH
oat a —
H—CG—H
Which statement is true?
A” At high acidity the protein loses its sec- H
ondary structure. Which substance might include this molecule?
B_ At high acidity the protein loses its tertiary A cellulose B__cholesterol
structure.
C glycerol D- insulin
C At low acidity the protein loses its primary
structure.
D_ At low acidity the protein loses its second- HELP
ary structure. NH, forms and amino group and -COOH
is a carboxyl group. Insulin is the only amino
acid in the list. Cellulose is a polymer of
HELP
glucose. Cholesterol and glycerol are both
In the @ -helix protein, the secondary struc- lipids.
ture is most important, hence the answer
could be A or D. A decrease in acidity (in-
crease in pH), would drastically reduce the Q40
symmetry of the protein helix.
Which protein has a fibrous structure?
A amylase B_collagen
Q38 C haemoglobin D insulin
The diagram shows two molecules of a biologi-
cal substance.
HELP
O O
Fibrous protein has a primary structure of
regular repetitive sequences. They are very
stable molecules and have structural roles.
OH OH
E.g. collagen which is a constituent of ani-
mal connective tissue.
‘\ Level 1000 Biology MCQ with HELPs P28 Frequently Examined Questions
ar Q43
Food tests are carried out on four solutions. Which term most appropriately describes cata-
Which solution contains only sucrose and pro- lase, collagen and haemoglobin?
tein? A enzymes
B_ fibrous proteins
acid C globular proteins
iodine in
hydrolysis
Benedict’s potassium
solution then D polypeptides
test iodide
Benedict’s
solution
test
HELP
Only collagen is a fibrous protein,
whereas catalase and haemoglo-
bin are both globular proteins.
Therefore, the most appropriate an-
swer that would include all these
key: J/ = positive result three proteins is a polypeptide.
X = negative result
Q44
HELP Some germinating seeds are crushed with wa-
ter and the extract is tested. The table shows
Sucrose is a disaccharide made from glu- the results of these tests.
cose and fructose. It is a non-reducing sugar,
so, it snould test negative for the Benedict’s result
test.
Barford’s test for Onitive
disaccharides Pp
Q42 Benedict’s test yellow precipitate
Which combination describes a triglyceride? biuret test purple colour

Clinistix test
soluble | provides | produces water negative
for glucose
in water energy when respired
emulsion test clear solution
K Uf J
iodine test blue-black colour
x
Uf,
Which molecules are present in the extract?
Uf
~
“A fat, maltose, starch only
/B fat, protein, sucrose only
HELP C glucose, protein, starch only
A triglyceride is formed by the condensation D_ maltose, protein, starch only
reaction of glycerol and fatty acids. When a
triglyceride is oxidised, it involves the pro-
duction of water molecules in the process. HELP
Triglycerides are also insoluble in water. There is no fat since the emulsion test was
negative (clear solution). There is no glucose
since the Clinistix test was negative. Maltose
is a reducing sugar, that is also a disaccha-
ride. It is commonly found in germinating
seeds.
| Level 1000 Biology MCQ with HELPs / 29 Frequently Examined Questions |

Q45 Q47
Which description applies to cellulose? Some microorganisms produce
f£-glucosidase enzymes, but mam-
glycosidic
molecule
bond linkage Biructure mals do not.
linear and branched a 1.6 and £ 1.4 fibrous The presence of these microorgan-
linear and branched a1.6and f£ 1.4 non-fibrous isms in a mammal’s digestive sys-
linear and unbranched | £ 1.4 Porous tem aids in the digestion of which
substance?
linear and unbranched | @ 1.6 non-fibrous
A cellulose’ B__ glycogen
C protein D © starch
HELP
Cellulose molecules are unbranched. They HELP
have £-glucose 1-4 glycosidic links and cross Relationship between mammal and microor-
bridges. It gives structural support and is ganism is mutualistic. Microorganisms secrete
hence, fibrous in nature. cellulase to digest cellulose, and another
enzyme for protein. As the enzyme involved
Q46 is {-glucosidase, it could be used in the
The diagram shows a ring structure of glucose. digestion of cellulose that consists of B-glu-
cose molecules.
Which form of glucose is shown and in which
molecule is it present?
CH,0H Q48.
~ Samples of a solution containing carbohydrates
were treated as follows.
tested with —
no
Benedict’s reagent change
warmed with acid,
cellulose neutralised and brick-red
then tested with precipitate
starch Benedict’s reagent
cellulose
starch treated with amylase
brick-red
solution and then tested
precipitate
with Benedict’s reagent
HELP Which carbohydrates were present in the solu-

The position of the hydroxyl (-OH) group on tion?
carbon atom 1 projecting downwards indi- A glucose, maltose and glycogen
cates that this glucose molecule is an a@-
isomer. Starch is made up of these isomers, B__ glucose, sucrose and glycogen
whereas cellulose is made up of £-isomers. C maltose and starch
f
D sucrose and starch
WW Level 1000 Biology MCQ with HELPs / 39 Frequently Examined Questions

HELP Which conclusion is consistent with the results?

From the results for sample 1 and 2, the A Egg white and sucrose had been placed in
carbohydrate present has to be a non-reduc- tube X.
ing sugar (e.g. sucrose) since it needs to be
B_- Maltose and starch had been placed in tube
hydrolysed by an acid prior to the positive
Z.
test. The result for sample 3 shows that the
carbohydrate present has to be starch since C Maltose and sucrose had been placed in
it is digested by the enzyme amylase to tube X.
produce reducing sugars that would test D__ Starch and sucrose had been placed in tube
positive. ve
HELP
Q49
Sucrose is a non-reducing sugar that would
A marine mammal, such as a seal or porpoise,
test negative with Benedict’s solution and
stores large amounts of subcutaneous fat as
starch would test positive for the iodine test.
‘blubber’. Which one of the following is an
incorrect statement about the adaptive value of
this fat?
Q51
A It has a low energy content for its mass in
The table shows some differences between glu-
comparison to other food reserves such as
cose and a triglyceride. Which difference ex-
glycogen.
plains the fact that glucose is soluble in water,
B_ It has an insulating function, fat having a while the triglyceride is insoluble in water?
low heat conductivity.
C It may act to streamline contours for swim-
ming and be a protective shock absorber
below the skin. contains polar
groups
D_ It acts as an energy store, being utilised
when the animal is short of food. does not contain
B
double bonds
HELP C higher ratio of lower ratio of

Fat has a very high energy content and serves carbon : hydrogen | carbon : hydrogen
to insulate marine animals from the cold en- occurs in a does not occur
vironment. ring form in a ring form
Q50 HELP
A student was asked to identify the two food Having polar groups enables glucose to be
substances in each of three test-tubes. The table soluble in water as these groups help to bind
shows the results of the student’s tests. to the hydrogen and hydroxyl ions in water.
reagent added to test - tube
iodine in
Q52
biuret Benedict’s
potassium Which feature is not characteristic of cellulose?
solution solution
iodide
A £-glucose molecules
brick-red brown
B fibrillar structure
blue blue-black
C~ 1-6 glycosidic bonds
blue blue-black
D hydrogen bonds
‘K Level 1000 Biology MCQ with HELPs Vid31 Frequently Examined Questions
HELP Q55
Cellulose has 1-4 glycosidic bonds, rather A sample of solution X is mixed with an equal
than the 1-6 bonds. volume of 5% sodium hydroxide solution in a
test-tube. When two drops of 1% copper sul-
Q53 phate solution are added, a purple colour is
produced.
‘Compared to globular proteins, fibrous proteins What does solution X contain?
are
A amino acids B lipids
A less regular in structure.
C polysaccharides D proteins
Bless stable chemically.
C more readily soluble.
HELP
D more resistant to high temperatures.
Candidates are reminded that this is the
procedure for the biuret test, which is used
HELP for determining proteins.
Fibrous proteins have regular and more stable
structures, thus are
temperatures better
able to withstand high
than globular proteins.
Q56
Fibrous proteins are also insoluble. Which formula is a carbohydrate?
A CH,CHO
Q54 BR CHO
Which feature is true of cellulose and accounts ge OHO,
for its strength? Di G.HJCOou
A It contains both q@-1, 4 and q@-1, 6 links
between glucose units.
HELP
B_ It has OH groups that form hydrogen bonds
Monosaccharides typically have the general
with adjacent cellulose molecules.
formula of CH, O..
C_iIt is a fibrous molecule which is insoluble
in water.
D_ It is made up of long, branched and coiled Q57
chains of (-glucose units with 1, 4 links. The following statements describe the structure
of a certain protein molecule.
1 The molecule consists of two polypeptide
HELP chains which are folded around each other.
Cellulose consists of -glucose units with p In each chain, the amino acids are held in
adjacent molecules that are rotated 180° so a helix by hydrogen bonds.
that hydrogen bonds can form between hy- Which orders of structure are described by these
droxyl groups of parallel chains. It is not statements?
branched or coiled, thus giving it structural
statement 1 statement 2
stability.
A primary tertiary
B secondary tertiary
@ tertiary secondary
D quaternary secondary
Level 1000 Biology MCQ with HEiPs 39 Frequently Examined Questions

HELP Q59
Candidates should remember that the fold-
The diagram represents a tripeptide.
ing of two or more polypeptide chains
constitutes quaternary structure, not tertiary HN
(which is a single polypeptide chain folded
and twisted). HOOC— CH,— C—H
i 1
O== — °
Q58 A
NH
3
‘The diagram shows four different amino acids, H—cC CH,OH
% 4
each with a different R group (side group). C= 0
Which amino acid could form a hydrogen bond 7
HN
between its R group and that of another appro- 6
priate amino acid? HS— CH,— C—H
Zi
A B O== GC
Nou
At which bonds does hydrolysis occur to re-

ee spiel wont lease the amino acids from the tripeptide?
CH! best
A 1and4 B 1 and 6
OH | CU 2 and 5 Dien 3 °and.6
C D
HELP
H,N —G— COOH H,N —G— COOH
a a
Hydrolysis should occur between the C=O
and N-H bonds to separate the amino acids.
ot neta | ee aa
Sooo
;vee ‘ec nS 3
HELP
Only amino acid A has a hydroxyl ion with
an electropositive hydrogen that can form a
hydrogen bond with another amino acid that
has an electronegative oxygen on the C=O
group.

ie
CELLULAR FUNCTIONS
Enzymes
Ne
Q1 HELP
NAD is an obvious answer as it can exist in
Which one of the graphs below shows the ef-
both a reduced and oxidized form. It tends
fect of pH on the reaction velocity of a typical
to act as a H, acceptor.
enzyme?
A B
Q3
q a
OP oe The specificity of enzymes is due to
O86
ow O86
wo A their high molecular weight.
ow oo
mM > ea(5S
B_ their hydrogen bonding.
pH pH C_ their pH sensitivity.
C D
D their surface configuration.
=|
Se Se
one oY
ce) cee) HELP
COM) oo
mi > Mm>
The surface configuration of enzymes, the
active site, consists of certain amino acid
pH pH
side chains whose linear arrangement and
the appropriate folding of the peptide chain
give the enzyme its specificity. This site
HELP
recognises and binds the substrate(s) and
The effective pH for a specific enzyme usu- catalyses the reaction once the substrate(s)
ally falls within a very narrow range of the have been bound.
optimum range. Further increase or decrease
in the pH will result in inactivity of the enzyme,
hence a decrease in reaction velocity. Q4
The diagram below represents reactions taking
Q2 place in a bacterium in which amino acids are
produced from one another by the action of
Which molecule is a co-factor used by dehy- specific enzymes. The numbers 1 to 3 refer to
drogenase enzymes? different amino acids and the letters V and X
A coenzyme A refer to different enzymes.
B cytochrome
C lactate
ja
The artificial introduction into the cell of an
D NAD excess of amino acid 3 reduces the rate of the
reaction catalysed by enzyme X. What is the
cause of this?

Topic 1(c) Enzymes
A competitive inhibition Q6
Bend product inhibition
In the following graph, each of the curves P, Q
C enzyme denaturation and R represents an enzyme-controlled reaction
D_ excess substrate inhibiting the enzyme in one of the following situations:
(i) with the enzyme uninhibited
HELP (ii) with a non-competitive inhibitor added to
the enzyme
End-product inhibitor, or feedback inhibitor,
is when an enzyme that catalyses one of a (iii) with a competitive inhibitor added to the
series of reactions is inhibited by the ultimate enzyme
product of the pathway. This process regu-
lates the level of the product.
Q5_
Curve X shown below represents the course of of
reaction
rate
an enzyme catalysed reaction under optimum
conditions. Curve Y shows the action of the
substrate concentration
same enzyme on the same substrate but with
one alteration to the reaction conditions. Which curve represents each situation?
100 uninhibited competitive non-competitive
enzyme inhibitor inhibitor
added added
A E Q R
WWoO
B P R Q
C Q R is
unreacted
of
% ules
substra
molee
te
D R P Q
0
time
Which one of the following factors, operating HELP

to a constant extent throughout the experiment, Curve P is representative of a typical enzyme
could give the results shown by curve Y? reaction where the rate of reaction remains
unchanged after a certain point when all the
A an end-product inhibitor active sites of the enzyme have been occu-
Ba higher pH pied by the substrates. When a competitive
Ca lower temperature inhibitor is added, the reaction increases less
rapidly since the probability of the substrate
D an increased substrate concentration binding with the active site is less. For curve
R, the number of active sites decrease, thus
the maximum rate of reaction is lower.
HELP
With increasing time, the percentage of
unreacted substrate molecules decreases and Q7
eventually remains constant. This is because
Which one of the following enzymes shows the
with the progress of the reaction, the end
greatest substrate specificity?
products start to inhibit the enzyme by inter-
acting with its active site. A lipase B_nuclease
C pepsin D __ sucrase

Topic 1(c) Enzymes 4
HELP Which one of the curves, A, B, C, or D, repre-

sents the expected result when the same experi-
Sucrase shows the most substrate specificity
ment is conducted in the presence of a fixed,
since it hydrolyses only the disaccharide,
low concentration of a non-competitive inhibi-
sucrose,
tor?
Q8 HELP
In the graph below, X represents the relation- The presence of a non-competitive inhibitor
ship between an enzyme and the concentration will cause the reaction to reach a lower
of its substrate under optimal conditions and optimum within a shorter time period, be-
without an inhibitor. cause it binds to sites on the enzyme other
than the active site and inhibits the enzyme.
Hence the number of active sites available
will decrease.
Q10
The four acids shown below form part of an
enzyme-catalysed sequence.
initial
velocity
reaction oxoglutaric acid ( a@-keto glutaric acid)
Which one of the curves, A, B, C, or D, repre- ewyme1 . succinic acid —™™2 ,

sents the expected result when the same experi- 2H
ment is conducted in the presence of a fixed,
fumaric acid enzyme 3 malic acid
low concentration of a competitive inhibitor?
The addition of malonic acid results in no
change in the concentration of oxoglutaric acid,
HELP
an accumulation of succinic acid, and a near
In the presence of a competitive inhibitor, the absence of both fumaric acid and malic acid.
probability of the substrate binding with an
Further addition of fumaric acid results in the
active site decreases since it has to compete
formation of malic acid.
with the inhibitor. Hence the rate of reaction
increases at a slower rate and ievels off later. What does this information indicate about
malonic acid?
A It is an inhibitor of enzyme 1.
2 es
B_ It catalyses the formation of succinic acid.
C_ It is an inhibitor of enzyme 2.
D It reacts with fumaric acid.
HELP
On addition of malonic acid, the formation
of fumaric acid from succinic acid is inhib-
ited, thus it can be concluded that if inhibits
initial
velocity
reaction enzyme 2. Without fumaric acid as a sub-
strate, enzyme 3 is also unable to act. How-
In the graph above, X represents the relation- ever, the addition of fumaric acid results in
ship between an enzyme and the concentration the formation of malic acid, which means
of its substrate under optimal conditions and that enzyme 3 is not inhibited.
without an inhibitor.
W Level 1000 Biology MCQ with HELPs / 36 Frequently Examined Questions

Topic 1(c} Enzymes
Q11 enzyme present in insect guts

An enzyme increases the rate of a reaction by
amylase protease | sucrase
A supplying the energy required to start the
reaction. v Jo
o x
B__ increasing the rate of random collisions of
molecules. x J
C removing the product of the reaction so al- x x
lowing it to continue.
D bringing the reacting molecules into pre-
cise orientation with each other. HELP
Complex carbohydrates are not found in
blood so there would be no need for the
HELP
enzymes amylase and sucrase to be present
An enzyme reduces the activation energy in the insect’s guts.
needed for the reaction to occur by binding
with a substrate and straining its bonds so
allowing for easier reaction, or binding mul-
tiple substrates in a way that brings them
_ (=oO
together in a precise orientation so they can
react readily with one another.
Q12 uioO
Which one of the following bonds permanently

to the active site of an enzyme? unreacted
of
% substrate
molecules
A allosteric inhibitor oO
time
B coenzyme
Curve X represents the course of an
C competitive inhibitor enzyme-catalysed reaction under optimum con-
D non-competitive inhibitor ditions.
Curve Y shows the action of the same enzyme
on the same substrate but with one alteration
HELP
to the reaction conditions.
A competitive inhibitor is structurally similar
Which of the following factors, operating to a
to the actual substrate, and can fit into the
constant extent throughout the experiment,
active site of the enzyme, forming an en-
could give the results shown by curve Y?
zyme-inhibitor complex that prevents the
substrate from binding to the enzyme. Aa higher pH
Ba lower temperature
Q13 Ec an end-product inhibitor

Dan increased substrate concentration
A medical scientist investigates four species of
insects. He knows that one feeds on human
blood and that the others feed on plants. As HELP
the insects look similar, he investigates the
For Y, a certain amount of substrate mol-
digestive enzymes present in their guts.
ecules remains unreacted. This is because
Which insect feeds only on blood? the end-product inhibits the reaction.
¥ Level 1000 Biology MCQ with HELPs 37 Frequently Examined Questions

Topic 1(c) Enzymes
Q15 Q17
An essential feature of a competitive inhibitor The diagram illustrates energy changes in an en-
is its ability to zyme controlled reaction.
A activate an operator gene.
B combine with a prosthetic group.
Cc modify a substrate.
D occupy an active site. energy
HELP
reaction
A competitive inhibitor binds to the active
site of the enzyme because it resembles the Which of the following represents the lowering
substrate. This results in a competition be- of the activation energy?
tween the inhibitor and the substrate for the Ve aaa 4 |; Ea
enzyme.
C Z D Z-Y
Q16 HELP
Which graph represents the changes in substrate The energy required to initiate a reaction is
concentration during the course of an known as the activation energy, E,. The bold
enzyme-controlled reaction? curve shows the uncatalysed reaction with E,
= Z, whilst Y represents the E, of the catalysed
A B
reaction (dotted curve). The E, is thus low-
ered by (Z — Y).
Substrate
Q18
Substrate
concentration concentration Which of the following is an example of feed-
° a3 qe) ° Time back inhibition in a metabolic pathway?
A A non-competitive inhibitor binds irrevers-
ibly to the substrate.
B An enzyme-controlled reaction slows down
as end product accumulates.
C There is competition between two enzymes
Substrate Substrate for a common substrate.
concentration concentration
=) ° Variations in enzyme concentration affect
st = © Time
the rate of the reaction it catalyses.
HELP
HELP
The substrate concentration decreases with
Some enzymes have, in addition to the active
time as more substrate molecules become
sites for binding to substrates sites that can
substrate molecules become associated with
recognise the end product. This results in the
the active site of the enzyme, and are con-
end product binding to the enzyme, suppress-
verted into the products of the reaction.
ing its activity, thus regulating the enzyme
action.
Level 1000 Biology MCQ with HELPs ? 3g Frequently Examined Questions

Topic 1(c) Enzymes
Qi19 curve 3
Each graph shows the rate of reaction of an un-
inhibited enzyme and that of the same enzyme non-competitive normal
inhibition activity
in the presence of a constant amount of either
a competitive or a noncompetitive inhibitor. normal non-competitive
activity inhibition
Which graph is correctly labelled?
competitive non-competitive
A B inhibition inhibition
inhibitor inhibitor competitive
inhibition
reaction
rate reaction
rate HELP
substrate substrate Curve 2 shows competitive inhibition, where
with increasing substrate, the substrate can
Cc D k compete with the inhibitor for the enzyme’s
non-competitive competitive a active site. The rate of the reaction thus
inhibitor inhibitor —— uninhibited remains constant at a later stage than if no
2 reaction
S inhibitor was present. Curve 3 shows non-
c -<- inhibited
~ . - .
& reaction competitive inhibition, where the increase in

vo
i] substrate concentration does not cause the
)
—
reaction
rate reaction rate to level off slower because the
substrate substrate inhibitor binds to a site other than the active
concentration concentration site and causes a permanent configuration
change in the enzyme.
HELP
With increasing substrate concentration in the Q21
presence of a competitive inhibitor, the rate The reaction rate of salivary amylase with starch
of reaction only remains constant at a later decreases as the concentration of chloride ions
stage. This is because the additional sub- is reduced.
strates can compete with the inhibitor for the
Which of the following describes the role of the
enzyme’s active site.
chloride ions?
A allosteric inhibitors
Q20 B coenzymes
The curves show the rates of reaction of an C cofactors
enzyme with and without inhibitors.
D competitive inhibitors
1
HELP
initial
Some enzymes associate with a non-protein
reaction
velocity 3 cofactor that is needed for enzymatic activity.
Organic molecules that associate with en-
zymes in a similar way are called coenzymes.
lf chloride ions were inhibitors, whether al-
substra te concentration
losteric or competitive, a decrease in con-
centration should result in an increase in the
What do the curves show?
rate of reaction instead of a decrease.

Topic l(c) Enzymes
Q22 HELP
As the substrate concentration increases, the
The diagram represents a reaction with and
rate of reaction increases until a maximum,
without an enzyme. What is the activation
when saturation of all the enzyme’s active
energy of the enzyme-catalysed reaction?
sites occurs. When this happens, the limiting
Cid
rt ae
| bie
Tie
la
ook tame
ae
=
D
factor is enzyme concentration.
jireactants B Q24
Occ an ale eeaeceria osney bene Which statement is true for a non-competitive
q
products
Ic inhibitor of enzyme activity, but not for a com-
petitive inhibitor?
eae A Inhibitor molecules are similar to normal
substrate molecules in size and shape.
HELP B_ Inhibition can be reduced by increasing the
The reaction that is enzyme-catalysed has a concentration of substrate molecules.
lower activation energy and is represented by C Large numbers of inhibitor molecules are
the dotted line. The energy input required to needed for effective enzyme inhibition.
raise the energy of the reactants to a certain
level before the reaction is triggered is called D_ The inhibitor binds to the enzyme molecule
at a position away from the active centre.
the activation energy. This is represented by
the increase in energy of the reactants to the
top of the ‘hill’, B. HELP
The competitive inhibitor binds reversibly to

O23 the active site and hence competes with the
substrate for the site. The non-competitive
Which graph shows the expected relationship inhibitor, on the other hand, binds to the
between enzyme activity and substrate concen- enzyme at a site other than the active site,
fon?
tration! hence it does not compete with the substrate
A B for the active site.
: :
8 g Q25
DB TS)
ee)
r
bal .
. How does an enzyme increase the rate of a re-
x v action?
ny © ° : :
A by bringing the reacting molecules into
substrate substrate precise orientation
C D B __by increasing the rate of random collisions
of molecules
6= S= C
Ar : ae
by shifting the point of equilibrium of the
vw wv .
9 9 reaction
o o
Ss a D__ by supplying the energy required to start
5 o the reaction
~ ad
Oo fae}
Ww = a
substrate substrate
concentration concentration HELP
An enzyme increases the rate of reaction by
either providing an alternate reaction path-
‘8 Level 1000 Biology MCQ with HELPs ? 4g Frequently Examined Questions

Topic 1(c) Enzymes
way with a lower free energy of activation Which graph shows the energy changes for the
or bringing the reacting molecules into a ge- same reaction when it is catalysed by an en-
ometry resembling the transition state of the zyme?
molecule, thus lowering the activation en-
ergy also. A 4
= >
Which graph represents the effect of tempera- e

ture o n enzyme activity
ivity? &2 &@
A B : :
5 g Time Time
9 g C D
.
Se
2
Ge
v= 6)
5 >i SS
65
a = o ©
m = = ies eee ag Cees nae
@) re) o ®
& e
C D on ey
3 3
Fs; Be] Time Time
1S) iS)
ise) [a0]
S 2
‘6 ‘6 HELP
2 2 ae
5 Ss An enzyme decreases the activation energy
0 0 of the reaction, illustrated by the lower ‘hump’.
However it does not change the free ener-
gies of the reactants and products, thus the
HELP start and end point must be at the same
As the temperature increases, the rate in- level.
creases at first until a maximum rate because
an increased number of molecules have suf- Q28
ficient energy to pass over the energy barrier
and react to form products. A further increase In an investigation to determine the effect of
in temperature results in a more rapid de- temperature on the activity of an enzyme, the
crease of reaction rate because of tempera- time for all the substrate to disappear from a
ture-induced denaturation of the enzyme. standard solution was recorded.
Which graph shows the results of this investi-
Q27 gation?
A B
The graph shows energy changes during an
uncatalysed chemical reaction.
time time
ay
>> ST iam CE a a
{Activation energy
. .
temperature temperature
o
8 Cc D
feb)
g
By
time time
Time
| ‘W’ Level 1000 Biology MCQ with HELPs P ar Frequently Examined Questions
=
Topic 1(c) Enzymes ]
HELP Q30
Since the y-axis is time, the graph obtained Which statement is true of all enzymes?
would be a vertically-inverted reaction rate
vs temperature graph. As the temperature in- A They are denatured at temperatures above
creases, the time needed decreases at first 60 °C.
until a minimum because an increased B_ They catalyse the breakdown of large mol-
number of molecules have sufficient energy ecules into smaller ones.
to pass over the energy barrier and react to C They have active sites which can bind to
form products. A further increase in tempera- only one kind of substrate molecule.
ture results in a more rapid increase of time
required because of temperature-induced de- D They reduce the amount of energy required
naturation of the enzyme. to start a reaction.
Q29 HELP
Enzymes reduce the amount of energy re-
Which graph represents the changes in substrate
quired to start a reaction by either providing
concentration during the course of an enzyme-
an alternate reaction pathway with a lower
catalysed reaction?
activation energy or bringing the reacting
A B molecules into a geometry resembling the
transition state of the molecule, thus lower-
6 8 ing the activation energy also.
£5 23
a Ze
om oo
se) GB)
a) 1S)
na
Qo
=} 1S)
epm=|
Q31
fe) re)
oO oO The graph shows the effect of an enzyme on a
0 Time 0 Time reaction.
C D
inte
: :
proits
(comme) om
fH a |
OE aE
Qo Qo
Se) f=} 1S)
Na na
se) fo)
cS oO
0 Time 0 Time of
Energy
system Product
Time
HELP Which combination identifies X, Y and Z?
As the reaction progresses, substrate con-
centration should reduce as more products
are formed. Therefore, the answer could be uncatalysed activation
C or D. Initially the substrate and enzyme reaction energy
forms a complex, and so the graph plateaus energy lost
for a while. A point is reached when all the catalysed uncatalysed
reaction
during
substrate sites are being used, and the en- reaction
reaction
zyme becomes a limiting factor. As products energy
are formed, the enzyme is free and the re- uncatalysed catalysed
reaction
gained
reaction
action starts again. Hence, the answer should by product
be C. overall
uncatalysed catalysed
reaction
energy
reaction
change
‘ Level 1000 Biology MCQ with HELPs P ao Frequently Examined Questions

Topic 1(c) Enzymes
HELP A It acts as an end-product inhibitor.

In the transition state, the reaction is B_ It acts as a competitive inhibitor.
uncatalysed. Therefore, X should read as an
C It decreases levels of ammonia.
uncatalysed reaction. Y is part of the catalysed
reaction. Portions of the graph above the D It increases levels of glutamate.
initial energy level would indicate an energy
increase.
HELP
The site of action is before the ammonia
Q32 reacts with the enzyme. Since it resembles
glutamate, it would be able to block the site
In the graph, X represents the relationship be-
of reaction, acting as a competitive inhibitor.
tween an enzyme and the concentration of its
substrate under optimal conditions and without
an inhibitor. Q34
The same experiment is repeated in the pres-
Which graph shows the effect of increasing en-
ence of a fixed, low concentration of a competi-
zyme concentration on product formation when
tive inhibitor.
there is an excess of substrate?
Which curve represents the expected result?
A B
fox ¢c
2 2
w ~ Cay
£8
(a) ce}
£8
CS
86
S Q
g8
eG
velocity 0 Oo 83
Initial
reaction
of enzyme of enzyme
Substrate concentration
Cc D
HELP cc Cc
2 xe)
- —
Competitive inhibitors are reversible. The fire 8 © 6
nal result should be the same. Hence the ie es
answer could be A or C. As the inhibitors
gfee 8(i. gre 8for
are in low concentration, graph A is more 86 8
appropriate.
of enzyme of enzyme
Q33
The diagram shows how the enzyme glutamine HELP
synthetase removes the ammonia produced
There would not be a slow down in the activity
during plant metabolism.
of the enzymes as there is excess substrate.
glutamine Therefore, the graph does not plateau, but
ammonia + glutamate —SYBthetase_, slutamine will increase proportionately.
Some herbicides contain an active agent which

resembles glutamate.
What is the likely mode of action of this agent?
"Level 1000 Biology MCQ with HELPs ? 43 Frequently Examined Questions

Topic l(c) Enzymes
Q35 HELP
A decrease in (1), decrease in lysine.
What is the effect of increasing substrate con-
centration on the degree of inhibition of an An increase in (2), increase in lysine but also
enzyme controlled reaction? threonine.
An increase in (3), increase in threonine.
A decrease in (4), decrease in threonine.
7 inhibition inhibition
Q37
A decreased increased
decreased no change
increased decreased A fungal amylase is incubated with starch at
no change increased 22 °C at pH 8. When a sample is removed after
five minutes and mixed with a solution of io-
dine in potassium iodide solution, the mixture
HELP is a light-brown colour.
With an increase in substrate, there will be What is the most likely explanation for this ob-
less competitive inhibition as more substrate servation?
can occupy the active sites. However, there A All the starch has been hydrolysed to
will be no change in inhibition from non- maltose.
competitive sources, e.g. the substrate itself,
B- An inhibitor of the fungal amylase is
since the inhibitor does not compete with the
present.
substrate for the active sites.
C Fungal amylase does not catalyse the hy-
drolysis of starch.
Q36 D_ The pH is too high to allow the reaction
A culture of bacteria produces the food supple- to proceed quickly.
ment lysine by the metabolic pathway shown.
aspartate HELP
enzyme 1 The presence of starch turns the iodine into
\ aspartyl phosphate inhibition a dark blue solution. However, amylase is an
enzyme 2 enzyme that can digest starch by hydrolysis
\ | in alkaline conditions, thus there would no
|
aspartic semialdehyde ———» lysine
longer be any starch present for the iodine
; enzyme 3 test.
|
; homoserine
\|
1
t
| enzyme 4
.
Q38
eyes threonine
Which statement is true of all enzymes?
Which change in enzyme activity will result in
the greatest increase in lysine yield? A They are denatured at temperatures above
60 °C.
change in activity B They are inhibited at low pH values.
decrease C They catalyse the breakdown of large

molecules into smaller ones.
increase
increase D_ They reduce the amount of energy required
decrease to start a reaction.
4 Level 1000 Biology MCQ with HELPs ? 4g Frequently Examined Questions

Topic 1(c) Enzymes
HELP
4
All enzymes lower the activation energy
needed for a reaction to occur. Not all
enzymes denature above 60°C or catalyse
the breakdown of only large molecules. Some
enzymes work best at low pH values. Energy |- - -- ~---------|(-------
initial
Q39 state D| final
state
In beer-making, enzymes present in malting >
barley hydrolyse starch into sugar, ready for Progress of reaction
fermentation. The graph shows the production
of sugar at three different temperatures over a
HELP
period of 50 minutes. All other conditions were
controlled. Enzymes help to lower the activation
50°C energy needed for a reaction to occur,
40 60°C thus region B would be lowered in
the presence of an enzyme so that
sugar 30 ae the reaction progresses faster.
concentration/
arbitrary units 55 Q41
The graphs show the effects of temperature and
pH on enzyme activity.
time/minutes Q
R
What does the graph show?
A At 60°C, all the starch is hydrolysed within
rate of F rate of
30 minutes. reaction reaction Ss
B At 70°C, the enzymes are denatured be-

fore hydrolysis is complete.
temperature pH
C Sugar is absent from the barley before
malting. Which statement is a correct explanation of the
rate of reaction at the point shown?
D_ The optimum temperature for the enzymes
is 50 °C. A At P, hydrogen bonds in the enzyme are
broken.
HELP B- At Q, the kinetic energy of enzyme and
substrate is highest.
Optimum temperature is the temperature
whereby the rate of enzyme reaction is at the C At R, covalent bonds are formed between
maximum, as can be seen in the graph for enzyme and substrate.
50 °C. It is not the temperature whereby the D_ At S, ionic bonds in the enzyme are bro-
rate of reaction reaches a constant rate faster, ken.
as seen in the other two graphs.
HELP
Q40 Q indicates the point where the rate of re-
The diagram shows the change in energy dur- action is the highest, thus this is the optimum
ing an uncatalysed reaction. In which region will temperature for enzyme activity. The kinetic
the introduction of an enzyme have most effect energy of the enzyme and substrate is at its
on the energy level of the reaction? peak so that more collisions can occur to
speed up reaction.

Topic 1(c) Enzymes
Q42 HELP
As competitive inhibitors compete for active
Curve X represents the course of an enzyme-
sites on enzymes, increasing the concentra-
catalysed reaction under optimum conditions.
tion of substrate will enable more substrate
Curve Y shows the action of the same enzyme molecules to occupy the active site than the
on the same substrate but with one alteration inhibitors. In non-competitive inhibition, there
to the reaction conditions. will be no effect since the inhibitors do not
100 compete for the same active sites as the
substrate molecule.
unreacted
substrate
molecules/%
50
Q44
Equal quantities of a 5% starch solution were
0
added to equal quantities of different solutions.
time
After 5 minutes at room temperature, the solu-
Which factor, operating to a constant extent tions were tested with iodine in potassium
throughout the experiment, could give the re- iodide solution and the depth of colour was
sults shown by curve Y? recorded using a colorimeter (with an arbitrary
A increased substrate concentration scale of 1 to 5, 5 being the darkest blue).
B_ inhibition by the end product The results are given in the table.
C less concentrated reaction mixture
colorimeter
D lower temperature solution
reading
. saliva and dilute HC/

HELP
. saliva and dilute NaHCO,
Curve Y shows that the percentage of
unreacted substrate molecules is higher than . dilute HC/ only
X and tapers off at 50%, thus the factor is . saliva at 100 °C
one that prevents the reaction from continu- . Saliva at 20°C
ing on after a certain time. If it was low
temperature or less concentrated mixture, the This experiment suggests that saliva contains a
curve would still be able to reach 0%, but biologically active substance that
over a longer period of time.
A hydrolyses starch in acid conditions.
Bis denatured by hydrochloric acid.
Q43 C is promoted in its action by high tempera-
In a reaction mixture, the concentrations of tures.
enzyme and inhibitor remain constant and the D may be activated by hydrogencarbonate
concentration of substrate is increased. ions.
How is inhibition affected?
competitive non-competitive HELP
inhibition inhibition
Saliva contains amylase enzymes that func-
A decreases increases
tion well at an optimum pH which is alka-
B_ decreases remains the same line. Therefore, the presence of
C increases decreases hydrogencarbonate ions provides the opti-
mum pH for this enzyme.
D__remains the same increases
Level 1000 Biology MCQ with HELPs % 4g Frequently Examined Questions

Topic 1{c) Enzymes
Q45 HELP
The graph shows the amount of product formed The rate of reaction can be determined from
by a standard concentration of enzyme and a the gradient of the graph, the faster the rate
standard concentration of substrate at a tempera- of reaction, the steeper the gradient while
ture of 20°C. the slower the rate of reaction, the more
gentle the gradient.
Amount a0 Decreasing the temperature decreases the rate
of 15 of enzyme-controlled reaction, resulting in a
product graph with a more gradual gradient with 10
formed / 19 arbitrary units of product formed.
arbitrary 5
units
0
Time
ae Q46
Which statement does not correctly describe a
Which graph shows the effect on the activity of
possible action of a non-competitive enzyme
the enzyme of decreasing the temperature to
inhibitor?
eri Cis
A It binds at a point where there are sulphur
Amount aon bridges and prevents the formation of an
of 15- enzyme-substrate complex.
product It binds at the active site and does not
A formed/ 197 prevent the formation of an enzyme-sub-
arbitrary 5 _| strate complex.
units
0 It binds near the active site and prevents
Time the formation of an enzyme-substrate com-
plex.
Amount 20 It binds to an allosteric site and prevents
of 15 the formation of an enzyme-substrate com-
product plex.
B formed/ 19
arbitrary 5
units HELP
0
Time A non-competitive enzyme inhibitor has no
structural similarity to the substrate and binds
Amount ad to the enzyme at allosteric site (site other
of 15-4 than the active site), resulting in reduced
product reaction rate. Upon binding of the inhibitor
Cc formed/ 197 to the enzyme, the enzyme configuration is
arbitrary ae changed such that its active site’s conforma-
units tion is altered, preventing the formation of
0 enzyme-substrate complexes and reduces
Time reaction rate.
Amount a0
of 15 Q47
product |
What is the chemical nature of enzyme?
D formed/ 19
arbitrary 5 A Phospholipid B_Polynucleotide
units C Polypeptide D_s~ Polysaccharide
0
Time
|‘ Level 1000 Biology MCQ with HELPs P az Frequently Examined Questions

Topic l(c) Enzymes
HELP
Enzymes are biological catalysts. Enzymes are Total
amount
normally globular protein made of polypep-
tide. of
C glucose
produced
Q48
Lactose is a disaccharide present in milk. The
Time
enzyme /(-galactosidase catalyses the conver-
sion of lactose to glucose and galactose. >
Total
10 cm’ of a 1% /-galactosidase solution was amount
added to 10 cm’ of milk. The graph shows the of
total amount of glucose produced over the next D__ glucose
10 minutes. produced
Total
amount
Time
of
glucose
produced HELP
Increasing the £ -galactosidase solution from
1% to 2% increases the enzyme concentra-
Time tion. As enzyme concentration increases, more
Then, 10 cm* of a 2% f#-galactosidase solution active sites are now available for successful
collisions between the enzyme and substrate
was added to 10 cm* of milk. Which graph
to form more enzyme-substrate complexes,
shows the results that would be obtained?
leading to an increase in the rate of reac-
tion. As the substrate concentration remains
Total the same at 10 cm? of milk, thus the total
amount amount of glucose produced will be the same.
of
A glucose
produced Qag
Which molecule in the key is enzyme?
Time contains nitrogen
Total Yes No
amount
of contains contains
B__ glucose pentose hexose
produced sugar sugar
Time
W Level 1000 Biology MCQ with HELPs / 4g Frequently Examined Questions

]
Topic 1(c) Enzymes |
HELP Which graph shows the results?

Enzyme is a protein and made up of amino
acids. There is an absence of pentose sugar
which is present only in nucleic acids and Cc
carbohydrates. ®
oe
&
Each amino acid consists of a central a ®o
carbon atom bonded covalently to four

A
&
&
groups: A basic amino group (—NH,), an the
of
reaction
completion
for
acidic carboxyl group (—COOH), a hydro-
gen atom and a variable group known as
the R-group (also called the side chain). 10 20 30 40 50 60
In conclusion, there is presence of nitrogen Temperature / °C
and absence of pentose sugar.
Q50 jon
oO
mG
Which statement correctly describes a possible &

o
action of a competitive enzyme inhibitor? &
B
A It binds at the active site and prevents the the
of
reaction
completion
for
formation of an enzyme-substrate complex.
B It binds near the active site and prevents
the formation of an enzyme-substrate com- 10 20 30 40 50 60
plex. Temperature / °C
It binds near an allosteric site and prevents
the formation of an enzyme-substrate com-
plex. S|
oO
It binds to an allosteric site and prevents Fs
the formation of an enzyme-substrate com- o
plex.
C
&
fH
of
the
reaction
completion
for
HELP
Competitive enzyme inhibitor is structurally 10 20 30 40 50 60
similar to the actual substrate, and can fit Temperature / °C
into the active site of the enzyme. When it
is bound at the active site, it prevents the
actual substrate from entering the site, hence
preventing the formation of enzyme-substrate q
oO
complexes and generation of products. 4
ie
oO
5
Q51 D bo
for of
the
reaction
completion
An enzyme is completely denatured at 50 °C. A
fixed concentration of this enzyme is added to
a fixed concentration of its substrate. The time 10 20 30 40 50 60
taken for completion of the reaction is measured Temperature / °C
at different temperatures.

Topic 1(c) oe
HELP The diagram shows a molecule. In which mol-

ecule would the linkage indicated by the arrow
As the enzyme is completely denatured at
50 °C, the enzyme reaction will never reach be found?
completion at 50 °C regardless of the amount A Cellulose B Amylose
of time available. C Amylase D_ Cholesterol
Q52 HELP
Which type of bonds hold the tertiary structure Amylase is an enzyme that catalyzes
of an enzyme? the breakdown of starch into mal-
tose. Amylase is formed by the
disulphide | glycosidic | hydrogen | ionic | peptide condensation of amino acids.
x J x Two amino acids react together in
x x J a condensation reaction with the loss
J J x of a water molecule to form a dipep-
v x J tide. The linkage formed is a cova-
lent bond known as a peptide bond.
HELP R! R?
H | O H j
Yi ~
Glycosidic bond is found in carbohydrates N— ;sec > Nee UW
we Sephy ieee)ao 274
and absence in protein (enzyme). H H ,OH Hi} is OH
To become a functional enzyme, a protein "water removed —

NN
must assume it’s primary, secondary and condensation |hydrolysis
tertiary structure.
peptide bon
The primary structure of a protein molecule R! es R?
refers to its number, type and sequence of ‘ | | if
amino acids held together by peptide bonds dipeptide Se N—-C—C—N+C—C
ae 4 sii
ae bi | *
in the linear strand of polypeptide chain. H - H: H OH
free amino group PAs, free carboxyl group
Secondary structures are regular repeating
structures stabilised by hydrogen bonds
between groups in the main chain of the
polypeptide. Q54
Tertiary structure is the three-dimensional con- At which levels of enzyme structure do hydro-
formation of a polypeptide maintained by phobic interactions occur?
ionic bonds, hydrogen bonds, disulphide
bonds and hydrophobic interactions. A primary, secondary and tertiary
B_ primary, secondary, tertiary and quaternary
C tertiary and quaternary
Q53 D quaternary only
z sl ee HELP
Ne—c—neo— ci Tertiary structure is the three-dimensional con-
HO formation of a polypeptide maintained by
ionic bonds, hydrogen bonds, disulphide
bonds and hydrophobic interactions.
4 Level 1000 Biology MCQ with HELPs p 50 Frequently Examined Questions

Topic 1(c) Enzymes
Many highly complex proteins consist of an HELP

aggregation of 2 or more polypeptide chains
Definition of a competitive inhibitor — A
held together by hydrophobic interactions,
compound that is structurally similar to the
disulphide linkages, hydrogen bonds and ionic
actual substrate, and can fit into the active
bonds.
site of the enzyme.
Definition of a non-competitive inhibitor — A
Q55 compound that has no structural similarity to
the substrate and binds to the enzyme at site
The diagram below shows the action of an other than the active site, resulting in reduced
enzyme on its substrate. reaction rate.
Sob
The rates of reaction of this enzyme were stud-
~_-
AG
Te)
o
n
ae
Oo
oOo VU
ig as
A Without
inhibitor
oe “With competitive inhibitor
ied in the presence and absence of inhibitors, = he

o
reaction
/ pee
and the results shown in the curves below. >
N
/ - .-7 With non-competitive inhibitor
¢c
o Tagtird
bs
velocity
Initial
reaction
Which of the following reflects correctly the

respective curves?
Curve 1 Curve 2 Curve 3
ve)
o
<a 573
’ Level 1000 Biology MCQ with HELPs 54 Frequently Examined Questions
Topic 1(c) Enzymes
Q56 HELP
The rate of reaction can be determined from
The graph shows the amount of product formed
the gradient of the graph, the faster the rate
by a standard concentration of enzyme and a
of reaction, the steeper the gradient while
standard concentration of substrate at a tempera-
the slower the rate of reaction, the more
ture of 15°C.
gentle the gradient.
Amount au The rate of an enzyme-controlled reaction is
of 15 doubled for every rise of 10°C. Thus, in-
product creasing the temperature increases the rate
formed / 19 of enzyme-controlled reaction, resulting in a
arbitrary 5 graph with a steeper gradient with 10 arbi-
units trary units of product formed.
(@) —»>
Time
Which graph shows the effect on the activity of Q57
the enzyme of increasing the temperature to
The enzyme amylase catalyses the conversion
20-C?
of starch to maltose. 10 cm® of a 1% amylase
solution was added to 5 cm of starch suspen-
Amount ao
sion. The graph shows the total amount of
of 15 maltose produced over the next 15 minutes.
product
A formed/ 19
arbitrary 5
units
0
Time Total amount
of maltose
Amount an produced
of 15
product
B formed/ 19
arbitrary 5 Time
units
(0) ———— Then, 10 cm’ of a 2% amylase solution was
Time added to 10 cm® of starch suspension. Which
graph shows the results that would be obtained?
Amount 20
of 15
product
C formed/ 19
arbitrary 5 Total amount
units of maltose
O A produced
Time
Amount 20
of 15
product Time
D formed/ 19
arbitrary 5
units
0
Time
‘A Level 1000 Biology MCQ with HELPs P 59 Frequently Examined Questions

Topic 1(c) Enzymes
Q58
A popular herbicide named glyphosate is re-
ported to kill plants by affecting an enzyme in
Total amount
the pathway leading to the synthesis of several
of maltose
amino acids required in the assembly of plant
B produced
proteins.
To determine the mechanism of glyphosate
action, you conduct assays of that enzyme with
—$_ >
increasing amounts of substrate and a constant
Time amount of glyphosate.
The results are shown in the table below.
Assay of enzyme activity with increasing
substrate, constant glyphosate levels:
Total amount
of maltose Substrate Relative enzyme
C produced concentration (mg/ml) activity (%)
20
>
Time
Total amount
of maltose The data show that glyphosate most likely
D produced A acts directly on one of the amino acids.
Bis a competitive inhibitor of the enzyme-
catalysed reaction.
(|
C does not affect activity at substrate concen-

Time
trations below 10 mg/ml.
D_ acts as a noncompetitive inhibitor of the
HELP pathway.
Increasing the amylase solution from 1% to
2% increases the enzyme concentration. As
HELP
enzyme concentration increases, more active
sites are now available for successful colli- From the data, it can be observed that at
sions between the enzyme and substrate to low substrate concentration (10 mg/ml), the
form more enzyme-substrate complexes, lead- relative enzyme activity is low (20%). That is,
ing to an increase in the rate of reaction. the frequency of enzyme-substrate collisions
is similar to frequency of enzyme-inhibitor (E-
In addition, the substrate concentration in-
|) collisions. Therefore, the number of en-
creases from 5 cm® of starch suspension to
zyme-substrate (E-S) complex formed is about
10 cm? of starch suspension, thus the total
the same as E-| complex formed and this
amount of maltose produced will be doubled.
leads to a lower rate of reaction.
Level 1000 Biology MCQ with HELPs 53 Frequently Examined Questions |

|
Topic 1(c) Enzymes 4
At high substrate concentrations (30 mg/ml), At extremes of pH, the rate of reaction
the relative enzyme activity is high (100%). decreases. This is because the change in pH
That is, the substrate competes more suc- results in disruption of the ionic and hydro-
cessfully for active site, resulting in more gen bonds that help to maintain the specific
successful collision between substrate and shape of the active site, causing enzyme to
enzyme, hence more E-S complex are formed, be denatured.
and this leads to a higher rate of reaction. At low temperature, the rate of reaction is
The data above shows the characteristic of reduced. The enzyme is inactivated due to
competitive inhibition. Competitive inhibition possession of minimal kinetic energy for
is reversible if substrate is present in high collision with substrate.
concentrations, as substrates can now out-
compete the inhibitors for binding to the active
site, and allow the rate of reaction to reach
its maximum value.
Q59
The list shows three characteristic of enzyme
activity.
1. Reaction rate decreases if the concentration
of non-competitive inhibitor increases.
2. Reaction rate is reduced at extremes of pH.
3. Reaction rate is reduced at low tempera-
ture.
What explains each of these characteristics?
Availability of Reduced kinetic energy Hydrogen

active site is reduces the rate of bonding is
reduced molecular collisions disrupted
1
HELP
Upon binding of the non-competitive inhibi-
tor to the enzyme, the enzyme configuration
is changed such that its active site’s confor-
mation is altered and can no longer bind the
substrate. Formation of such enzyme-inhibi-
tor complexes prevents the formation of
Enzyme-Substrate complexes and reduces
reaction rate.
W Level 1000 Biology MCQ with HELPs 54 Frequently Examined Questions

TOPIC 1 \ CELLULAR FUNCTIONS
\ A(d) Cell and Nuclear Division

/
(
Q1 Q3
The absence of centrioles from higher plant cells The formation of chiasmata is an important
means that during somatic cell nuclear division feature of meiotic divisions because it
there is
A ensures that the same genetic characteris-
A no spindle formed. tics appear in daughter cells as in the
B___ino equatorial arrangement of chromosomes parents.
at metaphase. B- ensures that the number of genes in the
C no new cell wall laid down at telophase. new chromosomes remains constant.
Dino apparent organiser of mitotic spindles. C provides opportunities for new genotypes
to arise.
D__ prevents homologous chromosomes from
HELP pairing.
Centrioles in higher animal cells are the
organising centres of spindle formation. These
centrioles are absent in plant cells, despite HELP
the formation of spindle during cell division. In the formation of gametes during the first
meiotic division, the homologous chromo-
somes pair up. This process is called syn-
Q2 apsis. The paired (maternal and paternal)
If one ignores the effect of crossing over, then homologous chromosomes cross over at the
the possible number of different haploid cells chiasmata and homologous portions of the
which could arise by the meiotic division of a chromosomes are exchanged, resulting in
diploid cell containing 10 chromosome (i.e. n recombination to form new genotypes.
= 5) is
we 2 Q4
B 4 ‘Suddenly, the chromatids belonging to each
C chromosome part company and move towards
the opposite poles of the spindle.’
BD 32
This is a description of mitotic
A anaphase.
HELP
interphase.
The possible number of different haploid cells
from meiosis can be calculated by the ex- metaphase.
pression 2° = 372. Syprophase.
a

Topic 1(d) Cell and Nuclear Division
HELP HELP
Mitosis is the complex process that appor- Chiasmata are crossed chromosomes par-
tions the new chromosomes equally to daugh- ticipating in recombination. These are formed
ter cells. During anaphase, the 2 sister during prophase | of meiosis.
chromatids separate into independent chro-
mosomes. Each contains a centromere that
‘ is linked by a spindle fibre to one pole towards Q7
which it moves. Thus one copy of each The following graph represents the changes in
chromosome is donated to each daughter the quantity of DNA present in the cell cycle
cell. at different stages.
5
Q5 a |IE\S
2222
s | lsle
£ 4n a,ES
The events shown below occur during different
Oo Oo |.o
phases of mitosis. < ew
7 2N| |00
1 spiralization of DNA ea ica}
n
2 hydration of DNA
3 centromeres split Time
4 centromeres attach to spindle fibres What stage takes place at X?
5 DNA replicates A anaphase B cytokinesis
Which one of the following correctly identifies C interphase D metaphase
each of the phases described?
SionA a)
metaphase | anaphase telophase HELP
After fertilisation, the DNA
content in the cell increases
because of the fusion of
genetic material of the par-
ents. Mitosis them occurs
and is followed by cytokine-
sis at X, which is the divi-
HELP sion of the cytoplasm into 2
During the S phase of interphase, there is compartments, i.e. 2 cells.
replication of DNA, followed by prophase,
where the chromatin condenses. At
metaphase the centromeres are ready to split; Qs
this occurs at anaphase. Finally, division is The graph below shows the changes in DNA
complete at telophase. content in a single cell during the mitotic cycle.
aS 2)
Q6
During which phase of meiosis are chiasmata
formed? 5
A prophaseI B metaphase I
of
DNA
Amount
C anaphase II D metaphase II
TS hf Time
Which stage occurs between time x and time y?
Level 1000 Biology MCQ with HELPs ?56 Frequently Examined Questions
A interphase B prophase Q11

C metaphase D anaphase
In root tip cells, cell plate formation occurs
during
HELP A anaphase. B interphase.
During interphase, chromosomal DNA is rep- C metaphase. D _ telophase.
licated and bound to protein. The pre-mi-
totic cell is 4n (i.e. there are 2 copies of
each chromosome) and since there are 2 HELP
morphologic chromosome of each type, there During telophase, new membranes form
are a total of 4 copies of each chromosome. daughter nuclei. As the chromosomes uncoil
and become less distinct, the nucleolus
becomes visible again, and the nuclear
Q9 membrane forms around each daughter
The absence of centrioles from higher plant cells nucleus. Cell plate formation then occurs for
means that during somatic cell nuclear division the formation of cell membranes during
there is cytokinesis.
A no apparent organiser of mitotic spindles.
B ino equatorial arrangement of chromosomes Q12
at metaphase.
The diagrams below represent a pair of chro-
C no new cell wall laid down at telophase. mosomes during prophase I of meiosis. Q and
D no spindle formed. q are alleles of one gene, and R and r are al-
leles of another gene.
HELP
Although no centrioles are visible, there is
spindle formation and the chromosomes do
exhibit equatorial arrangement. Spindle for-
mation is probably by another organelle, un-
known as yet.
Q10
A diploid cell contains three pairs of homolo-
gous chromosomes. Each pair is heterozygous
for a pair of alleles, Aa, Bb and Cc, respectively.
If this diploid cell undergoes meiosis, how many
different combinations of these genes could be
produced in the haploid daughter cells?
Aas B 6
crs Da 12
HELP
The eight (2° = 2°) different combinations
of the alleles are: ABC, AbC, ABc, aBC, aBc,
abC, Abc and abc.
| Level 1000 Biology MCQ with HELPs P s7 Frequently Examined Questions

Topic 1(d) Cell and Nuclear Division y
Q R HELP
Centrioles are organising centres for the
5 /Q R\/ spindle fibres which are composed of micro-
Se tubules. These are present only in animal
cells and not in plant cells.
q es
.Which diagrams represent situations which
would result in the segregation of alleles Q and Q15
q at anaphase I? Which is the longest phase in the cell cycle of
Ameen 2 wariclers human liver cells?
B 1, 2 and 4 A anaphase
Ge 223 <and..5 B cytoplasmic cleavage
ere 4 anges C interphase
D prophase
HELP
The alleles Q and q should occur in the HELP
same loci but on different chromosomes after The longest phase in the cell cycle is inter-
crossing over. phase, before the actual nuclear division pro-
cess. DNA replication occurs during inter-
Q13 phase.
A diploid cell contains four chromosomes (2n

= 4). If this cell divides by mitosis, and there Q16
is no mutation, how many genotypes exist In prophase of mitosis, which one of the fol-
among the daughter cells? lowing events occurs in animal cells but not in
Ay <1 Bo 42 plant cells?
Cc 4 Dears A Centrioles migrate to opposite sides of the
nucleus.
B Chromosomes become invisible due to
HELP
condensation.
In somatic cells which undergo mitosis, the
C Homologous chromosomes do not associ-
genotype always remains unchanged and the
ate.
daughter cells are all identical, because there
is no crossing over process or independent D_ The nuclear envelope (membrane) breaks
assortment. down.
Q14 HELP
Which one of the following structures would Centrioles move apart during nuclear divi-
be found in an animal cell undergoing mitosis, sion, and radiate microtubules, forming asters.
but not in a plant cell undergoing mitosis? These structures are not visible in higher
plants, which instead have a microtubule-
A centriole organising centre, from which spindle micro-
B centromere tubules arise.
C chromatid
D chromomere
‘8 Level 1000 Biology MCQ with HELPs ? 5g Frequently Examined Questions

Q17 What is the order of these stages during mito-

sis?
The graph below illustrates the behaviour of the
chromosomes during one mitotic cell division. “4 1 2 4 3 5
. BorezZ 4
Distance/um ae!
C 3 2S 4 il 2
D 3 4 fs) al 2
X
HELP
D shows the stages in mitosis from inter-
phase (3), condensation of chromatin (4),
alignment of chromosomes in metaphase (5),
separation of sister chromatids in anaphase
Oe Om ae Ome? 5a oO (1) and telophase (2).
Time/min
Which one of the following correctly indicates Q19
the changes illustrated by curves 1 and 2, and
the stage of mitosis which is commencing at X? The diagram below is of a cell from a gameto-
phyte undergoing division.
distance :
distance
stage of between
ers between
mitosis centromeres of
: centromeres
commencing | chromosomes
of sister
at X and poles
chromatids
of spindle
anaphase
anaphase What is the type of division and the stage?
metaphase A meiosis; prophase I; zn = 8
metaphase wi
B_ meiosis; metaphase II; n= 8
C mitosis; prophase; n= 8
HELP D_ mitosis; early anaphase; 2n = 8
During anaphase, the sister chromatids of
Moncey se
each chromosome separate at the cen-
HELP
tromere, each approaching opposite ends of The diagram shows the separation of the sister
the spindle pole. Hence the distance between chromatids at the early anaphase of mitosis.
the centromere and the poles decreases, whilst The resulting daughter cells are diploid with
that between the centromeres of the sister 8 chromosomes.
chromatids increases.
Q20
Q18 Throughout which phase of the mitotic cycle
The diagrams show stages of mitosis. would DNA be present in the least amount in
a nucleus?
4 5
zy 2 A anaphase B__ interphase
ORE
Net,
BS
SFr C metaphase D__ telophase
|‘ Level 1000 Biology MCQ with HELPs P 59 Frequently Examined Questions |

=
HELP Q23
Nuclear division would have been completed The chromosome drawings have been traced
by telophase, resulting in the amount of DNA from photographs of cells dividing in a root tip.
in the nucleus being halved, compared to xX Y Z
that at interphase, prophase and metaphase.
9, & va
Q21
The diagram shows
division.
one stage of mitotic cell
(am
In what order do these stages of cell division
occur?
first 5 __ last stage
A xX bf Z
By b ¥
From the position of the cell organelles and the CaaS Xx Z
chromosomes, what stage of mitosis has been Ly. os¥, Z xX
reached?
A early anaphase’ B _— early telophase HELP
C mid metaphase D late prophase Y shows the metaphase stage of mitosis,
where the chromosomes have aligned on
opposite poles. This is followed by X,
HELP
anaphase, where the sister chromatids sepa-
The diagram shows the alignment of chro- rate, and finally Z, where division is com-
mosomes on the spindle, ready for division pleted.
into the sister chromatids. This is the mid
metaphase stage of mitosis.
Q24
At which stages of the mitotic cell cycle do these
Q22 events occur?
If x units of DNA are present in the nucleus of
a cell which has just divided, what is the rela- DNA breakdown division
seer of nuclear of
tive amount present in this cell during prophase replication
membrane centromere
of the next mitosis?
interphase metaphase | metaphase
x x
interphase prophase anaphase
= 4 L 2
interphase interphase anaphase
C x D 2x prophase prophase anaphase
HELP HELP
During the S phase of interphase before Before nuclear division, there is DNA repli-
mitosis, DNA replication occurs so that the cation during S phase of interphase. At
amount of DNA is doubled (2x units). This prophase, the nuclear membrane breaks
process ensures that the chromosome num- down to allow the division process. The
ber of each daughter cell is preserved (x units) centromere finally divides at anaphase to
after mitosis. separate the sister chromatids of each chro-
mosome.
WW Level 1000 Biology MCQ with HELPs / gO Frequently Examined Questions
Cell and Nuclear Division
Q25 Q28
The amount of DNA in a mammalian cell in The diagram shows anaphase of mitosis.
early prophase I is x.
What is the amount of DNA in the same cell
in anaphase I of meiosis?
Ap Aa
= x tate By
A ~ ee B ag
a 2
S x nr 2x Which of the following diagrams shows
anaphase I during meiosis in the same organ-
ism?
A B & D
At prophase |, DNA replication has already
occurred, and the original amount of DNA Af de
ate
Q26 Anaphase of mifosis is the separation of sister

n
chromosome, whilst
When is the DNA content of a cell doubled? f meiosis is the separation of
A anaphase B interphase homologous chromosomes, This is repre-
ed by A. In B, one pair of homologous
C metaphase D__sprophase
chromosomes end up on one side and the
cond pair end up on the other side (the
HELP ferent homologous pairs ca n be diferen-
The DNA content of a cell is doubled during ated by their differing
ee li
length
anit
ths).
the S phase of interphase, when DNA rep-
lication occurs prior to nuclear division.
Q29
The graph represents the changes in the quan-
Q27 tity of DNA present in one nucleus at different
A diploid cell contains two pairs of homologous stages in the life cycle.
chromosomes. Each pair is heterozygous for a
E : x
pair of alleles, Aa and Bb.
After meiosis, how many different combinations
of these alleles could be produced in the hap-
elf
loid daughter cells?
rane 4 B 4 eae!
@ 14% I
Cc 8 D 16
2 Time
HELP Which stage takes place at X?
A interphase B metaphase
the 4 possible combinations ini the haploid
apioid
C prophase D_ telophase
daughter cells are AB, Ab, aB, ab.
W Level 1000BiologyMCQ with HELPs f 64 Frequently Examined Questions

HELP Which of the following names the stages of

division correctly?
The relative DNA content decreases from 4
to 2. X marks the end of the nuclear division mitosis meiosis
process (mitosis), where at telophase, two A _ prophase prophase I
daughter cells are formed.
B prophase metaphase I
C metaphase anaphase I
Q30 D metaphase metaphase II
The diagram shows two pairs of homologous
chromosomes.
HELP
The centrioles in the first diagram have not
separated to opposite poles yet, and the sister
chromatids have not yet separated. The stage
is this prophase. In the second diagram, the
homologous chromosomes have undergone
pairing, but have not separated into the
opposite poles. The centrioles are already on
opposite poles. The stage is thus metaphase
I,
Which stage of nuclear division is shown?
A anaphase of mitosis Q32
B_ anaphase I of meiosis During which phase in somatic cell division
C metaphase of mitosis does replication of the chromosomes take place?
D metaphase I of meiosis A interphase
B_ early prophase
HELP C middle prophase
The diagram shows the metaphase stage of D late prophase
mitosis, where the chromosomes have aligned
along the equatorial axis of the spindle, ready
HELP
to be split into the sister chromatids.
The replication of chromosomes takes place
during interphase, before the rest of the
Q31 mitotic cycle.
The diagrams below show chromosomes in a
cell undergoing mitosis and in a cell undergo-
ing meiosis.
Q33
During which stage of meiosis do homologous
mitosis melosis
chromosomes separate?
A prophase I
B anaphase I
C prophase II
D anaphase II
® Level 1000 Biology MCQ with HELPs ? 62 Frequently Examined Questions

HELP
Q36
The homologous chromosomes, one mater-
The second division of meiosis differs from
nal and one paternal, separate during
mitosis because in meiosis
anaphase I. The sister chromatids then sepa-
rate at anaphase Il, resulting in the forma- A chiasmata form between the chromatids.
tion of 4 daughter cells, each with half the Beach chromosome replicates at metaphase.
number of chromosomes that was present in
the parent cell. C individual chromosomes line up at random
on the equator.
D the separating chromatids differ genetically.
Q34
When identical twins marry identical twins, the HELP
children of both couples are genetically
In meiosis, the sister chromatids differ geneti-
A different because of random segregation cally due to crossing over during prophase
during parental meiosis. |. In mitosis, crossing over does not occur
B_ different because of the high probability of and the chromatids and thus genetically iden-
random mutation. tical.
C identical because of a low probability of
mutation.
Q37
D identical unless crossing-over takes place.
The diagram shows the chromosome comple-
ment of a cell just before the metaphase stage
HELP of mitosis.
During meiosis, the homologous pairs of

chromosomes separate independently of each
other. Through this process of random seg-
regation, the genotypes of different gametes
in one parent are different. Hence, even
different children borne by the same parents What will be the chromosome complement at
are genetically different, unless they are telophase?
identical twins. It then goes without saying
A B C D
that the children of both couples would be
i
genetically different.
Q35
During which stage of the mitotic cell cycle is
DNA replicated?
A prophase B metaphase HELP
C telophase D interphase At the metaphase stage of mitosis, each

chromosome exists as a pair of sister chro-
matids, joined together at the centromere. At
HELP telophase, the sister chromatids have been
separated and each sister chromatid exists
Prophase, metaphase and telophase are the
as a separate chromosome. The number of
some of the processes during mitosis. Inter-
chromosomes is not halved in mitosis as it
phase is the stage before mitosis during which
is in meiosis, hence excluding option D.
the DNA is replicated in the cell.
Level 1000 Biology MCQ with HELPs / 63 Frequently Examined Questions

Q38 Q40
Albinism in humans is controlled by a reces- The diagram shows the maternal and paternal
sive allele. chromosomes from a diploid cell.
How many copies of this allele will be found
at one of the poles of a cell at telophase I of ke
> maternal
meiosis in an albino person?
\ mes paternal
ye es) B 4
Cae Drs
If the cell divides by meiosis, which diagram
shows a possible viable gamete?
HELP A B
Since the allele is recessive, both homolo-
gous chromosomes in a somatic cell of an
albino person would have the allele. After
meiosis |, each end would have a homolo-
gous chromosome with the allele. As the
chromosome is existing as a pair of sister
chromatids at this stage, each chromosome
and hence each end would have two copies
of the allele.
Q39
Which diagram represents a cell undergoing
metaphase I of meiosis? HELP
A B A viable gamete would have one of each of
the three homologous pairs of chromosomes,
represented by the different lengths. The
combination of maternal and paternal parts
in one chromosomes occurs during crossing
over and is a natural process that leaves the
<<'eS gamete viable.
C D Q41
The diagram shows some chromosomes at late
prophase of mitosis.
Fass
Z
Af —
Ga) oO
HELP How many chromosomes would be present in

In metaphase | of meiosis, homologous chro- one nucleus at telophase II of meiosis?
mosomes, each existing as a pair of sister Atsr6 Bi mp22
chromatids, separate to different ends of the
Cc 18 D 24
cell.
| Level 1000 Biology MCQ with HELPs ? 6a Frequently Examined Questions

HELP
Q44
There are 12 chromosomes present. In a
The presence of starch in maize pollen grains
mitotic division, the number of chromosomes
is controlled by one allele of a particular gene.
remain the same, i.e. 2n—» 2n. In a meiotic
The other allele results in the absence of starch.
division the number is halved, i.e. 2n—>n.
So there should only be 6 chromosomes in Why do half the pollen grains of a heterozy-
the nucleus. gous maize plant contain starch?
Because alleles separate at meiosis during
Q42 A anaphase I and anaphase II.

metaphase I and anaphase I.
The following events occur in mitosis and/or
meiosis. Which event occurs only in meiosis? C metaphase II and anaphase II.
A chromatid formation D prophase I and prophase II.
B chromosome condensation
C chromosome movement to poles HELP
D chromosome pairing It is only during anaphase that the chromo-
somes are pulled to the poles by the spindle
fibers.
HELP
In meiosis, chromosome pairing occurs
ing metaphase |, and the homologous chro-
dur-
Q45
mosomes separate into different cells after At prophase of mitosis, a eukaryote chromosome
meiosis |. This does not occur in mitosis. consists of two chromatids.
What is the structure of a single chromatid?
Q43 A one molecule of single-stranded DNA coiled
around protein molecules
How does the second meiotic division differ
from mitosis? B two molecules of single-stranded DNA each
coiled around protein molecules
A Chiasmata form between the chromatids of
Cone double helix of DNA coiled around
a bivalent.
protein molecules
B- Each chromosome forms two chromatids
D_ two double helices of DNA each coiled
during metaphase.
around protein molecules
C Exchange of genetic material occurs be-
tween chromatids.
HELP
D_ ‘The separating chromatids of a pair differ
genetically. A chromatid consists of a DNA double helix
attached with histones (protein molecules) to
form nucleosomes.
HELP
One of the most important factors about
meiosis is that it gives rise to individuals who Q46
are genetically different. The chromatids un- At which stage of the cell cycle does the quan-
dergo crossing-over before they are sepa- tity of DNA per cell decrease by half?
rated to the different poles in the nucleus.
A anaphase B cytokinesis
C metaphase D telophase
# Level 1000 Biology MCQ with HELPs ? 65 Frequently Examined Questions

HELP HELP
At telophase |, the nucleus envelope forms Meiosis is the process of halving the number
and the spindle disappears. of chromosomes to form sex cells. Thus the
final answer should be either C or D. C is
formed from identical chromatids, whereas
Q47 D is the outcome after separation of sister
The diagram represents the life cycle of an chromatids (after anaphase Il).
animal. At which stage in the life cycle does
mitosis occur?
Q49
rere 8 0 The diagram shows anaphase of mitosis.
Gp Ae
HELP Wy¥y
Mitosis: 2n — 2n
Which diagram shows anaphase | during meio-
A is fertilization, C is meiosis and D is also
sis in the same organism?
fertilization.
A B
Raia
Q48
The diagram shows a cell at anaphase I of
meiosis. VW ||)vWV
C D
pa Ah
Vy LY
Which diagram shows a normal gamete that
could be produced from this cell?
HELP
A B The original cell has 4 sets of chromosomes.
In meiosis, each chromosome is seen to
Ss SS comprise 2 chromatids. So there should be

4 separate chromosomes, but with 2 chro-
a= =< matids each.
C D Q50
Which statement correctly describes homologous
chromosomes?
A They are formed during meiosis.
B_ They are held together by centromeres.
C They are identical.
D They carry the same gene loci.
1 Level 1000 Biology MCQ with HELPs P gg Frequently Examined Questions |
1
Topic 1(d) Cell and Nuclear Division |
HELP
Q53
Homologous chromosomes are made up of
The diagram shows a dividing nucleus contain-
two chromosomes, which need not be iden-
ing two pairs of homologous chromosomes.
tical, but is important in determining the same
characteristics for that individual. E.g. blood
group, eye colour etc.
Q51
At which stage of mitosis do these events oc-
cur?
spiralisation nuclear
and envelope | centromeres
condensation breaks separate
of DNA down Which phase of nuclear division is represented?
A anaphase of mitosis
interphase interphase | metaphase
B anaphase II of meiosis
interphase prophase | metaphase
C metaphase I of meiosis
prophase metaphase | anaphase
D metaphase of mitosis
prophase prophase anaphase
HELP
HELP As the chromatids are seen to be separating,
During prophase, the chromosomes become this phase is anaphase and not metaphase
visible as long, thin tangled threads. Gradu- where the chromatids would be seen lining
ally they shorten and thicken. The nucleolus up at the equator of the spindle. However,
disappears and the nuclear envelope disin- this anaphase stage is occurring during mi-
tegrates. tosis since the homologous chromosomes are
still in the same nucleus.
Q52
In the fruit fly, Drosophila melanogaster, the
Q54
diploid number of chromosomes is eight. During which stage of meiosis do centromeres
divide?
In the absence of crossing over or mutation, how
many genetically unique kinds of gamete might A prophase I
be formed by one individual? B metaphase I
A 2 B 8 C prophase II
C 16 D az D metaphase II
HELP HELP
As the diploid number is 8, there would be In prophase, the centromeres do not divide.
4 pairs of homologous chromosome pairing. In metaphase I, only the homologous chro-
This gives rise to a combination of 47 = 16 mosomes are about to separate and not yet
kinds of gametes. the chromatids.

Q55 Q57
The diagram shows the uncoiling and coiling The sorrel plant, Rumex acetosa, is a flowering
that might take place between homologous re- plant with separate sexes. The diagram below
gions of two double helical nucleic acid mol- is an outline of its life cycle, including the sex
ecules. chromosomes of the adults.
Adults
Male Female
sorrel plant sorrel plant
© ©
Adult
Zygote Pollen Megaspore

(microspore)
What do the diagrams represent? (3)
A chromosome mutation Male gamete
B_ DNA replication
C mRNA synthesis
Female gamete
D the early stages of crossing over
Which sex chromosomes would be found in
cells 1 to 4 if a male zygote were produced?
HELP cell1 cell2 cell3 cell 4
The diagram shows the meiotic process, A ¥ Xx ¥ Xx
where there is crossing over between homolo-
gous chromosomes, resulting in new com- B y XxX ABs XX
binations of genes. C AN XX Ye Xx
D RY XX XY XX
Q56
If the nucleus of a human motor neurone con- HELP
tains 6.8 picograms (pg) of DNA, what mass of The male zygote must have the genotype XY.
DNA is the nucleus of an actively dividing Since the Y chromosome can only come from
human skin cell likely to contain at the end of the male plant, the female plant contributes
interphase? the X chromosome.
A 3.4 pg B- 6.8 pg
C 13.6 pg D 20.4 pg Q58
What is the role of centrioles during meiosis in
animal cells?
HELP
The amount of DNA in the 2 somatic cells, A breaking down the nuclear membrane
during prophase
the motor neurone and the skin cell should
be the same. After interphase where DNA B_ helping homologous chromosomes to pair
has already replicated, the amount of DNA and form bivalents
is doubled, i.e. 6.8 X 2 pg = 13.6 pg. C holding the two chromatids of a chromo-
some together
D organising microtubules to form spindle
fibres
WW Level 1000 Biology MCQ with HELPs / 6g Frequently Examined Questions 4
HELP
Q61
Centrioles migrate to the poles at mid
The diagram shows an intergeneric cross per-
prophase | and start to form the spindle fibres
formed in a breeding experiment.
at late prophase |.
Brassica Raphanus
oleracea sativus
Q59 (cabbage) (radish)
parents 2n=18 2n =18
In the table, a tick (“) indicates that structures
are genetically identical; a cross (X) that they
are not. gametes n=9 n= 9
F, generation >*on=18 2
Which sequence of ticks and crosses is correct?
Which of the following statements ex-
tubers
pollen sperm plains why the F, hybrid plants were
brother
grains produced sterile?
ona and
in the by the
potato sister A Non-disjunction occurred in parental
same same
plant twins
anther male gamete formation.
B There was an odd number of chro-
mosomes in the gametes.
C The chromosomes of the F, hybrid
could not form homologous pairs
during meiosis.
D_ The F, hybrid was polyploid and
HELP could not undergo gametogenesis.
Only cells produced from mitotic division are
identical. These are somatic cells, e.g. tubers HELP
on a potato plant. The rest of the choices Although the chromosome number of the F,
arise from meiosis, thus are genetically dif- generation was normal, they did not form
ferent. homologous pairs during meiosis, resulting
in sterile hybrids.
Q60
The genotype of a human zygote will differ from
Q62
that of both parents. What happens to chromosomes in prophase I
Which of the following does not contribute to of meiosis?
this variation? A They are formed by replication of DNA.
A chiasmata occurring during meiosis B- They attach to the spindle fibres.
B mutation of genes C They divide to form chromatids.
C presence of dominant genes D_ They shorten and become visible.
D random combination of gametes
HELP
HELP Chromatids are formed after DNA replicates
The presence or absence of dominant genes during interphase and not due to division of
affects the genotype of the offspring, but it chromosomes. Attachment to spindle fibre
would not contribute to the variation in the occurs as the chromosomes arrange at the
_ resulting zygote. equator during metaphase I.
WW Level 1000 Biology MCQ with HELPs ? 6g Frequently Examined Questions

Q63 Q65
The diagram shows anaphase I of meiosis. The following experiment was carried out.
1 Haploid cells, containing three chromo-
somes each, were grown in a medium
containing radioactive thymine, so that all
the DNA was labelled.
Cells in early interphase were then trans-
ferred to a medium where the available
Which diagram shows metaphase II as meiosis
thymine was not radioactive.
continues in this cell?
A single cell was immediately isolated and
allowed to divide once. When the two
daughter cells reached the next metaphase,
they were fixed and their three chromo-
somes were inspected for radioactivity.
Which diagram represents the distribution of ra-
dioactivity at metaphase in the two daughter
cells?
key CT> normal chromatid
q@=mp radioactive chromatid
daughter cell 1 daughter cell 2
HELP A City a cD) Gap «_\ aD
GD DD Ga Coe Ce
Cell A shows early prophase II as the nuclear
eazDp> <>’ a» CL > GE), 3S
envelope has not yet disintegrated. Cell C B Gk (GE G2) CT > ame cot
shows anaphase | as the homologous chro- CC a= -___ wa» Ct ep cD
mosomes are moving to opposite poles of eGazaDp «c> a=» CT) amp coTD
the cell. Cell D shows incorrect exchange of DZ Gap «=z» SS) 2S Sas
GD 4 2 ae) ES ES Bs PS eee
genes between homologous chromosomes
after crossing over.
HELP
Q64 Candidates should take note that there would

be only 3 radioactive chromatids altogether
What is a definition of homologous chromo- for the 2 daughter cells. This is due to the
somes? isolated haploid cell replicating its DNA with
A They are divided into two identical chro- non-radioactive thymine during the earlier di-
matids. vision. After the next metaphase, there should
still be only 3 radioactive chromatids, since
B- They have the same sequence of bases.
no more radioactive thymine was used for
C They have the same sequence of genes. subsequent replications.
D_ They move to the same pole during nuclear
division.
HELP
Homologous chromosomes are similar due
to the genes being in the same position, thus
the chromosomes are the same in length.
Identical chromatids occur after the DNA has
replicated during interphase.
N Level 1000 Biology MCQ with HELPs / 79 Frequently Examined Questions

Q66 Q68
The graph shows the amount of DNA present An organism has a genome with four pairs of
in the nuclei of cells undergoing division in a chromosomes. A cell from this organism during
i
multicellular organism. division is shown.
DNA content/
arbitrary units 9
Which combination is correct?
type of nuclear What does the drawing represent?

division
A metaphase of meiosis I
meiosis metaphase I | telophase II B metaphase of meiosis II
meiosis telophase I | telophase II
C prophase of meiosis I
mitosis anaphase telophase
D__ prophase of meiosis II
mitosis metaphase | telophase
HELP
HELP As the 4 pairs are homologous chromosomes
As the final DNA content is half of the origi- still enclosed by a nuclear envelope, this stage
nal, this division is meiosis. Stage X has to is prophase |. In meiosis Il, the homologous
be telophase | because the DNA content has chromosomes would have separated.
returned to the original amount after the
doubling during replication. This is due to
the separation of the homologous chromo-
Q69
somes at telophase |. Between which two phases in meiosis do iden-
tical centromeres start to separate?
Q67 A metaphase I and anaphase I

B metaphase II and anaphase II
Albinism in humans is controlled by a reces-
sive allele. How many copies of this allele will C prophase I and metaphase I
be found at one of the poles of a cell at telo- D_ prophase II and metaphase II
phase I of meiosis in an albino person?
Ae 23 B 4
HELP
Cye2 Dy i
Between metaphase | and anaphase |, the
homologous chromosomes separate (but not
HELP their centromeres) to opposite poles of the
cell. However, between metaphase Il and
An albino person would have 4 copies of anaphase Il, the centromeres divide so that
the recessive allele at prophase |. At telo- the sister chromatids can separate.
phase |, the 4 copies would have been halved
to 2 when the homologous chromosomes
carrying the allele separate to opposite poles
of the cell.

Q70
The second division of meiosis differs from
mitosis because in meiosis
A chiasmata form between the chromatids.
Beach chromosome replicates at metaphase.
C individual chromosomes line up at random
on the equator.
D__ the separating chromatids differ genetically.
HELP
Candidates should take note that chiasmata
form between the chromatids during the first
division of meiosis (prophase |!)and not during
the second division of meiosis.
Q71
A diploid cell contains four chromosomes.
Which diagram shows the nucleus at prophase
II of meiosis?
Af
~—
C D
eS “es
Q) Q|
HELP
At prophase II, the chromosomes should no
longer be seen as homologous pairs (as in
diagram A), but only as one chromosome
consisting of two sister chromatids.
‘ Level 1000 Biology MCQ with HELPs Pr Frequently Examined Questions

TOPIC 2 DNA AND GENOMICS
2(a) DNA — Structure and Function
cS ay
Qi
after first after second
A molecule of transfer RNA has the anticodon generation generation
sequence UAC.
A half at X and quarter at X and at Z
What will be the corresponding nucleotide se- half at Y and half at Y
quence in the DNA?
half at X and | quarter at X and at Z
Gs Bi wvAUG
half at Z and half at Y
C TAC D TUG
half at X and
all atey
alt -atwy
HELP
half ay and
Corresponding pairs for uracil is adenine, alirateZs
ivaliteaiaZ4
and adenine is uracil, and cytosine is gua-
nine. Also, the thymine pairs with adenine.
The corresponding codon on the mRNA is HELP
AUG.
Due to the theory of semi-conservation rep-
lication, the 1st generation DNA is made up
Oy of one original strand of heavy DNA and
one new strand of light DNA. Therefore its
A culture of bacteria had all its DNA labelled weight would be intermediate between the
with the heavy isotope of nitrogen, *N. The heavy and the light types.
culture was then allowed to reproduce using
nucleotides containing normal “N. The DNA
was examined using a centrifuge after one gen- Q3
eration and again after two generations.
The two pyrimidine bases most commonly
The diagram shows the position of the DNA found in DNA are
band at Z in the centrifuge tube when the DNA
A uracil and thymine.
was first labelled.
B cytosine and uracil.
C cytosine and thiamine.
D cytosine and thymine.
oa
HELP
In the DNA double helix, purines base pair
with pyrimidines via hydrogen bonding. The
In which pattern would the DNA be found after 2 pyrimidine bases are made up of only 1
the first and after the second cell generations? ring and are heterocyclic, i.e. built of more
than one kind of atom, N and C.

4
Topic 2(a) DNA — Structure and Function
Q4 Q6
Deoxyribonucleic acid, adenosine triphosphate Cells from a bacterial clone were grown for
and ribonucleic acid do not contain many generations on a medium in which all the
nitrogen compounds contained only the isotope
A _ bases.
nitrogen 15 (*°N). Adenine comprised 36% of
B___ nucleotides. the nitrogen bases present.
C spentose sugars. A sample of these bacteria was transferred to a
D peptides. medium in which the only nitrogen source was
4NN and was provided with conditions suitable
for asexual reproduction.
What was the percentage of guanine in
the DNA?
A 14%
Nucleotide
B 18%
Nucleotide AMP + 2
nucleotide nucleotide phosphate C 28%
chain chain groups
D 36%
sugar
HELP
Adenine will base pair with thymine in
the bacterial DNA. Thus, the percent-
age of T will also be 36%. The bases
Q5 guanine and cytosine will constitute
28% of the total number of bases, of
The potentiality for replication of deoxyribose which guanine represents half of it,
nucleic acid depends on i.e. 14%.
A covalent bonds between bases.
B~ electrovalent bonds between base and Q7
phosphate groups.
Which statement describes the base pairing in
C high energy bonds between phosphate nucleic acids?
groups.
A Purine bases always pair with other purine
D hydrogen bonds between bases. bases.
B_ Purine bases can only pair with pyrimidine
HELP bases.
The DNA double helix consists of 2 sugar- C Adenine cannot pair with either uracil or
phosphate anti-parallel strands that wind thymine.
around each other, and are held together by D Hydrogen bonding can only occur between
hydrogen bonds between specific bases. In the pyrimidine bases.
DNA replication, the strands of the helix
separate, and each strand then seeks to
replace the specific hydrogen-bonded HELP
complementary nucleotides it has lost.
The purine bases, A and G, will base pair
with the pyrimidine bases, T and C, respec-
tively in a DNA molecule. A pairs with the
pyrimidine of U in a RNA molecule.
N Level 1000 Biology MCQ with HELPs ? 74 Frequently Examined Questions

Q8 HELP
What is the advantage of DNA having two 36% of adenine base pairs with 36% of
complementary strands? thymine in a DNA molecule, leaving 28% of
guanine and cytosine bases, each constitut-
A Pairing can occur between chromatids. ing 14% of the total bases in the DNA.
B_ Transcription and replication can occur
simultaneously.
C Semi-conservative replication is possible.
Q11
D_ Diploid cells can inherit DNA from both Which of the following is involved in the
parents.
inter-chain linkage between complementary
strands of DNA?
A covalent bonding between the sugar and
HELP nitrogenous bases
A DNA molecule is made up of 2 comple- B_ covalent bonding between the sugar and
mentary strands so that semi-conservative rep- the phosphate groups
lication may be possible, where each old
C covalent bonding between adjacent sugar
chain becomes paired with a new chain which
groups
is copied from it.
D hydrogen bonding between the nitrogenous
bases
Q9
Which of the following statements about the HELP
strands of a newly replicated DNA molecule is
The complementary strands of DNA are held
correct?
together by hydrogen bonds between the
A Both strands are made up of newly as- bases. A base pairs with T via two hydrogen
sembled nucleotides. bonds, whilst C and G are bonded by three
B_ One strand is new and the other is part of hydrogen bonds.
the original molecule.
C Both strands contain some nucleotides from
the original molecule.
Q12
In 1951, Chargaff analysed bovine thymus DNA
D_ The sugar-phosphate chains are conserved
and calculated the relative amounts of four
and new bases are inserted between them.
nitrogenous bases. His results are shown in the
table.
HELP
purines pyrimidines
DNA replication is a semi-conservative pro-
cess whereby the newly replicated DNA adenine base 1 base 2. base3
molecule consists of an old chain coiled 28.2% 21.5% 27.8% 22.5%
around the new one.
What are the bases 1, 2 and 3?
Q10 base 1 base 2 base 3

A cytosine thymine guanine
Adenine comprised 36% of the nitrogenous
bases in the DNA of cells from a bacterial clone. B guanine cytosine thymine
What was the percentage of guanine in the C guanine thymine cytosine
DNA?
D thymine cytosine guanine
A 14% B 18%
C 28% D 36%
‘W Level 1000 Biology MCQ with HELPs ? 75 Frequently Examined Questions

4
Topic 2(a) DNA — Structure and Function |
HELP HELP
The purines present in DNA are adenine and The tightly coiled DNA strands must first
guanine (base 1), whilst the pyrimidine present uncoil, causing the hydrogen bonds in the
are thymine (which will be about the same duplex to break. As the opposite strands
amount as adenine with which they form base break, the free nucleotides can complement
pairs with), and cytosine (which base pairs with that on the nascent strand, forming bonds
with guanine). again. Finally, the sugar-phosphate bonds are
formed.
Q13
Which statement describes base pairing in
Q15
nucleic acids? What is the function of the enzyme DNA poly-
A Adenine cannot pair with either uracil or merase?
thymine. A To build a strand of DNA using DNA as a
B Guanine is paired with adenine. template.
C Hydrogen bonding can only occur between B_ To build a strand of DNA using a polypep-
pyrimidine bases. tide as a template.
D ‘Purine bases can only pair with pyrimidine C_ To build a strand of mRNA using DNA as
bases. a template.
D_ To build a polypeptide using mRNA as a
template.
HELP
In nucleic acids, the purine bases, e.g. A and HELP
G, will base pair via hydrogen bonding, with
the pyrimidines, T and C, respectively. DNA polymerase is the enzyme involved in
DNA replication, where a strand of DNA is
synthesised using an old DNA strand as the
Q14 template.
The following events occur in the replication of

DNA: Q16
bonds between complementary bases break Which of the following describes the structure
bonds between complementary bases form of DNA?
DNA molecule uncoils Polynucleotide number of base
opposite strands separate chains pairs per complete
sugar-phosphate bonds form turn of helix
oon
FR
NH
FW free nucleotides align with complementary A parallel 5
nucleotides on each strand B anti-parallel 10
In which order do these events take place? C parallel 0s)
A 1 3 6 4 2 ¥) D anti-parallel 20
B 3 1 4 6 2 )
GC 3 6 1 4 5 2 HELP
D 4 3 1 6 5 2 The DNA double helical chains are bound
to each other via hydrogen bonds in an anti-
parallel fashion, i.e. 3' OH is bound to the
S' P end. There are 10 base pairs per
complete helical turn.
¥ Level 1000 Biology MCQ with HELPs 2 76 Frequently Examined Questions

Q17 only in DNA, uracil replaces thymine in

mRNA. Only the sugar-phosphate backbone
The table shows the percentages of bases in is found in both.
DNA from various types of cell.
source of
DNA
yep
enine | guanine thymine cytosine Q1g9
ox The diagram represents part of a DNA molecule.
thymus ZOez BALE 22O
ox A—T
spleen 279 Z2af, Zoe C—G
Ox C—G
sperm 28.7 apis
T—A
rat bone 28.6 aA Cc.
marrow C—G
yeast 31.3 18.7 32.9 od T—A
What would be the appearance after
Which of the following is a valid deduction from semi-conservative replication had occurred?
these data?
A B C D
A DNA is composed of two strands twisted
A—T T—A A—T—U U—
around each other.
C—G G—C C—G—C G—
B DNA occurs in about the same amounts in
all cells from the same species. C—G GC C—G—C G— C—
C The four bases show complementary base T—A A—T T—A—T A—
pairing. Ci GG G—C—G Cc—
D_ The structure of DNA is the same in both C—G G-C C—G—C G—
yeast and animal cells.
T—A ~A—T T—A—T A—
HELP
HELP
The amount of adenine and thymine are simi-
In semi-conservative replication, each DNA
lar, as are the amounts of guanine and cy-
strand becomes the template for the forma-
tosine. This shows that there is complemen-
tion of a nascent chain. Therefore, the
tary base pairing between the purines and
complementary nascent chains are shown
pyrimidines.
base-paired to the old chain.
Q18
Q20
Which of the following is found in both DNA
and messenger RNA? The table shows percentage concentration of
three bases in DNA from four different sources.
A double helix structure
Which source is a species of mammal with a
B ribose concentration of adenine of 31.0%?
C sugar-phosphate chain source cytosine guanine thymine
D thymine A je eal 30.9 19.0
B Ls 28 By 29.8
HELP G Zaee 22.8 23.4
The double helix structure is only found in D 3ULG PORE 19.0
DNA. Ribose is only found in mRNA, DNA
has deoxyribose instead. Thymine is found
| Level 1000 Biology MCQ with HELPs Paz Frequently Examined Questions
Topic 2(a) DNA — Structure and Function | 4
HELP Q23
Cytosine pairs with guanine and hence they Analysis of DNA produced the following ratios
should be present in approximately equal of nitrogenous bases.
amounts. Adenine pairs with thymine and so
ratio of purines
they should also be present in approximately
equal amounts. source of DNA to pyrimidines
bean seeds 0.99
cow heart 1.01
Q21 human liver 1.02
Which type of sugar and bonds are found in a rat bone marrow 1.00
DNA molecule? Which statement explains the difference in the
type of bonds linking ratios?
sugar complementary bases A Animal DNA contains more purines than
A hexose hydrogen pyrimidines.
B hexose peptide B Different parts of organisms contain differ-

ent proportions of purines and pyrimidines.
G pentose hydrogen
(es) DNA contains thymine instead of uracil.
D pentose peptide
D_ ‘There are variations in the accuracy of ana-
lytical techniques.
HELP
Each nucleotide has a pentose sugar, which HELP
is ribose in RNA and deoxyribose in DNA.
Hydrogen bonds are formed between the ni- The small differences in ratios obtained for
trogenous bases of complementary nucle- the different sources of DNA are insignifi-
otides. Adenine is joined to its complemen- cant. They are probably due to experimental
tary base thymine/uracil by 2 hydrogen bonds inaccuracies. Besides, A and B are false state-
while cytosine is joined to its complementary ments while C should not affect the ratio
base guanine by 3 hydrogen bonds. since both thymine and uracil are pyrimidines.
Q22 Q24
Biochemical analysis of a sample of DNA shows What is the effect of the enzyme DNA ligase?
that cytosine forms 40% of the nitrogenous A DNA is broken up at specific sites.
bases.
B DNA fragments are joined together.
Which percentage of the bases is adenine?
CDNA replication occurs.
A 10%
D DNA transcription occurs.
B 20%
C 40%
HELP
D 60%
DNA polymerase can produce 1 new DNA
molecule at a time. DNA ligase joins these
HELP newly synthesized polynucleotides.
Guanine + Cytosine
40% 40%
Adenine + thymine
10% 10%
N Level 1000 Biology MCQ with HELPs ? 7g Frequently Examined Questions

Q25
Pyrimidine bases contain 4 carbon atoms and
purine bases contain 5.
How many carbon atoms are there in a nucle-
otide containing cytosine?
A 8 B 9
Cc 10 D i1
hosphaie group, ribose or deoxyribose group

and oethe cytosine
4
group {form | the nucleotide.
Pome apa BRS
2 = eae
rnospnaie mH Pi )
How many hydrogen bonds are involved in
. ¥
4 holding these strands of DNA together?
ee in8 VY, — =A Tt 9
D
® Riboseie(C.H,__O.)
by
A 410 B 8
a mu rR
e Deoxyribose Col 7 eS Cc 6 D 4
© Cyiosine
a - = =>
has 4 carbon A
atoms,
int
as it is
— - =:
ape
a pyawomne
a KOWomicine
HELP
TI c " Si
heretore the ucieotiGce sno nave p
inererore tne nuciconce snovic nave Candidotec need tn remember tho each A.
a “<c 9C WUNUIUUISS cou 10 = c Vo rrUl o1e ‘
as == se
re —
= —
pairing
--
involves 2 hydrogen bonds and
| =| } ;
erie
eacn _-\ pa
Bein G cic a Paclocwas tated
VORVYES J nyc ogen DONGS
Q26
28
The table shows the percentages of nitrogenous Q : ee
bases in four samples of nucleic acids. How does DNA synthesis along the lagging
ie : strand differ from that on the leading strand?
Which base is adenine?
A An RNA primer is needed on the lagging
bases strand, but not on the leading strand.
oo oo C dee B Deoxyribonucleotides are added to the 5’
30 19 nal end instead of the 3’ end.
24 26 nil C Helicase synthesizes Okazaki fragments,
25 25 which are then linked together.
ie
ND
OO
fm ks
ID “SIO Ge
N
WN ow 3318
NS
eB nil D Okazaki fragments, synthesized 5° + 3’,
are linked by DNA ligase.
c tien
DNAiA has- no uracil base
Arce
(Sample
N\Namnes
I|,2 and
Ana
At ebos freee
DOaSeS A,
As.YY, C~— caad
Ge
1.
"ta h a 2
G pairs with C and A pairs w
In the DNA sam

the figures, it ca
resents adenine.
‘K Level 1000 Biology MCQ with HELPs

>
? 79 Frequently Examined Questions
Q29 Q30
The diagram shows the structure of a nucleotide. Bacteria were cultured in a medium containing
heavy nitrogen (1°N) until all the DNA was
phosphate & O base labeled. These bacteria (generation 1) were then
grown in a medium containing only normal
nitrogen (14N) for two more generations (genera-
pentose tions 2 and 3). The percentage of cells contain-
2 1 ing °N in each generation was estimated.
One type of polynucleotide consists of a single What will be the percentage of cells containing
strand, twisted into a clover leaf shape. Which ‘SN in generations 2 and 3?
is the type of pentose of this molecule and the
bonding between the nucleotides? Percentage of cells containing ’°N
Generation 2 Generation 3
Bonding between
Pentose j
nucleotides
between
deoxyribose
positions 1 and 3
between
occ. positions 2 and 3
between
ribose 7 HELP
; positions 1 and 3
between ay Va
Dinas positions 2 and 3

generation 1
x
HELP
16
N-oN
14 15
Ne 14 "N
tRNA comprises a single polynucleotide
: Mm,
strand. It forms a clover-leaf shape with three generation 2 o
loops and a stem. Ribonucleotides contains ~ ~
ribose are known as ribonucleotides.

EN - My ty 14 N 14 N_ “tN Nn 14)
5’ end
generation 3 > ; . >
~ ~
Nitrogenous
Q31
base
Which of the following enzymes or proteins is
NOT used in the process of DNA replication?
A Primase
Phosphate B DNA polymerase

C=
group Pentose
sugar
C_Translocase
D__ Single-strand binding protein
‘X Level 1000 Biology MCQ with HELPs ? gg Frequently Examined Questions

HELP
Q33
In DNA replication, primase catalyse the
In studying a virus, you find the following
formation of a short RNA primer, DNA
proportions of nitrogenous bases present: ad-
polymerase catalyse the formation of a
enine 23%, guanine 37%, cytosine 23%, uracil
phosphodiester bond between the free nucle-
17%. Which of the following statement(s) re-
otide and the preceding nucleotide, thus
garding this virus is/are correct?
extending the new strand of DNA while single-
stranded binding protein binds to the 2 I It probably uses RNA as its genetic mate-
separated strands of parental DNA to stabilise rial.
the single-stranded DNA formed. II The genetic material of this virus is prob-
ably single stranded.
Q32 III Base pairing rules in this virus include

adenine : cytosine.
The table shows the results of an analysis of A I only.
percentage concentration of three bases in
nucleic acids from four sources. Three of the BI and II only.
sources are DNA and one is RNA. Which source CII and III only.
is RNA?
D_ All of the above.
source | adenine | cytosine | guanine
Oe, 30.4 30.2 HELP
Statement |: Uracil is a nitrogenous base
B 20.0 | 24.6 [ 23.8
present in RNA.
C 26.7 28.8 22.3
Statement Il: If the genetic material is double
D oiilail 18.3 187 | stranded, the percentage of G = C, percent-
age of A = U. This is not observed in the
virus (adenine 23%, uracil 17%, guanine
HELP 37%, cytosine 23%).
In DNA molecule, the width between the 2 Statement Ill: If adenine base pair to cytosine,
backbones is equals to the width of 1 base uracil will base pair with guanine. The ratio
pair i.e. 1 purine and 1 pyrimidine. of uracil: guanine should be 27% : 27%.
c=
S—5 Q34
Eas Which of the functions of RNA is incorrectly
ork matched?
f—A— Ti A Messenger RNAs encode information for
ial synthesis of polypeptides.
G—Eé B Ribosomal RNAs bind with tRNA to
etc
catalyse the formation of phosphodiester
In DNA, the bases pair with complementary bonds.
bases of the opposite chain via hydrogen C Small nuclear RNAs bind with ribonucle-
bonds, adenine to thymine and cytosine to oproteins to form spliceosomes.
guanine. Thus, the number of G = C, number
D_ Transfer RNAs bind with mRNA to facili-
of A = T.
tate translation.
Hence, when the percentage concentration
of cytosine is similar to guanine, this sug-
gests that the source is DNA.
W Level 1000 Biology MCQ with HELPs ? g4 Frequently Examined Questions

HELP
Ribosomal RNA is made in the nucleus.
Ribosomal RNA binds with proteins to form
large and small ribosomal subunits which
combine to form ribosomes in the cytoplasm.
‘
Q35
Which of these molecules are linked to form a nucleotide containing uracil?
1 2 5
HOCHaz2 OH HOCH2 OH O OH
O O
ees
OF OH Or.
oon
Ribose Deoxyribose Pyrimidine Phosphate
AS -2.53-ands5 BO 2, 4cand*5
C Iee2 ald: 5 Dees) 42and<5
HELP
| Level 1000 Biology MCQ with HELPs ? g2 Frequently Examined Questions |

Q36
The diagram below shows the synthesis of a new strand of DNA during interphase.
New Template
Strand Strand
Pyrophosphate
released
Nucleoside
triphosphate
Which of the following shows the correct combination of bond(s) that need to be formed and the
kind of reaction that is involved in order for the nucleotide to be added to the DNA chain?
Bond(s) to be formed Reaction(s) involved
A Phosphodiester Condensation
B_Phosphodiester Hydrolysis
C_Phosphoester and Hydrogen Condensation
D___Phosphoester Dephosphorylation
HELP
Phosphoester
bond
Hydrogen
bond
Two nucleotides are joined by condensation reaction, between the sugar of one nucleotide (hydroxy!
group on C3) with the phosphate group of another nucleotide.
| ‘N Level 1000 Biology MCQ with HELPs id83 Frequently Examined Questions
Topic 2(a) DNA — Structure and ee
Q37 HELP
Statement | and Statement Il: Absence of
Which of the following statements about the
uracil (a nitrogenous base present in RNA)
structure of DNA is incorrect?
suggests that this virus’s genetic material is
A One complete turn requires 3.4 nm and 10 DNA.
base pairs.
s
Statement Ill: If the genetic material is double
B_ The backbones of each strand run in op- stranded, the percentage of G = C, percent-
posite directions relative to each other. age of A = T. This is observed in the virus
C Each pair of nucleotides is held together (adenine 23%, thymine 23%, guanine 27%,
by three hydrogen bonds. cytosine 27%).
D The width of the molecule is a constant 2 Statement IV: If thymine will base pair with
nm. guanine, the ratio of thymine : guanine should
be the same.
HELP
Each pair of nucleotides consists of 1 purine Q39
and 1 pyrimidine. The bases pair with comple- A mutation in one of the replication enzymes
mentary bases of the opposite chain via causes DNA polymerase to be unable to add
hydrogen bonds. 2 hydrogen bonds between nucleotides at the origin of replication, hence
adenine and thymine and 3 hydrogen bonds no daughter strands of DNA can be synthesized.
between cytosine and guanine. Which of the following is the defective enzyme?
A Helicase
Q38 B Primase
In studying a virus, you find the following C DNA Ligase
proportions of nitrogenous bases present: ad- D ‘Topoisomerase
enine 23%, guanine 27%, cytosine 27%, thym-
ine 23%.
HELP
What statement(s) can you make about this
virus? DNA polymerase binds to the single stranded
RNA primer and catalyse the formation of a
I It probably uses RNA as its genetic mate- phosphodiester bond between the free nucle-
rial. otide and the preceding nucleotide, thus
II It probably uses DNA as its genetic mate- extending the new strand of DNA. In the event
rial. that the primase is defective, RNA primer will
III The genetic material of this virus is prob- be absent and DNA polymerase is unable to
ably double-stranded. add nucleotides at the origin of replication.
IV Base pairing rules in this virus include

thymine: guanine.
Q40
A I only
Which one of the following is associated with
BI and III only accuracy of DNA replication?
CII and Ill only A High energy bonds between phosphate
D_ II and IV only groups.
B Covalent bonds between bases and phos-
phate groups.
ie, Hydrogen bonds between bases.
Covalent bonds between bases.
WW Level 1000 Biology MCQ with HELPs ? gg Frequently Examined Questions

HELP
In DNA replication, the DNA strands separate and serve as a template for synthesis of a new
daughter strand. Free deoxyribonucleotides with the correct complementary nitrogenous base, forms
hydrogen bonds to the base in the template DNA, ensuring accuracy of DNA replication.
Q41
Bacteria were cultured in a medium containing heavy nitrogen (°N) until all DNA was labelled.
These bacteria were then grown in a medium containing only normal nitrogen (‘4N) for 5 genera-
tions. The percentage of “*N DNA strands in each generation was estimated.
Which curve provides evidence that DNA replication is semi-conservative?
Percentage of ““N DNA

100
75
Generation
HELP
15a) "
15, 14
Ne N ee Hy)
generation 1 > =
~
~
5, c 14 N
15n) 14 N 14 N Hy My “Ne $y)
generation 2 = =
~ ~
By My 14 My aay tay 4) ‘ty 4) My yy My a Hy “Ne My
generation 3 S
~
From the diagram above, it can be seen that as the generation increases, the percentage of '4N
DNA increases from 2/4 = 50% (generation 1) to 6/8 = 75% (generation 2) to 14/16 = 87.5%
(generation 3).
|_% Level 1000 Biology MCQ with HELPs ? gs Frequently Examined Questions |
Q42 Q43
What is the basis for the difference in the A biochemist isolates and purifies various
synthesis of the leading and lagging strands of molecules needed for DNA replication. When
DNA molecules? she adds some DNA, replication occurs but the
A DNA ligase works only in the 3’ to 5’ DNA molecules formed are defective. Each
direction. consists of a normal DNA strand paired with
\ numerous segments of DNA a few hundred
B_ The origins of replication occur only at the nucleotides long.
5’ end.
What has she probably left out of the mixture?
C _Helicases and single-stranded binding pro-
teins work at the 5’ end. A DNA polymerase
B- Nucleotides
D_ DNA polymerase can join new nucleotides
only to the 3’ end of a growing strand. G Primers
D _sLigase
HELP
HELP
Synthesis of new daughter strand by DNA
polymerase is only in the 5’ to 3’ direction DNA ligase is needed to join the numerous
as DNA polymerase can only add nucleotides segments of DNA together. DNA ligase closes
to the 3’ end of a growing strand. the gaps between these segments of DNA by
forming a phosphodiester bond between the
New Template nucleotides to form a continuous strand.
Strand Strand
Q44
Identify the correct statements regarding the
replication of DNA.
1 Only 1 strand of DNA is replicated.
2 It occurs in interphase in both mitosis and
meiosis.
3 It occurs after the completion of telophase
in meiosis.
A 1 only B 1 and 3 only
C 2 only D 2 and 3 only
HELP
Statement 1: Both strands of DNA is repli-
cated. Each strand of a parental DNA
molecule separates and acts as template for
the synthesis of its new complementary strand.
Statement 2: DNA replication occurs during
S phase of interphase in both mitosis and
meiosis.
Statement 3: DNA replication (if it takes place)
occurs after the completion of telophase in
mitosis and telophase Il of meiosis Il.
‘8 Level 1000 Biology MCQ with HELPs ? gg Frequently Examined Questions |

Q45
What is the basis for the difference in the
synthesis of the leading and lagging strands of
DNA molecules?
I The anti-parallel arrangement of the DNA
strands.
II The RNA primers are required to initiate
DNA elongation.
III DNA polymerase joins new nucleotides to
the 3’ end of the growing strand.
IV Helicase and single-stranded binding pro-
teins work at the 5’ end of the DNA strand.
A II and IV
B I and III
C JIandiIVv
D II and III
HELP
The DNA strands are antiparallel i.e. run in
opposite directions. Synthesis of new daugh-
ter strand by DNA polymerase is only in the
5’ to 3’ direction, thus the DNA template is
read in the 3’ -— 5’ direction. This means
only the leading strand can be synthesized
continuously because the DNA polymerase
is moving in the same direction as the
unwinding DNA. The lagging strand is syn-
thesized discontinuously, because the DNA
polymerase has to move away from the
unwinding enzyme in the 5’ to 3’ direction.
W Level 1000 Biology MCQ with HELPs ? g7 Frequently Examined Questions

TOPIC 2 DNAAND GENOMICS
2(b) Protein Synthesis
‘ee a
Oil HELP
Purines will only base pair with pyrimidines,
Five different amino acids (numbered 1—5
and vice versa. The purines in RNA are ad-
below) form the following sequence in part of
enine and guanine, whilst the pyrimidines are
a polypeptide chain:
cytosine and uracil. Thus guanine will base
Ua ee Bega ree toe pair with cytosine, adenine with uracil, and
Messenger RNA (mRNA) codons which corre- thymine with adenine.
spond to these amino acids are:
amino acid 1 UGU Q3
amino acid 2 GAU The nitrogenous bases present in RNA are the
amino acid 3 CAC same as those present in DNA except that
amino acid 4 UAG A adenine replaces cytosine.
amino acid 5 AAG B adenine replaces thymine.
Which one of the following DNA base sequences C __ uracil replaces adenine.
could provide the code for the given section of jp uracil replaces thymine.
polypeptide?
A ACACTTGTGATGCTATTCGTG
HELP
B ACACUAGUGAUGCUAUUCGUG
Ronee Uracil is a pyrimidine found in RNA and re-
C CACTAGTGATGCTAAACGTG places thymine which usually base pairs with
D ACACTAGTGATCCTATTCGTG the purine and adenine in DNA.
HELP Q4
For the mRNA codons: Which one of the following correctly represents
UGUEGAULCAGWIAG_-GAUWLAAG-CAG how a RNA nucleotide aligns itself opposite a
The corresponding DNA is: DNA nucleotide during transcription?
ACA-CTA-GTG-ATC-CTATIC-GTG nN DNA
O
Q2 = oe rom }
The complementary messenger RNA triplet for
the DNA triplet GAT would read O
AS Oras B CUA B << eS
‘ Level 1000 Biology MCQ with HELPs ? 88 Frequently Examined Questions |

Topic 2(b) Protein Synthesis
Q6
c An anti-codon is the sequence of the nitrogenous
bases on the
© A complementary strand of DNA which codes
ae)
for one amino acid.
B complementary strand of mRNA which
codes for one amino acid.
C tRNA molecule where the amino acid is
HELP attached.
There is a complementary base-pairing be- D tRNA molecule which recognises the ap-
tween the RNA and DNA molecule. The A propriate sequence of bases on the mRNA.
nucleotide usually pairs with the residue U,
which is the RNA nucleotide equivalent to
the T residue in DNA molecule. HEL P
The anticodon of 3 bases is located at the
centre of the middle loop of a tRNA mol-
Q5 ecule and can base pair with the comple-
Three polypeptides were made using synthetic mentary three nucleotides of the mRNA codon
mRNA molecules as shown. during translation.
synthetic polypeptide ON!

mRNA used produced
Which of the following basis is never
UUUUUUUUUUUU phenylalanine-phenylalanine found in RNA?
-phenylalanine-phenylalanine A adenine
AAAAAAAAAAAA lysine-lysine-lysine-lysine B__scytosine
C guanine
UUUAAAUUUAAA phenylalanine-lysine
-phenylalanine-lysine D_ thymine
What are the DNA codes for the amino acids HEL P
phenylalanine and lysine?
Thymine is the pyrimidine base that cannot
phenylalanine __ lysine be found in RNA. Instead, uracil is the base
A AAA (wig? that base pairs with the purine, adenine.
B AAA UUU
C GGG CCC Q8
D ale GGG What is a codon?
A a length of DNA which codes for a par-
HELP ticular protein
The triplet codon of phenylalanine (UU) will B a part of the transfer RNA molecule to
base pair with AA in the DNA molecule, and which a specific amino acid is attached
that of lysine (AAA) will base pair with TTT. C a part of the transfer RNA molecule which
recognises the triplet code on the messen-
ger RNA
D a part of the messenger RNA molecule that
has a sequence of bases coding for an
amino acid
W Level 1000 Biology MCQ with HELPs ? gg
|
Frequently Examined Questions
HELP 3 transcription of mRNA from a DNA tem-

The triplet codon is made up of 3 nucleotide plate
bases and is located at the centre of the 4 formation of the polypeptide chain
middle loop of tRNA molecule, and base 5 attachment of the mRNA strand to a ribo-
pairs with the complementary bases on an some
mRNA molecule during protein synthesis.
In which order do these stages take place?
Bi 8 as ae
ORL B Li oSi- Sena dz
A mutation involving the substitution of one ni- CG oo LL ee 2
trogenous base for another has altered the base
sequence of a DNA molecule, coding for four ee a
amino acids, as shown below.
normal A-G-C-A-T-G-—G-—A-T-C-C-T HELP
mutant A-G—C-A-T-G—C-A-T-C-C-T Transcription of DNA into mRNA must first
The table shows six codons and the correspond- occur, and then this mRNA attaches itself onto
ing amino acids into which each is translated. a ribosome in the cytoplasm, and the trans-
lation machinery begins the protein synthesis
mRNA codon amino acid
process.
AAG lysine
CUA leucine
GGA glycine Q11
GUA valine Below is part of the DNA genetic code for six
UAC tyrosine
amino acids.
UCG serine
CGG codes for alanine
The mutation has changed the amino acid
RA codes for lysine
A leucine to valine.
GCG codes for arginine
B_ lysine to glycine.
AAA codes for phenylalanine
C serine to leucine.
CCA codes for glycine
D __ tyrosine to lysine.
CAA codes for valine
The diagram shows part of a mRNA molecule,
HELP
but the corresponding part of the protein formed
The segment coding for GAT on the normal was found to be:
DNA molecule will be transcribed into CUA
arginine-glycine—lysine—valine—alanine
in the mRNA molecule, whilst the mutant DNA
strand CAT will be transcribed into GUA on
the mRNA molecule. This implies a change CGCGUUAAAGU
UGEC'C
from the amino acid leucine to valine. Which triplet contains a single transcription
error?
Q10 A the first

B the second
Listed below are the stages in the cellular syn-
thesis of a protein. C the third
1 movement of mRNA from nucleus to cyto- D_ the fourth
plasm
2 linking of adjacent amino acid molecules
‘ Level 1000 Biology MCQ with HELPs 9g Frequently Examined Questions

HELP
Q14
The corresponding DNA for the mRNA is
Listed below are some amino acids and their
shown below:
corresponding mRNA triplets.
MRNA: CGCGUUAAAGUUGCC
amino acid mRNA triplet
DNA: GCGCAATTTCAACGG
phenylalanine UUU
lysine AAG
Qi12 arginine
alanine
CGA
GCA
Three consecutive bases in the DNA molecule
Which DNA sequence would be needed to
(a triplet) provide the code for each amino acid
produce the following polypeptide sequence?
in a protein molecule.
alanine-arginine-lysine-phenylalanine
What is the maximum number of different trip-
lets that could occur? A ~<CGT GCY FTG “WAA
A 16 B 20 BeGCGl SCG teak
C 24 D 64 Gr -CGU “GCUr TUUG. AAA
D CGU GCU UUG TIT
HELP
The triplet code consists of three of the four HELP
nucleotide bases — A, C, G or T. Thus the The complementary bases of GCA-CGA-
maximum number of possible amino acids AAG-UUU are CGT-GCT-TTC-AAA on the
that can be coded for is 4% = 64. DNA strand. Note that U in the mRNA base
pairs with A on the DNA molecule.
Q13
The DNA code for glutamic acid is CTC or CTT. Q15
The code for valine is CAA or CAT. In sickle Insulin is a protein containing 51 amino acids.
cell haemoglobin, valine is present instead of These include 17 of the 20 different amino acids
glutamic acid. commonly occurring in proteins.
Assuming a single base pair substitution has oc- What is the minimum number of different kinds
curred, what is the mRNA code in the affected of tRNA molecules involved in the synthesis of
mutant? insulin?
A CUU Aye 3
B GAA B 17
C GAG Cr -20
D GUA D 51
HELP HELP
Since a single base pair substitution has Since there are 17 different amino acids that
caused this mutation, the original codon for constitute insulin, and each amino acid is
glutamic acid must have been CTT, and the coded for by a triplet codon attached to a
mutant codon is CAT. The mRNA code for tRNA molecule, the minimum number of dif-
this mutant is hence GUA, i.e. complemen- ferent tRNA molecules is 17 x 3 = 51.
tary to CAT.
‘N Level 1000 Biology MCQ with HELPs P 94 Frequently Examined Questions

Q16 Q18
Which statement correctly describes the tran- The insulin molecule is composed of two
scription of DNA? polypeptide chains, one consisting of 20 amino
acids and the other consisting of 31.
A It produces amino acids.
What is the minimum number of base pairs of
B_ It produces messenger RNA.
DNA required to code for this molecule?
C It results in increased DNA synthesis.
A 20
D It is a semi-conservative process.
B.. 51
CG. 102
HELP
D 153
DNA transcription is a process whereby the
DNA message is copied into mRNA, a pro-
cess carried out by RNA polymerase. HELP
Each amino acid is coded by a codon of
3 nucleotides bases. Hence, the least num-
Q17 ber of base pairs = 20X3 + 31 X3 =
Which diagram shows the pairing of an RNA 153.
nucleotide with a DNA nucleotide during tran-
scription?
Q19
Three consecutive bases in the DNA molecule
(a triplet) provide the code for each amino acid
in a protein molecule. What is the maximum
number of different triplets that could occur?
Keo 20 B 24
C 48 D 64
HELP
There are 4 different bases — A, G, C and
QO
T in DNA. Mathematically, the maximum num-
ber of different triplets is 4° = 64.
oS Q20
Which statement correctly describes messenger
RNA (mRNA)?
HELP A mRNA binds amino acids for incorporation
C (cytosine) pairs with G (guanine) and A into proteins
(adenine) pairs with T (thymine)/ U (uracil). B mRNA contains the five-carbon sugar deox-
This excludes options A and D. DNA has the yribose
T nucleotide, while in RNA T is replaced by
U. C mRNA is a double stranded helix
D mRNA recognises the anticodon of tRNA
‘ Level 1000 Biology MCQ with HELPs ? 92 Frequently Examined Questions

HELP Q23
The mRNA has a series of three nucleotides,
In many cells, ribosomes occur in groups along
called the codon, coding for each amino
messenger RNA molecules.
acid. This is complementary to the anticodon
found on the tRNA which holds the corre- What is the advantage of this when compared
sponding amino acid. with single ribosomes?
A A greater variety of polypeptides can be
Q21 produced.
B Fewer transfer RNA molecules are used in
What is an anticodon? protein synthesis.
A three bases on a DNA molecule coding for € Larger polypeptide chains can be produced.
a eae gece Qaalranelaion D ‘Polypeptides can be produced more rapidly.
B three bases on a mRNA molecule after tran-
scription from DNA
C three bases on a tRNA molecule involved WISSS
in transcription from DNA Polypeptides are produced more rapidly as
several ribosomes can work on different
D__sithree bases on a tRNA molecule involved
stretches on one mRNA strand at the same
in translation into protein
time. The polypeptide produced depends on
the mRNA sequence and not the ribosomes.
HELP
Each tRNA carries a specific amino acid and Q24
has a particular sequence of three nucle-
otides called the anticodon. When these three Compared with single ribosomes, polyribosomes
bases are complementary to the codon on increase the efficiency of protein synthesis.
the mRNA, the amino acid is added to the How is this achieved?
euolite| Waely/o aile een: A Different protein molecules can be made
simultaneously.
O22 B_ Each copy of a protein can be made more
rapidly.
One complete turn of the double helix of DNA
contains 10 pairs of bases and is 3.4 nm long. © More than one copy of the mRNA molecule
d at th time.
What is the approximate length of the DNA Satu ante Bae ged
coding sequence of lysozyme, a protein of 129 D Many copies of the same protein can be
amino acids? made simultaneously from one mRNA
eo, molecule.
[bis Sei eeaten!

HELP
G. .66-nm ao care
a During protein synthesis, the ribosomes move
nm along the mRNA molecule. Rather than 1
ribosome at a time passing along the RNA,
HELP the process is carried out more efficiently by
ay Oe So omels a number of ribosomes moving simulta-
© PORN EsgVehce 'l + neously along the mRNA, like beads on a
387 ane a peut ia ee set string. This resulting chain of ribosomes is
ic COC ogWoy likeP Dases. Hees INE IeNg called a polyribosome or polysome.
ODINAn igs 367/10. 3.45 = 132 nm,
‘N Level 1000 Biology MCQ with HELPs ? 93 Frequently Examined Questions |

Q25 HELP
TCG GCC TAC CGG GCC CAT GCC
In a genetic engineering experiment a piece of
DNA containing 6000 nucleotides is transcribed There is only one alanine code present, as
and translated into protein. CGG would be the corresponding triplet of
bases on the DNA template. Note that GCC
How many amino acids are required?
is the codon on the mRNA, not the DNA,
A 500 that codes for alanine.
B= 1000
C =3000 Q28
D 4500
Which sugar and base, in addition to inorganic
phosphate, will be released from the hydrolysis
HELP of a certain nucleotide?
There is usually a triplet code for most amino
acids, e.g. GUA, CGG, CGU. As DNA is
a double stranded molecule, there are 6000/ deoxyribose uracil
2 = 3000 nucleotides on each strand. One fructose thymine
strand is used for protein synthesis. Therefore glucose thymine
3000/3 = 1000 amino acids are required.
ribose uracil
Q26
HELP
A synthetic mRNA molecule is made by using
only two types of nucleotide, containing adenine The sugars involved are either ribose or deox-
and cytosine. yribose. DNA is a double-stranded polynucle-
otide that contains deoxyribose with organic
How many different codons could it contain? bases A, G, C and T, but never uracil.
Ape? B 4
Ges D_ 16
Q29
The biochemical analysis of a sample of DNA
HELP shows that 32% of the nitrogenous bases are
With only 2 different bases present in the cytosine.
mRNA, only 8 different codons could be What is the total percentage of adenine and
formed. This is derived from 2° = 8, as each uracil in mRNA transcribed from this DNA?
codon consists of a triplet code.
A 16% B 18%
CC” =-32% D 36%
Q27
An mRNA codon for the amino acid alanine is HELP
GCC.
32% cytosine —» 32% guanine
How many alanine molecules are present in the
polypeptide, containing eight amino acids, coded 18% adenine > 18% uracil
for by the following DNA template? Total percentage of A and U = 18 + 18
TCGGCCTACCGGGCCCATGCCAAT = 36%
reg) B 1 (DNA does not contain uracil)
C2 D 3

Q30 HELP
How many different polypeptides, each consist- X is a phosphate group. It should be con-
ing of r amino acids, can be made if the num- nected to the sugar group, with in turn, is
ber of different amino acids available is n? connected to the base group. The base should
be left ‘open’ to allow for pairing. Therefore,
Agee B Te Y should be the base. The sugar must be
C nr D on ribose because anticodons are found in tRNA.
HELP Q33
For example, if there were 3 different amino If there were 34 amino acids and DNA only con-
acids available, and each polypeptide contained two types of nitrogenous bases, what
sists of 2 amino acids, the number of dif- would be the minimum number of bases per
ferent polypeptides possible is 3? = 9. codon that could code for proteins?
Aes
Q31 B 4
Which process does not occur during the for- C66
mation of messenger RNA? D 8
A condensation B___ polymerisation
C replication D transcription HELP
As there are 2 types of bases, 2° would
HELP provide 64 combinations, which is more than
sufficient. 2* would only provide 16 combi-
During the formation of the mRNA, there is
nations, which would be insufficient to code
no replication. The codons of the mRNA serve
for 34 amino acids.
as codon sites for the formation of an amino
acid that corresponds with the bases on it.
Condensation occurs between the nucleotides
to form a polynucleotide, i.e. the mRNA
Q34
strand. Part of the amino acid sequences in normal and
sickle cell haemoglobin are shown.
Q32 normal sickle cell

haemoglobin haemoglobin
The diagram represents an anticodon.
thr-pro-glu-glu | thr-pro-val-glu
mRNA codons for these amino acids are
glutamine (glu) GAA GAG

proline (pro) CCU CCC
threonine (thr) ACU ACC
valine (val) GUA GUG
Which transfer RNA molecule is involved in the
formation of this part of the sickle cell haemo-
deoxyribose phosphate
globin?
deoxyribose phosphate base
ribose base phosphate
ribose phosphate base
WW Level 1000 Biology MCQ with HELPs / 9g Frequently Examined Questions

Topic 2(b) Protein Synthesis 4
A B HELP
DNA replication is a semi-conservative pro-
cess and translation produces polypeptides
with the help of the ribosome.
O27,
GyG Coe The sequence of bases on a messenger RNA
molecule is shown.
C D ALU. G GuACA GAL Uke a7
It was transcribed from one strand of DNA.
What is the sequence of bases on the comple-
mentary, non-transcribed strand?
A vA GAGS AoAe Ge, TAD Gis
be ae EoAG BA T6 “6) AW AG oT UT ee
Gel Tyeths GotGe To Tela s vAy GA: Bae
HELP DU 6c UU) UG aeAee o> ia
CAU in tRNA is the only one that can com-
pliment the valine in the sickle cell haemo- HELP
globin.
The DNA sense strand would have the bases
TAGCTTCAAGCA. Therefore, the non-tran-
Q35 scribed strand would be ATCGAAGTTCGT,
where thymine is used instead of uracil.
What is carried by a molecule of transfer RNA?
A an amino acid molecule
B enzymes for protein synthesis
Q38
C_.information from the DNA In genetic engineering, polymers may be artifi-
cially produced using a molecular template and
D sequence of codons appropriate enzymes.
Which product cannot be formed in this way
HELP from the template?
Translation is the means by which a specific template product
sequence of an amino acid is formed in ac- A. DNA RNA
cordance with the codons of the mRNA. tRNA-
amino acid complex is attracted to the codon B polypeptide RNA
of the mRNA. C RNA DNA
D RNA polypeptide
Q36
Which statement correctly describes the tran- HELP
scription of DNA? It would not be possible for a polypeptide
A It is a semi-conservative process. to serve as a template since it is made up
only of amino acids and there are no bases
B_ It occurs at the surface of the ribosome.
in order to transcribe an RNA strand.
C_ It produces messenger RNA.
D_ It produces polypeptides.
# Level 1000 Biology MCQ with HELPs 9g Frequently Examined Questions

Q39 Qa41
In most organisms, all possible triplets of bases Part of a prokaryotic gene is 228 base pairs long.
in DNA code for an amino acid, except for the What is the length of amino acids synthesized
coding strand ‘stop’ triplets ATT, ATC, ACT. The by this DNA sequence?
coding strand is complementary to mRNA.
A 38 B 76
In the prokaryote, Methanosarcina barkeri, the
C 228 D 456
coding strand triplet ATC codes for an unusual
amino acid, pyrrolysine.
HELP
The non-coding strand of a section of DNA in
M.barkeri has the following sequence of bases. A triplet of bases in the DNA molecule is the
code for one amino acid in a polypeptide
TTTTTATTGTATTACTAGTGTTAATGA chain. Thus, the amino acids synthesized =
How many amino acids can be made into a 228/3 = 76.
peptide by M.barkeri from the coding strand of
this region of DNA?
A 5 Q42
B 6 A peptide consists of ten amino acids of four
different kinds. What is the theoretical minimum
co 7 number of tRNA molecules required to trans-
D 9 late the mRNA for this peptide?
A 4 B 10
HELP C WA D 30
The 1* 7 triplets can eventually be translated

into 7 amino acids. HELP
Triplet: ] 2 3 S S) 6 ji 8 9 A tRNA molecule
non-coding strand: tle Stl ealtG 9 JA 7TAC TAG TGT TAA TGA has an anticodon
coding strand: AAA AAT AAC ATA ATG ATS ACA ATT sACT loop that base
1 pairs with a par-
‘stop’ triplet ticular codon on
the mRNA and a
CCA stem where
Q40 the tRNA attaches covalently to amino acid
coded for by the anticodon of the tRNA. There
Which of the following catalyses the formation are twenty different amino acids and each
of a peptide bond during translation? tRNA carries a different amino acid.
A Aminoacyl-tRNA synthetase lf there are four different kinds of amino acids
B_ DNA polymerase in the peptide, there will thus be four differ-
ent tRNA molecule required.
C_Peptidyl transferase
D_ RNA polymerase
Q43
HELP A student just learnt about the fact that mature
The enzyme, peptidyl transferase resides in mRNAs have poly-A-tails about 100 nucleotides
the large ribosomal subunit and catalyses the long.
formation of the peptide bond during trans- He reasoned that he should be able to find a
lation. sequence of 100 nucleotides with adenine at the
end of each eukaryotic gene sequence.

However he was unable to find such sequences Q45

of nucleotides when he observed the eukaryotic
DNA. Why was this so? A pentapeptide has the following amino acid
sequence:
A He should have been looking for multiple
nucleotides with thymine instead. H,N - Met-Leu-Trp-Ala-Phe - COOH
B_ He was looking at the wrong complemen- where Met: Methionine

~ tary strand of DNA. Leu: Leucine
C The DNA had been degraded and so lacked Trp: Tryptophan
the poly-A-tails. Ala: Alanine
D_~Poly-A-tails only exist in mature mRNA but Phe: Phenylalanine
not in DNA.
HELP 8%) é
In post-transcriptional control, three process-
ing events: 1) capping, 2) poly-A tailing and Yong,\ suea \GIU Cp
7% oe
3) pre-mRNA splicing occur in the nucleus ~ A ™
‘\ \ / c c
_ or
before the genetic messages are dispatched “Gy _ | A Seer
to the cytoplasm as mature mRNA. In poly- ~e~ GU <3 ee
Cc i i
A tailing, the completely transcribed pre- ~ uv U tie G & Trypiopnan
He alc we
G | u
mRNA contains a polyadenylation sequence Agimne =p | ;
near the 3’ end. An enzyme recognizes the sume <C Zz a
polyadenylation sequence, and adds a poly-
A tail consisting of 50-250 adenine nucle-
SF
Oy fC
A he Sie
|G NBNE
\ gee
» ee =
otides to the 3’ end of the mRNA before the

mRNA exits the nucleus. Thus poly-A-tails only gt ae S/acyl Or.
4 $ fa} us \S\ %
exist in mature mRNA but not in DNA. < / / 2 | z %
/3/ F Pits ®
Q44 Using the genetic code shown in the diagram

How many different polypeptides, each consist- above, deduce the corresponding template strand
ing of 3 amino acids, can be made if the num- sequence during transcription.
ber of different amino acids available is 10? A 5’ — GAA GGC CCA CAA CAT - 3’
A 30 B 5’ — AUG CUG UGG GCA UUC - 3’
B 1000 G 5S —AlGetTG; 6G: GCG TI TAG. — 3
C 3000 D 5’ — TIA .GAA-GGC CCA CAA CAT — 37
D 59049
HELP
HELP Transcription is the synthesis of an mRNA
There is a possibility of any 1 of the 10 molecule with a base sequence complemen-
amino acid in the 1%, 2% and 3% position tary to a section of DNA.
in the amino acid. mRNA:
Thus there can be a total of: 10 x 10 x 5+ AUG. UUG UGG. GEG UUC DAA ="3*
10 = 1000 polypeptides possible.
template strand:
9’ — TAC AAC ACC CGG AAG ATT - 3’
Level 1000 Biology MCQ with HELPs ? 9g Frequently Examined Questions

Topic 2(b) Protein Synthesis |
Q46 HELP
Choose the answer that has these events of An mRNA of 336 nucleotides has 336/3
protein synthesis in the proper sequence. codons = 112 codons. The initiator codon
codes for amino acid, Met while the termi-
1. An aminoacyl-tRNA binds to the A site. nation codon do not code for any amino
2. A peptide bond forms between the new acid. Thus, the number of amino acids in the
amino acid and a polypeptide chain. protein translated from this mRNA = 112 —
3. Protein release factor binds to A site. 1 = 111 amino acids.
4. A small ribosomal subunit binds with

mRNA. Q48
5. tRNA translocates to the P site from the A
If proteins were composed of only 12 different
site.
kinds of amino acids, what would be the small-
est possible codon size in a genetic system with
four different nucleotides?
Aiete
fs . (orb
oO
bm
FP Bley
RE
ee
Lg
Bea
Cc 4
HELP De i2
A small ribosomal subunit recognizes and
binds to the start codon of the mRNA HELP
molecule. The initiator tRNA fits into the P
site of the large ribosomal subunit, and the There are four different nucleotides in the
next aminoacyl tRNA fits into the A site of DNA molecule. The four nucleotides in DNA
the large ribosomal subunit. A peptide bond must be able to code for the 12 different
is formed between the amino end of the kinds of amino acids used to make proteins.
amino acid in the A site and the carboxyl If two bases code for each amino acid, then
end of the growing chain in the P site. Peptidy| 4? = 16 amino acids could be specified into
transferase in the large ribosomal subunit the protein molecule. This is more than
catalyses the formation of the peptide bond. enough to incorporate all the 12 amino acids
The ribosome moves down the mRNA in a into the structure of protein molecules. Hence,
5’ to 3’ direction, that is, the tRNA, carrying the smallest codon size in this genetic system
the growing polypeptide in the A site is moved isin
to the P site. This process continues until a
stop codon reaches the A site of the ribo-
some and a protein release factor binds to Qa4g
the stop codon on the mRNA.
A gene that was 5055 base pairs resulted in the
expression of functional proteins that were 350,
Q47 450 and 1500 amino acids long. What could be
most likely reason for this?
An mRNA is 336 nucleotides long, including the A mRNA degradation
initiator and termination codons.
Gene amplification
The number of amino acids in the protein trans-
lated from this mRNA is Alternative splicing
A 10. B a1. ke
©)
iS]Mutations resulting in early termination
signals
C iz. Dae 2330"
WW Level 1000 Biology MCQ with HELPs ? gg Frequently Examined Questions

HELP Which of the following statement is TRUE of

Alternative RNA splicing is a form of regu- structures X and Y?
lation of gene expression where different A Structure X is double stranded whereas
mRNA molecules are produced from the same Structure Y is single stranded.
primary transcript, depending on which RNA B There is hydrogen bond interaction be-
segments are treated as exons and which as tween the subunits of both Structures X
introns. and Y.
This enables the single gene of 5055 base C Information on Structure Y is used to
pairs to code for more than one kind of synthesize Structure X.
polypeptide, depending on which segments
are spliced together during RNA processing. D_ The coiling of Structure Y is a direct re-
sult of the information on Structure X.
Q50 HELP
Assume that the average amino acid residue has X refers to the mRNA and Y refers to the
a molecular weight of 110. The DNA strand polypeptide. The codons in the mRNA acts
coding for a polypeptide chain of molecular as template for protein synthesis and con-
weight 20,000 has a length of tains information for the protein’s folding into
A 182 nucleotides.
a specific shape.
B 252 nucleotides.
C =540 nucleotides. Q52
D 760 nucleotides. Genetic drugs are short sequences of nucle-
otides. One example is an anti-sense drug made
from RNA nucleotides that are complementary
HELP to the protein-coding mRNA.
Average amino acid residue’s molecular Which is the process that is affected by the anti-
weight of = 110 sense drug and what is its most probable mode
Polypeptide chain of molecular weight 20,000 of action?
= 20,000/110 = 182 amino acids A It prevents DNA replication by binding to
A triplet of bases in the DNA molecule codes the anti
for one amino acid in a polypeptide chain. B_ It prevents transcription by binding to the
To translate 182 amino acids, there must be sense strand of DNA that codes for the
a minimum of: 182 x 3 = 546 nucleotides. disease
C It prevents translation by binding to the
Q51 mRNA that contains
disease
information for the
Below is a diagram showing a particular stage D_ It prevents the normal functioning of dis-
in protein synthesis. ease
HELP
The anti-sense drug binds by complementary
base pairing via hydrogen bonds between
complementary bases with the mRNA to form
double stranded RNA. This prevents ribosome
from binding to the mRNA, hence preventing
translation.
‘ Level 1000 Biology MCQ with HELPs " 100 Frequently Examined Questions |
Q53
The following coding sequence is taken randomly from a bacterial genome.
3’ — TTACGCTTCGAAATAGGAATATCATAGGCT - 5’
CGU, CGC, CGA, UUVA, UUG, CUU,

CGG, AGA, AGG CUC, CUA, CUG
GAU, GAC AAA, AAG
AUU, AUC, AUA UUU, UUC
UCU, UCC, UCA,
AUG
UCG, AGU, AGC
UAG, UGA, UAA UAU, UAC
This sequence is cloned into a plasmid and transformed into a suitable host. What would be the
first four amino acids of a peptide generated from this sequence as expressed by the host?
A Met-Arg-Ser-Phe B Met-Arg-Ser-Lys
C -Met-Ile-Phe-Leu D-Met-Tyr-Lys-Asp
HELP
Coding sequence: 3’-T TAC GCT TCG AAA TAG GAA TAT CAT AGG CT -S’
mRNA : 5’-A AUG CGA AGC UUU AUC CUU AUA GUA UCC GT
1" four v y 4 +
amino acids : Met Arg Ser Phe
Q54
A student obtained a sample of DNA. mRNA Which strand of DNA is the coding stranding,
was transcribed from this DNA and the two serving as a template for mRNA synthesis?
samples were subsequently purified. He then A’ Strand: 1
separated the two strands of the DNA sample.
B Strand 2
The base compositions of each strand and that
C Strand 3
of the mRNA were analysed. The results of the
analysis are shown in the table below. D Strand 2 and 3
HELP
Transcription is the synthesis of an mRNA
strand 1
molecule with a base sequence complemen-
tary to a section of DNA. Due to the comple-
DNA mentary relationship between the bases in
strand 2 DNA and in the free RNA nucleotides, cy-
DNA
tosine in the DNA pairs with guanine, gua-
strand 3
nine pairs with cytosine, thymine pairs with
adenine and adenine with uracil.
mRNA
WW Level 1000 Biology MCQ with HELPs 404 Frequently Examined Questions
7
DNA AND GENOMICS
Gene Mutation and Chromosome Aberration |
e =e
Q1 Q3
In the DNA sequence for sickle cell anaemia, The diagrams below show the results of two
adenine replaces thymine in a CTT triplet, form- types of gene mutation.
ing the triplet CAT. During translation of the CGATTACCATGCATA
mutant mRNA, the amino acid valine is incor-
porated into the haemoglobin molecule instead
hos
original base sequence
of glutamic acid.
What is the anticodon in the transfer RNA
CGATTAACCTGCATA
x aay
= CGATTACCAGGCATA
molecule carrying this valine?
mutant sequence | mutant sequence 2
AS CAL B CAU
Which one of the following shows the types of
Cc UGTA D GUA gene mutation producing mutant sequence 1 and
oe
HELP i 2
The codon on the mutant mRNA would be A deletion insertion

GUA, thus the anticodon is CAU. Candidates B insertion deletion
should remember that in RNA, uracil is present
(f inversion substitution
instead of thymine.
D substitution insertion
G2
A mutation is a change produced by an alter- HELP
ation in the genetic mechanism and Sequence | possesses a mutation in the third
codon, whilst sequence 2 possess mutation
A may arise spontaneously.
in the fourth codon. In sequence 1, CCA
Bis always induced by the environment. from the original sequence has inverted into
Cis never advantageous. ACC; whilst in sequence 2, T of TGC from
the original sequence has been substituted
D is not inherited.
by G.
HELP
Q4
A mutation is a change in the DNA that
changes the physiological effect of the DNA Hydroxylamine is a mutagen. It converts cy-
on the cell. Such phenomenon may be caused tosine to a compound which pairs with adenine.
by radiation, chemical carcinogens or may If DNA is treated with hydroxylamine, the
occur spontaneously. mutation which results is an example of
A a deletion. B an insertion.
C an inversion. D a substitution.
Topic 2(c) Gene Mutation and Chromosome Aberration
HELP HELP
If DNA is treated with hydroxylamine, the Non-disjunction occurs when paired chromo-
cytosine bases will be substituted with an- somes do not separate properly to the poles
other compound which will pair with adenine. during meiosis.
Ovum XX x Sperm XY
Q5 Gametes: XX X NG
The diagrams below show two types of chro- axe] XXX or XXY
mosomal mutation producing changes from the
normal gene sequence.
Q7
EN ley (C) 1D) RNG
—e—o__e—__
o_o _9_o_ normal gene sequence The diagram below shows a pair of homologous
chromosomes at prophase.
A BC DE Dit GG BAMBEE Cope

centromeres
(1) (2)
Which one of the following shows the two forms 4
of chromosome mutation shown above? chromatids
(1) (2) What type of chromosome mutation has oc-

A deletion duplication curred?
B duplication inversion A deletion B_ duplication
C duplication translocation C insertion D ___sinversion
D inversion duplication
HELP
HELP The mutation shown is an inversion of the

base sequences.
(1) shows a duplication of the genes C to
G, occupying a position adjacent to the
normal sequence of A to E. (2) shows a Q8
change in the position (translocation) of the
genes FG, so they are inserted between B Which of the following results in the addition
and C. of an extra chromosome to the chromosome
complement of a cell, as in Down’s syndrome?
Q6 A _ allopolyploidy
B__autopolyploidy
During the formation of an ovum,
C chromosome translocation
non-disjunction of the sex chromosomes oc-
curred. The ovum was then fertilised by a D non-disjunction
normal, Y-bearing sperm cell.
Which one of the following shows the sex chro- HELP
mosome complement of the resulting zygote?
Non-disjunction occurs when paired chromo-
JA ef@) somes do not separate properly to the poles
B XY during meiosis, resulting in an extra chromo-
some in Down’s syndrome.
Co XY
D XXXY
W Level 1000 Biology MCQ with HELPs ” 493 Frequently Examined Questions
Q9 Q11
A small proportion of men have the genotype Down’s syndrome can exist in two forms.
XYY. Classic Down’s syndrome affects all cells and is
Such a genotype is possible if one contributory very severe. The mosaic form arises from the
gamete to the zygote is presence of two or more cell types in the body
Aan egg produced by non-disjunction in
with differences in chromosome number and
structure.
meiosis.
How does the mosaic condition arise?
Ban egg containing an X and a Y chromo-
some. A non-disjunction of chromosomes in mito-
sis in early fetal development
C a sperm produced by non-disjunction at
meiosis I. B_non-disjunction of chromosomes in meio-
D a sperm produced by non-disjunction at
sis during formation of ova
meiosis II. CC non-disjunction of chromosomes in meio-
sis during formation of sperm
D _ translocation of chromosomes at maturation
HELP
of the ovum
The extra Y chromosome comes from the
male parent, where the paired chromosomes
in the sperm nucleus fails to separate prop- HELP
erly to the poles during meiosis Il. The mosaic condition can occur in 2 or more
cell types as a result of non-disjunction in
Q10 mitosis, i.e. the paired chromosomes fail to
separate properly during mitosis of the nucleus
Which of the following is an example of a gene in somatic cells.
mutation?
A Polyploidy
Q12
B_ Substitution
Occasionally, non-disjunction of the entire ge-
C Crossing over nome occurs during meiosis producing abnor-
D Non-disjunction mal gametes.
Which type of genetic variation may result when
HELP one such gamete is fertilised by a normal ga-
mete?
Option A is incorrect. Polyploidy is a form
of chromosome aberration. Polyploidy is a A aneuploidy
condition of the nucleus where there are three B_ deletion
or more times the haploid number of chro- C inversion
mosomes.
D triploidy
Option C is incorrect. Crossing over is a
process that may occur between non-sister
chromatids of homologous chromosomes in HELP
prophase | of meiosis Il.
Non-disjunction occurs when paired chromo-
Option D is incorrect. Non-disjunction refers somes do not separate properly to the poles
to the failure of chromosomes to separate during meiosis, resulting in an extra chromo-
during anaphase | or anaphase II, resulting some, or a triploid condition.
in chromosomal aberration.
WV Level 1000 Biology MCQ with HELPs ? 494 Frequently Examined Questions |
Q13 HELP
Which of the following statements about gene The enzyme V is responsible for making amino
mutation is incorrect? acid 2 from 1, whilst Z is responsible for the
conversion of 4 to 5.
A It can occur in both somatic and sex cells.
B_ [It can cause Down’s syndrome in humans.
C It can change a dominant allele into a re-
Q15
cessive one. Ozone is a gas in the upper atmosphere which
absorbs ultraviolet radiation from the Sun.
D_ It can be brought about by exposure to
ionising radiation. Which of the following would increase as a
direct consequence of the thinning of the ozone
layer?
HELP
A cancers due to mutation in cells exposed
A gene mutation cannot cause a dominant to sunlight
allele to become recessive, but can disallow
B__ photosynthesis due to increase in the spec-
it from being expressed phenotypically.
trum of radiation reaching Earth
Crate of carbon fixation due to increased
Q14 levels of atmospheric CO,
The diagram represents a sequence of reactions D sea level due to expansion of water and
taking place in a bacterium in which amino melting of polar ice caps
acids are produced from one another by the
ction of specific enzymes. Numbers 1 to 6
HELP
represent different amino acids; letters V to Z
represent different enzymes. All the amino acids When the ozone layer thins, there is increased
are essential for survival. exposure to UV radiation, resulting in chro-
mosomal mutations that can cause cancers.
x
| SS ee
Xx Z Q16
Which of the following results in the addition
3 5 of an extra chromosome to the chromosome
The original strain of the bacterium required complement of a cell, as in Down’s syndrome?
only amino acid 1. A _ allopolyploidy
A mutant strain of this bacterium could only B autopolyploidy
survive when provided with amino acids 1, 2 C non-disjunction
and 5 in its culture medium.
D polygenic inheritance
Which enzymes were missing in the mutant
strain?
A V and Z only HELP
BW and Z only Non-disjunction occurs when paired chromo-

somes do not separate properly to the poles
C X and Y only during meiosis, resulting in an extra chromo-
D_ V, W and Z some, or a triploid condition such as Down's
syndrome.
WW’ Level 1000 Biology MCQ with HELPs ? 405 Frequently Examined Questions
Q17 Q1g
The sex chromosome combination XYY is found Induced chromosome mutations produced a fer-
in a small proportion of men. tile hybrid species from cabbage and radish. The
table shows the chromosome numbers in the
Such a combination is possible if one contribu-
parental species and the hybrids.
tory gamete to the zygote is
A a sperm produced by a father whose cells
number of
lack an X chromosome. type of cell chromosomes
Ba sperm produced by non-disjunction at per cell
meiosis II.
parental cabbage
C an egg containing an X and a Y chromo- parental radish
some. parental gametes
Dan egg produced by non-disjunction at F, hybrids
meiosis I. F, gametes
F, hybrids
HELP F, gametes
F, hybrids
The extra Y chromosome comes from the
sperm nucleus. This occurs as a result of At which stage did the chromosome mutation
non-disjunction, where the paired chromo- occur?
somes fail to separate properly during meio-
sis Il. A during formation of the F, gametes
B during formation of the F, gametes
Q18 C during fusion of the parental gametes

D during fusion of the F, gametes
The human inherited diseased phenylketonuria
(PKU) is due to the absence of the enzyme
which metabolises the amino acid phenylala- HELP
nine.
During formation of the F, gametes, the
What is the most probable cause of this dis- number of chromosomes in the hybrid cell
ease? were not halved. This is where the chromo-
A deletion of bases within a gene some mutation occurred.
B_ duplication of a gene on a chromosome

C_ inversion of genes within a chromosome Q20
D translocation of a gene to another chromo- The diagram shows three of the 23 pairs of chro-
some mosomes found in a human cell.
HELP
The deletion of bases within a gene would
result in the absence of some amino acids.
Furthermore, if the number of bases deleted
is not a multiple of 3, then there will be a
frameshift mutation, where all bases down-
stream from the mutation would code for the
Which diagram shows an example of
wrong amino acids. This would cause a non-disjunction in the formation of an egg, that
change in the shape and hence function of
could lead to the formation of a Down’s syn-
the enzyme. drome zygote?
N Level 1000 Biology MCQ with HELPs 496 Frequently Examined Questions
A B Q22
Which combination of chromosomes would
result in a zygote showing polyploidy, if the
parental chromosome number is 36?
sperm ovum
C D A g 9
B 18 18
C 18 Ug
D 18 36
HELP
HELP Polyploidy refers to the presence of additional
Down’s syndrome is caused by a duplicate whole sets of chromosomes. Normally, each
copy of part of chromosome 21. Hence the gamete should have 18 chromosomes. Poly-
zygote that could lead to Down’s syndrome ploidy occurs when at least one of the ga-
is one where non-disjunction of chromosome metes has a number that is a multiple of 18.
21 has occurred.
Q23
Q21 Sickle cell haemoglobin differs from normal hae-
Newborn babies are screened for the presence | Moglobin because of a single change in an amino
of high levels of the amino acid phenylalanine acid; valine replaces glutamic acid.
in the blood, which indicates the hereditary Coding triplets in DNA for glutamic acid are
disease phenylketonuria. Pale skin also occurs (CTT and CGT.
in sufferers from this disease.
Coding triplets in DNA for valine are CAA and
The following series of reactions occurs in (CAG.
normal metabolism. Which mRNA codon would pro-
duce sickle cell haemoglobin if
ae cee aaa substituted for the normal mRNA
: other don?
protein — phenylalanine — tyrosine > eT tepolice codon:
ah enzyme 4 A GAA
melanin Rare
Which enzyme is lacking in persons with phe- GomGn

nylketonuria? D GUC
A 1 B we
GC 3 by HELP
GUC on the mRNA would correspond to the
coding triplet of CAG on the DNA. This codes
HELP
ddl for valine, the amino acid responsible for
The lack of enzyme 2 would effectively stop sickle cell haemoglobin.
the conversion of phenylalanine to tyrosine,
causing a build up of phenylalanine in the
blood.
‘N Level 1000 Biology MCQ with HELPs ti407 Frequently Examined Questions
Topic 2(c) Gene Mutation and Chromosome Aberration 4
Q24 Q26
A mutation results in the substitution of thym- During transcription of the DNA fragment
ine for cytosine in the base sequence ATC in a shown, a single base is paired incorrectly.
section of a DNA molecule. ~C=T-A=A—-C—T sense strand
What are the base sequences on the mRNA and ~-C A= T-T=GH=A “anti-sense strand
tRNA corresponding to the new triplet?
Which mRNA strand results?
mRNA tRNA
A C-A-T-T-G-A
A TAG ATG
B G-A-U-U-C-A
B TGG ACE
C G-A-U-U-G-A
C UAG AUG
D G-T-U-U-G-U
D UGG ACC
HELP sien!
The correct mRNA strand should be G-A-
The new triplet on the DNA molecule is ACC. U_U_G-A in order to be complementary to
This corresponds to UGG on the mRNA and he: sense. Strand of the DMA. soaqmeor
ACC on the tRNA. However, with a single cytosine base incor-
rectly paired, the mRNA would end up as G—
Q2 5 A—U—U-C-A.
The diagram shows a metabolic pathway involv-

ing some amino acids.
gene 1 gene 2 gene 3
y 1 1
metabolic ™2 1 ae 2 i 3
Ue ee —— ornithine —————> citrulline —————> arginine

acids
Q27
Three mutant strains of Escherichia coli each A mutation event inserts an extra nucleotide pair
fail to produce a different enzyme in the path-
near the beginning of a gene coding for a par-
way. ticular protein.
What should be supplied to the culture medium
What would be the effect of this on the pri-
to enable growth of all three mutant strains?
mary structure of the protein synthesised?
A arginine
A No amino acid is changed.
Bs citrulline
B One amino acid is changed.
C citrulline and arginine
C Two amino acids are changed.
D citrulline and ornithine
D Most of the amino acid are changed.
HELP
HELP
As arginine is the end-product of the meta-
Since gene coding for amino acids depend
bolic pathway, it should be supplied to the
on the correct sequence of nucleotides, the
medium to ensure the growth of the strains
insertion causes a shift in the sequence. This
that depend on this end-product.
means that different amino acids would prob-
ably be coded.
Q28 A DNA sequence codes for a polypep-

tide arginine-glycine-phenylalanine-va-
The table describes different kinds of mutations line-alanine.
in DNA.
The following mRNA molecule was tran-
scribed from the DNA sequence above.
mutation name
Which mRNA triplet contains a single
transcription error?
CGCGUUUUUGUUGCC
A The first
transversion
B The second
transversion C The third
D_ The fourth
HELP
DNA sequences coding for polypeptide argi-
nine-glycine-phenylalanine-valine-alanine:
Which diagram shows the DNA molecule after > 3’. - GCG CCA AAA CAA CGG - 5’
a transition has occurred? mRNA for the above DNA sequence based
on A-U and C-G pairing should be:
=>056 CGE, GGW BUUTCUU. CEE 3;
The second mRNA triplet contains a single
transcription error, instead of coding for GGU,
it coded for GUU.
HELP Q30
In transition, the bases that mutate could be One individual, organism P, in a sexually-repro-
A-T or C-G. The bases do not invert to form ducing population of mammals has two forms
I—Amor GC: of a protein in its heart muscle. The normal form
is identical to that in most other members of
the population, while the variant form differs
Q29 by one amino acid.
The table below shows some amino acids and The diagram shows the amino acid sequences
their DNA genetic code. in part of the normal protein and in the same
part of the variant protein.
Amino acid DNA code
Normal protein Variant protein
Alanine GGG
-gly-lys-lys-gly-glu- -glu-lys-gly-gly-glu-
Lysine What could account for the presence of the
Arginine normal protein and the variant protein in P?
Phenylalanine 1 The sequence of amino acids was altered

in a cell in the heart muscle of P’s mother.
Glycine
2 The sequence of amino acids was altered
Valine in a cell in the ovaries of P’s mother.
W’ Level 1000 Biology MCQ with HELPs ? 499 Frequently Examined Questions
3 The sequence of bases was altered in the Q32

DNA in a cell in the heart muscle of P.
RNA viruses appear to have higher rates of
4 The sequence of bases was altered in the mutation because
DNA in a cell in an ovary of P.
A RNA nucleotides are more unstable than
5 The sequence of bases was altered in the DNA nucleotides.
DNA in a cell in a testis of P’s grandfather.
B_ replication of their nucleic acid does not
A 1, 2 and 4 only involve the proofreading steps of DNA rep-
B 1 and 3 only lication.
C 2, 4 and 5 only CRNA viruses replicate faster.
D3 and 5 only D_ RNA viruses respond more to mutagens.
HELP HELP
Statements 1 & 2: When the sequence of Both prokaryotes and eukaryotes have proof-
amino acids was altered in a cell in the heart reading mechanisms to locate and correct
muscle of P’s mother or in the ovaries of P’s mutations and replication errors. Enzymes find
mother, this can be due to a transcriptional and bind to faulty or damaged sequences
or translational error. The sequence of bases and cut out the faulty sequences. The intact
in the DNA is not necessarily altered. Thus complementary strand guides the repair of
only P’s mother will be affected. P will not the faulty or damaged sequences. This pro-
be affected. cess is absent in the replication of nucleic
Statement 4: When the sequence of bases acid of RNA viruses.
was altered in the DNA in a cell in an ovary
of P this can be passed on the P’s offspring.
Thus, this will affect P’s offspring and not P Q33
Below is part of the DNA genetic code for six
Q31 amino acids.
CGG codes for alanine
The mRNA triplet UGA acts as a stop codon to
terminate the synthesis of a polypeptide. The TTT codes for lysine
diagram shows a strand of DNA coding for 4 GCG codes for arginine
amino acids. Where would a mutation, involv-
AAA codes for phenylalanine
ing the insertion of a thymine nucleotide, re-
sult in the termination of translation? CCA codes for glycine
RiGAGCGAC AAG CAA codes for valine
ir lial ij The diagram shows part of a mRNA molecule,
A Bae Ca iD) but the corresponding part of the protein formed
was found to be:
HELP arginine—glycine-lysine—valine—alanine
If the T is inserted into position C, the DNA
strand will be read as:
CGCEGUUAAAGUU
GCE
TTC ACG ACT AAG T Which triplet contains a single transcription
When transcripted, the mRNA coded for will error?
be: AAG UGC UGA UUC -+ UGA is a A _ the first B_ the second
stop codon and will result in termination of
translation. C the third D the fourth
‘ Level 1000 Biology MCQ with HELPs c 110 Frequently Examined Questions |
HELP I. The abnormal fungus cannot produce his-

tidine.
DNA mRNA Amino acid II The abnormal fungus can produce the
triplet triplet coded for other 19 amino acids.
The control tubes present in this experi-
alanine
ment were not necessary.
lysine A I and II only
arginine BI and Il only
phenylalanine CI and III only
glycine D_ All of the above
valine
HELP
The second triplet contains a single transcrip- Statements | and Il: Growth of fungus is only
tion error. GGU instead of GUU codes for observed in Tube 2 and Tube 12 where the
glycine. amino acid, histidine, is provided. In all the
other tubes, no growth is observed. This
Q34 proved that the fungus requires histidine for

growth and that this abnormal strain of fungus
Fungi can make their own amino acids and are is unable to make its own histidine.
able to grow on a substance called minimal Statement Ill: Control tubes present are
media. An abnormal strain of fungus that could necessary to prove that the changes observed
not grow on minimal media was discovered. An in the experiment is due to results of the
experiment was designed and the results are reactions being investigated, and not due to
outlined in the following diagram. The fungus other external factors.
grew in tube 12. The amino acid histidine had
been added to this tube.
(ees
4, 3) Oy. Or 9 TO, tA. eh Z 13,14, 15-16-17 «los 49) 20 221 32Z
Tube 1: Minimal media
Tube 2: Minimal media + all 20 different amino
Q35
acids added The DNA code for glutamic acid is CTC or CTT.
Tubes 3 to 22: Minimal media + one of the 20 The code for valine is CAA or CAT. In sickle
amino acids. Each tube contained a different cell haemoglobin, valine is present instead of
amino acid. glutamic acid. Assuming a single base pair
substitution has occurred, what is the mRNA
Spore of abnormal fungus was added to surface code in the affected mutant?
of media in each tube. All tubes were incubated
under the same conditions for several days and A CUU
then examined. B GAA
From this experiment, what conclusions can be Cascuy
made about the ability of the abnormal fungus D GUA
to produce amino acids?
HELP HELP
In sickle cell haemoglobin, valine coded for Gene mutation is defined as the changes in
has the code, CAA or CAT. After transcrip- the nucleotide base sequence of the genes
tion, this will code for GUU or GUA respec- within a chromosome.
tively. Chromosomal mutation is defined as changes
in chromosome number or structural alter-
ation to chromosomes and may occur across
Q36 chromosomes.
The condition in which a zygote contains three Option A: Gene mutation can produce both
copies of a particular chromosome as a result dominant and recessive allele.
of nondisjunction is called Option B: Gene mutation can involve inver-
A _ trisomy. sions.
B monosomy. Option D: Both gene mutation and chromo-
C polyploidy. somal aberrations can be equally harmful.
D = monoploidy.
Q38
HELP Which of the following illustrates chromosomal
Non-disjunction is the failure of chromosomes inversion?
to separate, resulting in chromosome aber-
ration.
A trisomy is a type of polysomy in which
there are three copies, instead of the normal
two, of a particular chromosome. A trisomy
is a type of aneuploidy (an abnormal num-
ber of chromosomes).
Q37
What do chromosomal aberrations and gene
mutations have in common and how are they
different?
Similarity Difference
Both may involve addition Gene mutations always produce dominant

of nucleotides. alleles but not chromosomal aberrations.
Gene mutations do not involve inversions
Both may not result in
but inversion of segments of chromosomes
disorders.
do occur.
Gene mutations occur within a chromosome

Both affect DNA sequence. but chromosomal aberrations may occur
across chromosomes.
Both may not result in a

Chromosomal aberrations are more harmful
difference in protein
than gene mutations.
expression.
HELP
Chromosomal Inversion occurs when a chro-
mosome breaks at two locations, and the
middle portion flips through 180° before
rejoining.
ABCDE FGH
Inversion
Q39
il Z 3
What type of chromosomal structure alteration is seen above?

A Chromosome duplication
B Chromosome deletion
C Chromosome inversion
D Chromosome translocation
HELP
Chromosome translocation is defined as a section of chromosome breaks off and becomes attached
to another chromosome, leading to new combination of alleles.
ABCDE FGH MNOCODE FGH

Reciprocal
translocation
SEED
‘N Level 1000 Biology MCQ with HELPs p 413 Frequently Examined Questions
Q40
The table shows the mRNA codons for 11 dif-
ferent amino acids.
The first seven DNA triplets coding for a pro-

tein are shown below.
These are DNA triplets from the coding strand,
complementary to the mRNA.
CAC GAG GCG AAG GGA CAC CGC
A mutation occurs when the seventeenth nucle-
otide in the DNA sequence is changed to G.
What is the amino acid sequence for the mu-
tated section of DNA?
A His Glu Ala Lys Gly Arg Arg
B Val Leu Arg Phe Pro Ala Ala
C His Glu Ala Lys Gly His Arg
D_ Val Leu Arg Phe Pro Val Ala
HELP
After mutation occurs when the seventeenth
nucleotide in the DNA sequence is changed
tol G,
DNAG CAC GAG GCG AAG GGA CGE CGE
mRNA: GUG CUG CGC-UUC CCU GEG GCG
‘4 Level 1000 Biology MCQ with HELPs e 114 Frequently Examined Questions
TOPIC
3 Genetics of Viruses and Bacteria
se a
Oi HELP
Which combination correctly identifies a type Three processes — conjugation, transduction

of virus? and transformation, lead to genetic recom-
bination in bacteria. Of the 3 processes, only
transduction involves a virus.
Q3
Which feature occurs only in the life cycle of
the influenza virus?
A Host cell DNA is destroyed by lytic en-
zymes.
HELP
B_ Host cell ribosomes are used to synthesise
A virus is a infectious particle consisting of: viral proteins.
A viral genome — It can be DNA or RNA C Viral RNA acts as templates for viral DNA
but never both. synthesis.
A capsid — A capsid is a protein shell en- D Viruses enter the host cell by endocytosis. -
closing the viral genome, and,
A membranous envelope (in some cases) —
HELP
The envelope is composed of phospholipids
and glycoprotein. Option A: It describes the life cycle of the
T4 bacteriophage. T4 Phage lytic enzymes
The combined structure formed by the ge-
(nucleases) hydrolyse the host cell DNA into
nome and capsid is called nucleocapsid.
small pieces of DNA.
Some viruses consist of no more than the
nucleocapsid and are called naked viruses. Option B: Host cells ribosomes are used
during the life cycle of all viruses to synthesis
viral proteins and not only by influenza virus.
Q2 Option C: This is applicable only for
Genetic recombination in bacteria leads to varia- retrovirus. Retrovirus contains reverse tran-
tion. scriptase, an enzyme that synthesizes DNA
from RNA template.
Which process leading to genetic recombination
in bacteria involves a virus? Option D: The influenza virus enters host cells
by receptor-mediated endocytosis.
A Conjugation
B_ Plasmid replication
C Transduction
D . Transformation
‘N’ Level 1000 Biology MCQ with HELPs ¢ 415 Frequently Examined Questions
Topic 3 Genetics of Viruses and Bacteria
Q4 DA hybrid virus with virus

tobacco mosaic virus protein.
Z DNA and
gp120 Bs
HELP
viral envelope
When the hybrid virus infect a cell, only it’s
p17 genetic material (RNA from a tobacco mosaic
p24 virus) will be transported into the cell’s cy-
protease Ay toplasm. The RNA from the tobacco mosaic
reverse transcriptase virus will then code for the synthesis of
tobacco mosaic viral components resulting
RNA
in the synthesis of more tobacco mosaic virus.
Q6
Virus X is a/an
A gene transfer occurred between two strains
A bacteriophage lambda. of bacteria. It was observed that cell-cell con-
B Orthomyxovirus. tact is NOT required, and a filter that removes
C herpes virus. viruses eliminates transfer. This would mean
that the transfer occurred by
D human immunodeficiency virus.
A conjugation.
HELP B transformation.
Human immunodeficiency virus has 2 copies C transposition.

of single-stranded RNA which is enclosed by D transduction.
a conical capsid. The capsid is in turn sur-
rounded by a plasma membrane. Within the
capsid are 2 molecules of enzyme reverse HELP
transcriptase. In order to enter the cell, the Option A: Conjugation requires cell-cell
glycoprotein 120 (gp120) on the HIV enve- contact. The donor bacteria cell produce an
lope must bind to a CD4 molecule on the appendage called sex pili to attach itself to
plasma membrane of the host cell. All of the the recipient bacteria cell to form a tempo-
above features are seen in the diagram rary cytoplasmic mating bridge between itself
above. and the recipient cell to provide an avenue
for gene transfer.
Option B: Transformation occurs when there
Q5
is uptake of naked, foreign DNA from the
The tobacco mosaic virus has RNA rather than surrounding environment by a bacterium. It
DNA as its genetic material. In a hypothetical requires neither cell-cell contact nor the
situation, RNA from a tobacco mosaic virus is presence of viruses.
mixed with proteins from a related DNA virus
Option D: Transduction is the process by
Z, resulting in a hybrid virus.
which bacterial DNA is transferred from one
If this hybrid virus were to infect a cell and bacterium to another by a virus eg. T4
reproduce, what would the resulting ‘offspring’ bacteriophage.
viruses be like?
A Tobacco mosaic virus.
B WiTtISE Za
CA hybrid virus with tobacco mosaic virus
RNA and virus Z protein.
WW Level 1000 Biology MCQ with HELPs ? 446 Frequently Examined Questions
Q7 Q9
(AEG) Viruses have some of the properties of living
A virus has a base ratio of E- organisms. Which of the following is a charac-
(U+C)
teristic of all organisms, but not of viruses?
What type of virus is this? A Ability to control metabolism.
A A single-stranded DNA virus. B Ability to reproduce.
BA double-stranded DNA virus. C Genetic information stored as nucleic acid.
CA single-stranded RNA virus. D Possess plasma membrane.
D_ A double-stranded RNA virus.
HELP
HELP A virus is a genome (complete set of genes)
The presence of U indicates a RNA virus. enclosed in a protein coat (capsid). The com-
bined structure formed by the genome and
A and G are purines while U and C are
capsid is called nucleocapsid. Some viruses
pyrimidines. When ratio of purines : pyrim-
consist of no more than the nucleocapsid,
idines = 1, this suggest that there is comple-
thus not all viruses have plasma membrane.
mentary base pairing between the bases.
Thus, this must be a double-stranded virus.
Q10
Qs Some events that take place during generalized
transduction are listed below
A group of scientists uses modified viruses as
vectors for the introduction of foreign genes into I Bacterial host DNA is fragmented.
bacteria. II Bacterial DNA may be packaged in a ph-
In one experiment, a bacteriophage was put age capsid.
together with the protein coat of T4 phage and III Recombination between donor DNA and
the DNA of a lambda phage. If this composite recipient DNA.
phage was allowed to infect bacteria, the ph-
IV Phage infects a bacterial cell.
ages produced in the bacteria will have
V Phage DNA and proteins are made.
A the protein of lambda phage and the DNA
of T4. Which sequence of events is correct?
B_ the protein of T4 and the DNA of lambda First ——— Last
phage.
AO TUL ie oT Tees ee
C the protein and DNA of lambda phage.
Boe sls oe Veen
D_ the protein and DNA of T4.
Ce SIs TLE Er eee iV pee ee
Dee Mie eee Le
HELP
When the composite phage was allowed to
infect bacteria, only the DNA of a lambda HELP
phage will be injected into the bacteria’s In generalized transduction, when a phage
cytoplasm. The DNA of the lambda phage undergoes the lytic cycle, the phage enzymes
will use the bacterium’s metabolic machinery hydrolyse the host cell’s chromosome into
and resources to synthesize lambda phage’s small pieces of DNA. During the assembly
DNA, enzymes and phage structural compo- of the phage genome within the phage
nents eg. protein coat resulting in the syn- capsid, a small piece of the host cell’s
thesis of more lambda phage. degraded DNA gets mistakenly packaged
within the capsid. This defective phage is D_ integration of virus DNA into host DNA
released. It can attach to another bacterium and during excision the viral genome car-
and inject the piece of bacterial DNA ac- ries along with it the host DNA to be as-
quired from the donor cell. The foreign sembled into the new virus.
bacterial DNA can then be incorporated into
the recipient cell’s DNA through homologous
recombination. HELP
In generalized transduction, when a phage
undergoes the lytic cycle, the phage enzymes
Q11 hydrolyse the host cell’s chromosome into
small pieces of DNA. During the assembly
Which process in bacteria always allows chro-
of the phage genome within the phage
mosomal and non-chromosomal DNA to be
capsid, a small piece of the host cell’s
transferred?
degraded DNA gets mistakenly packaged
A Binary fission within the capsid. This results in a defective
B Conjugation phage.
C Transduction
D ‘Transformation Q13
Which of the following viral structures are not
HELP completely coded by the virus’ own nucleic
acids?
Binary fission is the division of a single parent
bacterial cell into two genetically identical A Capsid
daughter cells. DNA replication of the chro- B_ Glycoprotein gp120 of HIV
mosomal and non-chromosomal (plasmid)
DNA occurs, followed by the newly synthe- C Viral envelope
sized DNA moving to opposite ends of the D_ Tail sheath of T4 bacteriophage
cell. After the completion of the chromosome
segregation, the plasma membrane starts to
invaginate and eventually divides the parent HELP
cell into two daughter cells. Each daughter Enveloped viruses have an envelope surround-
cell inherits a complete genome. ing the nucleocapsid. The envelope is com-
For conjugation, transduction and transfor- posed of phospholipids and glycoprotein. For
mation, only a small piece of the bacterium’s most viruses, the viral envelope is derived
DNA is transferred. from host cell membranes by a process called
budding. The envelope may come from the
host cell’s nuclear membrane, vacuolar
Q12 membrane (packaged by the Golgi appara-
tus), or outer cytoplasmic membrane. The
In Generalised Transduction, defective virus are virus does incorporate proteins of its own,
formed as a result of often appearing as glycoprotein spikes, into
A viral enzymes cutting the host DNA such the envelope.
that the host DNA is assembled into the
new virus.
production of host enzymes by virus which
nicks its own DNA such that it can be as-
sembled into the new virus.
no shut down of host DNA production
such that either host DNA or the virus
DNA can be assembled into the new virus.
Q14
The figure below shows the general structure
of a bacterial cell.
|
——<$<—<$<$—$___..
>
Use the letters on the diagram to identify the On

structures described below.
An E. coli cell, which carries a lambda
contains sites of | prevents contains prophage, is immune to g lytic infec-
advantageous | protein cell enzymes for tion by a second lambda virus because
genes synthesis lysis respiration A _ proteins from the prophage’s lytic
genetic program prevent replica-
tion of the second virus.
bo the second virus cannot inject its
's0)
Ze
Wael
qe) A
ADO DNA.
C proteins from the prophage’s
lysogenic genetic program prevent
HELP replication of the second virus.
P is the cell wall. Function: helps the bac- D the second virus cannot adsorb to
terium maintain its shape and protect the cell the cell.
from osmotic lysis.
Q is the ribosomes. Function: formation of HELP
polypeptides. (Ribosome is the site for pro- The e lambd ithi the
tein synthesis). lambda prophage within
E. coli contains a prophage gene
R is the Mesosome. Function: aids in com- that codes for a repressor protein
partmentalization and contains enzymes for that is able to represses most of
aerobic cellular respiration. the other prophage genes, inclu-
S is the plasmids. Function: contains advan- sive that of the second lambda
tageous genes that provide some benefits to virus. Hence, the expression of the
the bacterial cell e.g. genes encoding for second lambda virus’ genes con-
enzymes that inactivate antibiotics and make trolling lambda phage replication
the bacterial cells resistant to antibiotics. is blocked.
T is the bacterial chromosome, i.e. a double-
stranded circular DNA molecule.
‘N Level 1000 Biology MCQ with HELPs p 419 Frequently Examined Questions |
Q16 HELP
Generalized transduction requires
Which of the following correctly describes the
infection of a bacterium by a lytic
characteristics of a virus?
phage. In generalized transduc-
tion, any random portion of the
Ohitaate Involvement | Involvement Entry of bacterial DNA/any gene may be
amine of host of host cell nucleic acid
transferred.
P enzyme ribosomes into a cell
Specialised transduction requires
/ infection of a bacterium by a
J 4 temperate phage.
Specialised transduction is re-
/
stricted to bacterial genes adja-
cent to the integrated prophage
whereby only certain genes near the proph-
HELP age site on the bacterial chromosome is
Viruses are obligate intracellular parasites. transferred. Thus only certain portion of the
They can only survive and reproduce/repli- bacteria DNA/certain genes may be trans-
cate in the host cell, at the expense of the ferred.
host.
Viruses lack most of the structures and meta-
bolic machinery found in cells. Thus viruses
Q18
use the host cell’s enzymes for metabolism Viruses are classified according to several char-
and host cell’s ribosomes for protein synthe- acteristics, which includes all EXCEPT
sis. A DNA or RNA as the genetic material.
B single or double-stranded nucleic acids.
Q17 C circular or linear nucleic acid.
Generalized transduction is distinguishable from D presence or absence of metabolic machin-

specialized transduction by the fact that ery.
A generalized transduction may be used to
move any gene, whereas specialized trans- HELP
duction moves only certain genes.
All viruses are obligate intracellular parasites.
B- selective medium is required for This means that they cannot live indepen-
generalised transduction, whereas selective dently of its host. Viruses lack most of the
medium is not required for specialized structures and metabolic machinery found in
transduction. cells (i.e. they lack enzymes for metabolism
C donor DNA must be purified from the and ribosomes or other components for
donor for generalised transduction, whereas protein synthesis).
specialized transduction involves move-
ment of DNA by phages.
D_ generalized transduction is possible in
Q19
generally all organisms, whereas specialized During bacterial conjugation mediated by the F-
transduction is possible only in special plasmid, the function of the pilus is to
groups of organisms.
A synthesize the DNA single stranded prior
to transfer.
B_ draw the donor and recipient cells in con-
tact prior to DNA transfer.
Level 1000 Biology MCQ with HELPs ? 429 Frequently Examined Questions |
Topic 3 Genetics of Viruses and Bacteria |
C facilitate transfer of single-stranded

across the cell membrane.
DNA Q21
Which of the following would be the first step
D facilitate transfer of double-stranded DNA
in the biosynthesis of a virus with reverse tran-
across the cell membrane.
scriptase?
A Accomplementary strand of DNA must be
HELP synthesized from an DNA template.
In bacteria conjugation, the donor cells B Double-stranded RNA must be synthesized.
possess a segment of DNA called an F factor.
C Acomplementary strand of DNA must be
The F factor carries genes for sex pilus pro- synthesized from an RNA template.
duction. The sex pilus allows the donor cell
DA complementary strand of RNA must be
to attach itself to the recipient cell and forms
synthesized.
a temporary cytoplasmic mating bridge
between itself and the recipient cell. This
provides an avenue for the donor cell to HELP
transfer its F plasmid to the recipient cell. The function of reverse transcriptase is to
During the transfer, a single strand of F plas- catalyse the synthesis of a DNA strand
mid breaks at a specific point and moves |] complementary to viral RNA template. This
of the strands across the mating bridge, into strand is termed as cDNA.
the recipient cell.
Q22
Q20 Which of the following statements about bacte-
Bacterial Strain A has been infected with vi- ria is true?
ruses. Upon lysis, the virions produced are A Bacteria possess 80s ribosomes, introns and
introduced to Bacterial Strain B. After a short RNA processing.
period of time, a new strain of bacteria is de-
B_ Bacteria possess 70s ribosomes, introns and
tected that is very similar to Strain A but has
no RNA processing.
a few characteristics of Strain B. Which is the
process that leads to the production of the new C Bacteria possess 70s ribosomes, no introns
strain? and no RNA processing.
A Transduction D_ Bacteria possess 80s ribosomes, RNA pro-
cessing and no introns.
B_ Transposition
C Transformation
HELP
D Conjugation Prokaryotes, i.e., bacteria possess 70s ribo-
somes, no introns and no RNA processing.
HELP Only eukaryotes possess 80s ribosomes, has
non-coding DNA sequences such as introns
As the new strain of bacteria detected is very and requires RNA processing.
similar to Strain A but has a few character-
istics of Strain B, this indicates that genetic
recombination has taken place. The three pro-
cesses that lead to genetic recombination are
transduction, transformation and conjugation.
Of these three processes, only transduction
requires the presence of viruses.
4 Level 1000 Biology MCQ with HELPs 424 Frequently Examined Questions
Q23 Q25
What is present in a bacteriophage but not in Which of the following statements about the life
an influenza virus? cycle of the Human Immunodeficiency Virus are
FALSE?
A DNA B= RNA
I The HIV particles recognise the host cell
C Glycoprotein D_ Viral capsid
through the sialic-acid containing proteins
or lipids on the membrane of the host cell.
HELP II Upon entry of the HIV into the host cell,
The influenza virus is an enveloped virus with a drop in pH will result in a conformational
an RNA nucleocapsid. The influenza genome change in the HIV structure, consequently
is organised into 8 pieces of single stranded releasing the viral genome into the host
RNA and the genes in the RNA segments are cell.
used as a template for mRNA production. It III The viral DNA which enters the host cell’s
has 2 types of protein spikes — Hemagglu- nucleus will be integrated into the genetic
tinin and Neuraminidase projecting from the material of the host cell using the host
outer surface of the envelope. Thus of all the cell’s enzyme, integrase.
above options, only DNA is missing in an
IV. The viruses are released from the host cell
influenza virus.
by exocytosis.
A J and If
Q24 Bo cand IV
During a viral infection, attachment is usually © 1, Ul and Iv
specific to a particular cell type because
D_ All of the above
A the virus is attracted to the appropriate host
cells by proteins secreted into the extra-
cellular fluid. HELP
B_ the virus recognises and binds to specific Statement | & Il: The glycoprotein 120 on
molecules in the cytoplasm of the host cell. the HIV envelope must attach to both a CD4
C the virus recognises and binds to specific molecule and a chemokine receptor. The
molecules on the surface of the host cell. interaction between gp120 and chemokine
receptor brings about a conformation change
D _ the host cell produces channel proteins that in gp41 on the HIV virion, allowing the fusion
provide passageways for the viruses to of the HIV envelope and host cell membrane.
enter the cytoplasm. The fusion allows the nucleocapsid to enter
the host cell. The capsid is removed by cellular
HELP enzymes and the viral RNA genome and
various enzymes is released into the host cell.
Specific strains of viruses can only adsorb to
specific hosts cells. This is known as viral Statement Ill: The viral DNA which enters the
specificity. This is because specific glycopro- host cell’s nucleus will be integrated into the
tein spikes are present on specific virus and genetic material of the host cell using the
these glycoprotein spikes function in attach- HIV virus’s enzyme, integrase and not the
ing the virus to specific surface receptor host cell’s enzyme.
molecules on membranes of specific suscep- Statement IV: The viruses ‘bud’ from the host
tible host cells. cell’s plasma membrane and are not released
by exocytosis.
Q26 Which of the following best describes what

happens in the presence of lactose?
Which statement correctly describes the control ! ;
of transcription of the genes involved in the Rees be cco nec eae maane’ 176
breakdown of lactose in Escherichia coli? operator.
A A repressor protein binds to the operator BY “Transcription iss prevented:
and the genes are switched on. OD The repressor cannot bind to the operator.
BA repressor protein binds to the operator D RNA polymerase cannot bind to the op-
and the genes are switched off. eron.
C A transcription factor binds to the promoter
and the genes are switched on. HELP
D A transcription factor binds to the promoter When lactose enters the cell and is cleaved
and the genes are switched off.
by £-galactosidase into allolactose.
Allolactose binds to the lac repressor. The
HELP repressor changes its conformation and
The lac operon consist of: becomes inactive. It is unable to bind to the
operator. RNA polymerase is able to bind to
Promoter: binding site of RNA polymerase the promoter, and able to transcribe the three
Operator: binding site of the lac repressor structural genes of the operon. £ -galactosi-
protein
dase, lac permease and £-galactoside
CAP Binding Site: binding site of catabolite transacetylase are produced.
activator protein
3 structural genes: lac Z, lac Y and lac A
When lac repressor protein is synthesised in Q28
its active conformation, it binds to the op- An mRNA molecule transcribed from the lac
erator and the operon is switched off. That operon contains nucleotide sequences comple-
is, the 3 structural genes are switched off. mentary to
A structural genes coding for the enzymes.
Q27 the operator region.
The figure below is a diagram of the lac op- the promoter region.
eron. This structure explains the mechanism of caethe repressor gene.
gene expression in the presence of lactose in E.
coli.
Promotor
for Promotor ‘¢———___——- Structural loci———————_>
regulatory for
gene lac operon:
Structural
Regulatory Operator gene for Structural Structural |
gene | B-galactosidase ae te ; gene for ees
B-galactoside -galactoside
permease transacetylase;
<< ——___—_—_——_— lac Operon ———_____>
‘NV Level 1000 Biology MCQ with HELPs p 123 Frequently Examined Questions
HELP HELP
Only the structural genes of an operon are Tryptophan functions as a co-repressor, a
transcribed into mRNA molecule. Structural small molecule that binds with a repressor
gene is a region of DNA that codes for a protein to switch an operon off. The binding
protein or RNA molecule that forms part of of a tryptophan molecule to the trp repressor
a structure or has an enzymatic function. In changes the conformation of the trp repres-
< the case of lac operon, the structural genes sor to an active conformation which is able
are lac Z, lac Y, lac A which codes for #- to bind to the operator and prevents RNA
polymerase from binding to promoter and
galactosidase, lac permease and /# -galac- transcribing the genes of the trp operon.
toside transacetylase respectively.
Q29 Q31
What are the correct characteristics for a A repressible operon, such as the
prokaryotic genome? trp operon, is ‘off’ when
A the gene that codes for the
DNA always Repeat repressor is expressed con-
Plasmids
bound to sequences stitutively.
Promoters often
histone absent or
present B_ the repressor-corepressor
proteins uncommon
complex binds to the opera-
tor.
C the repressor binds to struc-
tural genes.
D_ the corepressor binds to
RNA polymerase.
HELP HELP
In prokaryotes, the DNA complexes with The trp repressor is synthesised in its inactive
nucleoid-associated proteins (H-NS proteins) conformation which is unable to bind to the
and not histone proteins. In addition to the operator and hence the trp operon is tran-
bacterial chromosome, many bacterial also scribed. Tryptophan functions as a co-repres-
have one or more extrachromosomal plas- sor, a small molecule that cooperates with
mids which contain a small number of genes a repressor protein to switch an operon off.
which, are not necessary for survival, but may The trp operon is repressed in the presence
confer selective advantages. Repeat se- of tryptophan.
quences are absent or uncommon in prokary-
otes and are normally found in eukaryotes. When tryptophan is present in the medium
surrounding the bacterium, the binding of a
tryptophan molecule to the trp repressor
Q30 changes the conformation of the trp repres-
sor from an inactive to an active conforma-
The trp operon lowers the rate of transcription tion which is able to bind to the operator
when and prevents RNA polymerase from binding
A the repressor binds to RNA polymerase. to promoter and transcribing the genes of
the trp operon.
B__ the repressor binds to the structural gene.
C tryptophan binds to the repressor.
D tryptophan binds to the promoter.
|
Q32 Q33
A mutation of the Jac repressor protein renders Which of the following is false regarding the
it being unable to bind to allolactose. When E. bacterial chromosome?
coli is being grown and incubated in a medium
A It consists of a single, circular DNA mol-
with only lactose, what will be the effect of this
ecule.
mutation on the bacteria population after 16
hours? B_ DNA replication begins at the origin of
replication.
A Remain constant.
C Its centromeres uncouple during metaphase
B Increase slowly.
of mitosis.
C_ Increase exponentially.
D_ It is highly folded within the cell.
D Decrease sharply.
HELP
HELP Centromeres are only found in eukaryotic
lac repressor is synthesised in its active con- chromosomes and not in prokaryotes.
formation and binds to the operator. As the
lac repressor protein is unable to bind to
allolactose, it remains in its active conforma- Q34
tion. Thus, RNA polymerase is unable to bind
If the trp operon were unable to produce any
to the promoter, and unable to transcribe the
enzymes regardless of the presence or absence
genes of the lac operon. £ -galactosidase, of the amino acid tryptophan, what could be
lac permease and £ -galactoside transacety- the likely reason for this?
lase are not produced. A Tryptophan is always bound to repressor.
As there is an absence of £ -galactosidase, B Operator sequence has been deleted.
lactose is not hydrolysed into glucose and C Repressor is unable to bind to operator.
galactose. The bacteria population is unable D_ trp R has been deleted.
to use the respiratory substrates as source of
energy for growth. Thus the population will
decrease sharply. HELP
Option B, C and D will result in the con-
tinuous transcription of the trp operon, as
the RNA polymerase will be able to bind to
the promoter and carry out transcription. This
will lead to the continuous production of the
enzymes.
Only option A turns off the trp operon and
prevents RNA polymerase from carrying out
transcription.
W Level 1000 Biology MCQ with HELPs / 425 Frequently Examined Questions |
Q35
trp1 to 5 (shaded in diagram) are five genes
coding for five different enzymes involved in
tryptophan synthesis in yeast cells.
trp1 trp4 kb
i ‘
trp2
4s
trp5
n
trp3
Transcription and
RNA processing
*
li ie
|Translation
- 3 fh gS Z.
Proteins — os _
What difference could we expect in the organi-

zation of the trp genes in a bacterial cell?
A Each trp gene would be on a different
circular chromosome rather than a linear molecule and controlled by the same pro-
chromosome. moter and operator.
B_ Each trp gene would have their own pro- Option C: The mRNA transcribed is a poly-
moter and terminator. cistronic mRNA
C trp genes would produce polycistronic
Promoter Terminator
mRNA. Genes of operon
Pie
D trp genes would give rise to more types of “™ Erer ape
Operator
tp iets tpA | LAY
mRNA. y a
\
} ‘ \ 1
HELP Ew
(eee ee gt ee eee
aaa ee : . ; Polypeptide subunits that make up
Option A: There is only circular chromosome enzymes for tryptophan synthesis
in a bacteria cell.
Option B: All the trp genes are arranged in Option D: The trp genes would not give rise
an operon. An operon is a cluster of genes to more types of mRNA.
that make up a single transcription unit i.e.
these genes are transcribed as a single mRNA
‘ Level 1000 Biology MCQ with HELPs y 426 Frequently Examined Questions
f
TOPIC
4 Organisation and Control of Prokaryotic and |

Eukaryotic Genome
ach
Qi C Some of the introns and exons are re-

moved, so that the remaining exons and
Which of the listed features are characteristic introns can be translated.
of a eukaryotic genome?
D_ All the exons and introns are translated.
1. circular DNA
2. DNA associated with histone
HELP
3. DNA may be transferred to new cells by
mitosis
Through the mechanism called RNA splicing,
introns that are interspersed within pre-mRNA
A 1 only are excised and removed while the exons are
B 2 only spliced together. The exons are expressed by
translation into polypeptide.
C dand 3
D 2 and 3
Q3
HELP When a person undergoes a stressful experience,
the immune system can be depressed too and
Statement 1: Each eukaryotic chromosome
become more susceptible to infection. Some of
consists of one linear, double-stranded DNA.
the elements involved in this chain of events
Statement 2: Two major types of proteins are shown in the diagram below.
(histones and non-histones) are associated
with DNA of eukaryotes.
stress causes brain to produce
Statement 3: In mitosis, DNA is replicated adrenocorticotrophic hormone (ACTH)
before the cell divides. At the end of mitosis,
the dividing cell transmits copies of its DNA
to its daughter cells. ACTH binds to cells of adrenal cortex,
causing synthesis of enzymes that
make the steroid hormone cortisol
Q2 y
One stage during protein synthesis in eukary- cortisol enters white blood cells and
otic cells involves preliminary mRNA, known induces synthesis of TCF protein
as pre-mRNA. The pre-mRNA is made up of
exons and introns.
y
TCF suppresses expression of interleukin 2,
What describes the next stage in the process?
a chemical that helps fight infection
A All the exons are removed, so that the
introns can be translated. Which combination correctly shows the genes
B’ All the introns are removed, so that the that have transcription-enhancing factors bound
exons can be translated. to their control elements during the above se-
quence of events?
Topic 4 Organisation and Control of Prokaryotic and Eukaryotic Genome
HELP
gene for gene gene for
ACTH for 1CE interleukin 2 Alternative splicing takes place only in the
eukaryotic nucleus before the mRNAs are dis-
eee patched to the cytoplasm.

Only prokaryotic genes are organised into
operons. An operon is a cluster of structural
N\ genes that make up a single transcription
unit i.e. these genes are transcribed as a
single mRNA molecule and controlled by the
HELP same promoter and operator.
Transcription-enhancing factors bind to the DNA methylation is catalyzed by DNA
control element, the enhancers, of the genes. methyltransferase on the DNA of eukaryotes.
Binding of transcription-enhancing factor to A repressor protein is specific for the opera-
enhancer accelerates the assembly of a tran- tor of a particular operon in the prokaryotes.
scription initiation complex at the promoter
and increases the rate of transcription of the
gene. This results in the synthesis of a spe- Q5
cific protein.
Seeds from a pure breeding plant were planted
From the diagram, there is increase produc- in identical pots of compost and watered regu-
tion of ACTH, the enzymes that make the larly. Sets of ten pots were placed in different
steroid hormone cortisol and TCF protein, light conditions and left until the first leaves
while there is a decrease in the production had developed.
of interleukin 2. This suggests that only the
genes for ACTH and TCF have transcription- The table shows the mean height for the young
enhancing factors bound to their control stems, mean length of first leaf and the colour
elements — enhancer. of the leaves.
dim ae
Q4 light light light
Four different genes are regulated in different mean
ways. height /cm
Gene 1 undergoes tissue-specific patterns of
alternative splicing. Gene 2 is part of a group length /cm
of structural genes controlled by the same regu-
latory sequences. Gene 3 is in some circum- colour pale | dark
stances subjected to methylation. Gene 4 codes of leaves yellow | green | green
for a repressor protein which acts at an opera-
tor site close by. Which explains the effect of light on the phe-
notype of the young plants?
Which row of the table correctly identifies
which genes are prokaryotic and which are A The activity of genes involved in chloro-
eukaryotic? phyll synthesis and stem growth varies
with light intensity.
prokaryotic eukaryotic
B_ The activity of genes involved in stem and
A 1 and 2 3 and 4
leaf growth is decreased by light.
Bs. deands3 2 and 4
C The genes involved in chlorophyll synthe-
Gaiio2 ands3 1 and 4 sis and stem growth are activated by light.
D 2 and 4 tance D_ The genes involved in chlorophyll synthe-
sis and stem growth are inactivated by
light.
¥ Level 1000 Biology MCQ with HELPs ? 428 Frequently Examined Questions
Topic 4 Organisation and Control of Prokaryotic and Eukaryotic Genome |
HELP @7
From the table, as light intensity increase from
The diagram represents the region of DNA that
no light to bright light, the colour of leaves
changes from pale yellow to dark green. The codes for £ haemoglobin.
green in the leaves is a result of the presence mien
of chlorophyll. This suggests that the gene intron
involved in chlorophyll synthesis increases in Bee
activity as the light intensity increases.
From the table, as light intensity increase from Which statement about the transcription and
no light to bright light, the mean height of translation of exons and introns is correct?
the stem decreases from 8 cm to 4 cm. This A Exons and introns are both transcribed but
suggests that the gene involved in stem growth only the exons are translated.
decreases in activity as the light intensity B_ Exons and introns are both transcribed but
increases. ;
only the introns are translated.
C Only the exons are transcribed and trans-
Q6 lated.
These statements describe types of DNA D Only the introns are transcribed and trans-
lated.
1. DNA with two 5’ and two 3’ ends
2. DNA not packaged with proteins
HELP
3. coding DNA interrupted by non-coding ee ve
DNA Transcription is the synthesis of an mRNA
molecule with a base sequence complemen-
4. DNA with no 5’ and 3’ ends tary to a gene which specifies the amino acid
Which combination of statements describes the sequence of polypeptides and proteins. Most
DNA characteristics of a eukaryotic genome? eukaryotic genes and their pre-mRNA have
\ oer aD long non-coding stretches of nucleotides
(introns) that are not translated.
Bre -and’3 j ;
Most of these introns are interspersed be-
C 2 and 3 tween coding segments (exons) of the gene,
D 2and4 and thus between coding segments of the
pre-mRNA.
HELP Through a mechanism called RNA splicing,
a introns that are interspersed within RNA tran-
Each eukaryotic chromosome consists of one script are excised and exons are spliced to-
linear DNA complexed with proteins — his- gether. The exons are expressed by transla-
tones and non-histones. The DNA consists of tion into polypeptide.
two DNA chains coil round each other to
form a double helix. Each chain has two
distinct ends: a 3' end and a 5' end. The
proteins help to pack the DNA into highly
compact structures. Eukaryotic chromosome
has coding sequence (exons) interspersed with
non-coding DNA sequences (introns).
‘N Level 1000 Biology MCQ with HELPs v,429 Frequently Examined Questions
Q8 Q10
What are the correct characteristics for a What prevents simultaneous
prokaryotic genome? transcription and translation
in eukaryotes?
DNA always Plasmids Repeat A The absence of three
; Promoters | bound to histone | often | sequences absent different RNA poly-
f proteins present or uncommon merases.
J B- The lack of gene clus-

ters into operons.
C The nuclear membranes
around DNA.
D_ The requirement to re-
move exons.
HELP
Option A: Plasmids are often present in HELP
prokaryotes and repeat sequences are ab-
In eukaryotes, transcription occurs in the
sent or uncommon in prokaryotes.
nucleus while translation occurs in the cyto-
Option B and C: Prokaryotic genome is not plasm. The matured mRNA has to be trans-
complexed with proteins — histones and non- ported to the cytoplasm for translation to take
histones. place. This is because, in eukaryotic cells,
the translation machineries are found in the
cytoplasm and are separated from the nucleus
Q9 by the nuclear membrane.
Promoters and control elements work together
to regulate transcription. What shows the pos-
sible locations of these in relation to a transcrip- Q1 1
tion start site on the DNA molecule? Transcription in eukaryotes may involve the use
promoters control elements of an enhancer.
A downstream distal or proximal What describes the role of an enhancer?
B upstream distal or proximal A It is a binding site for an activator protein.
C distal or proximal downstream B_ It is a gene that increases the production
D__ distal or proximal upstream pila aetraton Beot ar
C It is a promoter that increases the activity
HELP of RNA polymerase.
The promoter is made up of a basal pro- D_ It is a protein that activates a specific

promoter.
moter which is usually located within 40 base
pairs from the transcription start site, and an
upstream promoter (proximal control element) HELP
which may be located as far as 200 base Enhancers are positive regulatory elements
pairs from the transcription start site.
(segments of non-coding DNA that help
Control elements can be divided into two regulate transcription of a gene) that can be
kinds, depending on the distance from the located upstream, downstream of start site
basal promoter: proximal control elements or even within the gene they control. An
and distal control elements. Enhancers and enhancer region may contain one or more
silencers are distal control elements. elements recognized by transcriptional acti-
vator proteins.
| Level 1000 Biology MCQ with HELPs ? 430 Frequently Examined Questions
|
O12 HELP
The production of functional mRNA is con- Option A is the transcription start site.
trolled by a series of enzymes. Option B & C are the exons.
Which enzyme catalyses the removal of introns Option D is special sequence of bases in the
during the production of functional mRNA? DNA template called a terminator. This se-
quence signals the RNA polymerase to stop
DNA the transcribing process.
unzipped to
expose two
strands Q14
[aa A A region of eukaryotic DNA consists of over fifty
repeats of the same sequence of twelve bases.
transcribed Where is this repetitive region least likely to be
mRNA found?
produced
A an exon
(pre-mRNA)
Ban intron
enzyme B
Ca polymerase binding site
spliced mRNA D _ satellite DNA
(mature mRNA)
enzyme C HELP
functional eon polyadenylated An exon is the coding segment of the gene
mRNA mRNA that is eventually translated into amino acid
sequences. Repetitive region are least likely
to be found in the exon.
HELP
Enzyme B: spliceosome (a complex of pro-
teins and small nuclear RNA). Pre-mRNA
undergoes RNA splicing by spliceosome to
become matured mRNA.
Q13
The diagram shows the processing of transcribed
pre-mRNA from a eukaryote.
At which part of the DNA molecule does tran-
scription start?
Q15 Q16
The diagram represents the processing of pre- Which of the following is NOT true
messenger RNA. about cancerous cells?
A ability to divide for a certain
DNA number of times
B_ ability to divide further when in
pre-mRNA contact with neighbouring cells
q
C inability to differentiate properly
T
D_ inability to exhibit anchorage
dependence
S
HELP
mRNA Cancer is a condition of uncon-
t
trolled proliferation of cells. Can-
During the processing of pre-messenger RNA cerous cells are able to divide
each of the listed events occurs. infinitely.
1. capping
2. polyadenylation Q1 7
3. splicing What causes cancer in cells?
4. transcription I Damage to genes
5. translation II Chemical damage to cell membranes
Which correctly identifies the processes p, q, 1, IIJ_ UV damage to transport proteins
s and t?
A I only.
Dae aca BI only.
Se aa CI and III only.
a a D All of the above.
C 5 Me il 3 eb
D «4 2 1 3 5 HELP
Cancer occurs as a result of:

HELP
mutations in proto-oncogenes, tumour
Event p is transcription. It is the synthesis of suppressor genes and genes leading
an mRNA molecule with a base sequence to the activation of telomerase
complementary to a section of DNA.
2) aberration of genes that regulate
Event q is capping. apoptosis
Event r is splicing. The introns that are in- 3) sustained angiogenesis
terspersed within pre-mRNA are excised and 4)
tissue invasion and metastasis
removed while the exons are spliced together.
Event s is polyadenylation. An enzyme adds
a poly-A tail to the 3’ end of the mRNA.
Event t is translation.
X Level 1000 Biology MCQ with HELPs % 439 Frequently Examined Questions
Q18 HELP
All of the following scenarios describe gene Activation of proto-oncogene produces pro-
amplification except for tein products that stimulate cell division in a
normal cell.
A During amphibian development, millions of
additional rDNA exist as circular DNA in Tumour suppressor gene inhibits cell division
nucleoli separated from the chromosomes. in a normal cell to prevent inappropriate
growth. Inactivation of tumour suppressor
B__Proto-oncogene replicates many copies of gene leads to absence of suppression.
itself resulting in excessive amount of
normal growth-stimulating protein. Inactivation of programmed cell death gene
cause cells to evade programmed cell death,
C _-Proto-oncogene duplicates itself and trans-
even when the cells are irreparably damaged,
poses to a new locus under new gene regu- making them immortal.
latory control system.
All of the above allows the cells to maintain
D_ Primers that flank a portion of DNA se-
proliferation leading to the development of
quence, oligonucleotides, Taq polymerase cancer.
are added to a reaction mixture and put
through cycles of three different tempera-
tures. Q20
Which of the following protein groups contain
HELP examples of oncogene products?
Gene amplification refers to the process by (i) transcription factors
which a cell specifically increases the num-
(ii) cell surface receptors
ber of copies of a particular gene to a greater
extent, without a proportional increase in the (iii) peptide hormones
number of copies of other genes composing (iv) protein kinases
the remainder of the genome. These ampli-
A (i) and (iv)
fied genes can be transcribed and translated,
leading to an overproduction of the corre- B_ (ij, (ii) and (iii)
sponding mRNAs and proteins. C (ii) and (iv)
In option C, there is only 1 addition copy D All of the above
of the proto-oncogene and there is no over-
production of the corresponding protein.
HELP
Proto-oncogenes undergo mutation to be-
Q19 come oncogenes. Proto-oncogenes code for
proteins that stimulate normal cell growth and
The table shows changes that may occur to
division. These gene products include tran-
genes associates with the development of can-
scription factors, growth factors such as
cer.
peptide hormones, cell surface receptors such
Which combination of changes leads to the as growth factors receptors, protein kinases,
development of cancer? inhibitors of apoptosis, etc.
proto- tumour programmed

oncogene | suppressor gene | cell death gene
activated activated activated

activated inactivated inactivated
inactivated activated activated
inactivated inactivated activated
Level 1000 Biology MCQ with HELPs ie133 Frequently Examined Questions
Q21 Some viruses when introduced into cells have

the ability to transform a benign cell to a
Which of the following is NOT a mechanism malignant cell via the integration of the viral
whereby a proto-oncogene is converted to an nucleic acid into the DNA of host cell.
oncogene?
Mutations in Ras proto-oncogene to become
A methylation of bases Ras oncogenes. Mutated Ras protein increase
‘B-point mutation cell division even in the absence of growth
factors resulting in cancer formation.
C gene transposition
D chromosome translocation
Q23
HELP Which of the following statements
proto-oncogenes is FALSE?
concerning
Mechanisms whereby a proto-oncogene is
converted to an oncogene includes: A They can code for proteins associated with
cell growth.
1) Point mutation in a proto-oncogene —
A point mutation can change the gene’s B They are produced by somatic mutations
protein product to one that is more induced by carcinogenic substances.
active or more resistant to degradation C They can be involved in producing proteins
than normal protein. for cell adhesion.
2) Gene transposition or chromosome D They can code for proteins involved in cell
translocation — Translocation of either division.
the gene or promoter within a chro-
mosome. The translocation can result
in the proto-oncogene to be situated HELP
adjacent to an active promoter, result- Proto-oncogenes code for proteins that stimu-
ing in increased transcription of the late normal cell growth and division. These
gene and hence overproduction of the gene products include transcription factors,
protein.
growth factors such as peptide hormones,
cell surface receptors such as growth factors
ayy receptors, protein
apoptosis, etc.
kinases, inhibitors of
Which of the following does NOT lead to can- Oncogenes and not proto-oncogenes are
cer formation? produced by somatic mutation.
A Both tumour suppressor alleles are knocked
out by mutation.
B_ Infection by viruses.
Q24
C Gene for telomerase is inactivated. Control of gene expression in eukaryotes in-
cludes all of the following EXCEPT
D Production of Ras oncogene.
A alternative splicing of RNA transcripts.
B transcription factors.
HELP C feedback inhibition of enzyme activity by
Mutations in both tumour suppressor genes allosteric control.
lead to the decrease in the activity of tumour
suppressor proteins. This results in cancer as DNA methylation.
growth is stimulated when there is absence
of suppression.
N Level 1000 Biology MCQ with HELPs 7 434 Frequently Examined Questions
HELP
Q26
Gene expression in eukaryotes is controlled
Closely-coupled transcription-translation is pos-
at:
sible in prokaryotes because
1) chromatin level via Chromatin modi-
A there is no nuclear membrane separating
fication such as histone acetylation and
the prokaryotic DNA from the cytoplasm.
DNA methylation
B_ the prokaryotic genome is more complex
2) transcriptional level through the activ-
than the eukaryotic genome.
ity of regulatory transcriptional factors
C the methylated 5' guanine end of prokary-
3) post-transcriptional level e.g. 5’ cap-
otic mRNA is transcribed first.
ping, poly-A tailing and pre-mRNA
splicing D there is an absence of an origin of repli-
cation.
4) translational e.g. half life of RNA, ini-
tiation of translation, and
5) post-translational level e.g. biochemi- HELP
cal modification and protein degrada- In prokaryotes, control of transcriptional ini-
tion tiation is the major point of regulation. This
is due to the absence of a nuclear envelope
in prokaryotes which allows concurrent tran-
Q25 scription and translation to occur.
The major control of gene expression in mam-
malian cells is
A effected through different levels of
Q27
polyadenylation of the mRNA. Which of the following is an example of a
possible step in the post-transcriptional control
Bat the transcriptional level. of gene expression?
C at the translational level. A Gene amplification during a stage in de-
Dat the post-translational level. velopment.
B The removal of introns and splicing to-
HELP gether of exons.
The major control of gene expression in mam- C The binding of transcription factors to a
malian cells is at transcriptional level through promoter.
the activity of regulatory transcriptional fac- D_ The addition of methyl groups to cytosine
tors. Transcription factors is able to gain bases of DNA.
access to and bind to their target sequences
in the basal promoter region, transcription
also involves and depends on the activity of HELP
regulatory transcriptional factors. Post-transcriptional control of gene expres-
sion includes 5’ capping, poly-A tailing and
pre-mRNA splicing. In pre-mRNA splicing,
removal of introns and splicing together of
exons occurs.
Topic 4 Organisation and Control of Prokaryotic and Eukaryotic Genome ]
Q28 What is the length (in nucleotides) of the wild-

type f-globin primary RNA transcript (pre-
Which of the following statements concerning
telomeres is/are true? mRNA) and how many amino acids are present
in the wild type #-globin protein?
A Telomeres are made up of a repetitive DNA
sequence at the ends of each chromosome.
Length of No. of amino
B_ Telomeres protect cells from losing vital f-globin primary acid in wild-type
chromosomal DNA sequences during DNA RNA transcript /-globin protein
replication.
C Telomeres are lost in cells that don’t ex-
press telomerase, limiting the number of
cell divisions a cell can undergo.
HELP HELP
Option A: Telomeres are made of tandem To calculate the length of the wild-type £-
repeats of 5' TIAGGG 3' minisatellites. The globin primary RNA transcript (pre-mRNA),
repeat sequence is hundreds to as many as sum up all the length of nucleotides of all
2000 repeats of the six nucleotide sequence. the introns and exons.
Option B: Telomeres prevent lost of genes
50 4°90.+ 130 4+:222 + B50 + 126-- baz
as the DNA shortens with each round of DNA = 1600
replication.
To calculate the number of amino acids
Option C: Inability of DNA polymerase to
replicate to the end of chromosome. Hence present in the wild type -globin protein,
in cells that don’t express telomerase, telom- sum up all the length of the length of
eres shorten with each round of DNA rep- nucleotides of all the exons, beginning with
lication. Telomeres that are critically short the exon with ATG (which will code for AUG-
trigger apoptosis (programmed cell death), start codon) and stopping before the exon
hence limiting the number of cell divisions with TAA (which will code for UAA-stop
a cell can undergo. codon).
(90
+ 222 + 126) /3 = 146
Q29
Shown in the figure below is the genomic struc-
ture of the wild-type human / -globin gene. The
numbers within the boxes indicate the length
of nucleotides of each region, INCLUSIVE of
bases stated in the diagram. The DNA sequences
corresponding to the start codon and the stop
codon are indicated.
= = introns
= exons
850 CCA |:
ee
‘X Level 1000 Biology MCQ with HELPs / 436 Frequently Examined Questions
Q30 HELP
A gorilla mRNA differs from E. coli mRNA in In protein synthesis, transcription occurs where
that ribonucleotides join with exposed DNA bases
and form a molecule of pre-mRNA. This is
A the 5’ end of the gorilla mRNA is pro- followed by post-transcription modification,
cessed.
5’ capping, poly-A tailing and pre-mRNA
B_ the 3’ end of the E. coli mRNA is pro- splicing of pre-mRNA to mature mRNA. The
cessed. mature mRNA leaves the nucleus. Transla-
C_ only the gorilla mRNA contains a start tion next takes place where tRNA molecules
codon. bring specific amino acids to the ribosome
and peptide bonds formed between amino
Di only the gorilla mRNA can be translated acids. Translation occurs till one of the stop
into a polypeptide. codon is in the A site of the ribosome. Release
factor will bind to the stop codon of the
HELP mRNA and iranslation stops.
In prokaryotes eg. E. coli, there is absence

of post-transcriptional control of gene expres- Q32
sion 1) 5’ capping, 2) poly-A tailing and 3)
pre-mRNA splicing. Both prokaryotes and Which of the following statement about chro-
eukaryotes (such as gorilla) mRNA contains mosome structure is true?
a start codon and can be translated into a 1 Linker DNA refers to the linear double-
polypeptide. stranded DNA between adjacent nucleo-
somes.
Q31 2 The 30 nm chromatin fibre has a solenoid

structure.
The table below shows some of the events 3 The 300 nm chromatin fibre is attached to
which take place in protein synthesis. multiple locations on a central protein
1 tRNA molecules bring specific amino ac- scaffold.
ids to the ribosome. 4 Euchromatin is the more diffuse region of
2 Ribonucleotides join with exposed DNA the interphase chromosome and is tran-
bases and form a molecule of mRNA. scriptionally inactive.
3 Release factor binds to mRNA. A 1 and 2 B 1 and 4
4 Peptide bonds formed between amino ac- C 2 and 3 D 3 and 4

ids.
o1 mRNA molecule leaves the nucleus. HELP
6 mRNA undergoes capping and addition of Nucleosome is the most basic level of DNA
poly{A) tail. packing in eukaryotes. DNA wound around
a histone octamer consisting of 2 molecules
List down the correct sequence of occurrence
of H2A, H2B, H3 and H4 each to form a
of these events.
nucleosome.
A 2 Ol 4.3
Statement 1: Individual nucleosomes are
B 265143 connected by strands of linker DNA and H1
Cc 265134 histones to give a nucleohistone complex.
D 2 >. G13 4 Statement 2: With the aid of H1 hist ones,

the siring of nucleosomes coils to form a 30
nm wide chromatin fibre that has a solenoid
structure.
Statement 3: The 30 nm chromatin fibre folds Q34

to form looped domains (300 nm chromatin
fibre) that are attached to a base of scaf- Which of the following is false regarding the
folding proteins (non-histones). bacterial chromosome?
Statement 4: Euchromatin refers to the re- A It consists of a single, circular DNA mol-
gions of chromatin that are loosely packed. ecule.
Genes within these regions are transcription- B DNA replication begins at the origin of
ally active and can be expressed. replication.
C Its centromeres uncouple during metaphase
of mitosis.
Q33
D It is highly folded within the cell.
As shown in the diagram below, acetylation of
histones promotes loose chromatin structure.
Recent evidence has shown that chemical modi- HELP
fications of histones play a direct role in regu- A centromere is the specialized constricted
lation of gene transcription. Suggest how this region on eukaryotic’s chromosome where
works. two sister chromatids are joined in a repli-
cated chromosome.
Histone
Acetylase
os
a
Histone Histone tails
Deacetylase
A Helicase action is enhanced with acetyla-

tion of the histones. Q35
B_ Acetylation of histone tails neutralises their Which of the following structures of a eukary-
negative charges and encourage binding of otic chromosome is not primarily composed of
DNA polymerase I. DNA?
C When nucleosomes are highly acetylated, A telomeres
the chromatin becomes less compact and
DNA is more accessible for transcription. B origin of replication
D_ RNA polymerase work better by binding to C kinetochore
acetylated groups. D centromeres
HELP HELP
When histones of a nucleosome are acety- The DNA in the centromeric region is often
lated, the affinity of histone for DNA is heavily methylated and includes satellite se-
reduced. The histones change shape and quences. They consist of specific DNA se-
results in the loosening of histone complex quences to which a number of centromere-
from DNA. As a result, transcription factors associated proteins bind, forming a special-
have easier access to genes in the acetylated ized structure called the kinetochore.
region and increasing the rate of transcrip-
tion.
Q36
Which of the following are properties of enhanc-
ers?
(i) They are located away from the gene they
control.
(ii) They are recognized by transcriptional
activators.
(iii) They decrease the expression of the gene
they control.
(iv) They increase the expression of the gene
they control.
A (iv) only.
B (i) and (iv) only.
C (i), (ii) and (iii).
D (i), (ai) and (iv).
HELP
Statement (i): Enhancers are normally located
upstream of start site. (Most of them are
located thousands of nucleotides upstream
and could be far from promoter.)
Statement (ii): An enhancer region may
contain one or more elements recognized by
specific transcriptional factors called transcrip-
tional activators.
Statement (iii) and statement (iv): Binding of
activators to enhancers accelerates the as-
sembly of a transcription initiation complex
at the promoter and increases the rate of
transcription of the gene.
’ Level 1000 Biology MCQ with HELPs ? 439 Frequently Examined Questions |
Genetic Basis for Variation
Ags Be,
Q1 HELP
B: allele for black fur
In Man, the A, B, AB, O blood groupings are
controlled by a system of multiple alleles. A man Y: allele for yellow fur
of blood group A marries a woman of blood Phenotype: Black x Yellow
group B and they have one child. Which one
of the following statements about the child’s | X®xX8 x X’Y
blood is correct? Gametes: Ke ch? Mil dt
A It could only be group A. a eR OMY ya lek |
B_ It could only be group A or group B. i.e. ROR OEY
C It could only be group AB.
D It could be any of the groups A, B, AB, O. Os
A pure-breeding plant with the dominant phe-
HELP notype of character P and the recessive pheno-
type of character Q was crossed with another
Possibility 1: Possibility 2:
pure-breeding plant with the recessive pheno-
Blood group: A xX B A xB type of character P and the dominant pheno-
Genotype: et pe ecenl A he ee xcalele type of Q. The offspring of this cross were
crossed with a double homozygous recessive for
Gametes: ALB oeie ABS le
P and Q and the following results obtained:
Child’s
— 22 were phenotypically dominant for P
Blood group: AB AB, A, B or O
and recessive for Q.
— 5 were phenotypically dominant for
Q2 both P and Q.
In domestic cats the genes for yellow fur and — 4 were phenotypically recessive for both
black fur are an allelic pair which are sex-linked P and Q.
and codominant. — 24 were phenotypically recessive for P
When black females are mated with yellow and dominant for Q.
males, which one of the following is the ex- Which one of the following types of inheritance
pected proportion of heterozygotes in the off- is illustrated by these results?
spring?
_A& gene linkage of P and Q
A 0%
B_ independent segregation of P and Q
B 25%
C Mendelian dihybrid inheritance
EF 50%
D multiple alleles’
D,+75%
WW Level 1000 Biology MCQ with HELPs ? 449 Frequently Examined Questions
Topic 5 Genetic Basis for Variation |
HELP
Q5
1* crossing
In the North American catfish Catostomus clark,
Parental phenotype: Pq x pQ two alleles, represented by p and gq, control the
Parental genotype: PPaq x ppQQ synthesis of a vital enzyme. The three possible
genotypes (pp, pq, qq) lead to the synthesis of
Meiosis
variations of the same enzyme with different
Gametes: Pq pQ
temperature optima as shown in the graph
Fertilisation below.
F, genotype: PoQq
— co) qq genotype
2” crossing
F, phenotype: PQ x pq
F, genotype: PpQq x ppqq Ss co 4 Pq genotype
Meiosis
Gametes: PG Pq p@a spars pq
Fertilisation relative
activity
enzyme
0.6
F, genotype: PpQq : Ppaqq : ppQq : ppaq
Eeprenotype: PG). « .Pqe= p@Q.: pq | pp genotype
0 10 20 30 40
temperature/°C
Hence, if the P and Q genes are not linked
and there is independent assortment, the When the mean annual temperature is 5°C,
ratios of the four phenotypes should be which one of the following is correct?
1:1:1:1. However, since P is linked to q and & Allele p will be positively selected for.
p is linked to Q (deduced from the original
parental genotypes), there is significantly more B- Allele q will be positively selected for.
Pq and pQ phenotypes. The small numbers C Allele p will become dominant and q re-
of pq and PQ phenotypes obtained are due cessive.
to crossing over during meiosis |.
D_ The heterozygotes will have a selective ad-
vantage over the homozygotes.
Q4
Which one of the following phenotypic features HELP
of Man can be affected only by the genotype? At 5 °C, the genotype pp has the highest
A height relative enzyme activity. Such optimum func-
tion will be favourable at this temperature.
B intelligence
C - skin colour
2% number of different blood group antigens
Q6
In a certain species, the density of hairs on the
upper epidermis of the leaf is believed to be
HELP determined entirely by a single pair of alleles
All the above choices are phenotypic char- which show incomplete dominance.
acteristics which can be affected by the Which one of the following is the maximum
environment. The number of different blood number of different hair densities consistent
group antigens is only affected by the geno- with the view that environmental factors have
type. no influence?
Topic 5 Genetic Basis for Variation
Awad B 2 Q8
Cx D 4 Which one of the following genotypes cannot
occur amongst the offspring from a mating
HELP between a person of blood group A and a per-
son of blood group B?
Assuming that the genotype for hair density
on the upper epidermis is AB, where both A AA B- AB
alleles show incomplete dominance. The CG. +A0 D BO
maximum number of different hair densities
will be AA, AB and BB.
HELP
Phenotypes: A x B
Q7
Genotypes: a x aa
An entomologist collected from one habitat four
F, genotypes: . ‘I
A|B
I*|
A|O
I?|
BJO
aO|jO
types of black, white and red ladybird beetle
(Coccinellidae) illustrated below. Thus, the F, generation can be AB, AO, BO
or OO, but not AA. |
Q9 | ?
In mice, the gene for ‘dappled’ coat (D) and its
Each of the forms were of both sexes and when recessive allele, the gene for ‘plain’ coat (d), are
crossed together with the other colour forms located on the X-chromosome. The gene for
produced fertile offspring in one or more of ‘straight’ whiskers (W) and its recessive allele,
these discrete colour forms without intermedi- the gene for ‘bent’ whiskers (w), are autosomal.
ates. What conclusion can be made from this A male mouse with plain coat and bent whis-
investigation? kers was mated on several occasions to the same
female and the large number of offspring con-
_A The beetles are from four closely related
sisted of the following phenotypes in equal pro-
species.
portion:
B_ The species has colours forms that are con-
dappled male with straight whiskers
tinuously variable.
dappled female with straight whiskers
C The colour forms are influenced by envi- dappled male with bent whiskers
ronment and are not under genetic control. dappled female with bent whiskers
D_ The species shows a discontinuous varia- plain male with straight whiskers
tion due to genetic polymorphism. plain female with straight whiskers
plain male with bent whiskers
plain female with bent whiskers
HELP
If X? represents an X chromosome carrying a
There is no clear transition between the dif- gene for ‘dappled’ coat and X‘ represents an X
ferent coloured beetles, a phenomenon chromosome carrying a gene for ‘plain’ coat,
known as discontinuous variation. Although what is the genotype of the female parent?
they are different in appearance, the offspring
A X?X°WW
produced are still fertile in that they are of
the same species. B X?X°>Ww
C X°X*ww WV We
D X?X'*Ww w \" a ae
‘ Level 1000 Biology MCQ with HELPs a 142 Frequently Examined Questions
HELP HELP
The genotype of the male mouse is X¢Yww. In chromosome maps, it is postulated that
Since there are offspring with dappled coat, the relative frequency of crossing-over would
the female must have the dominant allele X°. be a measure of the distance apart of genes.
Since there are females with plain coats, i.e. This frequency is known as the cross-over
with genotype X‘X4, the female parent must value.
also have the recessive allele X?. Since there
are both straight and bent whiskers among
the offspring, the female must have both the Q12 8
dominant and recessive alleles, W and w.
A woman who is a carrier of haemophilia had
Hence, the female is heterozygous for both
phenotypically normal parents and is married
alleles.
to a man without the recessive haemophilia
gene. Which one of the following statements is
Q10 true?
A Her father must have been a carrier of
Haemophilia is caused by a sex-linked, reces-
haemophilia.
sive allele.
~ Her mother also possessed the gene. ~
Two parents have a haemophiliac son, a normal
son and a haemophiliac daughter. All of her sons will be haemophiliacs.
What are the most likely genotypes of the par- D_ All of her daughters will carry the reces-
ents? sive gene.
mother father
A » i Se ay, | HELP
B xy xy, Her father has only one X chromosome, and
hence could only be normal or haemophilic.
C XOX? my
Since he was normal, the gene must have
D ye EY. been passed from her mother to her. She still
has one normal X chromosome, so only 50%
of her sons would be haemophilic and only
HELP 50% of her daughters will carry the recessive
Since there is both a haemophiliac and gene. Because males only have one X chro-
normal son, the mother must have a het- mosome, 50% of her sons would express the
erozygous genotype. Since there is a recessive gene phenotypically.
haemophiliac daughter, the X chromosome
from the father must have the recessive allele.
Q13
Q11 A linkage group is composed of genes which
A affect the same characteristic.
In the construction of chromosome maps, the
evidence is derived mainly from B_ associate during prophase I.
AX cross-over values. Care in the same nucleus.
B_ electron microscopy. Dare situated on the same chromosome.
C hereditary effects of chromosome fragmen-

tation. HELP
D _ genetic ratios. Linked genes are those which are located on

the same chromosome.
WW Level 1000 Biology MCQ with HELPs ” 443 Frequently Examined Questions
Q14 A all normal

Ball AKU only
Genes P, Q, R and S occur on the same chro-
mosome. Investigation of a large population pro- Call PKU only
duced the following cross-over values between Dall both AKU and PKU
pairs of genes.
P and R 34%
HELP
P and Q 59%
Assuming that since the conditions are rare,
R and S 12% the person without the disease would prob-
S and Q 37% ably have a homozygous dominant instead
of a heterozygous dominant genotype. Hence
Which one of the following sequences of letters
all the children would have heterozygous
represents the sequence of genes on the chro-
genotypes for both diseases, which expresses
mosome?
as a normal phenotype.
A PRSQ B PSRQ 4
C QSPR D RQSP L . Ct [NZ
~ Y
Q16 ip ae
In cats, the genes controlling coat-colour are
HELP co-dominant (incompletely dominant) and are
In a linkage group, the relative frequency of carried on the X chromosomes. When a black
crossing-over is a measure of the distance female was mated with a ginger male the re-
apart of genes. The higher the percentage, sulting litter consisted of black male and
the further is the distance between the two tortoise-shell female kittens. What phenotypic
genes. Therefore the sequence of the genes ratio would be expected in the F, generation?
is PSRQ.
A 1 black male: 1 ginger male: 2 tortoise-shell
P S R Q females
es ee B 1 black male: 1 ginger male: 1 tortoise-shell

59 female: 1 black female
|Z C 2 black males: 1 tortoise-shell female: 1
37.
ginger female
D1 black male: 1 tortoise-shell male: 1 gin-
ger female: 1 black female
ORIG
The following reaction sequence occurs in HELP
humans. B: allele for black coat
X
BY: G: allele for ginger coat
. carbon dioxide
. .
phenylalanine — tyrosine > “11g water Phenotype: Black x Ginger

Genotype: X8X8 XSY
Phenylketonuria (PKU) is a disease caused by
an enzyme deficiency in step X, and alkapto- Gametes: x8 x8 X¢ vi
nuria (AKU) is due to an enzyme deficiency in F X8xS XY
step Y. Both conditions are rare and caused by
recessive alleles. Gametes: x8 X¢ xé ¥
A person with PKU marries a person with AKU. Pe2 EXE PY OX

Which phenotypes would be expected for their
children?
‘\ Level 1000 Biology MCQ with HELPs 4 144 Frequently Examined Questions
Q17 Qig9
Red-green colour blindness is a sex-linked re- A woman with normal colour vision, whose
cessive condition in Man. A man with normal father was red-green colour blind, married a
vision and his colour-blind wife would expect red-green colour blind man. What is the prob-
to produce ability of her first-born child being red-oe
w colour blind?
colour-blind sons and daughters with nor-
mal vision only. A 1.0 B 0.75 A
B sons with normal vision and colour-blind C 0.66 /D 0.50 Pee
daughters only.
colour-blind sons, colour-blind daughters HELP
and daughters with normal vision only.
X: recessive allele for red-green colour #
sons with normal vision, colour-blind blindness yY ¥V¥
daughters and daughters with normal vi-
sion only. X*: normal allele ; yy=
Genotype: ‘che a. XY
HELP F_ genotype: X* X : X*Y : X X : XY
b: allele representing red-green colour blindness The probability of the offspring being colour-
lind is 0.50.
Phenotype: Normal x Colour blind
Genotype: XeY x X°X®
Gametes: X° Y xe x?
Q20
F, genotype: Seat? rene gate? ed Polygenic inheritance forms the basis of
F_ phenotype: Normal daughters and colour A codominance (incomplete dominance).

blind sons /B continuous variation.
C_ discontinuous variation.
Q18 D _siinkage.
Which one of the following features is an ex-

ample of discontinuous variation in Man? HELP
blood group Continuous variation follows the Mendelian
body mass laws of inheritance. Polygenes are a collec-
B
tionofgenes acting together_and—effecting
Cc height variation in a continuous and inheritable way.
D intelligence
Q21
HELP
In the F, generation of a dihybrid cross between
All the above choices, except A, represent yellow, round seeded and green, wrinkled
phenotypes which can be influenced by the seeded pea plants, 17 out of 254 pea seeds were
environment, and hence show continuous green and wrinkled. Other seeds were:
variation. Blood group is a discontinuous trait
yellow and round;
and does not show a gradual transition
green and round;
between traits.
yellow and wrinkled.
What do these results indicate?
ee
* Level 1000 Biology MCQ with HELPs f 445
ee ee
Frequently Examined Questions
A Crossing-over has occurred. Q23

B- Green and wrinkled are both recessive The diagram shows the pedigree of a family
characters. carrying the sex-linked allele for
4 The alleles for green and wrinkled are colour-blindness.
linked.
A
D The allele for green is recessive but not the
; allele for wrinkled.
HELP key
0D normal male
The proportion of seeds that turn out to be
© normal female
green and/or wrinkled was very little, indi-
colour-blind male
cating that these two are both recessive
@ colour-blind female
characters, which are phenotypically expressed
X
only if they are present in homozygous con-
dition. From which labelled member of his family did
X inherit this disorder?
O27
HELP
The pie chart shows the results of a survey of
the incidence of blood groups A, B, AB and O A normal male cannot be a carrier of the
amongst people in Britain. colour-blindness gene.
Q24
In the human ABO blood group system, there
are six possible genotypes but only four pheno-
types.
An explanation of this is that the ABO blood
groups are controlled by
A one gene locus with three codominant
alleles.
Which of the following conclusions can be
Bone gene locus with two codominant alle-
deduced from the diagram?
les and two recessive alleles.
A Only 5% of individuals are heterozygous
© one gene locus with two codominant alle-
for blood group alleles.
les and one recessive allele.
B_ Group O is the most common as it is the
D_ two unlinked gene loci each with two al-
homozygous recessive group.
leles, one dominant and one recessive.
C Group O is most common because it has
the selective advantage of being the uni-
versal donor. HELP
X Any individual, selected at random from The alleles A and B are co-dominant, and
the sample population, has a 1 in 20 dominant over the O alleles. The O blood
chance of being blood group AB. group can only be expressed when present
in the homozygous condition.
HELP
5% of the population are of blood group
AB, i.e. 1 out of every 20 individuals is AB.
X Level 1000 Biology MCQ with HELPs / 446 Frequently Examined Questions
Q25 HELP
Which of the following would cause phenotypic If b represents the allele for red-green colour-
variation among organisms of the same geno- blindness and B the normal allele, the son’s
type? genotype will be X°Y and the daughter X®X°.
Both parents must have at least an X? allele
A continuous variation within the species
since the daughter is homozygous dominant.
B_ different varieties of the same species The father is thus X®Y, i.e. normal, and the
C_ different sexes mother must be X®X°, a carrier.
D_ exposure to different environments

Q28
HELP The diagram shows the inheritance of
haemophilia in a family.
Some phenotypes are influenced by the en-
vironment even if they are individuals of the key to phenotypes
same species, e.g. height and skin colour in O normal female
humans. @ haemophiliac female
0) normal male
haemophiliac male
Q26
In which of the following examples of human
inheritance is the inheritance pattern explained
by multiple alleles on an autosomal chromo-
some? key to chromosome types
A the ABO blood group system X":; normal X chromosome
B_ cystic fibrosis xX: X chromosome carrying allele for
haemophilia
C Down’s syndrome
Y: normal Y chromosome
D haemophilia
What is the genotype of person 7?
A X#XH B X#y
HELP
Cc) X#xXt D XX
The ABO blood group system consists of al-
leles found on a gene locus. The rest of the
choices below are sex-linked genes, i.e. genes HELP
found on the X or rarely on the Y chromo-
Normal males cannot be carriers of the
some.
haemophilia gene since they only have one
X chromosome. Thus, male 6 is normal and
Q27 9 must have inherited the gene from his
mother, 7. Since 7 is normal, she must be
What are the phenotypes of the parents of a heterozygous for the gene, i.e. X"X°.
colour-blind son and a non-carrier daughter with
normal colour vision?
Q29
father mother
a]
In the F, generation of a dihybrid cross, the phe-
carrier normal NA notypes occurred in the ratio 3:1. What does
colour-blind carrier this result indicate?
colour-blind colour-blind A the alleles were segregating independently.
normal
wyow> carrier B_ Polygenic inheritance was involved.
Topic 5 Genetic Basis for Varotonse|
C Codominance was being shown. HELP

) The gene loci were linked. The alleles for red and white flowers are co-
dominant, resulting in pink flowers when both
are present in the genotype.
HELP
A normal dihybrid cross of autosomal genes
will result in the dihybrid ratio of 9:3:3: 1 Q32
However, because the genes are linked, the
A cross between a round-leafed, tall plant and
resulting ratio is 3: 1, i.e. they occur on the
a round-leafed, dwarf plant produced the fol-
same gene locus.
lowing offspring:
K | key
Q30 121 round-leafed, tall plants R: round leaf
In birds, the male is the homogametic sex. A 124 round-leafed, dwarf plants r: oval leaf
male bird showing the recessive trait was ‘mated
with a female showing the dominant trait of a 42 oval-leafed, tall plants T; tall
characteristic governed by a pair of alleles which 37 oval-leafed, dwarf plants t: dwarf
are sex linked. What were the genotypes of the parents?
What is the probability that the male offspring A RrTt xX Rrtt
will show the dominant trait? }
B RrTt x RRtt
A Zero B 0.25
C RrTT x Rrtt "A
C 0.50 D 1.00
D RrTT x RRtt ee
HELP
HELP
Let X* represent the dominant trait and X° the
recessive trait. In order for the expression of double reces-
sive genotypes in the offspring, e.g. rrtt (oval-
Female x Male
leafed, dwarf plants), both parents must have
Genotype: Be A Ae at least one recessive allele.
F, genotype: i XAX°
Thus all the males will be heterozygous domi- Q83
nant for the trait and the probability that the
trait will be expressed phenotypically is 1.00. Why does haemophilia usually affect only males,
although females may carry the gene responsible
for the disease?
Q31 A The gene is inactive in the female.
A red-flowered plant crossed with a B _The gene is dominant only in males.
white-flowered plant of the same species, pro-
© The gene is carried on the X chromosome.
duced F, plants which all had pink flowers.
D The gene is carried on the Y chromosome.
Self-pollination of the F, plants produced an F,
generation in which 39 plants had red flowers,
83 had pink flowers and 40 had white flowers. HELP
What does this experiment demonstrate? The gene for haemophilia is carried on the
X chromosome. A female will only be
a codominance ~“
haemophilic of she has this gene in both her
B _continuous variation X chromosomes. A male, however, who
Ca dihybrid cross carries one haemophilic gene together with
a Y chromosome, will be haemophilic.
D linkage
W Level 1000 Biology MCQ with HELPs 44g Frequently Examined Questions
Q34 Q36
Which parental phenotypes would produce off- Why is haemophilia more likely to occur in
spring with blood group phenotypes in the human males than in human females?
expected ratio of 1 type A:1 type B?
A Females are the heterogametic sex.
blood group blood group f
B- Females can only act as carriers.
of mother of father
AZ The allele for haemophilia is carried only
A A B 9 on the X chromosome.
B AB AB
D_ The allele for haemophilia is carried only
C AB B oe on the Y chromosome.
D AB O
HELP
HELP Females have chromosomes XX and males
The mother would have genotype IAI® and have chromosomes XY. Haemophilia is
the father would have genotype I°I°. Thus, caused by a recessive allele on the X chro-
the two genotypes possible for their offspring mosome. Males only need one recessive allele
would be IAI° and I8I°, with equal probabil- for haemophilia to be expressed while fe-
ity. Hence, the expected phenotypes would males need two copies of the recessive allele
be 1 type A: 1 type B. before the disease is manifested.
Q35 Q37
Two parents, both of blood group A, have a
A cross between a tall plant with round leaves
daughter of blood group O.
and a dwarf plant with round leaves produced
the following offspring: What is the probability that their next child will
be a boy who has blood group 0?
key
zk 0125 BS 0:375
121 round leaf, tall R_ round leaf
124 round leaf, dwarf r_ oval leaf C_, 0.50 DD. 0.75
42 oval leaf, tall Tictall
37. oval leaf, dwarf t dwarf
HELP
What were the genotypes of the parents?
The probability of the next child being a boy
A RrTt x Rrtt is 0.5 the probability that the child has blood
B- RrTt x RRtt group O is 0.25. Hence the probability that
the next child will be a boy with blood group
C RrTT xX Rrit
O is 0.5 X 0.25 = 0.125. These probabili-
D_ RrTT X RRtt ties are independent of the sex and blood
group of the first child.
HELP
oe ee RrTt
ee RrITt
EN ee rrit
Tt RRTt
Round leaf, tall Roundleaf, tall Roundleaf, tall Oval leaf, tall
Tt RRtt Rrtt Rrtt rot
Round leaf, dwarf Roundleaf, dwarf | Round leaf, dwarf Oval leaf, short
Q38 Q40
The four children of two parents each have a The family tree was assembled by a genetic
different blood group of the ABO series. What counsellor for Mr and Mrs X who suffer from
were the blood groups of the parents? | heart disease due to hypercholesterolaemia.
Children who inherit the dominant mutant al-
A A and AB
lele from both parents rarely survive beyond
_B Aand B 6 puberty.
C AandO
DB and AB v
\
HELP
If the children have each of the 4 different
blood groups, then the genotypes of the
parents must be IAI° and I®I°, which corre- key
spond to blood groups A and B respectively.
affected male WA affected female Q
unaffected male [] unaffected female O

Q39
What is the probability that Mr and Mrs X's
The family tree shows the inheritance of a skin third child will be unaffected?
condition.
trees B 0.50
key € 0:25 D 0.00
CO normal man
WB affected man
O normal woman HELP
@ affected woman Both Mr and Mrs X have a heterozygous
dominant genotype since both are affected
and have survived beyond puberty. The prob-
What is the genetic basis of the skin condition? ability that the third child will inherit the
recessive allele from both parents, and hence
A autosomal dominant is unaffected, is 0.25. This probability is in-
B__ sex-linked dominant dependent of the genotypes of their previous
K autosomal recessive children.
D sex-linked recessive
Q41
HELP Red-green colour-blindness is a sex-linked re-
If the condition is X-linked, then every father cessive trait.
of an affected child should be affected. If it A colour-blind man marries a woman with
is Y-linked, then no women should be af- normal vision, whose father is colour-blind. If
fected. Hence, the condition must be auto- they have a daughter, what is the probability
somal. If the condition is dominant, then every that she will be colour-blind?
affected person should have at least one A 0
affected parent, but this is not so, hence it
is recessive. Baar 0.25
C 0.50
D_ 0.75
HELP HELP
The man’s genotype is XY and the woman's Phenotype: red-eyed x white-eyed
genotype is XX°. If the have a daughter, the female (F) male (M)
two possible genotypes are XX° and XX,
Genotype: XX’ x XY
which correspond to the phenotypes normal
vision and colour-blind. Gametes: ak! xy
F, Genotypes: X®Xr XX XRY XY
Q42 F, Phenotype: red F, white F, red M, white M
Haemophilia is caused by a sex-linked, reces-

sive allele. Two parents have a haemophiliac Q44 Hh jj
son, a normal son and a haemophiliac daugh-
Two animals are mated. One is homozygous
ter.
dominant for one character and homozygous
What are the most likely genotypes of the par- recessive for another. The other animal is het-
ents? erozygous for both characters. | LU q
mother father How many phenotypes are expected in the
A OXe ey offspring of this cross? Hf
AS xHyt xHy Als Bi 2 344 Ay oe 7
C xeXe X"Y Cano Dears er LA tH,ss
D ARyH Xty
HELP
HELP The animal which is homozygous dominant

will produce similar alleles, e.g. AAbb
— all
Since they have both a normal and Ab. Crossing with the other animal (AaBb—
haemophiliac son, the mother must have a AB, Ab, aB, ab) will produce 4 different
heterozygous genotype. Since they have a genotypes of offspring (AABb, AAbb, AaBb,
haemophiliac daughter, the father must have Aabb). However there are only two pheno-
the recessive h allele on his X chromosome. types.
Q43 Q45
In fruit flies a sex-linked gene controls the de- The diagram shows the inheritance of
velopment of eye colour. The eyes are either red haemophilia in a family.
or white. The male is the heterogametic sex.
1 de key
What will be the expected percentage of eye
) unaffected female
colours in the progeny when a heterozygous
red-eyed female is crossed with a white-eyed al unaffected male
male?
affected male
red eyes white eyes 3 4 5 6
males females males females,/ If daughter 4 married a normal male, what is
VA, 425,05 1-25.0 aie Ce 4 the probability that their first child would suf-
B S75 Be: WAS 1225 nN Xf
fer from haemophilia?
ee Celts ‘
|}
C125 “12.5 B75 S75 |

D 0 50.0 50.0 0
B 0.125 | Hf]
LES 025
Dos AT { AW \
W Level 1000 Biology MCQ with HELPs 454 Frequently Examined, Questions
HELP Q47
Daughter 4: A plant is heterozygous for a pair of alleles that
XX, XX where X° is the gene for haemophilia. are codominant. This plant is self-pollinated and
Probability of her being a carrier = 0.5 the resulting seeds are germinated and allowed
to grow.
Normal Male: XY
Which ratios are expected in the offspring?
XX h re XY
ratio of phenotypes ratio of genotypes
XX XX? XY mY,
(carrier) (haemophilia) fies
Vitel
Probability of a haemophiliac = 0.25
qt Zc
Therefore, probability of daughter 4 having Spe |
a haemophiliac child = 0.5 x 0.25 = 0.125
Q46 HELP
The diagram shows the inheritance of an For a plant with codominant alleles, both
X-linked recessive trait in humans. Which indi- characteristics will show unless the plant has
vidual is homozygous recessive? identical alleles. In this case, both the phe-
notypic and genotypic ratios will be the same.
Therefore the answer could be either A or
D. In the case of D, there is only 2 types
of outcome, but with 2 alleles, the outcome
should be 3 different types. Hence the an-
swer should be A.
Q48
How many different genotypes can be found in
the offspring of the cross BbCc x BbCc?
ee AGA:
key [_] normal male affected male A, Bole UBC. be
© normal female @ affected female Pap pee
BL ? . 4 Cet
D 16
bvjae | Vv
HELP OL
The homozygous recessive will show the char- HELP

acteristics involved. Therefore the answer
should be A or B. In males, the recessive
gene is in the X chromosome, not the Y chro-
mosome. Since the female (B) exhibits the
characteristics, then both her X-chromosomes
would be recessive. If only one of her X
chromosome was recessive, then she would
be a carrier who does not exhibit the char-
acteristics. The different genotypes include BBCC, bbCC,
BBCc, BBcc, BbCC, BbCc, Bbcc, bbCe and
bbcc = 9 genotypes
Q49 A 0 B- 0.0625
The family tree shows the inheritance of a con- Com 0.125 D 0.25
dition caused by the recessive allele r.
HELP
Probability of their first child being a rhesus
negative = 0.5
Probability of their first child being a red-
green colour blind boy = 0.25
Therefore, probability of their first child being
both = 0.5 x 0.25 = 0.125
key
© normal female Q51
[_] normal male
In a small mammal, the allele for grey fur, G,
@ affected female is dominant to that for white fur, g. The allele
BB affected male for long tail, T, is dominant to the allele for short
Which of the females are certain to have the tail, t. Animals with grey fur and long tails were
genotype Rr? crossed with those having white fur and short
tails. The table shows the phenotypes of the 55
PAs a. 6 and 7
offspring.
Pies Gh <7 cand 12 (
G 7, 9 and 15 eae ot fur tail
offspring
Bb 9, 12 and 15
HELP
Parent 3 is certain to have the genotype rr.
Since the male 10 is also having the geno-
type rr, this means that parent 4 must have What were the genotypes of the parents?
the genotype Rr. Therefore, female 9 must
have the genotype Rr. As female 13 has the
A Ggtt x ggtt
genotype rr, both her parents (7 and 8) must Bis (GGIt.< Get
have the genotypes Rr. Female 15 must have C GgTt x GgTt
the genotype Rr because her father (male
10) has the genotype rr and her mother D GgTt x ggtt
(female 11) is normal.
HELP
Q50 Father
ggtt (white fur and short tails)
A man has normal red-green colour vision. His
blood group is rhesus negative (homozygous re- Mother
cessive). His wife also has normal colour vision GgTt / GGTT (grey fur and long tails)
but is rhesus positive. She is heterozygous at
both the red-green colour vision locus and the
blood group locus.
What is the probability that their first child will
be a rhesus negative, red-green colour blind boy?
‘N Level 1000 Biology MCQ with HELPs v 153 Frequently Examined Questions
Q52 HELP
The mother of R should be a carrier, as her
A girl has blood group A and her brother has
other son exhibits colour blindness, and her
blood group B.
husband has normal colour vision. The son
Which combination of genotypes cannot belong stands a 1/4 chance of being colour-blind.
to their parents?
[nti [ar he RIE

Q54
A tall, pink-flowered plant is self-fertilised and
produces the offspring shown.
| flower colour
red pink white
tall plants 73 157 67
dwarf plants | 21 53 25
HELP
Gia one When self-fertilised, which type of plant will
Boy; PEt or PI? only produce identical offspring?
Mother IAIA and Father |®I° A dwarf, pink-flowered
PPMP? B dwarf, white-flowered

C tall, red-flowered
eae 4 esl
AJB
IA] AIB
A] AJO
lA| AJO
lA| D tall, white-flowered
There is no combination here to account for

the boy. HELP
From the data, there are three times as many
Q53 tall plants as there are dwarf plants. This
shows that the tall gene is dominant over the
The diagram shows the inheritance of red-green dwarf gene. However, in the case of the colour
colour blindness in a family. This condition is of the flowers, there exhibits a codominance
caused by a sex-linked recessive allele. between the genes, as the alleles express
themselves equally in the phenotype. There-
fore, a pure breeding plant will produce iden-
tical offspring if it were homozygous reces-
sive for height (i.e. dwarf) and homozygous
for colour (i.e. either red or white)
R
Q55
©) female, normal colour vision In Drosophila, ebony body colour and vestigial
@ female, colour blind wings are recessive to the wild type and are not
linked. Crossing two flies, heterozygous for both
[_] male, normal colour vision
characters, produced 256 offspring.
HH male, colour blind
How many offspring would be expected to have
What is the probability that individual R will ebony body colour and normal wings?
be a colour-blind boy?
As, 26 B 48
A 0 B O25
C 96 D 144
Ge 0:25 D eur
HELP
Q57
e: ebony recessive
Red-green colour blindness is caused by an X-
v: vestigial wings recessive linked recessive allele.
What would be the expected phenotypes of the
offspring of a colour blind woman and a man
with normal colour vision?
% colour blind offspring
female male
A 0 100
The number of offspring with ebony body B 25 50

and normal wings (indicated in table), is 3 G 50 50
out of a possible 16 offspring.
D 50 100
Number of offsprings expected to have ebony
body and normal wings from the population
aes
nize z 48
HELP
As the father provides only the Y chromo-
some to his sons, all his male offspring must
receive the X-linked recessive allele from the
Q56 mother. None of the female offspring will be
colour-blind as they would receive one X
Potato plants are propagated asexually by tubers. chromosome from the father, which carries
Twenty tubers are collected from one plant and the dominant allele for normal colour vision.
are grown, producing 20 second generation
plants. All the tubers from these plants are
collected and weighed. The twenty largest are Q58
grown under the same conditions as before. All
the third generation tubers are collected and are The table shows the blood group phenotypes
weighed. resulting from crosses between different geno-
types.
How will the mean mass of these tubers and
their genetic variation compare with the second
generation?
genotype genotype of
of 2nd parent
1st parent
third generation tubers if ie i
meanmass _ genetic variation ee A A andO
A greater increased yr A and AB A, B, O and AB
greater unchanged
unchanged reduced Two parents have a son who has blood group
unchanged unchanged A and phenylketonuria. One parent has blood
group O and the other has blood group AB.
Neither parent has phenylketonuria.
HELP What is the probability that the second child of
By the time the tubers reach the third gen- these parents will be a girl with blood group B
eration, the recessive gene can be almost who does not have phenylketonuria?
eliminated as only the largest tubers are A daine6 B sp boumrs}
propagated at each stage.
C 3 in 16 D 3} irl£8
J
HELP Q60
The probability of getting a girl is 2, the Which one of the following would cause phe-
probability of getting blood group B is also notypic variation among organisms of the same
Yo and the probability of getting the disease genotype?
is ¥ (both parents must be heterozygous as
they have a son with the disease). Therefore, A mutation
the final probability is V2 x V2 x Y% = 3/16. B different sexes
C exposure to different environments
Q59 D continuous variation within the species
There are two hypotheses to explain the pro-
duction of white, pale pink or dark pink flow- HELP
ers in a species of plant.
Some phenotypes, e.g. skin colour and height,
hypothesis 1 There are two codominant alle- can be influenced by the environment, result-
les. ing in organisms of the same species having
hypothesis 2 There are three alleles, one for large phenotypic variation.
each flower colour.
Which procedure is the best way of testing these
hypotheses?
Q61
A strain of toad has only one nucleolus in the
A Analysis of the flower pigments in several
nucleus of each cell, instead of the usual two.
different flowers by chromatography to find
When toads with one nucleolus per cell are
whether some plants contain more than
mated, approximately a quarter of the offspring
one pigment.
have two nucleoli per nucleus, half have one
B~ Controlled cross-pollination of all the dif- nucleolus per nucleus and a quarter have no
ferent colour varieties available, in all nucleoli.
possible combinations, and recording the
What is the most likely explanation of these
colours shown by the offspring.
results?
C Controlled self-pollination of several indi-
A The allele for the presence of two nucleoli
viduals of each of the colour varieties and
is dominant.
recording the colours shown by the off-
spring of each individual plant sampled. B_ The allele for the presence of two nucleoli
is recessive.
D Surveying large wild populations and find-
ing the ratios of the different colours in C The possession of one nucleolus is due to
these populations. the effect of crossing over.
D_ The possession of one nucleolus is due to
the heterozygous condition.
HELP
Recording colours of the offspring alone
would not differentiate between the presence HELP
of codominant alleles and multiple alleles. It is unlikely that allele for the presence of
If the ratios of the different colours are two nucleoli is dominant or recessive since
surveyed, codominance would show a there are offspring with no nucleoli. Cross-
1: 2:1 phenotypic ratio. Multiple alleles ing-over also would not produce such results
would show other ratios. as it is a random process.
‘8 Level 1000 Biology MCQ with HELPs ? 456 Frequently Examined Questions
Q62 HELP
Two genes, Q and R, affect the size of the petals Woman X will never inherit the BRCA 1 allele
of a flower. since her father has inherited only normal
genes from his parents.
Gene Q has two alleles, Q' and Q4. The geno-
type Q'Q! produces large petals, Q'Q4 produces
small petals and in Q‘Q4, petals are absent. Q64
Gene R has two alleles. R produces a red pig- In a species of plant, the allele for tall stems is
ment and is dominant over the allele r that dominant over that for short stems and the allele
produces no pigment. for purple flowers is dominant over that for
Two plants, both heterozygous for both genes, white flowers.
are crossed. How many phenotypes are expected A cross between two plants produced the fol-
in the next generation? lowing phenotypic ratio:
A 4 B, 26 tall, purple-flowered 3
ce 9 Dy Az tall, white-flowered 3
short, purple-flowered 1
short, white-flowered i
HELP
What are the phenotypes of the parents?
The genotype of the heterozygous parents
A yyshott; tall,
would be Q'Q4RER’, thus have four types of
purple-flowered purple-flowered
gametes (Q'R®, Q'R’, QAR® and Q*R). There-
fore, a Punnet square would provide the B _ short, tall,
results of the cross between two such parents - white-flowered purple-flowered
and six different phenotypes would be ob- Ce tall; tall,
tained. purple-flowered white-flowered
D staid, short,
Q63 white-flowered white-flowered
The diagram shows the inheritance of a form of

breast cancer associated with the presence of HELP
just one allele of the autosomal gene BRCA 1. From the cross, it can be seen that the first
key two phenotypes have a bigger ratio com-
pared the third and fourth phenotypes. This
male female
shows that the first two phenotypes are the
co 6 no cancer same as the parental phenotype, whereas the
@) breast cancer third and fourth phenotypes are recombinants.
developed
X
Q65
In Shorthorn cattle, the allele for hornless is
What is the probability that woman X inherits dominant to the allele for the presence of horns.
the BRCA 1 allele associated with breast can-
Coat colour can be red (genotype C*® C®), roan
cer?
(genotype C® C’) or white (genotype CC).
A 0.00 A roan bull, heterozygous for the hornless trait,
B 0.25 is crossed with a cow of the same genotype.
C 0.50 What is the probability that a calf from this
D_ 1.00
cross would have the same genotype as its
parents?
1 Level 1000 Biology MCQ with HELPs ? 457 Frequently Examined Questions
Topic 5 Genetic Basis for Variation a
Q67
A . B :
ss 8 The allele for an enzyme involved in the pro-
duction of chlorophyll in geraniums is C®. A
C D a mutant allele C” codes for a defective enzyme,
2 4 resulting in no pigment. A cross between two
heterozygotes produced pale green plants and
dark green plants in the ratio 2:1.
HELP
What is the most likely explanation for this
There would be 4 combinations with the same
ratio?
genotype as the parents out of a possible
16 combinations. This result can be obtained A C® is a dominant allele.
from a Punnet square of the cross.
B C™ is a dominant allele.
C CC® is a lethal genotype.
Q66 D CC” is a lethal genotype.
The following reaction sequence occurs in hu-
mans.
HELP
phenylalanine X
———> tyrosine Y
———» ae
and The heterozygous parents would have the
water genotype CC”. The resultant offspring would
have to be C3Cs, CsCv, C*C2 and CrC”,
Genetic disease P is caused by an enzyme whereby the 2 heterozygotes are pale green
deficiency in step X and genetic disease Q is and C8C? is dark green. The C”C” must be
caused by an enzyme deficiency in step Y. Both lethal, so that there would be no offspring
conditions are rare and are caused by recessive able to exhibit this phenotype.
alleles.
A person with genetic disease P marries a per-
son with genetic disease Q.
Which phenotypes would be expected for their
children?
A all have neither genetic disease
Ball have genetic disease P only
Call have genetic disease Q only
D all have both genetic diseases
HELP
Since both the genetic diseases are due to
recessive alleles, a person with a heterozy-
gous condition would not have either dis-
ease. Thus, the phenotype of the children
would all be heterozygous for each disease
since their parents only contribute one reces-
sive allele each.
® Level 1000 Biology MCQ with HELPs ? 458 Frequently Examined Questions
TOPIC.6 CELLULAR PHYSIOLOGY AND BIOCHEMISTRY
6(a) Photosynthesis
= ee
Qi HELP
The data below show the result of an investi- With the increase in CO, to 0.06%, the ni-
gation to determine whether increasing the trogen content in pods and beans has
carbon dioxide concentration in the immediate doubled from 0.38 g to 0.70 g. This is due
atmosphere would affect the total yield and to an increase in photosynthesis, leading to
nitrogen content of soya bean plants. The soya an increase in the formation of nitrogen used
bean is a legume and has nitrogen-fixing bac- in the formation of amino acids and pro-
teria in its root nodules. teins, and for the synthesis of nitrogenous
bases such as pu-
rines and pyrim-
Air Enriched air
idines.
(0.03% CO,) (0.06% CO,)
Dry mass / g
Plant body
Pods and beans
Nitrogen content / g
Plant body
Pods and beans
Nitrogen content in plants / kg hectare”

Total
Obtained from solid as nitrates, etc.
Obtained from nitrogen-fixing bacteria
Which one of the following accurately describes Q2

the effect on this crop of enriching the air with
The diagram shows the ultrastructure of a cell.
more carbon dioxide?
Where does glycolysis occur?
A Mass gain and nitrogen content are uni-
formly increased in plants and fruits.
B The mass gained by the plant is not sig-
nificantly altered.
C The number of hectares planted with the
- crop can be reduced.
y Mass gain and nitrogen content of the pod
and beans are almost doubled.
Topic 6(a) Photosynthesis
HELP A adenosine triphosphate (ATP)

Glycolysis occurs in the cytosol, A. The Golgi B carbon dioxide
apparatus, B, processes cell materials and eC nicotinamide adenine dinucleotide phos-
transports them to other parts of the cell or phate (NADP)
to the cell surface membrane for secretion.
The mitochondrial matrix, C, is where the D_ phosphoglyceric acid (PGA)
Krebs cycle occurs. The inner mitochondrial
membrane, D, has a built-in electron trans- HELP
port chain and this is where oxidative phos-
phorylation occurs. In photosynthesis, light energy trapped by
chlorophyll is used to excite electrons in the
chlorophyll. (An electron extracted from water
Q3 by photolysis fills the electron hole.) The
excited electrons are then transferred through
Removal of the source of carbon dioxide from the electron transport chain in the thylakoid
photosynthesising chloroplasts results in rapid membrane to NADP*, forming NADPH in the
changes in the concentration of certain chemi- stroma.
cals. Which one of the following represents the
correct combination of concentration changes?
Q5
ribulose Which one of the following is a
phosphoglyceric
diphosphate correct outline of the main events
acid (PGA)
(bisphosphate)
in photosynthesis?
decreases decreases increases A Oxygen reacts with a carbo-
decreases increases no change hydrate to produce water and
increases increases decreases carbon dioxide in the pres-
increases no change increases ence of light.
B_ Light joins carbon dioxide to
an acceptor compound which
HELP is then reduced by hydrogen
The initial reaction that fixes CO, into or- obtained from water.
ganic compounds involves a condensation C ‘
Light splits water and the resulting hy-
with ribulose 1,5-bisphosphate (RuBP) to form
droxyl group combines with a compound
two molecules of 3-phosphoglyceraldehyde
which has incorporated carbon dioxide.
(3-PGA). With the substrate CO, removed,
PGA decreases whilst RuBP increases. Since D Carbon dioxide combines with an acceptor
no energy is expended into photosynthesis, compound and this is reduced by hydro-
ATP also increases. gen split from water by light.
Q4 HELP
Photosynthesis is the process by which plants
In a classic experiment on photosynthesis, R.
manufacture food. This occurs when CO,
L. Hill demonstrated that an illuminated in vitro
combines with ribulose 1,5-bisphosphate
suspension of isolated chloroplasts could pro-
(RUBP) to form the products of photosynthe-
duce oxygen in the presence of a hydrogen
sis.
acceptor such as methylene blue. In this case
methylene blue is reduced. Which one of the
following compounds replaces methylene blue
in the intact photosynthesising plant?
Q6
A small aquatic plant was put in each of three
petri dishes, X, Y, Z, containing different cul-
ture solutions. After six weeks the plant in dish
X had the same number of leaves as it had
previously and they were all small and yellow-
ish. The plant in dish Y had more leaves and arbitrary
/units light
they were of normal size and much darker green. concentration
oxygen
The plant in dish Z also had more leaves, of time/min
normal size but very pale. The *O, concentration fell in light because it
Which one of the following shows which ele- was
ments were missing from the culture solutions? A undergoing radioactive decay to form "°O.,.
X Y Z B_ absorbed in respiration but was not being
A magnesium nitrogen phosphorus produced in photosynthesis.
B magnesium phosphorus nitrogen C absorbed in respiration slower than it was
being produced in photosynthesis.
& nitrogen phosphorus magnesium J
YD absorbed as CO, in photosynthesis.
D_ phosphorus magnesium nitrogen
HELP
HELP
The oxygen produced in photosynthesis is
Nitrogen is an essential component of all produced from the splitting of a water mol-
amino acids and proteins, amines, amides,
ecule by light energy, and not directly from
purines, pyrimidines, porphyrins and many the oxygen taken in during respiration.
other substances. Lack of nitrogen causes
small and yellowish leaves. Phosphorus is an
essential constituent of all living cells, for Q8
lipoprotein structure and for nucleic acids.
Phosphorus compounds play a vital part in During the light stage of photosynthesis, the
carbohydrate metabolism. Magnesium helps photo-activated pigment removes an electron
maintain tissue excitability, and is a constitu- from the hydroxylation derived from the water
ent of the chlorophyll molecule, where molecule.
magnesium ions are activators of phosphate The fate of the free hydroxyl] radical is that it
enzymes. A is broken down into oxygen and a free
radical of hydrogen.
7 B is used to raise the activation level of chlo-
rophyll by donating a positive charge.
The graph below shows the result of an experi-
ment in which isotopes of oxygen were used to C is used to produce adenosine triphosphate
distinguish between oxygen absorbed by plants from adenosine diphosphate.
and oxygen given out. D reduces carbon dioxide to sugar.
A mixture of the oxygen isotopes O, and “O,
was supplied to a suspension of the unicellular
HELP
alga Chlorella which had previously been ex-
posed-to **O, only. During the following hour The water molecule is split as shown in the
changes in the concentration of these gases in equation ©) >) 720), 2h + Je,
the suspension were measured. forming oxygen and hydrogen radicals.
Q9 A Photosynthesis occurs but no storage of

starch occurs in this zone.
The increase in dry mass of a leaf can be used
B Photosynthesis proceeds slowly in the
to measure the rate of photosynthesis if suit-
absence of chlorophylls a and b.
able adjustments are made. Which one of the
following adjustments is necessary? CG Products of photosynthesis diffuse into the
yellow zone.
A Allowance must be made for the rate of
‘transpiration only. D Products of respiration accumulate in the
yellow zone.
B Allowance must be made for any changes
in the moisture content of the leaf.
C Allowance must be made for the oxygen HELP
evolved during photosynthesis. In the light, only the green area of the leaf,
D Allowance must be made for the rate of which contain chlorophyll, can
€
respiration and the translocation of mate- photosynthesise. Some of the photosynthates
rials out of the leaf. produced from the radioactive CO, diffuse
from the green areas to the yellow ones,
resulting in the low radiation detected there.
HELP
The important processes that occur within a
leaf are photosynthesis, where organic sol- Q11
utes are synthesised; respiration, where these In non-cyclic photophosphorylation, water
solutes are oxidised to release energy, and molecules are split, oxygen is released and
translocation, where the solutes are trans- hydrogen is taken up by an acceptor molecule.
ported from the site of manufacture to other
Which one of the following is the hydrogen
parts of the plant.
acceptor?
A flavine adenine dinucleotide (FAD)
B__ nicotinamide adenine dinucleotide (NAD)
C nicotinamide adenine dinucleotide phos-
phate (NADP)
D__phosphoenolpyruvic acid (PEP)
HELP
Electrons excited by photosystem | during pho-
X (dark) Y (light) tosynthesis may undergo cyclic or non-cyclic
photophosphorylation. In the latter, the re-
radioactivity is shown in arbitrary units duced molecule NADPH is formed when
in boxes NADP accepts a hydrogen molecule.
Variegated leaves of a plant were supplied with
radioactive carbon dioxide ("*CO,) during an ex-
periment. Leaf X was kept in the dark and leaf
Q12
Y was kept in the light. Which metal atom is present in chlorophyll?
At the end of the experiment the radioactivity A copper
in the leaves was measured and found to be as B. jiton
shown on the diagram.
¢ magnesium
What is the most likely explanation for the level
of radioactivity found in the yellow zone of leaf D phosphorus
¥?
HELP
Q14
Chlorophyll is a ringed compound with a
The graph shows changes in the pH of water in
magnesium atom in the centre of five rings.
a fresh water lake on a summer day.
pH
Q13 OLS
The electromicrograph shows a chloroplast.
6.8
6.7
6.6
X Y time
What is the probable cause of the rise in pH

between times X and Y?
A decreased levels of mineral nutrients in the
water
B decreased levels of carbon dioxide due to

photosynthesis
C increased levels of carbon dioxide due to
respiration
What are the structures labelled X and Y and
D__ increased oxygen released by the produc-
what are their main functions?
ers
X Y
structure function | structure function HELP
photolysis fixation The increased pH means that the water is
granum stroma
of water ohCO; less acidic. This is because carbon dioxide
is taken up from the water for photosynthe-
fixation photolysis
granum lamellae Chine sis.
of. CO;
fixation photolysis
granum of CO,
stroma
of water Q15
fixation photolysis Why is RuBP important in the process of pho-
lamellae granum Kees tosynthesis?
of CO,
A It is a source of phosphate ions.
B It is an intermediate in sucrose formation.
HELP
C It is an acceptor molecule for hydrogen.
X shows stacks of grana, known as the thy-
Dp It is an acceptor molecule for carbon diox-
lakoid, which is the site of the splitting of
ide.
water by light photons. Y is the stroma, where
carbon dioxide fixation occurs to form sug-
ars. HELP
Ribulose 1,5-bisphosphate (RUBP) is a 5-car-
bon compound which is the first acceptor of
CO,, resulting in the formation of 3-
phophoglyderaldehyde (3-PGA).
Q16 HELP
The photosynthesising cell will have a high
The diagram shows the ultrastructure of a chlo-
concentration of the CO, acceptor, RuBP and
roplast as seen in section. What are the func-
a high ATP concentration, and low amounts
tion of P, Q and R?
of PGA, which is the first product of pho-
tosynthesis.
Q18-
~The diagram represents a section through a chlo-
roplast.
carbohydrate | carbohydrate ae
storage synthesis absorption
carbohydrate | carbohydrate light

synthesis storage absorption In which labelled part are the enzymes con-
C carbohydrate light carbohydrate cerned with the reduction of carbon dioxide
synthesis absorption storage found?
, light carbohydrate | carbohydrate

absorption storage synthesis | HELP
- The compound must accept the electron re-
leased from the excitation of the photosys-
HELP tem, and under blue and red light, where
chlorophyll absorbs maximally.
P represents the thylakoid membrane, where
light energy is harnessed for the photosyn-
thetic process. Q is a starch grain which is Q1i9
the site of carbohydrate storage, whilst R is
the stroma, where CO, fixation occurs. Which statement only applies to carbon fixa-
tion in photosynthesis?
Q17 AX GP (PGA) is reduced to carbohydrate.
&B The reactions are not dependent on tem-
Which of the following describes conditions in perature.
a photosynthesising cell, exposed to high light C
At low light intensity these reactions limit
nee, and low carbon edge concentration?
the rate of photosynthesis.
concentration concentration | concentration DA 2-carbon compound is the ac-

of CO, acceptor of ATP of GP (PGA) ceptor for carbon dioxide.
HELP
Carbon fixation occurs during the
Calvin cycle in photosynthesis,
where 3-phosphoglyceraldehyde
(PGA) is reduced to form carbohy-
drates.
‘\ Level 1000 Biology MCQ with HELPs Va164 Frequently Examined Questions
Q20 Q21
Three of the graphs below show the absorption Isotopes of oxygen can be used to distinguish
spectra of photosynthetic pigments. One graph between oxygen absorbed by plants and oxygen
shows the action spectrum of photosynthesis for evolved.
a plant containing the pigments.
A mixture of oxygen isotopes °O, and *O, was
All the x axes show wavelength. Three of the supplied to a suspension of the unicellular alga
y axes show light absorption. One y axis shows Chlorella which had previously been exposed
the rate of photosynthesis. to *°O, only. During the following hour, changes
Pa
in concentration of these gases in the suspen-
graph 1 graph 2
sion were measured in light and dark conditions.
The graph shows the results:
Se eveleneayagi
graph 3 graph 4
/arbitrary
units dark ; light
concentration
oxygen
time/min
What caused the concentration of *°Q, to rise
er DI a Gr re in light?
Which of the following identifies the four A H,”O was being photolysed
graphs? more rapidly than H,’°O.
B %O, formed a decreasing
Son aiike absorption spectra action
chlorophyllb | carotenoids spectrum
proportion of the oxygen
evolved.
C *°O, was absorbed at differ-
ent rates in light and dark.
D 0, was being produced in
photosynthesis faster than
was being absorbed in res-
piration.
HELP
The action spectrum is a measure of the ability
HELP
of light of different wavelengths to support
photosynthesis. Chlorophyll a absorbs light In the light, both photosyn-
of wavelengths 680 nm, chlorophyll ‘at thesis and respiration are oc-
650 nm and carotenoids at shorter wave- curring simultaneously. But
lengths. radioactive oxygen is pro-
duced in photosynthesis at
a faster rate than it is ab-
sorbed in respiration.
Q22 HELP
Carbon dioxide uptake is favoured in high
In the conversion of RuBP to GP (PGA)
temperatures and when it is present in rela-
A a molecule of carbon dioxide is accepted. tively high concentrations in the atmosphere.
Ba stable six-carbon molecule is produced. Thus, the lowest temperature and lowest CO,
percentage will significantly lower the rate of
C_ ATP is generated.
photosynthesis.
“D hydrogen is combined with oxygen to form
water.
Q25
HELP The diagram shows the main structures in a
Ribulose 1,5-bisphosphate (RuBP) is the first chloroplast.
acceptor of CO, in the formation of two
molecules of 3-phosphoglyceraldehyde (PGA)
during the Calvin cycle of photosynthesis.
Q23
Which of the following occurs in the light re-
action of photosynthesis?
A ADP is phosphorylated.
B Hexose phosphates are hydrolysed
Which part is the site of carboxylation of RuBP?
C Reduced NADP is oxidised.
D_ RuBP is carboxylated.
HELP
HELP The carboxylation of ribulose 1,5-

bisphosphate (RuBP) occurs during the Calvin
During the light reaction of photosynthesis, cycle, which is carried out in the stroma.
ADP is phosphorylated to form energy-rich
ATP, which will be used in CO, fixation and
form carbohydrates. Q26
For every 100 units of sunlight falling on a chlo-
Q24 _roplastof a-green plant, 50 units are not used
for photosynthesis.
If light intensity is uniformly high, under which
of the following conditions is carbon dioxide Why is this?
most likely to be the main limiting factor upon At The wavelengths are inappropriate.
the rate of photosynthesis?
“B They are converted into heat energy.
temperature / °C % carbon dioxide
C They are used to evaporate water vapour.
A 25 4.00 D__ They fall on non-photosynthetic structures.
B 25 0.04
C 15 0.04 HELP
p 5 0.01 Photosynthesis occurs most efficiently at wave-
lengths of red and blue light, because the
chlorophyll pigments absorb light maximally
at these wavelengths.
‘ Level 1000 Biology MCQ with HELPs Me166 Frequently Examined Questions
Topic 6(a) Photosynthesis |
Q27 Q29
The rate of photosynthesis of a freshwater plant The diagram shows the ultrastructure of a chlo-
is measured using five spectral colours. roplast as seen in section.
Which sequence of colours would give an in-
creasing photosynthetic response?
smallest ——____» | largest response
A blue green yellow orange red<
Bp green yellow’ orange red blue
Cred orange yellow green blue’
In which labelled part does carbon fixation
D_ yellow green orange blue red x during photosynthesis take place?
HELP HELP
Photosynthesis occurs most efficiently with red Carbon dioxide fixation occurs in the chlo-
or blue light because the chlorophyll pig- roplast stroma, where the enzyme Rubisco
ments can absorb light maximally at these occurs. Carbohydrates are formed as a re-
wavelengths and the least at green light. sult.
Q28 Q30
The graph shows the effect of increasing light What happens during the light phase of photo-
intensity on the rate of photosynthesis at two synthesis?
different CO, concentrations.
A ADP is hydrolysed and reduced NADP is
C oxidised.
0.04% CO, 3B ADP is phosphorylated and NADP is re-
duced.
ATP is hydrolysed and NADP is reduced. /\
carbohydrate 0.02% CO
as ae ATP is phosphorylated and NADP is re- X
duced.
/ increasing light intensit

carbohydrate A Pele eee Y HELP
used up vi During the light stage, photophosphorylation
occurs. ADP is phosphorylated to ATP as elec-
trons are passed down the electron transport
Which label shows the compensation point? chain. NADP is the final electron acceptor
of non-cyclic photophosphorylation, it is con-
verted to reduced NADP by NADP reduc-
HELP tase.
The light intensity at which the intake of
carbon dioxide for photosynthesis exactly
balances its output from respiration, is called
the compensation point.
J
Q31
Which statement only applies to carbon fixa-
tion in photosynthesis?
A A 2-carbon compound is the acceptor for
carbon dioxide.
B At low light intensity the reactions limit
the rate of photosynthesis.
G = GP (PGA) is reduced to carbohydrate. HELP
D_ The reactions are not dependent on tem- A is the thylakoid membrane of the granum,
perature. where photophosphorylation occurs.
HELP Q34
GP (phosphoglyceric acid, PGA) is reduced The diagram shows the movement of substances
to triose phosphate, a carbohydrate. Ribu- into and out of a chloroplast.
lose biphosphate (RUBP) is the 5-carbon com-
pound that accepts carbon dioxide. B refers 2 4
to photophosphorylation. The enzyme Rubisco
is involved in carbon fixation, hence it is tem-
perature dependent. € chloroplast
Q32 light
dependent
reactions
What are the products of the light-dependent
reactions of photosynthesis in green plants?
XX ATP and reduced NADP
-B- GP (PGA) and reduced NADP
C GP (PGA) and RuBP 1 3
D__triose phosphate and NADP
What do labels 1 to 4 represent?
il 2 3 4
HELP
A co, EF H,0 starch
ATP and reduced NADP are produced in pho-
B CO, H,O sugars .
tophosphorylation in the light-dependent stage
of photosynthesis. These are passed on to ¢ Ho O, CO, sugars
the Calvin cycle, where it is used in carbon D sugars H,O ATP O,
fixation.
HELP
Q33 In the light-dependent reactions, photolysis
The diagram represents a section through a of water occurs to release electrons, hydro-
chloroplast. gen ions and oxygen. Oxygen is released as
In which part are the enzymes associated with oxygen gas. In the light-independent reac-
photosynthetic phosphorylation found? tions, carbon dioxide is fixed, producing car-
bohydrates.
Q35 C Photoactivation of the chlorophyll cannot

occur.
The diagram represents the Calvin cycle.
D_ Photolysis of water does not occur.
HELP
hexose
phosphate Only the electron transport
system produces ATP and re-
duced NADP in the plant.
Without these compounds, the
At which stage is CO, incorporated? Calvin cycle cannot proceed
and carbon fixation cannot
occur and there is no respi-
HELP ratory substrate available for
Carbon dioxide combines with Ribulose respiration.
biphosphate (RuBP) to form GP (phospho-
glyceric acid, PGA) which is subsequently con-
verted to triose phosphate. Q38
The diagram shows. stages in the
Q36 light-independent reactions of photosynthesis.
— amino acids
What is the outline sequence by which carbon
dioxide may be incorporated into starch by pho- yy
tosynthesis?
seca
RuBP + CO, GP (PGA)
A GP (PGA) + CO, > RuBP = triose phos- </
(5C) (3C)
phate -—» hexose phosphate ~— starch
B . GP (PGA) + CO, + RuBP - hexose \/
phosphate -» triose phosphate ~ starch triose phosphate
C RuBP + CO, > GP (PGA) - hexose (3C)
phosphate -— triose phosphate —» starch At which stage is most of the reduced NADP
oxidised?
RuBP + CO, — GP (PGA) - triose phos-
phate — hexose phosphate —+ starch
HELP
HELP ATP and reduced NADP are used in stage

C and are converted to ADP and NADP re-
This is the sequence followed for carbon fixa- spectively. Stage A also involves the conver-
tion and carbohydrate production. sion of relatively less ATP to ADP.
Q37 Q39
The weedkiller DCMU blocks the flow of elec- What are the products of the light-dependent
trons from the electron transport chains in pho- reactions of photosynthesis?
tophosphorylation.
A oxygen, ATP and NADP
Why does this kill the plant?
oxygen, ATP and reduced NADP
A Active transport of mineral ions is pre-
water, ATP and NADP
y vented.
B . ATP and reduced NADP are not produced. oS
Om.water, ATP and reduced NADP
| Level 1000 Biology MCQ with HELPs ? s69 Frequently Examined Questions
Topic 6(a) Photosynthesis “
HELP Q41
Photolysis of water produces oxygen and The diagram represents a transverse section of
hydrogen which would combine with NADP a leaf.
to produce reduced NADP. ATP is generated
during photophosphorylation as electrons are Which region is the main site of carbon fixa-
passed along the chain of electron carriers. tion?
Q40
The graph shows the relationship between oxy-
gen production in photosynthesis and light
intensity for a unicellular green organism in
0.02% sodium hydrogencarbonate solution.
oxygen production/mm’*h*
A: upper epidermis
B: palisade mesophyll cell
C: spongy mesophyll cell
D: air space
40 60 80 100 120 140 160 180 200 Carbon fixation occurs during the light in-
dependent reactions of photosynthesis. Pali-
9 light intensity/Jm™~s * sade mesophyll is the main photosynthetic
tissue.
The most likely explanation of the fact that the
graph levels off at 180 J m~*s* is that the sys-
tem is Q42
A light limited and carbon dioxide saturated. It has been found that an aqueous suspension
B light limited and the temperature is below of isolated chloroplasts will evolve oxygen if
optimum. illuminated in the presence of a certain type of
compound.
C light saturated and carbon dioxide limited.
Which type of compound and which colours of
D light saturated and the temperature is
light are required for maximum oxygen evolu-
above optimum.
tion?
HELP colours of light

type of
at which maximum
The amount of light given is saturated, not compound
evolution occurs
limited. Therefore, the answer could be C or
D. The concentration of carbon dioxide is in electron acceptor blue and green /
short supply, hence limiting the rate of pho- ‘| electron acceptor blue and red
tosynthesis. electron donor blue and green <
electron donor blue and red >
WW Level 1000 Biology MCQ with HELPs / 470 Frequently Examined Questions
HELP
At the light dependent stage, electrons from
The table shows two measurements of produc-
chlorophyll are passed into the light inde-
tion in birch and pine forests in England.
pendent reaction. Chlorophyll absorbs light
in the blue-violet and red regions of the visible
spectrum. The green region is reflected off, production | carbon dioxide
of fixation during
giving it its characteristic colour. An electron
oganic growing season
acceptor is required to receive the electron matter / grammes of
from the chlorophyll (in PS | and PS I). type / tonnes per | carbon fixation
of unit area per unit
Q43 forest per year area per day
During photosynthesis, which process releases

electrons that return chlorophyll molecules to
their reduced state?
A activation of photosystem I What is the most likely reason for the higher
annual production of the pine forest?
B_ oxidation of reduced NADP
A Pine trees have a faster daily rate of pho-
C phosphorylation of ADP tosynthesis than birch trees.
oon photolysis of water B_ Pine trees have a larger total leaf surface
than birch trees.
HELP C Pine trees have a longer growing season
Cyclic- or non-cyclic-phosphorylation can than birch trees.
generate ATP. In non-cyclicphosphorylation, D__‘s*Pine trees have a lower light compensation
electrons from the splitting of water returns point than birch trees.
to the chlorophyll to replace the electrons
lost in P 680 to the electron acceptor. HELP
As the carbon fixation is less for the pine
Q44 trees compared to the birch trees, the pine
trees would need to have a longer growing
Carbon dioxide labelled with *C has been used season in order to produce more organic
to identify the intermediate compounds in the matter. The larger total leaf surface and faster
Calvin cycle, the light-independent stage in rate of photosynthesis is not likely true for
photosynthesis. the pine trees since their carbon fixation per
Which compound would be the first to contain unit area per day is lower than the birch
the “C? trees.
A _ glucose UB = GP (PGA)
CG RuBP D__triose phosphate
Q46
Which process is the link between the light de-
pendent and the light independent stages of
HELP photosynthesis?
Candidates must take note that RuBP would A photolysis of water~
not contain the '4C as it is not formed from
absorbing the '4C. Instead, GP (PGA) would B production of carbon dioxide acceptor mol-
ecules
wo
be the first to contain the '4C since it is formed
from the combination of the labelled carbon production of reduced hydrogen carrier and
dioxide with RuBP ATP
D__ireduction of carbon dioxide
W Level 1000 Biology MCQ with HELPs 2 474 Frequently Examined Questions
Topic 6(a) Photosynthesis 4
HELP HELP
Photolysis of water refers to the breakdown The 5-C sugar is combined with carbon di-
of water during the light dependent stage. oxide by NADPH and H* and ATP from the
It does not connect both stages. The produc- light dependent stage. Answers B, C and D
tion of reduced hydrogen carrier is necessary are all stages of the light dependent reac-
for the reduction of glycerate phosphate to tions in the plant. Photolysis of water is the
triphosphate. The ATP produced is also breakdown of water in the presence of light.
needed for the energy required for the con- Photophosphorylation of ADP is required in
version to starch. the light stage to supply ATP for the light
independent stage. And finally, oxygen is re-
leased in the light dependent stage as the
Q47 plant takes up carbon dioxide.
Isolated chloroplasts liberate oxygen when illu-
minated in the presence of a hydrogen or elec-
tron acceptor. DCPIP is such an acceptor and
Q49
the following change occurs. Which reactants are used in the Calvin cycle?
light + chloroplasts reduced A carbon dioxide, ADP and NADP
B carbon dioxide, ATP and reduced NADP
C oxygen, ADP and reduced NADP
For which naturally occurring compound is the D oxygen, ATP and NADP
DCPIP substituting?
A ATP HELP
B NAD Calvin cycle reactants are:
Vee NADP
D RuBP ABae NADP involved in the light
3 ATP independent reactions
HELP The fixation of CO, and reduction of GP

This represents the NADP that is reduced in using NADPH + H* and ATP from the light
the light dependent stage (non-cyclic phos- dependent reaction will produce a triose
phorylation) to release a reduced hydrogen phosphate (TP).
carrier to be used in the light independent
stage of the plant cycle.
Q50
Which of the following is the source of high-
Q48 energy electrons in the light-dependent reactions
Which of the following is a stage in the light of photosynthesis?
independent reactions in photosynthesis (the A ATP B_ chlorophyll
Calvin cycle)?
@ hydroxyl ions D reduced NADP
A carboxylation of a five-carbon sugar
B photolysis of water—/
HELP
C__photophosphorylation of ADP y
The chlorophyll molecule has two reaction
D release of oxygen “ centres (PS | and PS Il) that will trap light
energy to boost electrons to a higher energy
level and does not produce electrons itself.
Q51 HELP
The diagram shows a chloroplast. Chlorophyll absorbs red and blue light better,
so the rate of photosynthesis would be faster
Which region contains electron carriers involved in region T and V. This helps produce more
in the reduction of NADP? oxygen in these areas where the aerobic
bacteria would be attracted to.
Q53
What occurs in the conversion of RuBP to GP
(PGA)?
A’ A molecule of carbon dioxide is accepted.
BA stable six-carbon molecule is produced.
C ATP is generated.
D Two three-carbon compounds combine.
HELP
Electron carriers are found in the thylakoids
of the chloroplast in order to accept the HELP
electrons during the light-dependent reactions. RuBP is a 5-carbon molecule that accepts
carbon dioxide to combine and produce an
intermediate 6-carbon molecule. This inter-
Q52 mediate then breaks down into two 3-car-
A filament of the alga Cladophora was illumi-
nated as shown. At the same time, motile,
aerobic bacteria were placed in the water with
the alga and their position was determined by
microscopic examination after 10 minutes.
chloroplasts
SU
S a U V
violet indigo green yellow orange red
light from a prism
In which two regions will the number of bac-

teria be highest?
AS Sand: T
BS and U
of T and V/
D UandV
WW Level 1000 Biology MCQ with HELPs 473 Frequently Examined Questions |
o
TOPIC 6 CELLULAR PHYSIOLOGY AND BIOCHEMISTRY
6(b) Respiration
~ ae
Q1 At which numbered stages does decarboxylation

take place?
Which substances enter and leave a mitochon-
Ay “Rand: 2 B 1, 2and..3
drion during aerobic respiration?
C 1, 3 and 4 Dp -t;-2>3"
and 74
-— enters leaves
acetylcoenzyme A carbon dioxide HELP
ADP lactate During the Kreb’s cycle, there is release of
glucose reduced NAD ATP and CO,. The release of CO, is de-
pyruvate AXAUE: carboxylation. It is present in stages 1, 2 and
3.
HELP
Q3
Pyruvate enters the mitochondria to combine
with O, to take part in the Kreb’s cycle. The The diagram below summarises the stages in-
release of energy in the various cycles is also volved in respiratory metabolism of mammalian
present. skeletal muscle.
hexoses
|1
Q2 triose phoshpate
The diagram shows the Krebs cycle. \2
pyruvate lactate
pyruvate 3 4
coenzyme A 1 acetyl coenzyme A
acetylcoenzyme A tricarboxylic acid (Krebs) cycle
electron transport chain

Stage 4 in the diagram occurs in mammalian
oxaloacetate citrate muscle cells under anaerobic conditions. Why
is stage 4 necessary?
A To detoxify pyruvate.
4 2 B_ To form lactate which is immediately re-
converted to glycogen.
4C compound C To oxidise the reduced nicotinamide ad-
5C compound enine dinucleotide facilitating stage 2.
D_ To reduce the oxidised nicotinamide ad-
3
enine dinucleotide facilitating stage 2.
‘® Level 1000 Biology MCQ with HELPs 474 Frequently Examined Questions
Topic 6(b) Respiration
HELP
Q6
The enzyme phosphorylase attaches an in-
What is the approximate ratio of ATP
organic phosphate molecule to sugar mol-
synthesised during anaerobic respiration com-
ecules, forming glucose 1-phosphate. This
pared with aerobic respiration?
process occurs during glycolysis.
A EZ B the She
& 17.0 D 1523.0
4
The amount of energy released from a given
HELP
quantity of glucose is greater in aerobic respi-
ration than in anaerobic respiration. By approxi- 36 molecules of ATP are produced during
mately how much is the energy yield increased aerobic respiration, whilst only 2 ATP mol-
in animals? ecules are released in aerobic respiration.
The approximate ratio is thus 1 : 20.
A 3 times B 9 times
& 12 times D 18 times
Q7
HELP Which molecule is common to both glycolysis
and the Calvin cycle?
36 molecules of ATP are generated in aero-
bic respiration whilst only 2 molecules of ATP A hexose phosphate
are produced in aerobic respiration. The B NADP
energy yield in the former is this 18 times
C pentose phosphate
more than the latter.
D__triose phosphate
Q5 HELP
Which one of the following is the main bio- Glycerate 3-phosphate (GP) is reduced to
chemical process which takes place inside the produce triose phosphate in the Calvin cycle.
mitochondrial matrix? Fructose bisphosphate splits into two triose
A photophosphorylation phosphate molecules (PGAL) during glycoly-
sis.
B- the formation of lactic acid
C the translation of messenger RNA
D the tricarboxylic (citric) acid cycle. Qs
Before entering the tricarboxylic acid cycle, the
pyruvate produced by the glycolytic pathway is
HELP first converted to
The tricarboxylic acid cycle (TCA) follows gly- A acetyl-coenzyme A.
colysis and occurs in the matrix. The 2-carbon
acetyl residue from acetyl CoA condenses B_sccitrate.
with the 4-carbon compound, oxaloacetate C coenzyme A.
(OAA), to form the 6-carbon molecule, ci-
D ethanol.
trate.
HELP
On entering the matrix from the cytosol,
pyruvate reacts with coenzyme A to form CO,
and the intermediate acetyl CoA.
|W Level 1000 Biology MCQ with HELPs 7 475 Frequently Examined Questions
Qg A To act as a solvent.
B_ To provide a source of food.
Lactic acid is produced when muscle contracts.
Frog muscle can contract in the absence of C To assist in the extraction of enzymes.
oxygen and lactic acid accumulates until fatigue D_ To prevent the mitochondria from chang-
sets in. On return to aerobic conditions, the ing in structure.
muscle can contract again and the lactic acid is
. metabolised.
Which of the following is the best interpreta- HELP
tion of these observations? The osmotic pressure of 0.25 mol dm™® su-
crose solution approximates that of the in-
A Lactic acid is produced only in anaerobic
ternal environment of the mitochondria, thus
conditions.
this solution is applied to prevent the mito-
B_ In anaerobic conditions, lactic acid is pro- chondria from undergoing structural changes.
duced faster than it can be removed.
C_In aerobic conditions
fatigue.
the muscle will not
Q12
D Formation of lactic acid is Where are the enzymes located which are in-
oxygen-dependent. volved in the chemical reactions which occur
during glycolysis?
A In the fluid matrix of cytoplasm.
HELP
B_~ In the mitochondrial matrix.
Lactic acid is produced during anaerobic res-
piration, resulting in the production of 2 C In the nuclear sap.
molecules of ATP. The lactic acid is D On the cristae of a mitochondrion.
metabolised as soon as oxygen is available
again.
HELP
Q10 Glycolysis occurs in the cytosol, where the

glucose molecule is converted into two mol-
How many moles of carbon dioxide are pro- ecules of the three-carbon compound, pyru-
duced by the complete oxidation of 1 mole of vate. The enzymes are located here.
pyruvate?
A eel B
Q13
C 3 D 4
Six tubes containing preparations from animal
tissue were set up as shown in the table.
HELP tube contents
Pyruvate is a three-carbon compound, 1 glucose + homogenised cells
(CH,C[O]C[O]OH), which on complete oxi-
dation releases three moles of (COR Z glucose + mitochondria
3 glucose + cytoplasm lacking organelles
Q11 4 pyruvic acid + homogenised cells

5 pyruvic acid + mitochondria
When mitochondria are extracted from cells for
biochemical study, they are usually kept in a 6 pyruvic acid + cytoplasm lacking
0.25 mol dm sucrose solution. organelles
Why is the sucrose solution used? After incubation, in which three tubes would
carbon dioxide be produced?
AM e4: 2 and 3
Q16
By) 4, 4Aeand5
Which graph represents the relationship be-
C 1394 and’ 6 tween the relative energy intake of a person and
Dey 3.5 and. 6 temperature over a range of environmental tem-
peratures from —40°C to +38 °C?
HELP A B
Glucose and pyruvic acid serve as sources

of substrates which the homogenised cells
Be
Shao)
Be SS
Shae)
on Sw
ow oe)
can oxidise in glycolysis and Krebs cycle re- wo & @ Pa
> wv 2 YU
spectively. Mitochondria however, can only velfe BM
aSYe S$
oxidise pyruvic acid via the Krebs cycle.
—
we ve
= 0 + = wi Come
Q14 temperature temperature
Which of the following releases most energy C D

during respiration?
Bb Boe
A conversion of glucose to ethanol and car- Dae)
oe
Gu
5s
Y
oO 55
Sw Pe wg
bon dioxide tae (DD)
oN AS)
B oxidation of pyruvate to carbon dioxide and ae 28
water ane u.S
C oxidation of those phosphate to pyruvate 0 SIF a at) ae

D phosphorylation of glucose
HELP HELP
The most energy is released at the Krebs At lower temperatures, there is a need for
cycle, where about 30 molecules of ATP are a higher relative energy intake in order to
produced in the mitochondria. carry on his metabolic processes and to
generate heat in his body for enzyme activi-
Q15 ties. This

increases.
need decreases as the temperature
What is the final pathway followed by all car-

bon atoms derived from carbohydrates, lipids
and proteins when they are oxidised during Q17
respiration? The diagram shows stalked particles on part of
A the Calvin cycle a crista membrane in a mitochondrion.
B_ the electron transport system
C_ the Krebs cycle
D_ the ornithine cycle 1 inner membrane sphere
2 matrix
HELP 3 base
The Krebs cycle is a complex of nine reac-

tions where two molecules of acetyl CoA are
oxidised to CO,.
What occurs in each of the numbered regions?
Topic 6(b) Respiration j
Q19
The diagram shows some of the reactions fol-
re ADP electron Krebs lowing glycolysis during aerobic respiration.
synthesis transport cycle
substance S
ADP Krebs (pyruvate)
C ATP Krebs electron COz

synthesis cycle transport acetylcoenzyme A
ATP Krebs J
coenzyme A
substance U substance T
HELP (oxaloacetate) (citrate)
The electron transport system occurs in 3,

and is coupled to proton transport across the
inner membrane (1), generating the proton- a ketoglutarate
motive force, powering ATP synthesis. Krebs
cycle occurs in the matrix, where two mol-
ecules of acetyl CoA are oxidised. succinate
How many carbon atoms are in each of the sub-

Q18 stances S, T and U?
The diagram summarises the pathway of glu- S r U
cose breakdown. A 2 a) 3
hexose B 2 6 4
41 C 3 4 6
triose phosphate
D 3 6 4
th)
pyruvate ——> lactate
1 HELP
acetyl CoA Pyruvate is a three-carbon compound. Ox-
14 aloacetate, a four-carbon compound, com-
6C compound bines with acetyl coenzyme A (two-carbon)
to form citrate, a six-carbon compound.
15
H,O+.CO,
Which two steps result in a net increase of ATP?
Q20
Both glucose and appropriate enzymes are nec-
A 1 and 3 B 1 and 4
essary for the process of glycolysis to begin.
C 2 and 4 Dim 42rand: 5
Which additional compound must also be
present?
HELP
A acetylcoenzyme A
ATP formation occurs both at 2, where glyc-
B..ArP
eraldehyde-3-phosphate is converted to pyru-
vate; and at 5, where the six-carbon com- C pyruvate
pound, citrate, releases water and CO, in D_ reduced NAD
the Krebs cycle.
W Level 1000 Biology MCQ with HELPs 47g Frequently Examined Questions
HELP Q23
In glycolysis, 2 ATP must be hydrolysed for
The complete oxidation of one mole of glucose
the phosphorylation of glucose to fructose
yields 2880 kJ of energy. The addition of one
1,6-bisphosphate.
phosphate molecule to ADP requires 30.6 kJ of
energy per mole. In aerobic respiration, 38
Q21 molecules of ATP are formed as a result of the
breakdown of each glucose molecule.
After vigorous exercise, changes occur in the Which figure best represents the efficiency of
muscle tissue. Compared with ‘at rest’ condi-
aerobic respiration in trapping the energy re-
tions what will the changes be?
leased by the glucose molecule?
— glycogen lactate pH A 23%

decreased decreased increased decreased B 36%
decreased increased increased increased C 40%
increased increased increased increased D 45%
increased decreased decreased increased
HELP
HELP The total amount of energy used in forming
During vigorous exercise, the glycogen store S8*ATP== 38 30:6:k)> = -11:62 85k):
Thus, the efficiency of aerobic respiration is
in the muscle will be used to produce more
ATP, depleting the store of energy in the 1162.8/2880 x 100% = 40%.
muscles. Lactate in the muscles will increase
because some anaerobic respiration will Q24
occur, resulting in a decreased pH because
In mitochondria, where do the reactions of the
of the presence of lactic acid.
electron transfer chain occur?
A in the inner membranes
Q22 Bin the outer membranes
Which substances enter and leave a mitochon- Cin the matrix
drion during aerobic respiration?
D between inner and outer membranes
enters leaves
A acetyl-CoA carbon dioxide HELP
B ADP lactate The electron transfer chain occurs in the inner
C glucose reduced NAD mitochondrial membrane, where the compo-
nents such as coenzyme Q occur.
D__spyruvate ATP
HELP Q25
Pyruvate is the end-product in glycolysis, Six tubes were set up as shown in the table.
enters the mitochondrion and then is con- tube contents
verted into acetyl CoA, which undergoes
glucose + homogenised animal cells
Krebs cycle and finally results in ATP forma-
glucose + mitochondria
tion.
glucose + cytoplasm lacking organelles
pyruvate + homogenised animal cells
pyruvate + mitochondria
PF
WH
oorpyruvate + cytoplasm lacking organelles
’ Level 1000 Biology MCQ with HELPs * 479 Frequently Examined Questions
After incubation, each sample was analysed to Q28

determine the presence of carbon dioxide and
lactate. What happens to most of the reduced NAD mol-
ecules in cell metabolism?
In which tubes is lactate most likely to be
present? A They act as oxidising agents in glycolysis.
A 1 and 3 only B They are oxidised in mitochondrial ATP

formation.
B, ) 2335" ana 6 only.
-) They are oxidised in the Calvin cycle.
C3 and 6 only
D They combine with succinic acid as part
D 4,5 and 6 only of the Krebs cycle.
HELP
HELP
Lactate is produced in anaerobic respiration
which occurs when aerobic respiration is in- Reduced NAD are oxidised via reactions in
hibited. Aerobic respiration requires mitochon- the electron transport chain, which is coupled
dria which is present in homogenised animal with ATP production.
cells but absent in cells lacking organelles.
Q29
Q26 Which of the following pathways outlines the
The electron transport system in cells is directly order of events during aerobic cellular respira-
coupled with tion?
A hydrolysis of hexose phosphates. fitSt, the
_patebry
elt o! obobae,} Sieh teees
B__ production of pyruvate. A glucose -» triose phosphate ~+ pyruvate
C_ reduction of NAD. — Krebs cycle + CO, + H,O + ATP
D synthesis of ATP. B_ glucose -» triose phosphate + pyruvate
— Krebs cycle + CO, + H,O + ADP +
HELP Pi
The reactions in the electron transport chain C glucose -» hexose phosphate -» pyruvate
pumps protons (H* ions) across the inner mi- — Krebs cycle + CO, + H,O + ADP +
tochondrial membrane, setting up a proton Pi
gradient. ATP synthase couples the diffusion
D__ glucose — hexose phosphate -» pyruvate
of protons down their concentration gradient
to the phosphorylation of ADP to ATP — Krebs cycle - ethanol + CO, + ATP
Q27 HELP
Glucose is converted to hexose phosphate,
How many moles of carbon dioxide are pro- which is broken down to triose phosphate,
duced by the complete oxidation of one mole which is subsequently converted to pyruvate.
of pyruvate?
Pyruvate enters the Krebs cycle, producing
Anes B 3 carbon dioxide, reduced NAD and ATP. Re-
Cc 4 T0916 duced NAD enters the electron transport
chain, where oxygen is reduced to water and
ATP is produced.
HELP
One mole of pyruvate contains 3 moles of
carbon atoms, and hence would produce 3
moles of carbon dioxide.
Q30 HELP
What is oxidative phosphorylation? Molecular oxygen is the final electron accep-
tor of electrons that are passed down the
A addition of phosphate to ADP using energy
electron transport chain of oxidative phos-
gained by transferring electrons along a
phorylation, combining with hydrogen ions
chain of carriers
to form water.
B_ addition of phosphate to ADP using energy
gained by transferring electrons between
chlorophyll molecules Q33
C addition of phosphate to glucose in the first Which changes occur when the electron trans-
step of glycolysis fer system in animals is inhibited?
D_ removal of phosphate from ATP with the lactate oxygen Krebs cycle
release of energy for work within the cell concentration consumption activity
A decreased decreased increased
HELP B decreased increased increased
A is oxidative phosphorylation. B is photo- C increased decreased decreased
phosphorylation, C does not involve redox D increased increased decreased
reactions and D is dephosphorylation.
HELP
Q31 When the electron transfer system is inhib-
Where are the enzymes located which are in- ited, aerobic respiration cannot occur and
volved in the chemical reactions which occur anaerobic respiration occurs instead. Anaero-
during glycolysis? bic respiration does not make use of oxygen
A in the fluid matrix of the cytoplasm and it makes use of pyruvate, which occurs
at a stage before the Krebs cycle, to make
Bin the mitochondrial matrix lactate.
Con the cristae of a mitochondrion
Don the smooth endoplasmic reticulum Q34
Which type of mammalian cell does not carry
HELP out oxidative phosphorylation?
Glycolysis occurs in the cytoplasm, Krebs cycle A cardiac muscle cells
occurs in the mitochondrial matrix and the
B liver cells
electron transport chain is sited in the cristae
of a mitochondrion. C neurones
Dred blood cells
Q32
HELP
What is the function of molecular oxygen in cel-
lular respiration? Red blood cells have no nucleus and no mi-
A to combine with carbon to produce carbon tochondria to make more room for haemo-
globin, hence increasing the carrying capac-
dioxide
ity for oxygen. Without mitochondria, oxida-
B_ to combine with glucose to produce car- tive phosphorylation cannot occur.
bon dioxide
Q to combine with hydrogen to produce water
D to oxidise ADP to ATP
Q35 Q37
In the conversion of glucose to two molecules The diagram shows a respirometer that is used
of pyruvate, what does not occur? to measure gaseous exchange in pea seeds. The
apparatus is maintained at a constant tempera-
hydrolysis of ATP
ture.
phosphorylation of hexose
reduction of NAD syringe
>
SQrelease Of CO,
HELP
xX
The release of one CO, occurs in the con- perforated
version of pyruvate to acetyl CoA. The re- basket manometer
lease of two CO, occurs in the Krebs cycle. peas
x
filter paper
wick
Q36 potassium
The diagram shows a respirometer used to mea- hydroxide
solution
sure oxygen uptake by woodlice.
What happens to the gas pressure at X and to
the fluid level at Y?
syringe
ie4 gas pressure at X | fluid level at Y

rises
perforated 2
basket S
' S
woodice :
filter paper
wick
xX HELP
What is X? Potassium hydroxide absorbs whatever car-

bon dioxide is released during respiration.
A _ buffer solution to control the pH The gas pressure at X will fall as O, is
B- lime water to indicate the presence of absorbed during respiration. This would cause
carbon dioxide the fluid level at Y to fall and try to fill the
C potassium hydroxide solution to absorb loss of pressure at X.
carbon dioxide
D_ water to control the humidity Q38
Where does ethanol formation occur in a yeast
HELP cell?
The woodlice take up oxygen and then they A cell vacuole
give out carbon dioxide. To prevent this build
up of CO,, potassium hydroxide will absorb Bs cytoplasm
it. Thus the movement in the manometer C Golgi apparatus
would indicate the amount of oxygen loss D mitochondrion
from the air around the woodlice, instead of
complication from the CO, coming out of
the woodlice.
‘A Level 1000 Biology MCQ with HELPs p 182 Frequently Examined Questions |
HELP
Q40
Since glycolysis occurs in the cytoplasm of
cells and not the mitochondria, the pyruvate The growth curve shows the change in the size
would remain in the cytoplasm for the con-
of a yeast population maintained under anaero-
bic conditions.
version to ethanol during anaerobic respira-
tion. In which stage of growth is there the greatest
mean rate of ethanol production per cell?
Q39
The diagram shows a simple respirometer.
drop of liquid
in capillary tube population
size
yeast
time
small
animals
HELP
basket
Ethanol is produced by yeast in the main
growth phase of the yeast population. After
carbon dioxide absorber
that, the ethanol accumulates around the
yeast until its concentration rises to a level
The changes in gas volume in the tube are mea- that prevents further growth. At this stage,
sured at intervals. the ethanol will start to kill the yeast.
gas volume gas volume

time with without Q41
(minutes) carbon dioxide carbon dioxide
The diagram shows some of the reactions fol-
absorber (cm’) absorber (cm’*) lowing glycolysis during aerobic respiration.
How many carbon atoms are in each of the sub-
stances S, T and U?
substance S$
Tube X contains 2 g of small animals. What is

the carbon dioxide output per g per hour for acetylcoenzyme A
these organisms?
A 0.9 cm’ B Lass iene coenzyme A
C 2.4 cm? Dine oucmy:
substance U substance T
HELP
1.8 cm® of carbon dioxide output for 60
minutes from 2 small animals (2 g).
For 1g, there would be 0.9 cm? of gas.
# Level 1000 Biology MCQ with HELPs 483 Frequently Examined Questions
the stalked granules. This flow acts as a

driving force to combine ADP with the inor-
ganic phosphate to form ATP.
Q43
The diagram shows a simple respirometer.
capillary tube
HELP
Kreb’s cycle:
Substance (3C-pyruvate)
Acetylcoenzyme A animals
Substance U Substance T
(6C-citrate)
ee potassium hydroxide solution
(4C-oxaloacetate)
ee What is being measured by this apparatus?

A carbon dioxide production
Q42 B carbon dioxide production minus oxygen
uptake
The diagram shows a mitochondrion in a cell.
C oxygen uptake
_— cell surface
membrane D oxygen uptake minus carbon dioxide pro-
alt duction
2
3
4 HELP
Potassium hydroxide absorbs carbon dioxide.
Therefore the instrument measures the oxy-
Where is ATP produced from ADP during res-
gen uptake by the animal without the carbon
piration?
dioxide produced by respiration.
A 1 and 2 only
B \ies2i-ands3
G -29and <3danly.
Q44
Intact mitochondria are mixed with a solution
DD” 2 -eseand*4
containing DCPIP, succinate and sucrose. The
enzyme succinate dehydrogenase in the mito-
HELP chondria oxidises the succinate and the DCPIP
is a hydrogen acceptor.
1: Cytoplasm
Why is the sucrose added to the reaction me-
2: Crista
dium?
3: Matrix
A To act as a hydrogen donor.
4: Inter-membrane space
B_ To act as a reducing agent.
NAD picks up hydrogen atoms in the matrix.
C ‘To maintain the osmotic balance.
The split produces protons, which enter the
space, then flows back into the matrix via D To provide energy for the reaction.
N Level 1000 Biology MCQ with HELPs / 484 Frequently Examined Questions
7
Topic 6(b) Respiration |
HELP HELP
Sucrose is a non-reducing sugar that can Unlike glycolysis, the Krebs cycle and sub-
help maintain osmotic balance. DCPIP ac- sequent ATP production will not occur under
cepts hydrogen from the oxidation of succi- anaerobic conditions as oxygen has to be
nate, which is the hydrogen donor. present to be the final hydrogen acceptor.
However, without lactate dehydrogenase, gly-
colysis cannot occur since the reduced NAD
Q45
is not converted back to NAD. Thus, there
Which of the following is a molecule formed in is insufficient NAD as hydrogen carriers.
metabolic pathways by the equal splitting of a
phosphorylated hexose into two halves?
Q47
A acetyl coenzyme A
The diagram shows some of the stages of res-
B__ fructose 1,6-bisphosphate piration. Which molecule contains four carbon
C ribulose bisphosphate (RuBP) atoms?
D__triose phosphate glucose
HELP CO2
Acetyl coenzyme A is a two-carbon compound
acetyl coenzyme A
that is formed from combining pyruvate with
coenzyme A. Fructose 1,6-bisphosphate and
RuBP are both not formed from splitting of
hexose sugars.
ID} Krebs cycle |B]
(Q46
The diagram shows the reversible conversion of CO2 CO2
pyruvate to lactate by the enzyme lactate dehy-
drogenase.
HELP
reduced NAD
” NAD A Te Molecule D has to have 4 carbons so that
it can combine with the 2-carbon acetyl co-
cC=0 + ae CHOH enzyme A to obtain a 6-carbon compound,
| NAD e which is molecule B.
COO reduced Coo
pyruvate NAD lactate
Q48
What would be the effect of inhibition of lac-
tate dehydrogenase in a mammalian cell under The diagram shows apparatus used to measure
anaerobic conditions? the respiration rate of small animals.
A A decrease in cell pH, due to the accumu- capillary tube
lation of lactic acid. screw clip
BA decrease in glycolysis, due to the lack
of NAD. drop of fluid
C An increase in ATP production, due to in-
creased amounts of reduced NAD. animals
D_ An increase in activity of the Krebs cycle,
due to increased amounts of pyruvate. potassium hydroxide
solution
Should the screw clip be left open or closed, HELP

and why? Candidates are reminded that reduced NADP
is used in photosynthesis only, whereas NAD
is used in respiration. Only glycolysis uses
ATP. whereas the Krebs cycle generates ATP.
open to allow entry of air
open
closed
to
to
allow for temperature fluctuations
measure output of carbon dioxide
Q51
closed to measure uptake of oxygen During anaerobic respiration in mammals, the
pairs of hydrogen atoms released during glyco-
lysis are accepted by NAD.
HELP To which molecule are the pairs of hydrogen
If the screw was left open, oxygen from the atoms then transferred?
atmosphere would enter the tube and influ- A coenzyme A
ence the reading of the fluid movement in
B lactate
the capillary tube.
C oxygen
Qa49 D__pyruvate
ATP can be formed by oxidative phosphoryla-

tion in the electron transport system and by
HELP
glycolysis. Lactate is only formed after the pyruvate
molecule accepts the hydrogen atoms from
In the complete oxidation of one molecule of
the reduced NAD.
glucose, approximately what percentage of ATP
is formed by oxidative phosphorylation?
A 10% B 25% Q52
C 75% D 90% At which stage in the oxidation of glucose are
both ADP and NAD required?
HELP
Oxidative phosphorylation contributes 34 ATP hexose triose
glucose > phosphate
out of the 38 ATP produced per glucose phosphate
molecule, which is 89.98%. Glycolysis and +C
the Krebs cycle contribute 4 ATP pyruvate
4D
acetyl coenzyme A
Q50
The table shows events that may occur in the HELP
Calvin cycle, the Krebs cycle or in glycolysis.
NAD is required to accept the hy-
In which of these processes do the events oc- drogen produced when glyceralde-
Cues, hyde-3-phosphate (PGAL) is con-
verted to glycerate-3-phosphate
ae ATP used dehydrogenation reduced NADP used (PGA). ADP is required to accept the
Calvin cycle glycolysis Kerbs cycle phosphates that will form ATP when
PGA converts to pyruvate.
glycolysis Calvin cycle Kerbs cycle
glycolysis Kerbs cycle Calvin cycle
Kerbs cycle glycolysis Calvin cycle
Q53
What is the precise role of oxygen in cell res-
piration?
A to act as the final hydrogen acceptor in the
electron transport chain
B____to combine with acetyl coenzyme A to form
citrate in the Krebs cycle
C to combine with carbon from carbohydrates
to form carbon dioxide
D _ to oxidise reduced NAD in oxidative phos-
phorylation
HELP
Oxygen serves as an acceptor of hydrogen
so that water is formed at the end of the
electron transport chain.
Q54
Which statement about anaerobic respiration is
correct?
A Animals are unable to use lactate for the
production of ATP.
B From one molecule of glucose, ethanol and
lactate production yield the same amounts
of ATP.
From one molecule of glucose, ethanol pro-
duction yields more energy than lactate
production.
Yeast is able to respire ethanol for the pro-
duction of ATP.
HELP
Candidates are reminded that ethanol can-
not be further broken down to produce ATP
The only ATP produced is through glycolysis,
thus ethanol and lactate production during
anaerobic respiration yields the same 2 ATP
molecules.
’ Level 1000 Biology MCQ with HELPs ? 487 Frequently Examined Questions
|
a
TOPIC 6 CELLULAR PHYSIOLOGY AND BIOCHEMISTRY
6(c) Structure, Roles and Functions of Membrane |
~ re
Ql HELP
Cholesterol occurs in the hydrophobic tails
The approximate width of a cell membrane is
of the membrane’s phospholipid bilayer, and
A 0.01 nm helps to maintain membrane structure.
B 0.10 nm
C 1.0 nm Q3
D 10.0 nm
The diagram below represents a model of the
structure of a biological membrane.
HELP
The cell membrane consists of a protein and
afARARAL |W
AAAACAAAL AAA
bilipid layer, with a thickness of about 80 /. outside
The best electron micrographs of animal cells
reveal 2 dense lines (lipid layer) of about
20 each, separated by a lighter band
(protein layer) of about 35 /#.
PLUNN a TE
Which one of the structures, A, B, C or D, will
i= ory
carry out active transport from the cell?
ame= "107m
therefore, 1 = 107'nm
804 = Bnm wx 10.0 nm HELP
The transport protein C spans the membrane
and consists of 2 binding sites at the exterior
@zZ and the interior, each being capable of bind-
The diagram below represents a current model ing the substrate that is to be transported.
of the structure of a biological membrane. When binding occurs at one side, a confor-
mational change in the protein occurs, al-
lowing the substrate through to the other side.
Q4
AAC JAAAL AAR The diagram shows three zones, X, Y and Z, of
UUBUUUUUUL) UWL a membrane protein in the phospholipid layer.
In addition to the structures shown, cholesterol

is also present. In which one of the areas, A,
B, C, or D, is this found?
WW Level 1000 Biology MCQ with HELPs ? 4g8 Frequently Examined Questions
Topic 6(c) Structure, Roles and Functions of Membrane
What enables the protein to maintain its rela- Which labelled part would restrict the move-
tive position in the membrane? ment of small, lipid-insoluble molecules?
A covalent bonds between zone Y and the
phospholipids
HELP
Bionic bonds between zone Z and the cyto-
A represents the hydrophobic interior of the
plasm
bilipid membrane, restricting the entry of
C large numbers of hydrophobic amino acids small, lipid-insoluble (non-hydrophobic)
in zone Y molecules.
D large numbers of hydrophobic amino acids
in zone X
7,
Which technique provided the primary evidence
HELP for the fluid mosaic model of the cell mem-
The phospholipid membrane has a hydro- brane?
phobic interior. The intrinsic protein shown A cell fractionation
has the most hydrophobic amino acids in
zone Y so as to maintain its position in the B_ chemical analysis of membrane proteins
membrane. C chemical analysis, microscopic staining
D freeze-fracture
Q5
Which cell component forms pinocytic vesicles? HELP
A cell surface membrane (plasma membrane) The freeze-fracture technique allows the 2
faces of the cell membrane to be separated
B_ endoplasmic reticulum and examined under electron microscopy. The
C lysosome membrane is frozen and fractured by a sharp
D nucleolus blow, splitting the membrane into the two
phospholipid leaflets, showing the membrane
model.
HELP
Pinocytosis is the non-specific uptake of small
Q8
droplets of extracellular fluid by vesicles that
arise from the invagination of the plasma By which process does glucose move into red
membrane. This process occurs so that sub- blood cells from the plasma?
stances may be exchanged between the in- A active transport
tracellular and extracellular environment.
B_ endocytosis
C facilitated diffusion
Q6 D osmosis
The diagram shows a model of the structure of
a biological membrane.
HELP
Glucose transport occurs by the glucose trans-
porter (a carrier protein), which moves glu-
Pe C eae cose down its concentration gradient from
the plasma into the cytoplasm of the cell.
WRU OWUUUWBE UWE WUE

Sree
|‘ Level 1000 Biology MCQ with HELPs ? 489 Frequently Examined Questions
Topic 6(c) Structure, Roles and Functions of Membrane 4
Q9 HELP
Charged ions like Cl-ions and polar mol-
The diagram shows a cell found in an organ in
ecules are repelled by the hydrophobic re-
the body.
gions in the middle of the membrane. Hence,
they can only travel through integral proteins
|microvilli such as A that span across the whole mem-
brane.
nucleus Qi1
The diagram represents a model of the struc-
ture of a biological membrane.
From its structure, what are the functions of this
cell?
A uptake and transport of fluids against a outside c D
B_
concentration gradient
intracellular digestion and transport of
ATIAAAA, |ARARACOAAR) |ARE
products BUUEdE| JUUBBUUUUUL| ULL
C phagocytosis, pinocytosis and secretion
Which label indicates hydrophobic hydrocarbon
D secretion and transport of mucus
chains?
HELP
HELP
Microvilli are extensions of the cell surface
which greatly increase the surface area and The hydrophobic tails of the lipid membrane
enhance the absorption of fluids to the cells, are represented by B. These restricts the entry
e.g. glucose. The abundance of mitochon- of small lipid-insoluble molecules, and main-
dria shows that the cell uses a lot of energy tain the membrane structure.
to serve this purpose of uptake against a
concentration gradient.
Q12
The diagram shows the fluid-mosaic model of
Q10 membrane structure. What are X, Y and Z?
The diagram represents a cell membrane. Z
outside of cell C
J
AARAR pEARACORARY (RAR

AH aod AAAAAL» UsULL WAUUNEELU! IA
sels BUUBLUUUL aelelels inside of cell
A
xX
lipid
¥
carbohydrate _ protein
Z
Which structure allows the diffusion of Cl ions

B_ilipid protein carbohydrate
between the outside and the inside of the cell? C protein carbohydrate lipid
D protein lipid carbohydrate
Level 1000 Biology MCQ with HELPs ” 499 Frequently Examined Questions
HELP HELP
X refers to the hydrophilic heads of the The tissue has a water potential of -700 kPa.
phospholipid molecules. Y shows a periph- A is isotonic to the tissue. Addition of solute
eral protein, whilst Z is a carbohydrate chain tends to lower the water potential. Therefore
on an integral protein. the most negative (hypertonic) will have more
solutes in it, causing water to move out of
the tissue into the solute. This would be the
Q13 answer B (-1000 kPa). C and D are both
The diagram shows some of the main structures hypotonic to the tissue, causing water to move
which form the cell surface membrane. in, making it more turgid instead.
Q15
Which part of a phospholipid molecule contrib-
utes most to the thickness of a cell surface
membrane?
A _ glycerol
B hydrocarbon chain
C hydrophilic head
D_ phosphate group
Which two structures, when hydrolysed, would

release amino acids only? HELP
Ay, | and 2 B 1 and 3

Gy -2-and 4 DP (3-and <4 long chain
of hydrocarbon phospholipid
structure
HELP
ones hydrophilic
2 and 4 are proteins, and hence would break spi c fest °
down to from amino acids only. 1 is phos-
pholipid, which consists of fatty acids, glyc-
erol and a phosphate group. 3 is glycopro-
tein, which has carbohydrate as well as Q16
protein components. The water potential of three adjacent plant cells
is shown.
Q14 xX \¢
Four identical samples of plant tissue, each with 0 kPa —1000 kPa
a water potential (Y) of -700 kPa, are placed
in four different solutions. Which solution in-
duces full plasmolysis within the tissue?
In which direction will water move?
A from cell X to cells Y and Z
A —700 kPa B_ from cell Y to cells X and Z
B —1000 kPa C from cell Z to cell X
C —400 kPa
D from cell Z to cell Y
D —200 kPa
Topic 6(c) Structure, Roles and Functions of Membrane 4
HELP HELP
Candidates should well remember that water If the solution has less negative water po-
molecules always move from an area of tential, then there are less solutes in the
higher water potential (0 kPa) to areas of solution and a higher concentration of water.
lower water potential (more negative, i.e. This will induce movement of water from the
—1000 kPa and -4000 kPa). solution into the plant cell. Thereby, making
the cell turgid. The movement of molecules
here would refer to water molecules, not the
Q17 solution itself.
Potassium cyanide is known to interfere with
the formation and use of ATP in cell metabo-
lism.
Q1g
The diagram shows a generalised animal cell.
If the use of potassium cyanide resulted in an
accumulation of a solute in a cell, it may be
deduced that the solute normally enters by
A active transport.
B diffusion.
C osmosis.
D pinocytosis.
HELP
As potassium cyanide caused the solute to Which structure would be involved in the final
remain in the cell, it can be deduced that secretion of digestive enzymes from this cell?
the solute is no longer actively transported
out of the cell. Therefore, the solute would
enter the cell via diffusion down a concen- HELP
tration gradient, since it normally has to be
The digestive enzymes are formed in the
actively transported out of the cell against a
cytoplasm on the ribosomes, and then
concentration gradient.
localised in the lumen of the rough ER. These
proteins them migrate to the Golgi appara-
Q18 tus in the membrane-bound vesicles, A, ready
to be secreted.
A plant cell is placed in a solution with a less
negative water potential. Which change occurs
in the cell and what causes the change? Q20
What is the role of cholesterol in the cell sur-
face membrane?
cell becomes solution diffuses A to assist active transport
more flaccid out of the cell
B to assist facilitated diffusion
cell becomes water diffuses
C to provide hydrophilic channels
more flaccid out of the cell
D to regulate fluidity of the membrane
cell becomes solution diffuses
more turgid into cell
cell becomes water diffuses

more turgid into cell
Topic 6(c) Structure, Roles and Functions of Membrane |
HELP
Questions 23 and 24 refer to the
Cholesterol makes the membrane less fluid following information.
at higher temperatures and more fluid at lower
temperatures. Proteins play a role in assisting Substance X (a mineral ion) is actively trans-
active transport across the membrane. ported into cells. Equal-sized samples of cells
were placed in media containing different con-
centrations of X for an hour.
Q21 The intracellular concentration of X was then
Which process enables proteins to enter cells? measured. All other metabolic conditions were
maintained at the optimum level. The graph
A active transport
below shows the results.
B_ diffusion
C endocytosis 0.04
age
D osmosis Y
0.02
HELP
Diffusion involving the movement of ions and
polar molecules through the cell membrane
is slow. Proteins can be broken down to such
0.001 0.002 0.003 0.004
a form. Endocytosis involves uptake of ma-
concentration of X in the external
terials in bulk, osmosis is in reference to the
passage of water. Active transport enables
proteins (in the form of amino acids) to enter
cells faster. Q23
From the information given above, which one
Q22 of the following would account for the level
region of the graph indicated by the letter Y?
What is the approximate width of the cell sur-
face membrane? A respiratory inhibitor had been intro-
duced.
A 7.5 nm
B’ As the internal concentration of X rose,
B 75 nm
more of the substance was metabolised.
C Wis [yaa C The active transport carriers had been in-
D 75 #M activated by a non-competitive inhibitor.
D_ All the active transport carriers had been
operating at their maximum rate.
HELP
The cell wall is 10-80 nm.
HELP
The cell membrane is thinner than that, about
The region Y on the graph indicates that the
7.5m.
maximum amount of X that can be trans-
A measurement in “Mm will be considered to ported is 0.04. This is because all the bind-
be too thick for a cell membrane. ing sites on the active transport carriers for
the mineral ions have been occupied thus
there is a saturation of the carriers.
Q24 HELP
Diffusion and osmosis is the movement of
Which one of the following is the maximum
molecules down their concentration gradient
concentration of X in the intracellular solution
and does not require energy provided by ATP.
relative to the external solution that can be
Osmosis refers specifically to the movement
maintained by active transport in these condi-
of water molecules across a membrane. Ph-
tions? require en-
agocytosis and active transport
‘A 4 times B 5 times ergy provided by the hydrolysis of ATP. Active
C 10 times D 20 times transport occurs through protein channels or
transporters, and hence must necessarily occur
across a membrane.
HELP
Under such saturating conditions, the intra-
cellular concentration of X is 0.04, whilst the
Q26
concentration of X in the external is 0.002. Potassium cyanide is known to interfere with
Thus the ratio of the 2 values is 0.04/0.002 the formation and use of ATP in cell metabo-
= 20 times. lism.
If the use of potassium cyanide resulted in an
Q25 accelerated entry of a solute into a cell, it may
be reasonably assumed that, under normal cir-
The table summarises methods of movement of cumstances, the solute enters by
substances.
A active transport.
movement movement B osmosis.
does not always
always involve C passive diffusion.
involve passage
of
D pinocytosis.
passage
of substance substance
through through
membrane membrane HELP
energy provided Under normal circumstances, the cell must
only Syinetic have sodium pumps (Na*/K* ATPase) which
energy of actively transport ATP into the cell. When KCN
particles
is added, the carriers are destroyed, thus ATP
energy provided can enter freely.
by hydrolysis
of ATP
What do the numbers in the table represent?
S
foe oe he ae ee
ctive transport
active transport
[D|pins |asion [ave waar

diffusion
osmosis
Q27 HELP
Strips of plant tissue were immersed in a range Glucose moves into red blood cells down a
of sucrose solutions of different concentrations. concentration gradient, thus the process is
Their lengths were measured before immersion passive diffusion. However, as it is an im-
and after 30 minutes in the different solutions. portant respiratory substrate for cells, more
rapid movement is required, hence the pro-
The graph shows the ratio of initial length to cess is facilitated diffusion.
final length.
1.4
Q29
1.2
The graph shows the relationship between y
initial length 1.0 (water potential), y, (solute potential) and y,
finallength 6, 8
(pressure potential) for a plant cell placed in
pure water.
0.6
0.2
0.4 56
OT 0:2 90:3" 0.4705" 0.60.7 +08
sucrose concentration/mol dm~
mm OVE
a
Which concentration of sucrose solution has the x 0 time
same water potential as the cell sap? foo}
oD
Ae 4 z -0.1 ss
By 0:25 Z
=o'2
C 0.45
D_ 0.6
HELP
When the concentration of sucrose solution
has the same water potential as the cell sap,
there would be no net movement of water
across the cell membranes of the plant tissue
and there would be no change in the length
of the strip. For the 0.45 mol dm* sucrose
solution, the ratio of initial length : final length
was 1.0, which means that the length of the HELP
strip of plant tissue was unchanged. If the plant cell is placed in water, it will
become turgid as the water from the solution
Q28 moves into it. X should be the pressure
potential as it is positive. As the water moves
By which process does glucose move into red into the cell, the water potential would in-
blood cells from the plasma? crease greater than the solute potential.
A active transport
B_ endocytosis
C facilitated diffusion
D osmosis
]
Q30 - Q31
The table shows the results of an experiment Which group of cells, taken from the same
on the rate of uptake of sugars by rat intestine. plant, has been placed in a solution with a
less negative water potential than the cell
rate of absorption contents?
relative to glucose
Sugars under under
aerobic anaerobic
contitions contitions
hexose sugars
glucose 100 30
galactose 106 32
pentose sugars
xylose 32 32
arabinose 30 30
Which conclusion may be drawn from the re-

sults? HELP
A All four sugars can be absorbed by active Water always moves from an area of less
transport. negative water potential to an area of more
negative water potential. Therefore, water
B Only hexose sugars can be metabolised by
the rat. from the solution would enter the cells and
make them more turgid.
C The intestine is freely permeable to hex-
ose sugars.
D_ The rate of passive diffusion of all four Q32
sugars into the gut is similar. Which pair of factors is inversely proportional
to the rate of diffusion?
HELP A Concentration gradient and size of diffus-
ing molecule.
Passive diffusion does not require energy, thus
it can occur under anaerobic conditions where B_ Distance over which diffusion occurs and
there is no oxygen to drive the oxidative surface area over which diffusion occurs.
phosphorylation process to produce ATP. From C Size of diffusing molecule and distance
the results, it can be seen that the rates under over which diffusion occurs.
anaerobic conditions are similar.
D Surface area over which diffusion occurs
and concentration gradient.
HELP
Small molecules diffuse faster than large ones,
that is, the smaller the molecule, the greater
the rate of diffusion. The rate is proportional
to the reciprocal of the size of the molecule.
The shorter the distance between two regions
of different concentration, the greater the rate
of diffusion. The rate is proportional to the
reciprocal of the square of the distance.
‘N Level 1000 Biology MCQ with HELPs 496 Frequently Examined Questions
Q33 Q35
Plant tissue was moved from solution X to The diagram represents part of a cell surface
solution Y and the cells became less turgid. membrane through which benzene molecules
Compared with solution X, what was the rela- © moving.
tive water potential of solution Y and what
caused the change in the cells?
water potential cause of

of solution Y change in cells
A | less negative water diffused in
B less negative water diffused out
more negative water diffused in
more negative | water diffused out of
Direction
movement
Benzene — nonpolar molecule

HELP
ete Oats Cet ritte ncoaics "since
‘ : ; i
Which correctly explains this movement’
water diffusing out of the cells will make them A active transport through a carrier protein
less turgid. Candidates are reminded that B_ facilitated diffusion through a channel
water always moves from areas of less protein
negative water potential to a more negative
water potential. C pinocytosis through the cell surface mem-
brane
D simple diffusion through the phospholipid
Q34 bilayer
Which statement about the phospholipids in the
phospholipid bilayer is correct? HELP
A They are made
: up of three fatty acids Benzene is a non-polar molecule and is able
combined with glycogen. to move down its concentration gradient
B They are made up of three fatty acids across the hydrophobic core of the phos-
combined with glycerol. pholipid bilayer via simple diffusion.
C They form a bilayer in the membranes of
cells. Q36
% vyPoe pease ey AeRN

ei nenranee Which combination would increase the fluidity
of a cell surface membrane?
HELP saturated non-

fatty saturated cholesterol
The phospholipids of cell membranes align
acids fatty acids
with one another, such that their hydropho-
bic tails are buried inside the two hydrophilic decrease increase decrease
layers formed by the phosphate groups. This
lle| decrease increase increase
produces a sheet composed of two paralle
molecular layers called a phospholipid bi- increase decrease decrease
layer that forms the fundamental structure of increase decrease increase
_ membranes.
| ‘AW Level 1000 Biology MCQ with HELPs f 197 Frequently Examined Questions
HELP Q38
Kinks are present in the hydrocarbon chains Phospholipid molecules are present as a bilayer
of the non-saturated fatty acids and absent in the plasma membrane because
in the hydrocarbon chains of the saturated
fatty acids. A the polar groups are hydrophobic, thus
they are confined to the center of the
Kinks prevent the molecules of unsaturated membrane.
lipids from packing together closely enough
to solidify. Hence the presence of kinks in- B the fatty acid chains are hydrophilic, thus
crease the fluidity of the cell surface mem- they are confined to the center of the
brane while the absence of kinks decrease membrane.
the fluidity of the membrane. C non-polar groups are hydrophobic, thus
Cholesterol present in the membrane in- they are confined to the center of the
creases membrane fluidity by hindering the membrane.
close packing of phospholipids. D_ polar groups with opposite charges are
attracted to each other.
ORVE HELP
The diagram shows the relationship between the Phospholipids have hydrophilic phosphate
size, lipid solubility of molecules and their heads that seek water and hydrophobic hy-
ability to cross cell membranes. The diameter drocarbon tails that exclude water.
of the circles proportional to the size of the
molecules. The phospholipids of cell membranes align
with one another, such that their hydropho-
Which circle represents a substance that has a bic tails are buried inside the two hydrophilic
large molecule size, a low solubility and a layers formed by the phosphate groups, that
permeability that is greater than might be ex- is they are confined to the center of the
pected? membrane.
Q39
In an investigation into the properties of mem-
branes, washed beetroot cells were shaken for
five minutes in different solvents. The intensity
of the red colour of the solvent was then mea-
Permeability
sured. Which of the following is possible?
intensity of colour
tube conditions (arbitrary units)
Lipid solubility A tap water at 20°C 10

B_ ethanol at 20°C 35
C tap water at 35°C 35
HELP
D_ distilled water at 45 °C 50
large molecule size — option C is out
low solubility — option. D is out
HELP
greater permeability — option B is out
Ethanol dissolved the phospholipid bilayer and
resulted in damage to membrane. Thus the
red pigment leaked out of the beetroot cells
into the solvent.
W Level 1000 Biology MCQ with HELPs ? 49g Frequently Examined Questions
Q40 Q41
The components of the membrane found within The diagram represents part of a cell surface
and at the surface of cells contribute to their membrane through which amino acid molecules
functions. Examples of components are found _are moving.
below.
1 glycolipids
a
2 glycoproteins F
o
3. phospholipids 5
4 proteins S
Which row matches the components with their 5
functions? 5
o
JE
bind cells | separating | recognizing Oo
together dissolved self or hee ‘d
into tissues ions non-self eee
1
A Which correctly explains this move-
ment?
1 3
A active transport through a carrier
2 a protein
ez 1 B_ facilitated diffusion through a
channel protein
C pinocytosis through the cell sur-
HELP face membrane
Function of components of membrane are D simple diffusion through the
as follows: phospholipid bilayer
] glycolipids: bind cells together into tissues or
recognizing self or non-self HELP
3 glycoproteins: bind cells together into tissues ea ee eens
or recognizing self or non-self Sclledibisiie iyarmeenopic core
3 phospholipids: forms the fundamental struc- of the phospholipid bilayer. Thus,
ture of membranes — the phospholipid bi- for amino acid molecules to move
layer and aids in separation of dissolved ions across the membrane and down
its concentration gradient (seen in
4 proteins: proteins can function as enzymes to
catalyse reactions
the diagram), it has to diffuse
through the channel protein (seen
in the diagram) via facilitated
diffusion.
‘NW’ Level 1000 Biology MCQ with HELPs p 499 Frequently Examined Questions
Q42
The components of the membrane found within and at the surface of cells contribute to their
functions.
Examples of components are found below:
i cholesterol
°2 glycolipids
3 glycoproteins
4 phospholipids
h) proteins
Which row matches the components with their functions?
binding recognizing | separating | stabilizing the | transporting

sites for self or dissolved hydrophobic | ions through
toxins non-self ions membranes
1 5
HELP
Function of components of membrane are as follows:
] cholesterol: stabilizing the hydrophobic layer, increasing the fluidity and stability of the membrane
2 glycolipids: recognizing self or non-self or binding sites for toxins
3 glycoproteins: recognizing self or non-self or binding sites for toxins
4 phospholipids: forms the fundamental structure of membranes — the phospholipid bilayer and
aids in separation of dissolved ions
proteins: transmembrane proteins are responsible for transporting ions through membranes
via facilitated diffusion or active transport
Q43
The diagram represents a cell membrane. HELP
Option A is glycolipid.
i C Option B and C are integral proteins.
Option D is the hydrophobic core of the
_ (ie
AFA D
phospholipid bilayer.
Non-polar molecules are able to move down
elses eeleleesece aa its concentration gradient across the hydro-
phobic core of the phospholipid bilayer via
simple diffusion.
Which structure allows movement of non-polar
molecules across the membrane?
‘\ Level 1000 Biology MCQ with HELPs ? 200 Frequently Examined Questions
i
TORIC GS CELLULAR PHYSIOLOGY AND BIOCHEMISTRY
6(d) Homeostasis, Hormonal Control and Cell |

Signalling
y
Ql HELP
Protein was the only food available to a mam- The body usually uses surplus, circulating
mal. If this supply of protein was only half the stores before oxidising stored substrates such
minimum required to supply its energy needs, as glycogen. The last substrate source is
the mammal would show an increase in the amino acids and proteins.
A concentration of amino acids in the blood.

B__sconcentration of insulin in the blood. Q3
C synthesis of glycogen. Which hormones promote the processes shown?
D_ihydrolysis of glycogen.
conversion | respiration | uptake of
of glycogen | of glucose | glucose by
HELP to glucose in in muscle
Glycogen is stored in the lover and muscles. liver cells liver cells cells
When the external nutrition source is inad- insulin glucagon | glucagon
equate, glycogen is hydrolysed to provide the
insulin glucagon insulin
energy required in its metabolic processes.
glucagon insulin glucagon
glucagon insulin insulin
Q2
Energy can be made available to the body in
HELP
the following ways:
The conversion of glycogen to glucose in
1 conversion of surplus amino acids and glyc-
liver cells is promoted by glucagon. The
erol to blood glucose and the mobilisation
opposite conversion applies to insulin. There-
of fat deposits which pass to the tissues
fore the answer is either C or D. This answer
for oxidation;
also applies to insulin for respiration of
2 breakdown of liver and muscle glycogen to glucose in liver cells. However, for the up-
form glucose; take of glucose by muscle cells, it is the
3 breakdown of tissue proteins to release presence of insulin that allows for this. Hence,
amino acids which are then converted into the answer is D.
glucose.
In which order does the body draw on poten- Q4
tial energy when it is being starved of food?
A 15
2 > 3 A person has poorly functioning /-cells in the
islets of Langerhans.
B1i>37>
What will be the concentration of glucose, in-
C 251- 3 sulin and glucagon in the blood after that per-
‘age
ee eens son has eaten a meal rich in carbohydrates?
WW’ Level 1000 Biology MCQ with HELPs * 204 Frequently Examined Questions
Topic 6(d) Homeostasis, Hormonal Control and Cell Signalling .| !
At which numbered points would the hormone

|| glucose |insulin |glucagon | insulin accelerate the pathways in the directions
indicated?
low
low Avetloscagntes Biel, Zeende
high Gu) 1i3candud D \2,3 am
high
HELP
HELP Insulin serves to increase the rate of glucose
uptake by increasing the number of glucose
a@— produces glucagon
. ee transporters in the plasma membrane (1), in-
B- produces insulin creasing the activities of liver enzymes that
synthesize glycogen (2), and of enzymes in
After a meal, the carbohydrates are converted adipose cells that synthesize triacylglycerols.
in the liver by insulin to glucose-6-phosphate
and finally glycogen. If the insulin is insuf-
ficient, the glucose levels will remain high. Q6
This would indicate answers A or B. As the
glucose levels in the blood are high, gluca- In a healthy mammal, which one of the follow-
gon is not required to be produced in high ing will lead indirectly to increased production
amounts.
of glycogen in liver cells?
A a reduction in insulin output
Q5 B a high glucose content in the diet
The diagram below shows some biochemical or eee rons Ve

pathways in a liver cell. Some of the points D sas; reduction in the amino acid concentra-
where hormones affect the pathways are labelled tion in the blood
AtOmo:
Liver cell
OY,
glucose glucose
,
|
glyceraldehyde
glycerol === -3-phosphate PROTEINS
free fatty .
free fatty |
acids acids > acetyl-CoA
citrate
‘A Level 1000 Biology MCQ with HELPs ? 202 Frequently Examined Questions
To —
Topic 6(d) Homeostasis, Hormonal Control and Cell Signalling |
HELP
Q9
Insulin is produced by the Islets of Langer-
What does an increase in the secretion of insu-
hans when the blood glucose level increases,
lin produce?
and serves to increase the rate of glucose
uptake from the blood into muscle cells by A a decrease in glucose metabolism
increasing the number of glucose transport- Ban increase in blood sugar level
ers in the plasma membrane. It also increases
C an increase in glucose permeability of cells
the activities of liver enzymes that synthesize
glycogen. D an increase in the conversion of glycogen
to glucose
Q7 HELP
As a result of the activity of insulin there is
Insulin is secreted by the Islets of Langerhans
A increased uptake of glucose by muscles. in the pancreas when the blood sugar level
B_ decreased uptake of glucose by cells. is high. This increases the rate of glucose
uptake from the blood into the muscle cells.
C the presence of glucose in the urine.
D deposition of fat in blood vessels.
Q10
HELP Two organs secrete substances which affect the
body.
Insulin produced increases the rate of glu-
cose uptake from the blood into muscle cells organ! 1) Sse
= == products
by increasing the number of glucose trans-
Ofgane oye = SyeTOC ICU
porters in the plasma membrane.
Negative feedback control of product 2 would
be achieved if
Qs A product 1 counteracts product 2.
Under which of the following circumstances will
B_ product 1 reinforces the effect of product
insulin be secreted?
dic
A The blood sugar level in the liver is low.
C product 2 inhibits organ 1 and product 1
B_ The blood sugar level in the hepatic portal stimulates organ 2.
vein is low.
D product 2 stimulates organ 1 and product
C The blood sugar level in the islets of 1 stimulates organ 2.
Langerhans is high.
D_ The glycogen level in the skeletal muscle HELP
is high.
For negative feedback, the presence of more
product inhibits the production of it. In C,
HELP the presence of excess product 2 would in-
Insulin is secreted by the Islets of Langerhans hibit organ 1, causing less product 1 to be
in the pancreas when the blood sugar level produced. This in turn inhibits organ 2, re-
is high. This increases the rate of glucose sulting in less product 2 being produced.
uptake from the blood into the muscle cells.
’ Level 1000 Biology MCQ with HELPs ” 203 Frequently Examined Questions
Topic 6(d) Homeostasis, Hormonal Control and Cell Signalling t
Qi11 Q13
Which homeostatic function of the liver is con- How does insulin act on its target cells?
trolled and monitored in the pancreas? A It activates enzyme conversion of glycogen
A deamination of amino acids to glucose.
B_ release of glucose B_ It alters specific receptor sites on the cell
surface membrane.
“C release of iron
C It enters the cell and stimulates transcrip-
D removal of toxins
tion of DNA.
D It stimulates the intracellular hydrolysis of
HELP lipids.
Glucose is stored in the liver as glycogen.
Glycogen can be converted to free glucose
HELP
by the process of glycogenolysis, which in-
volves the activation of a phosphorylase B-cells of the Islet of Langerhans produce
enzyme by the hormone glucagon. Gluca-
insulin directly into the blood. Receptor sites
gon is made by the pancreas and is released
on cell surface membranes bind insulin and
when the blood sugar levels fall.
this leads to changes in the permeability of
the membranes to glucose.
Q12
Homeostasis in a mammal is defined as the Q14
maintenance of a
Which function is carried out by the hormone
A constant internal environment, providing a insulin?
degree of independence from the external
A It breaks down blood glucose.
environment.
B__ It catalyses the condensation of glucose to
B__sconstant internal environment, resulting in
form glycogen.
complete dependence on the external en-
vironment. C_ It enables glucose to enter cells.
C variable internal environment, resulting D It prevents glucose from being excreted by
from a variable external environment. the kidney.
D constant internal and external environ-
ments resulting from temperature fluctua- HELP
tions.
Insulin increases the uptake rate of glucose
by cells, as well as converts glucose into
HELP glucose-6-phosphate. It is not a catalyst, as
it is not an enzyme.
Homeostasis is the maintenance of a con-
stant internal environment within an external
environment that can change. This is achieved Q15
through structural, physiological and
behavioural mechanisms that develop in the Which one of the following describes the chemi-
organism. cal nature of insulin?
A a pentose sugar
Ba _phospholipid
C a polypeptide
D a polysaccharide
HELP
Q17
Insulin, from the Islets of Langerhans in the
Which change contributes to the lowering of the
pancreas, is an albumin protein containing
blood sugar level, if a person is injected with
up to 12% of the amino acid tyrosine.
insulin?
A decrease in the permeability of cells to
Q16 glucose
The graph below illustrates the changes in blood B_ decrease in the rate of absorption of glu-
sugar concentration after a healthy man has cose from the gut
drunk a glucose solution. C increase in the rate of excretion of glucose
3 300 D increase in the synthesis of glycogen
is
we)
‘5
Shit HELP
=
oD
Insulin is a hormone produced by the pan-
= 1009 creas and it catalyses the phosphorylation of
iB} glucose to glucose phosphate, which is sub-
sequently converted to glycogen by conden-
Sb 0 sation.
time/h
Which one of the following graphs would ap- Q18

ply to a diabetic man in similar circumstances? As a result of the activity of insulin there is
A B A increased uptake of glucose by muscles.
300 300
B_ decreased uptake of glucose by liver cells.
200 200
C the presence of glucose in urine.
100 100 D depletion of fat stores.
oe 1 2 aa 1 2
HELP
C D
300 300 Insulin is produced by the beta cells in the
Islet of Langerhans in the pancreas. The
200 200
hormone produces several responses. In the
100 100 liver, it increases glycolysis and glycogen
synthesis. In the skeletal muscle, it increases
: 0 1 Som: e 0 1 2 glucose uptake, glycolysis and glycogen syn-
thesis. In adipose tissue, it increases the
storage of fat and the conversion of glucose
HELP to fat. All these have a general effect of
lowering blood glucose.
In diabetics, the rise in blood glucose above
the normal level of 80—90 mg/100 ml fails
to stimulate the production of insulin from
the pancreatic B-cells of the Islets of Langer-
hans. As a result, the glucose is not removed
from the blood to be stored in muscle cells
as glycogen, resulting in a high blood glu-
cose level for a long period of time.
Level 1000 Biology MCQ with HELPs * 205 Frequently Examined Questions
Q19 Q21
Which of the following is a sign of insulin de- Which responses are promoted by the recogni-
ficiency? tion and operation of insulin at the cellular
level?
A a low blood sugar level
Ban increased ability of the tissues to oxidise rate of uptake
conversion
glucose of glycogen ALE of
C an increased amount of glycogen stored in to glucose formation | glucose
the liver
decreased increased | decreased
D_ the excretion of sugar in the urine
decreased increased | increased
increased decreased | decreased
HELP
increased decreased | increased
If there is insulin deficiency, then excess
glucose due to an intake of food or glucose
would not be converted to glycogen and
stored. Thus, the blood glucose levels would HELP
be very high and this glucose is excreted in Insulin stimulates the conversion of glucose
the urine at the kidney. into glycogen and also makes the cell mem-
brane more permeable to glucose for faster
Q20 uptake.
The blood glucose concentration of four people

was measured over a 2.5 hour period after Q22
drinking a concentrated glucose solution. The
How does injection of insulin into
graph shows the results.
diabetics lead to a lowering of blood
350 glucose concentration?
300 person A A by decreasing the permeability
blood glucose 299 of cells to glucose
concentration/ 200 person B B by increasing the excretion of
mg100cm™~’ 150 glucose
100--
by promoting the formation of
50
the hormone glucagon
0
OF ers) aU eo, 2-0” 2,5 D__ by promoting the synthesis of
hours polysaccharides
Which person is least likely to have problems
associated with insulin secretion? HELP
Insulin stimulates the conversion
HELP of glucose into glycogen, which
After drinking a concentrated glucose solu- is a type of polysaccharide. This
tion, the glucose would be absorbed at the helps reduce the amount of
small intestine. The blood is then carried glucose in the blood.
directly to the liver by the hepatic portal vein,
where it is converted to glycogen by insulin
and stored. Thus, in a person with no prob-
lems with insulin secretion, the blood glu-
cose concentration would remain constant.
Q23 Q25
What happens in a biological control system? Which of the following can inactivate a protein
A The effector regulates the receptor. by its enzymatic action?
B The monitor fluctuates about a norm. I phosphodiesterase
C The output is modified according to the II protein phosphatase
input. III protein kinase
D_ The receptor and effector are maintained IV GTPase
in equilibrium.
I and II only
I, If and IV
HELP
II, If and IV only
A biological system is regulated by feedback o> all
Ser of the above
control, which is usually negative feedback.
The input is a substance that has an effect
on the amount of the product, which is the HELP
output.
Phosphodiesterase converts cAMP to AMP
Protein phosphatase removes phosphate from
Q24 protein.
The hormone insulin binds to the tyrosine ki- Protein kinase transfers phosphate groups
nase receptors and initiates various signal trans- from ATP to a protein.
duction pathway to generate cellular responses. GTPase hydrolyses the bound GTP on G
Which of the following shows the correct se- protein.
quence of events, following the binding of in-
sulin to the receptor?
i) phosphorylation of tyrosine kinases Q26
ii) dimerization of tyrosine kinase receptor Blood samples were taken from an individual
who had just completed a run.
activation of enzyme
Which of the following statements describes
Pee do 1h, =Lid
hormone levels found in his blood?
B il, sie
A High levels of glucagon
§ it, Th, “abel
B High levels of glucose
Dy iy 1, 1
C High levels of glycogen
D High levels of insulin
HELP
Insulin binds to a tyrosine-kinase receptor the HELP
cell membrane. The binding causes:
An individual who had just completed a run
1) tyrosine kinase receptor to dimerize will experience a fall in the blood glucose
2) the tyrosine kinase parts of the recep- level. The fall in blood glucose level will
tor add phosphates to the tyrosine tail stimulate the secretion of glucagon. The
of the receptor glucagon activity will result in the blood
glucose level increases back to 90 mg per
3) activation of insulin response protein 100 cm? of blood.
that eventually leads to the activation
of the enzyme glycogen synthase
W Level 1000 Biology MCQ with HELPs 207 Frequently Examined Questions |
Topic 6(d) Homeostasis, Hormonal Control and Cell Signalling 4
Q27 Q28
The figure below shows part of a signalling A diabetic patient has accidentally given him-
pathway in a cell. The pathway leads to the self an overdose of insulin. What is the most
activation of a gene that codes for a molecular logical treatment for this patient?
inhibitor of a cyclin-dependent kinase respon- A Give the patient intravenous insulin.
sible for moving a cell into the S phase of the
cell cycle. How would a mutation that results B Give the patient intravenous glucose.
in a non-functional Protein kinase 3 affect the C Give the patient a drug that blocks the
cell’s rate of division? action of glucagon.
D_ Give the patient a drug that stimulates the
Protein
pancreatic beta cells.
kinase 1
(Active)
HELP
Protein Protein
kinase 2 kinase 2 When there is an excessive
(Inactive) (Active) amount of insulin in the body,
it will result in the blood
Protein Protein glucose level decreasing be-
kinase 3 kinase 3 low 90 mg per 100 cm? of
(Inactive) (Active) blood (set point).
Transcription Transcription A low blood glucose level
factor Si ee factor may result in fainting but the
(Inactive) (Active) glucose level can be raised
by the consumption of car-
bohydrate-rich food which will
DNA be digested into monosac-
| charides, mostly glucose and
mRNA be absorbed into the blood.
Hence, the most logical treat-
A Cell division would proceed at a rapid rate. ment is to provide the patient
with intravenous glucose.
B Cell division would proceed at the normal
rate.
C Cell division would proceed, but at a de- Q29
creased rate.
Which of the following statements correctly de-
D_ Cell division would be completely inhib- scribes the effect of blood insulin?
ited.
Insulin level
in blood Effect
HELP
There will be an absence of the molecular a decrease in glucose
A high
inhibitor of a cyclin-dependent kinase respon- metabolism
sible for moving a cell into the S phase of an increase in
the cell cycle. Cell will continuously move B high conversion of glycogen
into S phase of the cell cycle, thus cell division to glucose
would proceed at a rapid rate.
a decrease in glucose
C l
a permeability of cells
an increase in uptake of
D ]
ria: glucose by muscle cells
Topic 6(d) Homeostasis, Hormonal Control and Cell Signalling
HELP HELP
High insulin level in blood leads to an in- An individual who has been fasting for 24
crease in glucose metabolism, an increase hours will experience a fall in the blood
in conversion of glucose to glycogen and an glucose level. The fall in blood glucose level
increase in the uptake of glucose by muscle will stimulate the secretion of glucagon. The
cells, glucagon activity will result in the blood
glucose level increases back to 90 mg per
100 cm? of blood.
Q30
The diagram shows a hormone
metabolism in humans.
which affects
Q32
Which of the following describes correctly the
action of G-protein?
H2N 1 OH A Intracellular signal molecule activates G-
protein resulting in a change in surface
configuration.
COOH gig
O I B G-protein acts as GTPase enzyme and
hydrolyses GDP to GTP
—
C G-protein linked receptor is inactivated

How does this hormone act on its target cell? when the activated G-proteins binds to a
A It activates an enzyme cascade that ampli- membrane protein.
fies the hormone signal. D_ G-protein mechanism results in multiple
B__It alters specific receptor sites on the cell cellular responses.
surface membrane.
C_ It enters the cell and binds to nuclear HELP
receptors.
When a specific signal molecule binds to the
D_ It inhibits the synthesis of cholesterol G-protein-linked receptor at the surface of
molecules. a cell, the receptor changes configuration,
binds and activates the G protein. A mol-
HELP ecule of GTP replaces the GDP on the G
protein. The activated G protein binds to and
The hormone shown in the diagram is a non- activates the enzyme which triggers the next
polar molecule. As such, it can diffuse across step in the pathway leading to the cell’s
the hydrophobic core of the phospholipid response.
bilayer into the cytoplasm and bind with
nuclear receptors.
Q33
Which of the following can activate a protein
Q31 by transferring a phosphate group to it?
Blood samples taken from an individual who
1 cAMP
had been fasting for 24 hours would have which
of the following? 2 Phosphodiesterase
high levels of insulin 3 Phosphotransferase
high levels of glucagon 4 _ protein kinase
high levels of glycogenesis A sent and, 3 Beyt2zeand 3
es
wesh
ey
=) low levels of glucagon C 2 and 4 D 3 and 4
HELP Q35
Cyclic AMP is a second messenger of many Many signal transduction pathways use second
G-protein-signalling pathways. messengers to
Phosphodiesterase converts cAMP to AMP A transport a signal through the plasma
Phosphotransferase refers to any of a class membrane.

of enzymes that catalyze the transfer of a B relay a signal from the outside to the in-
phosphate group. side of the cell.
Protein kinase transfers phosphate groups C relay a signal from the inside of the mem-
from ATP to a protein. brane throughout the cytoplasm.
D amplify the message by phosphorylating
Q34 proteins.
Which of the following responses below would
occur in a human body as a direct result of HELP
i ? : ;
eating a school lunch? Signal transduction occurs when an extracel-
lular signalling molecule activates a cell
surface receptor. In turn, this receptor alters
Pancreas intracellular molecules creating a response.
Secondary messengers are a component of
signal transduction pathway. Signals received
P Q R S at the surface of a cell by either G-protein-
more less more less linked or enzyme-linked receptors are relayed
insulin | insulin blood | blood into the cell interior (cytoplasm) by second
sugar messengers.
Liver
more glycogen T
Q36
1 l U
Protein phosphorylation is commonly involved
canoe aaa with all of the following except
A activation of G-protein linked receptors.
A R, P and T B- enzyme activation.
B Jeo area ob C regulation of transcription by extracellular
C R, Q and T signal molecules.
DR, P and U D__activation of protein kinase molecules.
HELP HELP
Food consumed will be digested into There is no protein phosphorylation in the
monosaccharides, mostly glucose and be activation of G-protein linked receptors. When
absorbed into the blood. A rise in blood a specific signal molecule binds to the G-
glucose concentration stimulates the secre- protein-linked receptor at the surface of a
tion of insulin. When bound to receptor sites cell, the receptor changes configuration, binds
of receptors on the surface membrane of cells and activates the G protein.
throughout the body, insulin stimulates an
increase in the rate of conversion of glucose
to glycogen in liver and muscle cells.
‘ Level 1000 Biology MCQ with HELPs P 240 Frequently Examined Questions
Q37 HELP
Which of the following statements BEST de- For intracellular receptors, the signalling
scribes the outcome of the negative feedback molecules that are hydrophobic can diffuse
loop in a homeostatic mechanism? across the hydrophobic core of the phos-
pholipid bilayer and bind with nuclear recep-
A Glucagon is released by the pancreas in
tor (forming a hormone-receptor complex) in
response to a drop in blood glucose con-
the cytoplasm. The hormone-receptor com-
centration below the normal level. plex, acts as a transcription factor, then enters
B_ The liver cells break down glycogen to the nucleus and bind with DNA, switching on
glucose in response to glucagon. genes and regulating transcription.
C Blood glucose level increases to the nor- For cell surface receptors, the signal mol-
mal level in response to the release of glu- ecule is complementary in shape to a spe-
cagon. cific binding site on the cell surface receptor
D_ Release of glucagon is stopped in response and binds to it. The binding of a ligand
to blood glucose concentration returning to generally causes the receptor protein to
the normal level. undergo a change in shape. For many re-
ceptor proteins, this conformation change
directly activates the receptor proteins so that
HELP it can interact with another cellular molecule
such as catalyzing the phosphorylation of
Negative feedback loop refers to a type of
intracellular proteins.
control circuit where any fluctuation from the
set point activates the control system result-
ing in a series of process which ultimately
returns conditions towards their optimum level.
That is, a change in the variable being
monitored triggers the control mechanism to
counteract the initial fluctuation.
Q38
Which of the following gives an accurate com-
parison between intracellular receptors and cell
surface receptors?
Intracellular receptors Cell surface receptors

Their ligands can either be Their ligands must be
water-soluble or lipid-soluble | lipid-soluble because they
because they do not need to | need to bind with the cell
bind with the cell membrane. | membrane.
All are single-pass All are multi-pass

transmembrane proteins. transmembrane proteins.
They may bind to DNA and They may catalyze the

act as gene regulators. phosphorylation of
intracellular proteins.
None of them act as Some of them act as
enzymes. enzymes.
® Level 1000 Biology MCQ with HELPs 244 Frequently Examined Questions
TOPIG.G CELLULAR PHYSIOLOGY AND BIOCHEMISTRY
6(e) Nervous Control
<
Q1 HELP
Myelin is a stack of specialized plasma mem-
Which one of the following identifies the role
brane sheets produced by a glial cell that
of acetylcholine in nerve physiology?
wraps itself around the axon. The myelin
A It increases the resting potential of the cell. sheath acts as an electric insulator of the
B It increases the selective permeability of the axon by preventing the transfer of ions
cell membrane. between the axonal cytoplasm and the ex-
tracellular fluids. Thus, all electrical activities
C It activates the sodium pump mechanism
in axons are confined to the nodes of Ran-
of the cell.
vier, the sites where ions can flow across the
D_ It increases the potassium concentration axonal membrane.
inside the cell.
Q3
HELP
Certain nerve gases developed for military pur-
Acetylcholine molecules released from the
poses work by producing convulsive muscular
axon terminal diffuse across the synaptic cleft
contractions upon the slightest stimulation. This
and combine with the receptor molecules in
suggests that their function is to inhibit the
the membrane of the postsynaptic neuron or
action of
muscle cell. This interaction increases the per-
meability of the membrane to sodium and A acetylcholine.
potassium ions, producing a net depolariza- B__atropine.
tion to about —15 mV from the resting po-
C cholinesterase.
tential of about —60 mV. An action potential
is thus generated. D _ eserine.
Q2 HELP
Impulses travel very rapidly along nerves from Acetylcholine is released from an excited
the leg muscles of a mammal because terminal axon depolarizes the membrane, and
is then very rapidly inactivated by the enzyme
A there is a high concentration of Nat ions cholinesterase, which is present in great con-
inside the axons. centrations in the neuromuscular junction. The
B the nerves contain myelinated fibres. inhibition of cholinesterase will result in the
there is a potential difference across the muscle being unable to restore the state of
axon membranes. polarization.
the cell bodies of the fibres are contained

within the dorsal root ganglion.
: ]
Topic 6(e) Nervous Control |
Q4 HELP
The diagram below represents the synapse be- Acetylcholine is released from the neuromus-
tween two mammalian myelinated neurones, X cular junction, triggering off an action po-
and Y. The arrows show the direction of im- tential following membrane depolarization.
pulses. This stimulates the release of calcium ions
from the sarcoplasmic reticulum (Y), leading
a)
xX Y to the ultimate release of energy from ATP
hydrolysis.
Q6_
The diagram below represents the electrical
The transmission of impulses across the syn- events within a neurone during the passage of
apse is brought about by the an action potential.
:aie |
A breakdown of the terminal membrane of X.
B_ passage of an electric current between X
and Y.
C_irelease of sodium ions from X.
D secretion of a chemical from X.
HELP
difference/mV
potential
Acetylcholine is released from X on excitation time/ms ———>
of the neurone X, and binds to the receptor
What causes the initial rising phase of an ac-
molecules on neurone Y, increasing Na* per-
tion potential in a neurone? (See X in diagram.)
meability of Y. The membrane is thus depo-
larized and an action potential is generated. A Chloride ions leaving the neurone.
B Potassium ions leaving the neurone.
Q5 C Potassium ions entering the neurone.

D Sodium ions entering the neurone.
The diagram shows the synaptic junction at a
muscle end plate.
HELP
When the neurone receives the excitatory
stimulus, there is an increase in sodium
permeability in the membrane, allowing the
entry of more sodium ions, resulting in mem-
brane depolarization.
Which chemical substances were released from Q7

the regions labelled X, Y and Z?
Curare causes paralysis of striated muscle. When
curare is applied to a nerve-muscle preparation,
Xx
(i) the muscle does not contract when the
acetylcholine | calcium ions nerve is stimulated, but
acetylcholine | sodiumions | pyruvate (ii) if a stimulus is applied directly to the
adrenaline | potassium ions | pyruvate muscle, contraction occurs.
calcium ions sodiumions_ | pyruvate
i}
4
When curare is applied only to the nerve, the HELP

muscle will contract when the nerve is stimu- The excitatory stimulus brings about the re-
lated. lease of acetylcholine, which produces an
Which one of the following correctly explains action potential, causing the release of more
the effect of curare? Ca2+ ions. Actomyosin is then formed, which
is directly responsible for muscle contraction,
A It inhibits the development of an action po-
with energy from ATP.
tential in the nerve fibre.
B_ It makes the nerve cell end-plate more per-
meable to acetylcholine. Q9
C It prevents the depolarisation of the Certain drugs act at synapses and affect the
postsynaptic membrane. action of neurotransmitter substances. The table
D It stimulates the formation of acetylcholine shows the effects of four different drugs.
at the nerve cell end-plate. drug effect
1 inhibits the enzyme cholinesterase
HELP 2 prevents the release of acetylcholine
Curare prevents the increase in membrane 3. competes with acetylcholine at receptor
permeability of the postsynaptic membrane sites
to sodium ions, thus preventing its depolar- 4 inhibits the enzyme which destroys no-
ization. radrenaline
Which two drugs would prevent a skeletal
Q8 muscle from responding to an electrical stimu-
lus in the presynaptic neurone?
The following sequence of events occurs at the
neuromuscular junction. Ar *and®2
nerve impulse -» release of V + end B 1 and 4
plate potential — W produced in Gai 2.andss
muscle fibre — X released from sarco- D 2and4
plasmic reticulum -— formation of Y
— muscle contraction
Which one of the following shows the correct HELP
sequence from V — Y? The drugs will only pre-
vent the response of the
alin Mogi l|ns.atWiera muscle to an electrical

stimulus if it prevents the
A | acetylcholine chon on pn actomyosin release of acetylcholine
potential ions and so inhibit the in-
: action calcium crease in membrane per-
o acetylcholine opiate actomyosin meability to sodium ions;
ions
and if the drug competes
action with acetylcholine at the
ions potential receptor sites.
Ici ;
Taman gouUn acetylcholine actomyosin
potential
‘WV Level 1000 Biology MCQ with HELPs Po14 Frequently Examined Questions
]
Topic 6(e) Nervous Control
Q10 A to assist in the metabolism of the cell

body
Which of the following describes the state of a
non-propagating (resting) mammalian axon? to enable the cell to regenerate after
damage
relative condition of C to facilitate rapid transmission of im-
concentration
in axoplasm permeability | cation pumps pulses
of axon In axon D to supply nutrients to the cell body
membrane membrane
active
HELP
inactive
The myelin sheath, X, serves as an
active insulator to prevent the transfer of ions
between the axonal cytoplasm and the
active extracellular fluid, thus facilitating the
rapid transmission of impulses.
HELP
The sodium ion concentration is low, whilst
Q12
that of potassium ions is high. The mem- After the initial membrane depolarisation, which
brane permeability remains low to sodium of the following is the first event leading to
ions. The cation pumps are active so that muscle fibre contraction?
sodium ions are not allowed to accumulate. A calcium ions flooding into the muscle fi-
bres
Qi1 B_ hydrolysis of glycogen reserves
The diagram below shows a motor nerve cell. C movement of actin-myosin bonds, with hy-
drolysis of ATP
D_ release of energy from mitochondria
HELP
An action potential is generated after mem-
brane depolarization, which increases the
membrane permeability to sodium ions. Cal-
cium ions are released from the sarcoplas-
mic reticulum.
Q13
Which of the following is common to all
neurones?
A a cell body which contains a nucleus
B a thick myelin sheath
C presence of nodes of Ranvier
D presence of Schwarnn cells
What is the function of the structures labelled

X?
W’ Level 1000 Biology MCQ with HELPs / 245 Frequently Examined Questions
HELP In what conditions was action potential Y re-

All neurones contain a cell body which bears corded?
a nucleus and most of the ribosomes, lyso- A __ sea-water containing excess potassium ions
somes and ER. This is the site of synthesis B__ sea-water containing insufficient potassium
of all neuronal proteins and membranes. ions
ar C sea-water containing excess sodium ions
D isotonic saline containing insufficient so-
The diagram shows the structure of a synapse. dium ions
HELP
Sodium ions are responsible for the depo-
larization of the membrane. But because the
surrounding medium is an isotonic saline de-
ficient in sodium ions, there is entry of a
lower amount of sodium ions into the axon,
resulting in a lower depolarization voltage.
Q16
What will occur if the receptor sites on the
postsynaptic membrane are blocked by a drug
Which membrane can produce either a at the neuromuscular junction?
depolarisation or a hyperpolarisation in response A inhibition of acetylcholine release
to a chemical stimulus?
B___sinhibition of cholinesterase
C muscle contraction
HELP
D muscle paralysis
The postsynaptic membrane (D) can produce
either a depolarization or hyperpolarization
depending on which neurotransmitters are re- HELP
leased from the presynaptic membrane, C. The acetylcholine that is released from the
presynaptic membrane will not be able to
Q15 bind the receptor sites on the postsynaptic
membrane and trigger off the appropriate
The diagram shows action potentials recorded contraction. This results in muscle paralysis.
from an axon of a marine invertebrate. The
action potential X was recorded in normal
sea-water. Q17
Victims of curare poisoning die of asphyxiation
because the poison causes a synaptic block at
junctions between nerves and muscles involved
in breathing.
stimulus / \
The postsynaptic membranes fail to become
depolarised because curate inhibits the action
of
A acetylcholine. B__ adrenaline.
C cholinesterase. D noradrenaline.
# Level 1000 Biology MCQ with HELPs 246 Frequently Examined Questions
]
HELP specific receptor sites on the postsynaptic

Acetylcholine is normally released from the membrane, opening ion channels and caus-
presynaptic membrane into the synaptic cleft. ing sodium ions to enter (5), depolarising the
It then diffuses across the synaptic cleft and membrane.
attaches to specific receptor sites on the
postsynaptic membrane, depolarising them.
Cholinesterase breaks down acetylcholine to
Q19
prevent over-stimulation of the postsynaptic Impulses travel very rapidly along nerves to the
membrane. Adrenaline and noradrenaline are leg muscle of a mammal.
hormones produced by the adrenal medulla
Which fact accounts for the speed at which they
that affects the circulatory system.
travel?
A A nerve impulse is an all-or-nothing phe-
Q18 nomenon.
The diagram shows the sequence of events oc- B- The nerves contain myelinated fibres.
curring as an action potential arrives at a syn- C There is a high concentration of Nat ions
apse. inside the axons.
The numbered arrows represent the movement D_ There is a potential difference across the
of substances across the membranes. axon membranes.
postsynaptic
resynaptic
Spsebeas neurone HELP
neurone
The nerves are myelinated, with unmyelinated
segments called nodes of Ranvier. The high
phospholipid content of the myelin sheath
offers electrical insulation, thus saltatory
conduction occurs as impulses ‘jump’ from
What are the substances moving across the one node to the next. This form of conduc-
membranes? tion facilitates a very rapid
transmission of impulses.
Q20
@ace
acetylcholine Which diagram illustrates the
acetylcholine Na* distribution of sodium and
Gan
acetylcholine potassium ions in a section of
an axon which is at resting
potential?
HELP
A B
As the action potential reaches the synapse, Na’ high Na’ high
ihe) Gees
the presynaptic membrane is depolarised due + + + + foes Soe
to the entry of sodium ions (1). The mem-
brane is subsequently repolarized by the exit
of potassium ions (2). The arrival of the action C D
potential causes calcium channels in the Na’ low Na’ low
membrane to open, thus calcium ions rush ++. + + aes
K‘ high @ K* low
into the synaptic knob (3). This causes the ry eee a
synaptic vesicles to fuse with the presynaptic
’ membrane, releasing acetylcholine into the
synaptic cleft (4). Acetylcholine binds to
¢
HELP Which chemical substances are released from

regions X and Y?
At resting potential the extracellular concen-
tration of sodium ions is high while the X Y
intracellular concentration of potassium ions A acetylcholine calcium ions
is high. Also, the intracellular potential is
negative with respect to the extracellular B_ acetylcholine sodium ions
potential. These are results of the action of C cholinesterase calcium ions
the sodium-potassium pump which transports D cholinesterase sodium ions
3 sodium ions out for every 2 potassium
ions transported in.
HELP
Q21 Acetylcholine is released from the synaptic

vesicles, X, in the presynaptic membrane.
The diagram shows the structure of a synapse. Calcium ions are released from the sarco-
plasmic reticulum, Y.
Q23
The diagram shows an action potential.
What is X?
A acetylcholine receptor site
B_ acetylcholine release site
C vesicle containing acetylcholine
D presynaptic membrane resting
A D potential
HELP At which point on the graph is the membrane

most permeable to sodium ions?
Acetylcholine released from synaptic vesicles
in the presynaptic membrane into the syn-
aptic cleft binds to these receptor sites (X) on HELP
the postsynaptic membrane, causing the
The opening of sodium ion gates increase
depolarisation of the membrane.
the permeability of the axon membrane to
sodium ions. As more sodium ions enter the
Q22 axon, the membrane potential increases until
it reaches a positive value.
The diagram shows the synaptic junction at a
motor end plate.
W Level 1000 Biology MCQ with HELPs 2 24g Frequently Examined Questions
Q24 What is X?
The diagram shows a motor nerve cell. A a dendron

Ban axon
C a Schwann cell
Ds neurone cytoplasm
HELP
A Schwann cell wraps itself around the nerve
axon to form the numerous concentric circles
(characteristic feature for this cell) which
comprise the myelin sheath. The space in the
middle of the circles is the axon.
Q26
Four events in the transmission of nerve im-
pulses across synapses are:
1 depolarisation of the presynaptic membrane
2 propagation of postsynaptic action poten-
D
tial
3 hydrolysis of transmitter substance
Which part of the cell contains a transmitter
substance? 4 rupturing of synaptic vesicles
In which sequence do these events occur?
HELP first ————————_>

The synaptic end bulb contains synaptic
vesicles which hold acetylcholine, a transmit-
ter substance. When this synaptic end bulb
synapses with a dendrite of another neurone,
it is acetylcholine that sets up an action
potential in the postsynaptic membrane in
response to an action potential in the pr-
esynaptic membrane. HELP
Depolarisation of presynaptic membrane is
Q25 the first step in the sequence. This is followed
by excitation-secretion coupling, which is, in
The diagram represents a transverse section effect, the rupturing of synaptic vesicles. (From
through a neurone as seen under an electron these two steps, it is easy to make out that
microscope. the answer is event 1, 4, 2 and 3).
(G27 Q29
During some surgical operations the drug curare, The diagram shows a synapse.
which has a similar shape to acetylcholine, is
injected into the muscles to relax them.
Why do the muscles remain relaxed?
A calcium ions cannot be taken up by mem-
brane vesicles
B_ cholinesterase cannot remove acetylcholine
C postsynaptic membrane receptors are
blocked
D sodium channels remain open In people with low blood calcium levels, which
structures will be unable to fuse?
HELP A land zZ
Acetylcholine is a neurotransmitter. It trans- B Z and 3

mits messages across the synapse (excitary G 2 and 4
synapse). The drug curare blocks the postsyn-
D 3 and 4
aptic membrane receptors so that the muscle
will relax.
HELP
Q28 The transfer of nervous impulses across a

synapse. Calcium ions are required to stimu-
The graph shows the changes in membrane per- late the fusion of the synaptic vesicles (struc-
meability when a stimulus X is applied to a ture 2) to the presynaptic membrane (struc-
neurone. Where is the point of maximum per- ture 3) before releasing the neurotransmitter
meability to sodium ions? molecules.
Q30
The diagram shows part of an axon.
membrane
potential X
(mV)
As an action potential reaches point X, in which

HELP direction do K* ions move and by what pro-
cess?
A sodium ions moving in rapidly due to
increased permeability X process
B no net movement of ions (sodium and into axon active transport

potassium) into axon diffusion
C potassium ions moving out rapidly out of axon active transport
D ion exchange complete (sodium in, oS
onout of axon diffusion
potassium out), sodium pumps work-
ing again
# Level 1000 Biology MCQ with HELPs / 299 Frequently Examined Questions
HELP HELP
When the action potential reaches X, the An action potential depolarises the presyn-
depolarisation of the axon membrane facili- aptic membrane and triggers an influx of
tates the K* ions to diffuse out of the axon Ca?*. This causes the synaptic vesicles con-
as the sodium ions rush inwards. taining neurotransmitter to fuse with the
presynaptic membrane and release the neu-
Q31 rotransmitters into the synaptic cleft.
The diagram shows a myelinated axon. The binding of neurotransmitter to its specific
receptors opens the ion channels and postsyn-
aptic action potential is propagated in the
postsynaptic membrane. The neurotransmit-
a ters are quickly degraded by enzymes, clos-
ing the ion channels and terminating the
synaptic response.
How does the myelin sheath increase the speed
of the impulse transmission?
A It ensures that the ions are kept close to Q33
the axon membrane in region Y.
The figure shows the relative irritability of
B__ It insulates the axon, so increasing the po- stimulated nerve fibre.
tential at regions X and Z.
Increasing refractory
C It promotes a change in potential difference irritability period
in region Y.
stimulus
D It restricts a change in potential difference
to regions X and Z. normal
level
HELP
The myelin sheath is an electrical insulator
that provides resistance to current flow be-
tween the axoplasm and external fluid. Thus, Time
the action potential will move from region
What would happen if a second stimulus is
X to Z, without passing through Y. There is
applied during the period XY?
no increase in potential.
A A stimulus below the normal threshold will
Q32 cause a response.
B- The fibre will respond repeatedly to a
Four events in the transmission of nerve im- single stimulus.
pulses across synapses are:
C The reaction to the stimulus will be greater
1. depolarisation of the presynaptic membrane than normal.
2. propagation of postsynaptic action poten- D_ The reaction will occur more quickly than
tial normal.
3. hydrolysis of transmitter substance
4. rupturing of synaptic vesicles HELP
In which sequence do these events occur? Refractory period is the period following the
A dl 3 2 4 passage of an action potential when the axon
is no longer excitable or only excitable pro-
B 1 4 2 3 vided that the stimulus is stronger than
C 4 it 3 uy normal. As shown in the figure, the irritability
eee Ss 2 level of the nerve fibre is below its normal
value.
Topic 6(e) Nervous Control f
Period X is after the refractory period and as When resting axon is treated with dinitrophe-
shown in the figure, the irritability level of the nol that prevents the production of ATP,
nerve fibre is above its normal value. This sodium-potassium pump is no longer able
suggested that a stimulus below the normal to actively transport 3 Na* out of the cell
threshold will cause a response. and 2 K* into the cell. Thus the charge outside
the axon membrane becomes less positive.
Q34
Dinitrophenol is a metabolic poison that pre-
Q35
vents the production of ATP. What will happen The drug atropine binds antagonistically to
if a resting axon is treated with such a poison? acetylcholine receptors. Nerve gases inhibit the
A The charge inside the axon membrane activity of cholinesterase.
becomes more negative. What will be the effects of these substances on
B The charge outside the axon membrane the rate of transmission of impulses across a
becomes less positive. synapse?
C The charge inside the axon membrane atropine nerve gas

becomes less positive. A increased increased
D_ The charge outside the axon membrane B__ increased reduced
does not change. C reduced increased
D reduced reduced
HELP
In a resting axon, the sodium-potassium pump HELP
uses ATP to actively transport 3 Na* out of When the drug atropine binds antagonisti-
the cell and 2 K* into the cell. Thus the cally to acetylcholine receptors, the Na*
charge outside the axon membrane becomes channels would remain closed, thus there will
more positive. In addition, the cytoplasm
be no transmission of impulses across the
contains large, negatively charged protein synapse.
molecules that cannot cross the surface
membrane and thus are a pool of internal Nerve gases inhibit the activity of cholinest-
negative charge that remains in the cell. erase, an enzyme that splits each acetylcho-
line molecule into acetate and choline. Thus
Hence, in a resting axon, the charge distri-
the acetylcholine remains bound to the re-
bution inside and outside the axon mem-
ceptors, the Na* channels would remain
brane is as follows:
open, and action potentials would fire con-
tinuously. Hence, there will be increased
transmission of impulses across the synapse.
Q36
When a stimulus arrives at a nerve ending, the
membrane becomes depolarized. The events
during depolarization are listed below.
1. K* channels open, Na* channels close.
INSIDE [K+] = (wary [Ar] 2. Na* channels open and Na* floods in
CELL 1450mM 15mM 100mM
3. Potential difference inside the membrane
is +40 mV compared to the outside.
4. Potential difference inside the membrane
is -65 mV compared to the outside.
What is the correct order of events? Q38

[Nee gelgy Aes ya Bo a 3
The diagram below shows part of an electron
SCs ame Ie? D 4, 2, 3;1 micrograph of a neuron. Name the portion of
the neuron that forms the membrane which
HELP fuses with structures A.
At resting potential, the potential difference
inside the membrane is -65 mV compared
to the outside. When a stimulus arrives at
a nerve ending, gated Na* channels open
and Na* diffuse rapidly into the neurone
down their electrochemical gradient. When
the potential difference inside the membrane
is +40 mV compared to the outside. The
gated K* channels open and gated Na*
channels close.
Q37
Which is a correct description of the role of
calcium ions in the neuromuscular system?
A exchanged with sodium ions through co-
transport channels at axon surfaces during
the reestablishment of a resting potential
after an action potential
moved in by diffusion through gated ion
channels in pre-synaptic membranes of ex- A Terminal button
citatory neurones causing vesicles to move B Axon
to pre-synaptic membrane as an impulse
(é Dendrite
arrives
exchanged with chloride ions at the post- D Synapse
synaptic membrane, in changing membrane
potential in inhibitory neurones HELP
actively pumped out of axons at nodes of Structure A refers to synaptic vesicles con-
Ranvier of myelinated neurones, being the taining neurotransmitters that fuse with the
main cause of the potential difference that pre-synaptic membrane of the terminal but-
is maintained during the resting potential tons.
HELP
The arrival of an impulse at the synaptic knob
~
Axan terminals
causes gated Ca?* channels in the presyn-

‘ Node of Ranvier
aptic membrane to open. Ca?* rush into the Myelin | x
cytoplasm of the presynaptic neurone from
the synaptic cleft. The influx of Ca?* causes
vesicles with neurotransmitters to move to the
presynaptic membrane and fuse with it,
emptying their contents into the synaptic cleft
by exocytosis.
W Level 1000 Biology MCQ with HELPs 7 223 Frequently Examined Questions
Topic 6(e) Nervous Control f
Q39
What do X, Y and Z in the above figure of an action potential represent?
potential
Membrane
(mV)
JURIGUIBUL
JO
sod
uadg
win
spauueyo
z
X Y Z
Change in membrane Resting membrane
Na* permeability
potential potential
Change in
Na* permeability Ca?* permeability
membrane potential
Change in membrane
Na* permeability K* permeability
potential
Resting membrane
Ca?* permeability K* permeability
potential
Q40
The vertebrate system conducts impulses in only HELP
one direction. This one-way conductance across Impulse is passed in one direction only, as
synapse occurs neurotransmitter substance can only be re-
A because the Nat-K* pump moves ions in leased from one side of synapse from the
one direction. pre-synaptic neuron to the post-synaptic
neuron.
B as a result of voltage-gated sodium chan-
nels found in the vertebrate system.
because only the postsynaptic membranes
can bind neurotransmitters.
because vertebrate nerve cells have den-
drites.
‘ Level 1000 Biology MCQ with HELPs P 204 Frequently Examined Questions
4

Q41 to flow out of the neurone down their elec-
trochemical gradient. The outflow of K*
A particular type of autoimmune disease causes restores the resting potential at that part of
antibodies to destroy acetylcholine receptors of neurone and the membrane is said to be
neurons. repolarised.
What effect will this have on the functioning of
the nervous system?
A Presynaptic neurons will be unable to re-
Q43
lease neurotransmitters into the synaptic The post-synaptic membrane of a nerve may be
clefts. stimulated by certain neurotransmitters to per-
B_ Neurons will be unable to propagate action mit the influx of negative chloride ions into the
potentials along their axons. cell. This process will result in
C Depolarized neurons will be unable to A membrane depolarization.

reestablish an ionic gradient across their Ban action potential.
membranes. C the production of an IPSP.
D_Postsynaptic neurons will be unable to D_ the production of an EPSP.
detect signals from presynaptic neurons.
HELP
HELP
At the inhibitory synapses, arrival of neu-
If acetylcholine receptors of neurons are rotransmitter at the postsynaptic membrane
destroyed, the postsynaptic neurons will be causes the entry of Cl and the efflux of K*.
unable to detect signals from presynaptic The interior of the postsynaptic neurone
neurons. This is because the acetylcholine is becomes even more negative and the pas-
unable to bind to the acetylcholine receptors sage of an action potential is inhibited. This
on the postsynaptic membrane, the Na* chan- increased negativity is called an inhibitory
nels on postsynaptic membrane will remain postsynaptic potential (IPSP).
close, and no action potentials will be gen-
erated at the postsynaptic neurons.
Q44
Q42 Which axon would transmit an action potential
most rapidly?
During an action potential, how is the resting
potential restored? A 1mm diameter neuron lacking myelin.
A by an increase in the membrane’s perme- B 1mm diameter neuron with myelin.

ability to potassium and chloride ions C 2 mm diameter neuron lacking myelin.
B__ by the opening of sodium activation gates D 2 mm diameter neuron with myelin
C_ by the action of the sodium-potassium
pump HELP
D__iby the opening of voltage-sensitive potas- Speed of transmission of action potential in
sium channels and the closing of sodium myelinated neurones is faster (by up to 50x)
activation gates than continuous conduction in unmyelinated
neurones of the same diameter. In addition,
the wider the diameter of the axon, the lower
HELP
is the resistance offered by its axoplasm and
At the peak of the action potential, voltage- the faster the speed of transmission of the
sensitive Na* channels close and the volt- action potential.
‘age-sensitive K* channels open allowing K*
Q45 HELP
Neurones P and Q
The figure below shows the effect of impulses
are the presynaptic
from neurones P and Q on the production of an
neurones while neu-
action potential in neurone A.
rone A is the postsyn-
aptic neurone. The
: oe ee release of neu-
rotransmitter in re-
sponse to a single
os Neurone A action potential is
usually not sufficient
to develop an action
potential in a
postsynaptic neu-
rone. Normally sev-
eral vesicles with
Action potentials in __ Seale
P —l—1—_1 eos neurotransmitters
neurones P and Q Q have to be released
before the threshold
potential required to
propagate an action
potential is achieved.
Membrane This addition effect in
Potential in Bis the postsynaptic
RRL membrane is known
30 as summation.
Graph X shows tem-
100 Oooo poral summation.
The synaptic knob of
¥ presynaptic neuron P
does not release
enough neurotrans-
mitter for an action
potential but a 2% and 3% impulse are
released by the same knob quickly after the
1%. The EPSP created by successive impulses
add together sufficiently for an action poten-
tial to be produced in postsynaptic neurone
Spatial Temporal
A.
summation summation
Graph Y shows spatial summation. The
Temporal Spatial synaptic knobs of presynaptic neuron P and
summation summation
Q release sufficient neurotransmitters to set
up an action potential. The EPSPs produced
by the different synapses add together at the
same time, generating an action potential in
postsynaptic neurone A.
Q46
The diagram below represents an impulse path-
way.
Nerve gas interferes with the action of an en-

zyme that breaks down acetylcholine.
At which location does this inhibiting effect of
the nerve gas occur?
A 1
Dae
C3
D 4
HELP
Location | refers to the nucleus in the cell
body of the presynaptic neuron.
Location 2 refers to the axon.
Location 3 refers to the synaptic cleft.
Location 4 refers to the myelin shealth.
Acetylcholinesterase is an enzyme that breaks
down acetylcholine into acetate and choline.
Acetylcholinesterase is found in the synaptic
cleft.
‘NX Level 1000 Biology MCQ with HELPs ? 907 Frequently Examined Questions
OEIC
7 Diversity and Evolution
E.
QI Q2
The graph below shows the effect of radiation The frequency of a mutant gene in a popula-
on two small inbreeding populations of Droso- tion would be likely to increase if
phila, derived from the same parental stock. A the gene were selectively advantageous.
100 B the gene were dominant.

C the gene were sex-linked.
15 Pea ee D_ the population increased.
PS <a continuous exposure
& Ma to gamma radiation HELP

Each gene probably has its own character-
istic mutational behaviour. Some genes un-
dergo mutations more frequently than others
2
lethal
mutations
percentage in the same organisation and are called
control-no exposure
unstable or mutable. This gene is likely to
mutate if its mutant form will allow the
25 50 75 100 125 population to adapt successfully in the en-
generations vironment.
What causes the rise in graph 2?
A spontaneous mutation in a small gene pool Q3
B natural selection Why are some antibiotics, such as penicillin,
Ca decrease in genetic drift no longer effective in the treatment of certain
: : sete j ia?
D an increase in the background radiation diseases caused by bacteria’
A The antibiotic causes bacteria to mutate
into resistant forms.
HELP
ose B_ Some bacteria possess inheritable resistance
Spontaneous mutations are those that occur to the antibiotic.
without a known cause. They may be truly
spontaneous, resulting from an inherent low C Human populations have developed anti-
level of metabolic errors, i.e. mistakes during bodies which make the antibiotic ineffec-
DNA replication, or because of mutagenic wie
agents in the environment, which is probably D_ Through natural selection, human popula-
not the cause in this case. tions have become resistant to the effects
of the antibiotic.
‘ Level 1000 Biology MCQ with HELPs ? 228 Frequently Examined Questions 3 |
Topic 7 Diversity and Evolution
HELP Q6
Some bacteria are capable of altering their
Which of the following increases the number
genome to that which will code for proteins
of different alleles in a population?
that can confer resistance to the antibiotics.
A selection pressure (antibiotics) encourages A crossing over
this mutation. B gene mutation
C random fusion of gametes
Q4 D___reassortment of chromosomes in meiosis
Which of the following increases variation
within a gene pool?
HELP
A chromosome inversion
All the other options increase the number of
B scrossing over ways the alleles are combined but only gene
C gene mutation mutation increases the number of different
alleles in a population.
D random fusion of gametes
HELP
Q7
Gene mutations are spontaneous events
The graph shows the effect of pesticide treat-
which result in the alteration of existing genes ment on houseflies over a number of years. A
and the occurrence of new sequences. standard amount of pesticide was used each year
in summer.
100
Q5
80
The decline in sickle cell anaemia among North
Americans of African origin is thought to be due 60
to an absence of selection pressure by malaria. 40
survival
%
Which other factor has had the most influence 20
in this decline?
A new mutations to the sickle cell allele ZL 4 6" “S10 12314 To-18)
20
B outbreeding with other races time/years
C new mutations from the sickle cell allele How is the effect of the pesticide best explained?
D inbreeding within their community A A few resistant flies reproduced more suc-
cessfully and the resistance allele increased
in frequency.
HELP B At every generation an increasing propor-
Inbreeding weakens the genotype within a tion of flies mutated to become resistant.
population. By outbreeding with other races,
C Repeated exposure to the pesticide caused
there is increased genetic variation, leading
the flies to become more resistant.
to higher chance of acquiring resistance to
malaria. D__iThe allele for resistance mutated from the
recessive form to the dominant form.
,
HELP Q9 a ee.
Percentage of survival increases steadily from Modifications in the organisation of the basic
below 20% to a full 100% over a period of pentadacty! limb structure found in vertebrates
20 years. This shows that the resistance was provides good evidence for the principle of
total by the end of the tests.
A adaptive radiation.
B convergent evolution.
Q8 C genetic drift.
The diagram below represents the proportions D_ inheritance of acquired characters.
of a population of new-born deer calves falling
into various birth weight classes. The graph
superimposed on the diagram represents mor- HELP
tality in relation to birth weight.
The basic pentadactyl limb structure found
20 in vertebrates subscribes to the idea that all
100
members within each of these groups are in
Pa 70
ie) e some way related to one another. The ho-
5 50 &
= 15 o mologues of a single basic type, showing
a. 30s differences through adaptation to different
a 1) &
s oak environmental conditions and modes of life,
10 = are said to show divergent evolution or
5 10 £
7 =€
adaptive radiation.
Q10 ba St
3
2
Which one of the following pairs represents
analogous features?
PN wae a Oh te 90 10 1
birth weight/kilograms A elephant tusks and human incisors
From the information given which one of the B_ insect wing and bat wing
following interpretations is correct? C teleost erythrocyte and mammalian eryth-
A Birth weight is undergoing stabilising se- rocyte
lection. D_ mole fore-limb and bird wing
B_ Birth weight is an example of discontinu-
ous variation.
HELP
C Birth weight is inversely proportional to
mortality. The insect wing and bat wing are similar by
analogy, i.e. they serve only the same pur
D_sBirth weight is genetically linked to mor- pose. But the similarity ceases there because
tality. they have no common structural feature. (In
contrast, homology implies structural and
HELP developmental likeness.)
The diagram and graph shows that newborn

deer calves that fall within the 6-8 kg range
have the lowest mortality. This results in
stabilising selection, where a selection pres-
sure towards a particular range exists.
‘N Level 1000 Biology MCQ with HELPs 239 Frequently Examined Questions
Topic 7 Diversity and Evolution |
Q11 Q13
In haemoglobin, the amino acid sequence of the Which one of the following represents an ho-
beta () polypeptide chains differs among the mologous evolutionary feature?
species which possess the molecule. The beta A pentadactyl limb and arthropod claw
chains of the species shown in the table below B molluscan eye and vertebrate eye
were analysed. The number of amino acid dif-
ferences between Man and each of the species C sperm tail and tadpole tail
was counted and ranged between 8 and 127. D fish haemoglobin and reptile haemoglobin
Which one of the following shows the differ-
ences which would be consistent with the pro-
HELP
posed evolutionary relationships between the
organisms? Homologous features imply structural and de-
velopmental similarities, where the parts con-
amino acid differences cerned may not perform the same functions.
dle earth- Giga iene: rhesus This is as in the case of the fish and reptile
worm monkey haemoglobin.
Q14
67 ANS) 27, NAS
MAH 67 LAS 8
15} WARY 8 67 Two populations of a given species will only
8 67 ALS) 2, evolve into two distinct species if they are
subjected to
A _ geographical isolation.
HELP
B_ disruptive selection.
The proposed evolutionary relationship be-
C genetic isolation.
tween the organism is such that the rhesus
monkey is most closely related to man, fol- D stabilising selection.
lowed by the dog, frog, earthworm, and the
lamprey as the least related to man. The
HELP
amino acid differences are thus the greatest
for the least related organism. The evolution of a particular species into 2
distinct ones takes place over a very long
period of time. In such an event, the DNA
Q12 sequence of the species undergoes different
mutations, ultimately acquiring its own dis-
Which one of the terms below correctly de-
tinct genotype.
scribes the relationships between the flight
organs of the following animals: locust, bat,
swallow and flying fish? Q15
A analogous B homologous Which one of the following describes the ex-
C homozygous D = monotypic ploitation of new ecological niches by organ-
isms?
A adaptive radiation
HELP
B_ conservative evolution
The flight organs of the locust, bat, swallow
and fish are similar by analogy, i.e. they serve C convergent evolution
only the same purpose. But they have no D natural selection
common structural feature.
‘N Level 1000 Biology MCQ with HELPs P 034 Frequently Examined Questions
HELP HELP
The homologous of a single basic type, show- Organisms belonging to different species will
ing differences through adaptation to differ- not be able to produce fertile offspring. Thus,
ent environmental conditions and modes of by mating the two, it is possible to distin-
life, show divergent evolution, or adaptive guish if they belong to the same species.
radiation.
Q18
Q16 The following observations refer to evolution.
Three forms of the peppered moth, Bistan 1 Inherited variations which are ‘favoured’ in
betularia, namely the melanic form, the pale particular environment are passed on.
form, and a form intermediate between these
two, are found in Britain today. 2 There is a struggle for existence.
The melanic form was first observed in 1848 3 In time, ‘favoured’ inherited variations may
and its frequency subsequently increased. This accumulate causing gradual changes in the
is thought to be the result of organism.
A adaptive radiation. 4 Although populations tend to overproduce,

they remain more or less constant in num-
B convergent evolution. bers from generation to generation.
C_ divergent evolution. In what sequence should the statements be
D natural selection. placed to support Darwin’s theory of evolution?
A dhe RPA aye B Dis) Nees
HELP G iy dhe oe D ze A A
Natural selection occurs when a species
changes by becoming increasingly adapted HELP
to its surroundings and ultimately becoming
a new species. The melanic form increased The sequence of the statements is in Darwin's
because it could survive best in industrialised theory of evolution, describing how natural
Britain. selection in organisms ensures that only the
fittest survive.
Q17
Q19
An inter-breeding population of finches became
separated geographically, forming two isolated Five species, P, Q, R, S and T, possess the
groups. Each group then became subject to enzyme cytochrome c oxidase. The primary
different selective pressures. One group was structure of the enzyme was determined for each
then introduced into the habitat of the other. species. The number of amino acid differences
between species is given in the table.
Which one of the following would determine
whether they now formed two distinct species?
A They had been separated for more than
three million years.
B_ They failed to produce fertile F, hybrids.
C They showed marked differences in the
uKs Fanaa
shape of their beaks.
21,10 40
D_ Their plumage had become markedly dif-
ferent. Which diagram represents the probable evolu-
tionary relationships between these species?
X Level 1000 Biology MCQ with HELPs / 2392 Frequently Examined Questions
HELP
POR ST PQ RST The natural system of classification traces the
evolutionary relationships between organisms
whilst the artificial system is based on phe-
notypic characters.
POR SE “POR ST
Q22
Human blood, when mixed with antibodies to
human blood, will give maximum precipitation.
If another animal’s blood is mixed with anti-
HELP bodies to human blood, the percentage of pre-
The greater the number of amino acid dif- cipitation indicates how similar the animal is
ferences between the species, the more dif- to a human. The following experimental results
ferent they are. Q and R bear the least were obtained.
number of amino acid differences and are species: H 100%; M 37%; N 75%;
the closest in the diagram.
O 79%; P 17%
Which phylogeny would fit these results?
Q20 A B
Which one of the following lists three homolo- HON MP HONM P
gous structures?
A bird leg, dolphin flipper, fish pectoral fin
C D
B- whale flipper, bat wing, lizard front leg
C locust wing, bat wing, bird wing
D crab claw, human hand, scorpion pincer
HELP HELP
Homologous features have structural and de- The higher percentage of precipitation, the
velopmental similarities, but the parts con- more similar it is to a human. Thus, H, O
cerned may not perform the same function. and N are the most closely related.
Q21 Q23
Which one of the following statements describes Which of the following statements could not be
a feature of a natural system of classification used to describe a species?
which an artificial system does not have? A a group of organisms showing distinctly
A A natural system of classification is based similar autosomes
on phenotypic characters. Ba group of organisms showing analogous
BA natural system of classification is based body structures
on analogous structures. C a group of organisms capable of mating to
C_ A natural system of classification is based produce viable offspring
on cytological characters. Da group of organisms sharing the same eco-
D_ A natural system of classification is based logical niche
on evolutionary relationships between or-
ganisms.
|
|
J
Topic 7 Diversity and Evolution Y
HELP Q26
Analogous structures only serve the same Some statements concerning evolution are listed
purpose but may not have any common struc- below.
tural feature. This alone cannot be used to
describe a species. 1 More offspring are produced than can
possibly survive to sexual maturity.
Q24 2 Individuals in a sexually reproducing popu-

lation are different.
Which of the following statements could explain 3 The fossil record shows that many species
the absence of native placental mammals in have become extinct.
Australia?
4 Offspring tend to resemble their parents.
A Marsupial mammals are well adapted to
their niches. 5 Characteristics acquired during an
organism’s life time are passed to its off-
B Geographical isolation prevented an inva-
spring.
sion by placental mammals.
Which of these statements form the basis of
C The environmental conditions were unsuit-
Darwin's theory of evolution by natural selec-
able for the evolution of placental mam-
tion?
mals.
A’ “t)2and3 B 1° 2-and4
D Widespread disease eradicated placental
mammals in Australia at an early stage in GC 1 4canes D .2).39 and4
their evolution.
HELP
HELP Darwin's theory of evolution describes how
The land bridge that connected North America organisms evolve certain characteristics that
and Australia was broken before the placen- help them to adapt to their surroundings,
tal animals could establish themselves in Aus- where only the fittest will survive.
tralia.
Q27
Q25 Which of the following statements about natu-
Which of the following ideas was not part of ral selection is not true?
Charles Darwin’s theory of evolution by natural A It can stabilize a gene pool.
selection?
B_ It can change a gene pool.
A Organisms produce more offspring than the
C It can improve the adaptation of species.
environment can support.
D It can increase mutation rate.
B Variation between individuals arises by
gene mutation.
C Only those individuals best adapted to the HELP
environment survive and reproduce. The mutation rate of a genome is not in-
D Individuals compete for scarce resources. creased during natural selection. Note that
mutation is a spontaneous event whereas a
selection pressure is a constant factor im-
HELP posed on a species.
Darwin did not describe natural selection as
resulting in genetic variations between indi-
viduals due to mutations in the genome.
Q28 Q30
All the alleles present in the gametes of a sexu- In which situation would evolution be slowest
ally reproducing population are known as the for an interbreeding population?
population’s
migration selection variation due
A gene complex. pressure to mutation
B gene frequency. A absent high high
C gene pool. B absent low low
D genome. C high high low
D high low high
HELP
The gene pool of a population represents all
the alleles in the gametes responsible for the
HELP
For the Hardy-Weinberg equilibrium to be
various genotypes possible in the popula-
maintained and evolution not to occur, there
tion.
has to be a large population size, isolation
from other populations (i.e. no migration),
Q29 no net mutations, random mating and no
selection pressure.
The diagram shows a summary of Darwin’s
theory of natural selection.
Q31
population numbers
A single species evolves into several species
remain constant
which occupy different habitats. What describes
this evolutionary process?
A adaptive radiation
‘Natural Selection’ B _sconvergent evolution
Which statements should be placed in boxes 1, C directional selection
Zoand 3?
D mutation
There is a Variation Individuals

struggle is shown show great HELP
for in all reproductive
existence| |populations capacity Adaptive radiation is the emergence of many
diversely adapted species from a common
A il 2 3 ancestor.
B 2 1 3
C 2 3 1
D 3 il 2 Q32
In a given phylum, which group contains the
greatest number of species?
HELP
A class B_ family
Darwin’s theory of evolution of natural se-
C genus D order
lection describes how there is variation among
populations under the selection pressure of
the various habitats, so that only the fittest HELP
will survive. The levels of classification from the broadest
to the narrowest are kingdom, phylum, class,
order, family, genus, and species.
WW Level 1000 Biology MCQ with HELPs 7 235 Frequently Examined Questions |
j
Q33 Q35
The Galapagos Islands are a group of volcanic The following observations refer to evolution.
islands in the eastern Pacific Ocean, about 1000 1 Inherited variations which are ‘favoured’ in
km from South America. Thirteen species of a particular environment are passed on.
finch are found on the islands; they resemble
each other closely but differ in their feeding 2 There is a struggle for existence.
‘habits and in the shape of their beaks. 3 In time, ‘favoured’ inherited variations may
Assuming that an ancestral stock of finches accumulate causing gradual changes in the
came from the mainland, what is the most likely species.
explanation for the existence of similar but 4 Although populations tend to overproduce,
distinct species of Galapagos finches? they remain more or less constant in num-
A Finches developed different kinds of beak bers from generation to generation.
in order to feed on different kinds of food. In which sequence should these be placed to
B_ Finches evolved separately according to the support Darwin's theory of evolution by natural
habitat in which they settled. selection?
C Finches from the mainland bred with a aD

resident population of a related species and
A 1 2 3 4
produced new genotypes.
B 2 1 3 -
D_ Finches underwent convergent evolution to
produce very similar species. G 3 i zt Z.
D + 2 a 3
HELP
This is a reasonable deduction since the HELP
various species differ in their feeding habits The observations in this order form the basis
and hence the shape of their beaks, which for Darwin’s theory of evolution.
were adapted to different kinds of food.
Q36
Q34 Which of the following has evolved mainly as
Which of the following describes the process of a result of artificial selection?
natural selection?
A darker colouring of the peppered moth near
A change from simple to more complex or- industrial areas
ganisms
B__ increased production of antibiotics by the
B_ differential reproductive success between fungus Penicillium sp.
genotypes
C increased resistance of houseflies to the in-
C increase in the size of a population secticide DDT
D occurrence of new mutations D_ increased tolerance of lichens to heavy
metals on tree bark around mine workings
HELP
Natural selection is wherecertain genotypes HELP
that are better adapted to
survive and repro- Artificial selection is the direct selective breed-
duce in the environment have a higher re- ing of certain organisms that have certain
productive success, henceincreasing the fre- properties. The other options are natural se-
quencies of these genotypes. lection processes due to human factors.
|
|
Q37 To which order do these crocodiles belong?

In the classification of organisms, which of the A Chordata B Crocodylidae
following is the correct hierarchy of taxonomic C _ Loricata D_ Reptilia
groups?
smallest _——__» largest Ber

Kingdom Animalia
genus class order phylum Phylum Chordata
genus order phylum class Class Reptilia
family order class phylum Order Loricata
phylum order family class Family Crocodylidae
Genus Crocodylus
HELP Q40
The smallest group here should start with
What is the best characteristic for determining
genus. The answer is either C or D. The next
whether sexually reproducing flowering plants
smallest cannot possibly be phylum, so D is
from separate populations are members of the
also an incorrect answer.
same species?
A ability to cross-fertilise
Q38 B__ ability to cross-pollinate
In which taxonomic group are all the organisms C occupation of similar niches
most similar to each other?
D similarity of flower structure
A class B_ family
C genus D order
HELP
Flowering plants from the same species must
HELP be capable of interbreeding and having suc-
Candidates should remember that genus is cessful fertilisation to produce fertile offspring.
the smallest of these taxonomic groups so
more characteristics of the organisms in this
group would be the most similar, rather than
Q41
in the larger groups that would have more When organochlorine insecticides such as DDT
variety. were in widespread use, mosquitoes in malarial
regions developed resistance more rapidly than
did houseflies in Britain.
Q39 What could account for the dif-
The chart shows the classification of two spe- ference in the rates of the devel-
cies of crocodile. opment of resistance?
A Houseflies produce more
Animalia generations a year.
Chordata B More insecticide was used in
Reptilia Britain.
Loricata
C More insecticide was used in
Crocodylidae malarial regions.
Crocodylus
D Mosquitoes show fewer ran-
Crocodylus niloticus Nile crocodile
dom mutations per genera-
Crocodylus porosus Salt water crocodile
tion.
W Level 1000 Biology MCQ with HELPs / 237 Frequently Examined Questions |
4
HELP
Candidates are reminded that increased use
of insecticides causes the mosquitoes to
evolve and develop better resistance. The
increased use would happen in malarial
regions where the mosquitoes are carriers of
the malaria-causing parasite.
Qa42
The diagram below shows the frequency and
distribution of four Littorina species (peri-
winkles) on a rocky shore. All feed in a snail-like
manner by grazing on algae.
Il. ngHioides ee
Splash zone
Upper shore
Highest spring tides
Mean high water
Highest neap tides
Middle shore
Lowest neap tides
Mean low water
Lowest spring tides
Lower shore
L. Littoralis jk ne
Which one of the following factors could not

directly contribute to this distribution pattern?
A variation in the tolerance of each species
to desiccation
B competition between species for different
feeding niches
C the photoperiod and seasonal change in day
length
D the differential selection of periwinkles by
predators
HELP
The distribution of the Littorina species is
largely due to the interaction between this
species and other organisms or the environ-
ment.
‘ Level 1000 Biology MCQ with HELPs ? 238 Frequently Examined Questions
8 Isolating, Cloning and Sequencing DNA
E
Qi 1. To obtain a genetic linkage map of

human genome. This involves the iden-
For what purpose is the polymerase chain reac- tification of thousands of genetic
tion used? markers and their localization along the
A to cut DNA autosomal and sex chromosomes in
human beings.
B~ to join DNA sequences
2. To obtain the DNA sequence of the
C to produce DNA
entire human genome.
D to clone cells
Q3
HELP
The diagram shows the results of electrophore-
The polymerase chain reaction (PCR) is a
sis of DNA fragments from four members of a
method for amplifying a specific DNA se-
family R, S, V, W and another male X, who
quences (selective amplification) in vitro.
claims that he is actually the father of person
R.
2 Son DaughterHusband Wife Male
What is not expected to be an outcome of the R S V Ww xX
Human
A
Genome Project (HGP)?
identification of all genes present in hu-
man beings
|
B__ identification of all alleles present in hu-
man beings
C map and sequence the genetic makeup of
00100
0
100000
every human being
D map and sequence all the genetic material
i
present in the chromosomes of human
beings
Ot
JUUW
HELP
Option C is not an outcome of the HGP Which bands on the electrophoretogram indi-
Option A, B and D are expected outcomes cate that person V is the father of R?
of HGP. Two of the expected outcomes of the A 1 and2 B
Human Genome Project are: Ce 2a andy, D
Topic 8 Isolating, Cloning and Sequencing DNA | ‘
HELP Which selective growth medium would identify

Each individual’s combination is unique, hav-
the bacteria containing the recombinant plas-
ing inherited one allele for each locus from mids?
each parent. Son R did not inherit band 1, A a medium containing agar
band 3 and band 4 from his mother, W. B A medium containing ampicillin
Hence these 3 bands should have been
contributed by male X if male X is the father. C A medium containing ampicillin and X-gal
However, male X only has band 3 and is D A medium containing X-gal
unable to contribute band 1 and band 4.
Hence male X is not the father of Son R. This
proves that person V is the father of Son R. HELP
Only transformed bacteria containing plas-
mids would be able to survive in a medium
(4 containing ampicillin.
The diagram shows the plasmid pUC18. Bacte- Presence of the 2 selectable marker (i.e. lac
ria containing this plasmid produce blue colo- Z gene) enables the differentiation between
nies when grown in the presence of X-gal. a bacterial cell that has been transformed
Bacteria containing a genetically engineered with a recombinant or a non-recombinant
recombinant pUC18 plasmid produce white plasmid.
colonies. Insertion of a
gene of interest
into one of the
ampicillin restriction sites
resistance will result in the
different
gene disruption of lac
restriction
Z gene which
sites
lac Z gene x prevents. the
metabolism of
ow»ro
eR
oon
N X-gal to pro-
10 duce a blue
colour.
Thus, transformed bacteria containing recom-

binant plasmid will survive in a medium con-
Some of the features of this plasmid are: taining ampicillin and form white colonies
on agar containing X-gal.
1. It is small and replicates to form about 500
copies per host cell.
2. It contains restriction sites for 10 different Q5
restriction enzymes.
What are the advantages and limitations of the
3. It contains a gene giving resistance to the polymerase chain reaction (PCR)?
antibiotic ampicillin.
1. All lengths of DNA in the original liquid
4. It contains the lac Z gene which allows the will be multiplied.
metabolism of X-gal to produce a blue
colour. 2. Large numbers of lengths of DNA are pro-
duced quickly.
A gene of interest was inserted into one of the
restriction sites to form a recombinant plasmid. 3. Strict measures are needed to prevent
Bacteria were transformed with this recombinant contamination.
plasmid and identified using a selective agar 4. Only very small amounts of DNA are
medium. needed.
¥ Level 1000 Biology MCQ with HELPs 7 249 Frequently Examined Questions
a
Topic 8 Isolating, Cloning and Sequencing DNA
advantages limitations HELP

A 1 and 2 3 and 4 Statement 1 is considered to be unethical as
B 1 and 3 2 and 4 this involves the ownership and use of per-
sonal genetic information. The ownership to
C 2 and 3 1 and 4 access of genetic information is a matter for
D 2 and 4 1 and 3 concern e.g. should insurance agents have
access to the genetic fingerprint and grants
insurance policies based on clients’ genetic
HELP predisposition.
The polymerase chain reaction (PCR) is a Statement 6 is considered to be unethical if
method for amplifying a specific DNA se- prenatal genetic testing results in genetic ma-
quences in vitro. After 20 cycles, more than nipulation or a decision to abort based on
one million (220) copies of the target DNA undesirable traits disclosed by the tests.
(amplicons) are made.
PCR has high sensitivity and can amplify
minute amount of DNA. 7
The restriction enzyme Tai1, cuts DNA as
shown.
Q6
What uses of the information from the human
ACCT ----ACGT
genome project are generally considered to be
SrOCAc= TGCA----
unethical? Which of the plasmids below can be cut using
1. An insurance company only giving cheap restriction enzyme Tai1, in order to allow DNA
rates to people with genetic predispositions to be inserted into the circular plasmid without
to fewer diseases. loss of any part of the plasmid?
2. Genetic archaeologists identifying the ear- key ---- other nucleotides
liest forms of genes to show evolutionary The rest of the plasmid does not
relationships. contain this restriction site.
3. Cytologists developing tests for only some ---- TAACGTAC---- CTCAAGCT----

defective genes. Nea AAT CGATG.-- CACTIGCA ne
4. Doctors only giving specific drugs to block
the actions of faulty genes to carrier of
EI PNACEDA-- -GACETCE le
Be 2 AAR CCAT mtGIGCACEAR =:
those genes.
5. Genetic councilors giving specific lifestyle COLA CG iE CACOT Ne
information only to people genetically pre- Co # = TGEATCCA=
= ACCTCCAT—
disposed to risks.
6. Parents choosing embryos for implantation
P=ACCTAGGI = COACCICA
Dee Tee Ateen CCC eNGize.
only after ante-natal tests for acceptable
genes.
A 1 and 3 HELP
B 1 and 6 The plasmids below can be cut using Tail
Carei2Zeands5 as highlighted.
D3 and 4 IAG Gl AGC GhAGCIees.

PCC nC hGICGA----
For option B and C, there are 2 restriction Site 2 is the insertion site, also known as the
sites for Tail, hence if Tail is used for di- restriction site which can be targeted and cut
gestion, the sections flanked by the restric- by endonuclease for insertion of gene of in-
tion sites will be lost. terest.
Site 3 codes for antibiotic resistance gene.
---- TTAIACGTIA----C)/ACGT|GGT---- This allows for the selection of successtully
‘8B <2 SAAT IGCAMa-2-GlTGCA|CGA-~s- transformed cells.
----ACGTIACGT|----TCC |ACGTI|A----
Ce ee TGCAITGCA As AGGCITGEAIT..2«- Q9
Insulin is produced by genetic engineering in
For option D, there is no restriction site for
several stages. Some of these stages are listed.
Tail. Thus the DNA cannot be inserted into
the plasmid. il, addition to DNA sequence of ‘sticky ends’
Lis splicing of synthesized DNA into host
plasmids
Q8 isolation or synthesis of appropriate DNA
The diagram shows some features of a plasmid.
use of specific restriction endonuclease to
3 cut host plasmid with specific ‘sticky ends’
antibiotic 1 What is the correct order?
resistance origin of
aS A SS ay es
gene replication
Bie ee eee
(Gg Ss ih ey ea %
ID) Sty Hes Bs
HELP
Some of the stages of production of insulin
by genetic engineering are outlined as fol-
Which row shows the role of each of the sites
lows:
ieeZeand .3%
Isolation or synthesis of the insulin gene (ap-
endonuclease copying locating
propriate DNA). (Stage 3)
target cloned transformed
site gene cells Insertion of the insulin gene (creation of re-
combinant DNA molecule). Both DNA and
A 1 2 3
plasmid are cut with the same restriction en-
B 2 it 3 donuclease. Using the same restriction en-
C 2, 3 1 donuclease helps ensure that specific ‘sticky
ends’ produced are complementary and can
D 3 1 2
base-pair specifically. (Stage 1 and 4)
The cut plasmids and DNA fragments are
HELP then mixed in vitro, allowing the sticky ends
Site 1 is the origin of replication. Plasmid (a to reanneal in a specific, complementary
vector) contains an origin of replication, so manner through the formation of hydrogen
that it can replicate themselves as well as the bonds between the bases. DNA ligase is then
inserted gene of interest, within the host cell. added to covalently seal the nicks between
the fragments through the formation of
phosphodiester bonds. (Stage 2)
¥’ Level 1000 Biology MCQ with HELPs 249 Frequently Examined Questions
Topic 8 Isolating, Cloning and Sequencing DNA |
Q10 Q11
The diagram shows the changes in temperature A gene coding for the production of a human
of the reaction mixture during the polymerase gene product was inserted into a plasmid with
chain reaction (PCR). genes coding for resistance to antibiotics ampi-
cillin, streptomycin and tetracycline. The plas-
x
mids were used to transform FE. coli and the
heat to 95 °C
bacteria grown on a nutrient medium. The re-
sulting master plate is shown in the diagram.
Hb Y
heat: to 72°C cool to 37 °C
The main events during one cycle of the reac-

tion are listed.
1. binding of RNA primers
2. DNA synthesis Transformed cells were selected by replica plat-
ing the bacteria colonies onto media containing
3. separation of DNA strands various antibiotics.
Which combination correctly matches each Which plate contains the colony of bacteria into
event with the temperature in the reaction which the human gene has been successfully
mixture? inserted?
xX Y Z
A 1 2 3
B , 3 il
C 3 1 2
D 3 2 1
HELP
There are three major steps in a PCR.
Step 1: Denaturation. The thermal cycler heats Medium with Medium with
the mixture of primer and DNA fragment to ampicillin and the antibiotic
about 95°C. Hydrogen bonds holding the streptomycin kanamycin
dosible-stranded DNA fragment break and
the double-stranded DNA separates and dis-
C D
sociates into single strands.
Step 2: Annealing of primers. The solution
is allowed to cool to 37°C. As it cools,
primers base pair with complementary se-
quences at the 3’ end of the single-stranded
DNA.
Step 3: Primer extension. The thermal cycler
then raises the temperature to 72°C. Using
the primer, the polymerase synthesizes the Medium with Medium with
rest of the fragment resulting in new strand ampicillin, streptomycin tetracycline
of DNA. and tetracycline
|‘ Level 1000 Biology MCQ with HELPs 243 Frequently Examined Questions
aaa
HELP Option B: The plasmid inserted only con-

tains genes coding for resistance to antibi-
The colony of bacteria into which the human
otics ampicillin, streptomycin and tetracycline.
gene has been successfully inserted is high-
Thus, even if the bacterium is transformed,
lighted as shown (option A).
it will not have resistant to kanamycin.
Option C shows colonies of transformed bac-
terial cells with non-recombinant plasmid.
That is, all the 3 genes coding for resistance
to antibiotics ampicillin, streptomycin and tet-
racycline are intact.
Option D has all the colonies present in me-
dium C, indicating that the gene coding for
resistance to tetracycline is intact and that
Medium with
the human gene has not been inserted into
ampicillin and
the gene. All colonies of bacteria present are
streptomycin
transformed with non-recombinant plasmid.
Q12
pBR322 vector is used to clone a eukaryotic gene Which of the following media
which has been digested by the restriction would bacterial cells that con-
endonuclease BamHI.
tain the recombinant plasmids
Pst l 3611 grow in?
Pvu I 3736 A I and I
Sca I 3846
B I and Il
C I and IV
D IV only
EcoR 1 4359
Hind III 29 HELP
Pvu II 2066
EcoR V 187 Due to insertional inacti-
vation by the eukaryotic
gene which disrupts the
BamH I 1375
tetracycline resistance
Sph 1566 gene, transformed bacte-
ria containing recombi-
Sty 11369 Sall 651
nant plasmid would not
BstZ 1 939
be able to survive in a
Following transformation, bacterial cells were medium containing tetra-
grown in four different media, as shown below. cycline, i.e. media Il and
Ill. Thus, bacterial cells
nutrient broth plus ampicillin that contain the recombi-
nant plasmids can only
nutrient broth plus tetracycline survive in media | and lV.
nutrient broth plus ampicillin and tetracycline
nutrient broth without antibiotics
Q13 HELP
The figure below illustrates how biotechnologists For statement Y, Bt Gene is

can make corn become resistant to infection by inserted into crop via
European corn borer. electroporation and not
electrophoresis. Gel electro-
Which statements correctly describe X and Y? phoresis is a procedure for
separating a mixture of mol-
Bt Gene is
ecules through a gel in an
inserted electrical field while
Bacillus into crop electroporation disturbs the
thuringiensis phospholipid bilayer of the
membrane and causes the
formation of temporary
aqueous pores allowing
cells to uptake DNA.
For statement X, Bt Gene is
isolated from Bacillus
thuringiensis with the help of
restriction endonucleases
and not restriction exonu-
cleases.
Crop is infected by Pest dies when feeding on

European corn borer any plant part
Q14
Plants are more readily manipulated by genetic
Bt Gene is isolated engineering than are animal cells because
Bt Gene is
from Bacillus
inserted A plant genes do not contain introns.
thuringiensis with
into crop via
the help of restriction Bmore vectors are available for transferring
electrophoresis.
endonucleases. recombinant DNA into plant cells.
Bt Gene is isolated C a somatic plant cell can often give rise to
Bt Gene is
from Bacillus a complete plant.
inserted
thuringiensis with
into crop via D_ plant cells have larger nuclei.
the help of restriction
electroporation.
endonucleases.
Bt Gene is HELP
Bt Gene is isolated
inserted into Option A: Plants are eukaryotes and contain
from Bacillus
crop as a result introns.
thuringiensis with
of infection by
the help of restriction Option B: There are lesser vectors available
Agrobacterium
exonucleases. for transferring recombinant DNA into plant
tumefaciens.
cells.
Bt Gene is
Bt Gene is isolated Option D: The size of nuclei of plant cells
inserted into
from Bacillus and animal cells are the same.
crop as a result
thuringiensis with
of infection by
the help of restriction
Bacillus
exonucleases.
thuringiensis.
| Level 1000 Biology MCQ with HELPs ? o45 Frequently Examined Questions
Q15 Q17
To date, genetically modified food crops have A plasmid has two antibiotic resistance genes,
been modified to one for ampicillin and one for tetracycline. It is
treated with a restriction enzyme that cuts in
A produce needed human nutrients.
the middle of the ampicillin gene. DNA frag-
B resist insect pest. ments containing a human globin gene were cut
C deliver vaccines. with the same enzyme. The plasmids and frag-
ments are mixed, treated with ligase, and used
to transform bacterial cells. Clones that have
taken up the recombinant DNA are the ones that
HELP A are blue and can grow on plates with both
Genetically modified food crops have been antibiotics.
modified to produce needed human nutri- B_ can grow on plates with ampicillin but not
ents such as rice with increased iron and with tetracycline.
vitamins that may alleviate chronic malnutri-
C can grow on plates with tetracycline but
tion in Asian countries, herbicide- and in-
not with ampicillin.
sect-resistant soybeans, corn, cotton and
vaccines against infectious diseases such as D Cannot grow with any antibiotics.
hepatitis B.
HELP
Q16 As the bacterial cells contain the recombi-

nant DNA which contains the tetracycline
Which of the following characteristics is unde- resistance gene, the bacterial cells are able
sirable in cloning vectors used in genetic engi- to survive on plates with tetracycline.
neering?
However, due to insertional inactivation by
A Control their own replication the human globin gene which disrupts the
B- High copy number ampicillin resistance gene, transformed bac-
teria containing recombinant plasmid would
C Small in size
not be able to survive in a medium contain-
D Vulnerable at several sites to a restriction ing ampicillin.
enzyme
HELP
Q18
If the first three nucleotides in a six-nucleotide
Option A, B and C are characteristics de-
restriction site are CTG, what would the next
sirable in cloning vectors used in genetic
three nucleotides most likely be?
engineering. All vectors contain an origin of
replication, so that they can replicate them- A AGG B” GI¢
selves as well as the inserted gene of inter- CG. -€re D CAG
est, within the host cell. The most widely used
vector, bacterial plasmids, are relatively small
circular molecules of double-stranded DNA HELP
that are found naturally in high numbers within Restriction sites are palindromic, that is the
certain bacteria. nucleotide sequences of each of the two DNA
strands is identical when read in 5’ -» 3’
direction.
D -¢ClG GAG. 13
3 t- GAG Gre 275"
Q19
Nine skeletons were found in an unidentified grave. To establish the relationship between these
nine individuals, small amounts of DNA were isolated from these skeletons and genetic finger-
printing was then carried out.
The chart shows some of the results obtained from the genetic fingerprinting of seven of the
skeletons: three children and four adults.
Child 1 | Child 2 | Child3 | Adult1 | Adult 2 | Adult3] Adult 4
All three children on the chart had the same parents. Which of the following shows the children’s
parents?
A Adult 1 and 2
B Adult 1 and 3
C Adult 2 and 4
D Adult 2 and 3
‘N Level 1000 Biology MCQ with HELPs ? 247 Frequently Examined Questions
HELP
Child ] Child 2 Adult 2
Each individual’s combination is unique, hav-

ing inherited one allele for each locus from HELP
each parent. Only Adult 1 and 3 are able As the mixture cools to 60°C, annealing of
to contribute the highlighted bands to Child primers take place.
Iitoro:
The denatured single strands of DNA tend
to reassociate into double strands but due
Q20 to the large excess of both the forward and
reverse primers, primers base pair with
At the start of the polymerase chain reaction complementary sequences at the 3’ end of
(PCR), single stranded primers are added to the the single-stranded DNA and prevents the
denatured DNA and the mixture cooled to 60°C. denatured DNA strands annealing with each
What explains why the denatured DNA strands other.
anneal with primers and not each other?
A The primers are shorter and anneal more
easily.
Q21
B The primers anneal only to the 3’ end of Which of the following best describes a plas-
denatured DNA. mid?
The primer concentration exceeds the de- A A gene within the chromosome.
natured DNA concentration. B Small circular piece of DNA outside the
The temperature prevents the denatured chromosome.
DNA from annealing together. iS) The genetic material of a bacteriophage.
D_ A single, linear strand of DNA.
HELP Gel electrophoresis is a procedure for sepa-

Plasmids occur naturally in bacteria, yeast, rating a mixture of molecules through a gel
and some higher eukaryotic cells. Bacterial in an electrical field. The DNA molecules,
plasmids are relatively small circular mol- which are negatively charged, migrate to-
ecules of double-stranded DNA that are found ward the positive electrode, the anode. A
naturally within certain bacteria and sepa- molecule’s rate of movement is determined
rated from a bacterial cell’s chromosomal mostly by its length; longer molecules travel
DNA. more slowly through the pores in the gel, the
smallest DNA fragments move faster and
travel the longest distance. Thus, fragment C
(O22 which is the largest fragment will be closer
to the negative electrode, while fragment a
This segment of DNA has restriction sites I and and fragment b are similar in size and are
II, which create restriction fragments a, b, and closer to the positive electrode.
C.
I I
Which of the following gels produced by elec-

trophoresis would represent the separation and Q23
identity of these fragments?
The gene map of a plasmid, which has been
used for genetic engineering, is shown below.
It contains two antibiotic resistance genes. The
positions of several restriction endonuclease
binding sites are also shown below.
Cc a b
- off
1 Tf
b a Cc
ampicillin tetracycline
resistance resistance
gene
Cn b
Which enzyme(s) would be the most suitable

for the cleavage of the plasmid and the DNA
containing the gene of interest?
HELP A BamHI B_ Bgl
When the segment of DNA is digested, the C i HaelII D BamHI and Haelll
size of the fragments will be as follows:
HELP
as
A suitable restriction endonuclease should cut
SS the plasmid at only one position in order to
ets Saye nes Se 2 allow the DNA containing the gene of in-
terest to be inserted into the circular plasmid
without loss of any part of the plasmid.
‘N Level 1000 Biology MCQ with HELPs ? 249 Frequently Examined Questions
4
Q24 Q25
The following figure summarizes the formation What is not necessary for PCR to occur?
of insulin using genetically engineered yeasts. A» AAT B Primers
C DNA fragments D_ Ribonucleotides

insulin mRNA extracted from
human pancreatic cells
HELP
|p A PCR reaction
requires the fol-
single stranded complementary plasmid containing ampicillin & lowing elements:
DNA (cDNA) for insulin tetracycline resistance genes
Template DNA
! | (DNA fragments
to be copied)
double-stranded (cDNA) linearized plasmid
Oligonucleotide
for insulin
primers
DNA polymerase
recombinant plasmid Deoxynucleoside
containing cDNA for insulin triphosphates
(dATPs, dITPs,
dCTPs and
dGTPs)
transformed yeasts cells
containing recombinant plasmid
Which enzyme would be used at P and Q? Q26

Which of the following procedures would pro-
P Q duce RFLPs?
A RNA polymerase Restriction enzyme A incubating a mixture of single-stranded
B | Reverse transcriptase | Restriction enzyme DNA from two closely related species
C RNA polymerase DNA ligase B_ incubating DNA nucleotides with DNA
polymerase
D | Reverse transcriptase DNA ligase ; ; : one
C incubating DNA with restriction enzymes
D_ incubating RNA with DNA nucleotides
HELP and reverse transcriptase
At step P, cDNA for insulin is synthesized from
the insulin mRNA strand using reverse tran- HELP
scriptase. Restriction Fragment Length Polymorphism
At step Q, DNA ligase is added to covalently (RFLP) analysis is a technique in which or-
seal the nicks between the cDNA for insulin ganisms may be differentiated by analysis
and the linearized plasmid through the for- of patterns derived from cleavage of their
mation of phosphodiester bonds to form a DNA. Ditferences in nucleotide sequence
recombinant plasmid. between alleles at a locus results in the
formation of restriction fragments of differ-
ent length upon digestion by the same re-
striction enzyme and detected by Southern
blot analysis.
‘® Level 1000 Biology MCQ with HELPs ?259 Frequently Examined Questions
Q27 A QQ
Bacteria containing recombinant plasmids are Bo Qq
often identified by which process? C 44
A examining the cells with an electron mi- DP? eXty.
croscope
B___using radioactive tracers to locate the plas- HELP
mids
Upon digestion with Hindlll:
C exposing the bacteria to an antibiotic that
kills the cells lacking the plasmid For allele Q, there is presence of 3 restric-
tion sites, 2 restriction fragments will be
D__ producing antibodies specific for each formed.
bacterium containing a recombinant plas-
mid For allele q, there is presence of 2 restriction
sites, 1 large restriction fragment will be
formed, resulting in a band that is nearest
HELP to the well.
Only transformed bacteria containing plas- From the analysis, there is only 1 band
mids coding for resistances to antibiotics will (nearest to the well) observed. This indicates
be able to survive in a medium containing that Individual Z carries allele q. The band
antibiotic. Bacteria lacking the plasmids will is more intense as there is twice as much
be destroyed by the antibiotic. DNA in it, proving that Individual Z is a
homozygote carrying two copies of the allele
q.
Q28
The region of the genome containing the RFLP
used in this analysis is shown below.
HindIll HindIII* Hindlll
Allele Q = |
HindIII indicates the restriction sites for this
enzyme and * indicates the polymorphic site
which is missing in the recessive allele q. Q29
The black bar indicates the position of the probe How does a genomic library differ from a cDNA
used to detect the RFLP DNA fragments from library?
three different individuals, X, Y and Z, were A A genomic library contains only non-cod-
subjected to restriction digestion by HindIII and ing sequences, whereas a cDNA library con-
separate by gel electrophoresis. The following tains only coding sequences.
results were obtained.
BA genomic library varies, dependent on the
cell type used to make it, whereas the
content of a cDNA library does not.
C A genomic library can be made using a
restriction enzyme and DNA ligase only,
whereas a CDNA library requires both of
these as well as reverse transcriptase and
DNA polymerase.
D The genomic library contains only the
Deduce the genotype of individual Z. genes that can be expressed in the cell.
:
HELP HELP
Option A and D: A genomic library contains normal allele .
coding and non-coding sequences.
ieee Ee
Option B: The same genomic DNA can be
obtained from all cells of the organism, thus, recessive allele
a genomic library does not vary and is not I
dependent on the cell type used to make it. | af: &
Whereas each cell of an organism will give If a individual is a carrier, he will have 1
rise to a different set of mRNA depending copy of the normal allele and 1 copy of the
on its stage of development, environmental recessive allele. When digested with restric-
conditions and functions, each cell will give tion enzyme pstl, there will be 5 restriction
rise to a differing cDNA library. The content fragments formed:
of a cDNA library varies, dependent on the 1 copy ‘|
cell type used to make it. 1 copy =k
ligepye il |
2 copies
Gel electrophoresis is a procedure for sepa-
The restriction fragment shown below contains rating a mixture of molecules through a gel
a gene whose recessive allele is lethal. The in an electrical field. The negatively charged
normal allele has restriction sites for restriction DNA molecules migrate toward the positive
enzyme pstl at sites I and II. The recessive allele electrode at a rate inversely proportional to
lacks restriction site I. their length. Thus, the largest fragment will
An individual who had a sister with the lethal be closest to the negative electrode, while
trait is being tested to determine if he is a carrier the 3 smaller fragments which are similar in
of that lethal trait. length are closer to the positive electrode.
I I
Q31
Which of the band patterns would be produced
Restriction enzymes are molecular
on a gel if he is a carrier?
scissors used in genetic engineering
well
a:
Fe. to cut up DNA. In nature where are
restriction enzymes found and what
A On is their natural role?
In viruses; to splice host cells DNA.
»oHl | | | |je
nS In bacteria; to defend against viral in-
vasion.
In yeast cells, to defend against foreign
col | | ||e
DNA invasion.
oS In viruses; to defend itself against mu-
tation.
>of | boa | |© weve

Restriction enzymes serve to protect the
bacteria from attack by bacteriophages.
Bacteria use their restriction enzymes to
degrade the incoming viral DNA from
invading bacteriophages.
WN Level 1000 Biology MCQ with HELPs / 259 Frequently Examined Questions
Q32
BamH1 is a restriction enzyme that cuts DNA as shown in the diagram.
BamH1
o
The diagram below shows part of the procedure for producing E. coli that will synthesize human
growth hormone, hGH.
plasmid
DNA ligase
At the end of this process, many plasmids do not contain the hGH gene.
What could explain this?
A Different alleles of the hGH gene have different sticky ends.
B- Not all of the plasmids cut by BamH1 have sticky ends.
C Some of the plasmids are cut at more than one position.
D The sticky ends of some of the plasmids rejoin with each other.
‘NV Level 1000 Biology MCQ with HELPs ? 253 Frequently Examined Questions
HELP 2. Electrophoresis. The restriction frag-

ments are then separated by electro-
Option A and B: When the hGH gene or
phoresis.
plasmids are cut with BamH1, the same sticky
ends will be produced. All restriction enzymes 3. Blotting. These restriction fragments are
recognize and cut only at their specific re- transferred from the gel to a sheet of
striction sites, giving the same pattern of cut nitrocellulose membrane. The single
each time. strands of DNA stick to the paper and
are positioned exactly as that on the
Option C: As seen from the diagram, there
is. only one BamH\1’s restriction site in the gel.
plasmid, thus the plasmid is only cut at one 4. Hybridisation with radioactive probe.
position. The nitrocellulose membrane is incu-
bated with a solution containing ra-
Option D: The sticky ends produced are
complementary and can reanneal in a spe- dioactively labelled probes that is
cific, complementary manner through the complementary to the DNA sequence
formation of hydrogen bonds between the of interest.
bases.
Q34
Q33 A method used to detect a particular DNA
A student performed the following steps in a sequence within a mixture of many DNA frag-
Southern blot experiment to determine the ments is
number of copies of a particular gene that has A DNA sequencing.
been inserted in a genetically modified organ- B- DNA fingerprinting.
ism.
C colony hybridisation.
Transfer of DNA to nitrocellulose mem-
brane. D_ Southern blotting.
Restriction digestion of genomic DNA.
Cleaved DNA separated using gel electro- HELP
phoresis. A mixture of many DNA fragments will yield
Create radioactive probe. too many bands to be distinguished individu-
ally using gel electrophoresis. Hence South-
Incubate probe and membrane.
ern blotting is carried out using a specific
Which is the correct sequence to the above probe to label discrete bands that contain a
steps? particular DNA sequence.
A (ii) > (i) > (i) > (iv) => &)
B (ii) > (iii) > (i) > (Vv) > (iv)
C (iv) > (VY) > fi) > Gi - (iii)
D_ (v) > (iv) > (iii) > (ii) > (i
HELP
Correct sequence to Southern blot experi-
ment:
1. Restriction fragment separation. Ge-

nomic DNA samples to be tested are
prepared and a restriction enzyme is
added to produce restriction fragments.
‘X Level 1000 Biology MCQ with HELPs P 254 Frequently Examined Questions
Q35
The diagram shows a section of a DNA molecule.
ATCGTAGAATTCGGCTCGAGGCATTAGAATTCCTAGGATCGAATTGGCAT
TAGCATCTTAAGCCGAGCTCCGTAATCTTAAGGATCCTAGCTTAACCGTA
This molecule was cut under ideal conditions, using two different endonucleases, EcoR1 and Tac1,
which recognize different restriction sites:
EcoR1 GAATTC Tac1 TCGA

CTTAAG AGCT
What is the number of DNA fragments that can be produced?
Number of DNA fragments
P=
Wes
(@y
=} SF
m7
aoa
ATCGTAIGAATTC|GGC hee GGCATTA aTTC}CTAGGA|TCGA| ATT GGCAT

TAGCAT|CTTAAG] CCG hee CCGTAAT a G|GATCCT |AGCT|TAACCGTA
There are 2 restriction sites respectively in the DNA molecule for the two endonucleases, EcoR|
and Tacl (highlighted in the above diagram). Thus, EcoR] and Tac! are able to make a total
of 4 cuts on the molecule hence giving rise to 5 DNA fragments formed.
Q36
Five stages in the production of human insulin HELP
by genetic engineering techniques are given. The five stages in the production of human
1 DNA cut with restriction enzymes insulin are carried out in the order 3, 2, 1,
4 and then 5.
2 DNAcopy made using reverse transcriptase
3 messenger RNA extracted from cells
4 plasmid DNA joined to donor DNA using Q37
ligase enzymes Synthesis of human insulin by genetically ma-
5 recombinant plasmid inserted into bacte- nipulated bacteria involves the use of the en-
rial cell zyme reverse transcriptase.
Which sequence is correct? What is the role of this enzyme?

A It adds ‘sticky ends’ to insulin genes.
ist ees ee last
B_ It causes complementary DNA to be formed
— 4 from mRNA.
1 5 C It causes production of mRNA in the pan-
2 4 creas cells.
D It causes single-stranded DNA to convert
ees
seal
(ely
iso} 3 Llw an
wo
FP
mw tld
Y Ny
NPwo
PB Ho
koan
en hy)
to double-stranded DNA.
|| 4
HELP Q39
Reverse transcriptase can be used to synthe- When bacteria are genetically engineered to pro-
size DNA, called complementary DNA (cDNA) duce human insulin, the enzymes used in the
from the mRNA. procedure are
1 ligase
Q38 2 restriction endonuclease
3 reverse transcriptase
The flow diagram shows some of the events in
the production of a human hormone by genetic In which order are the enzymes used?
engineering.
At which stage in the process is a restriction
enzyme used?
human cells bacteria grown

grown in culture in culture
y human messenger plasmids extracted HELP

RNA extracted from bacteria
Reverse transcriptase is first used to make a
complementary DNA (cDNA) from an mRNA
molecule. Then, restriction endonuclease is
human DNA
B_ synthesised from used to cut the bacterial plasmid so that sticky
messenger RNA ends are obtained. Finally, DNA ligase is
needed to join the inserted gene to the sticky
ends of the plasmid vector.
C human DNA and
plasmid DNA cut
Q40
In the genetic engineering of bacteria to pro-
D human DNA and
duce insulin, what is the vector?
plasmid DNA joined
A a bacterium
Ba gene
recombinant plasmids
taken up by bacteria C an enzyme
D a plasmid
HELP HELP
Restriction enzymes are used to cut DNA The vector is the plasmid which is removed
between specific base sequences before the from a bacterium and inserted with a foreign
ends are joined up. gene. The plasmid vector is then reinserted
back into the host bacterium for replication.
‘® Level 1000 Biology MCQ with HELPs ? 256 Frequently Examined Questions
Q41
Synthetic insulin from genetically engineered
bacteria is compared with human pancreatic
insulin.
Which statement and explanation about the
insulin molecules is correct?
statement explanation
different a bacterial gene is altered to

resemble the human gene
altered human genes are

different
inserted into the bacteria
a bacterial gene is altered to

C | identical
resemble the human gene
mi tienccal human gene controls the

synthesis of bacterial insulin
HELP
The insulin produced is identical as the syn-
thetic gene that codes for this protein is based
on the sequence of nucleotides found in
human DNA that specifically codes for in-
sulin. The bacterial genes are not altered, as
the bacterial plasmid is only cut to enable
the insertion of the synthetic gene.
‘’ Level 1000 Biology MCQ with HELPs ? o57 Frequently Examined Questions
_
TOPIC
9 Applications of Molecular and Cell Biology |
— Z
Ql HELP
P and S are processes used to improve the
Stem cells are widely used in medical research.
quality of crop plants by improving the nu-
Which property of stem cells makes them par- tritional value of rice and soya beans.
ticularly useful in this research?
A They can be fused together to form a zy-
gote. Q3
B_ They can divide and eventually give rise Gene therapy is a way of treating genetic dis-
to a whole organism. ease by introducing a piece of DNA into the
C They can divide and be made to differen- cells of an affected individual. Liposomes can
tiate into various types of cell. be used for gene therapy as they target the cells
affected by a genetic disease.
D_ They will continue to divide indefinitely.
The diagram shows the structure of a liposome.
HELP
Stem cells are capable of dividing indefinitely glycolipid
and producing copies of themselves. In ad- membrane
dition, stem cells can undergo differentiation containing specific
giving rise to specialized cell types. carbohydrates
DNA strand
Q2 What feature of a cell surface membrane allows

the liposome to target cells affected by a genetic
Which of these processes could increase crop disease?
yield?
A carrier molecules
P: Inserting genes for vitamin A production
into rice
B_ phosphate groups
Q: Inserting genes for pest resistance into cot-

C protein channels
ton D receptor molecules
R: Inserting genes for herbicide resistance into
oilseed rape. HELP
S: Inserting genes for nitrogen fixation into The liposome’s glycolipid membrane contain-
soya beans. ing specific carbohydrates recognizes and
A PandQ binds to receptor molecules on cell surface
B” (@ and. membrane of target cells. The liposome is
thus able to deliver genes to specific target
C RandS cells and is able to deliver DNA into the cell.
Di. Sand?
Level 1000 Biology MCQ with HELPs ? asg Frequently Examined Questions
Topic 9 Applications of Molecular and Cell Biology |
Q4 Q6
Which genetic modification could increase the Which property of embryonic stem cells makes
yield of a crop measured as mass of crop pro- them particularly useful in medical research?
duced per unit area per year?
A They can be fused together to form a zy-
A herbicide resistant plants gote.
B_ delayed ripening in the fruits B- They can divide and are pluripotent.
C more essential amino acids in the seeds
C They can divide and are totipotent.
D more vitamin A in the grain
D_ They will continue to divide indefinitely.
HELP
HELP
Genetic modification of plants into herbicide
resistant plants can improve crop yield. This Embryonic stem cells are not totipotent but
is because herbicides are used to get rid of are multipotent cells. They have the ability
weeds which compete with crops for soil to differentiate into almost any cell type to
nutrients. Transgenic plants are not inhibited form any organ or type of cell.
by herbicide. Thus farmers may apply a
specitic herbicide to control weeds popula-
tion, without damaging their herbicide-toler- Q7
ant crops. This leads to an increase in crop A patient suffers from adenosine deaminase
yield because of less competition from weeds. (ADA) deficiency, an autosomal recessive im-
mune deficiency in which bone marrow lym-
Q5 phoblasts cannot replicate to generate immuno-

competent lymphocytes. The treatment option
Stem cells can be divided into four main types. that would permanently cure the patient is
Which of the four types of stem cell can differ- A germ-line gene therapy to replace one ADA
entiate into a limited range of tissues? gene copy.
A adult stem cells B germ-line gene therapy to replace both ADA
B embryonic stem cells gene copies.
C fetal stem cells C somatic cell gene therapy to replace both
D zygotic stem cells ADA gene copies in circulating lympho-
cytes.
HELP D somatic cell gene therapy to replace one

ADA gene copy in bone marrow lympho-
Adult stem cells are tissue specific and can
blasts.
enter normal differentiation pathways to form
only the specialized cell types of the tissue
which they reside in. HELP
Embryonic stem cells and fetal stem cells are In gene therapy, only somatic cells and not
pluripotent stem cells and have the ability to germ cells are targeted for treatment.
differentiate into almost any cell type to form
ADA deficiency is inherited in an autosomal
any organ or type of cell.
recessive pattern, which means two copies of
Zygotic stem cells are totipotent cells, which the ADA gene in each cell are altered. The
means that it has unlimited capability to dif- presence of one copy of ADA gene in bone
ferentiate and give rise to the extra-embry- marrow lymphoblasts will produce sufficient
onic membranes and tissues, the embryo and ADA enzymes to ‘cure’ the genetic disease.
all post embryonic tissues and organs. The
‘cell has the potential to give rise to any and
all human cells.
Topic 9 Applications of Molecular and Cell Biology
4
Qs Phospholipid bilayer of liposome mimic struc-

ture of cell surface membranes. The lipo-
Which feature of stem cells obtained from blood some carries the DNA in its aqueous core,
in the umbilical cord enables their use in the fuses with the target cell’s surface membrane
treatment of a variety of blood cancers? allowing DNA to enter into cell and passes
A They can differentiate into bone marrow the DNA to the nucleus.
cells.
B They can differentiate
component of blood.
into any cellular Q10
The search for pluripotent stem cells is intense.
C They can replace blood stem cells affected
The spermatogonium is the diploid precursor of
by cancer.
haploid sperm in the developmental pathway
D_ They are totipotent. of mouse gametes as shown below.
HELP G Spermatogonium (2n)

Umbilical cord blood stem cells are DNA Replication ||
multipotent, in that they have the ability to
Primary
differentiate into limited cell types to give rise spermatocyte (4n)
to a range of specialized cells that have a Meiosis I y,
S
S
specific function. Umbilical cord stem cells Secondary
found in cord blood only can differentiate spermatocyte (2n)
into any cellular component of blood eg.
white blood cells (such as B lymphocytes, T
S
Meiosis II aS a
lymphocytes, natural killer cells, macrophages L L L Sgigas: (n)

and platelets etc.) — vital for fighting infec-
tions and safeguarding the body, red blood
cells — important for transporting oxygen to Ihe) donee NE Gail
cells. Mature
sperm Cells (n)
Q9
Which type of gene therapy is least effective in Scientists were interested to find out which
transferring DNA to the nucleus? stages of sperm development have stem cell
capacity. Two experiments were carried out
A Adenoviruses
using sterile host males with testes that lacked
B- DNA attached to a ligand germ cells. The results are shown in the table
C Liposomes below.
D Retroviruses
Type of
Result
cells used
HELP Experiment Secondary Fertility
Viral delivery using adenoviruses and 1 spermatocytes was not
retroviruses are specific and ensure effective- were injected | restored
ness. The viral vector recognizes and binds
Fertility
to receptor on cell and enters cells. The vector
is able to deliver genes to specific target Experiment |Spermatogonia | WS restored
+ for the rest
tissues and is able to deliver DNA to the 2 were injected
of the
nucleus. mouse’s life
What property of a stem cell is missing in the HELP

secondary spermatocytes?
Embryonic stem cells are described as pluri-
A Specialization potent which means that they have the ability
B_Self-renewal to develop into almost any kind of cell in
the body except extra-embryonic membrane
C Commitment
(but not the trophoblast).
D_ A proper stem-cell niche
Adult stem cells such as blood stem cells
and muscle stem cells are undifferentiated
HELP and unspecialized cells found among differ-
entiated cells in a tissue eg. bone marrow
Stem cell niche is used to describe the mi- or organ. The primary role of adult stem
croenvironment in which stem cells are found. cells is to maintain and repair the specific
Since fertility was restored after the injection tissues where they reside.
of spermatogonia, it suggests that sper-
matogonium displays the general properties
of stem cells such as being capable of dividing
indefinitely and producing copies of them-
Q12
selves (self-renewal), can undergo differen- Which genetic modifications would not decrease
tiation giving rise to specialized cell types the quantity of chemicals sprayed onto crop
(haploid sperm). plants by farmers?
As fertility was not restored upon injection of A Fungus resistance
secondary spermatocytes, it suggest that the B Herbicide resistance
secondary spermatocytes do not have a stem C
Insect resistance
cell niche and do not display the properties .
of stem cell. Virus resistance
Q11
What are normal functions of stem cells in a
living human?
Functions
Differentiating into many Producing insulin in Cells that can

kinds of cells in a 3-5 day pancreases damaged by differentiate into bone
old human embryo type 1 diabetes cells in the skeleton
Differentiating into many Producing red blood Cells that can

kinds of cells in a 3-5 day cells worn out by differentiate into cardiac
old human embryo normal wear and tear muscle cells in the heart
Differentiating into only Producing dopamine in | Cells that can

one kind of cell in a 3-5 the brains of people differentiate into cartilage
day old human embryo with Parkinson cells in the joints
Differentiating into only Producing differentiated Cells that can
one kind of cell in a 3-5 cells that can be used to differentiate into nerve
day old human embryo screen new drugs cells in the brain
|X Level 1000 Biology MCQ with HELPs ? 264 Frequently Examined Questions
HELP Q14
Genetic modification of plants into herbicide Which feature of embryonic stem cells (ESCs)
resistant plants can improve crop yield. This is illustrated below?
is because herbicides are used to get rid of
weeds which compete with crops for soil we
© +
nutrients. Transgenic plants are not inhibited * S
by herbicide. Thus farmers may continue to cote

apply the same quantity of specific herbicide blastocyst ESCs
’
to control weeds population, without dam-
aging their herbicide-tolerant crops. This leads
to an increase in crop yield because of less
competition from weeds.
Fungus resistance, insect resistance and virus
resistance plants will lead to destroy the fun-
gus, insects or virus that is being targeted.
Hence these fungus, insects or virus are
hematopoietic SCs neural SCs mesenchymal SCs
unable to cause further damage to crops,
farmers will have higher crop yield.
O18 wate, “Ye ¥ =

gS: A~L ~
a - ee =F.
Which of the following statements is false about —

hematopoietic stem cells? cells of nervous Connective tissue,
blood cells
bones, cartilage
A Hematopoietic stem cells are able to repro- system
etc.
duce continually.
B Hematopoietic stem cells are present in A ESCs are capable of dividing indefinitely.
minute quantities.
B ESCs are multipotent.
C Hematopoietic stem cells can be found in
the bone marrow. C ESCs are pluripotent.
D Hematopoietic stem cells can differentiate D ESCs show plasticity.

into all specialised cells.
HELP
HELP Embryonic stem cells are pluripotent cells.
Option A: The hematopoietic stem cells will That is, they have the ability to develop into
constantly divide to replace cells such as the almost any kind of cell in the body (as seen
red blood cells that are worn out in three from diagram, hematopoietic SCs, neural SCs
to four months. and mesenchymal SCs) except extra-embry-
onic membrane (but not the trophoblast).
Option B and C: Hematopoietic stem cells
are a type of adult stem cells that can only
be found in the bone marrow in minute quan- Q15
tities. Hematopoietic stem cells can only give
rise to blood cells: red blood cells and white Which of the following disorders would gene
blood cells (such as B lymphocytes, T lym- therapy be least effective?
phocytes, natural killer cells, macrophages A Cystic fibrosis
and platelets etc.).
B Hungtington’s disease
C Sickle cell anaemia
D_ Type II diabetes
Level 1000 Biology MCQ with HELPs ? ag Frequently Examined Questions |

HELP Statement 3: Only zygotic stem cells are

Cystic fibrosis, Hungtington’s disease and totipotent cells, that is, only they have the
Sickle cell anaemia arises as a result of a ability to differentiate into any cell type to
genetic disorder. A genetic disorder is an form whole organisms.
illness caused by abnormalities in genes or
chromosomes. They are a result of genetic
disorder when there is defect in a single gene. Q17
Type Il diabetes is a type of multifactorial Which of the following represents the correct
and polygenic (complex) disorder where mani- plant growth regulator(s) for the formation of
festation of disease may be dependent on the corresponding plant tissue?
the effects of multiple genes in combination Plant Growth Formation of
with lifestyle and environmental factors. Regulator plant tissue
Gene therapy is a technique for introducing A Auxin Shoot
a copy of normal functional gene/allele into
B Auxin + Cytokinin Callus
target cells with non-functional genes and
works better when there is/are defect(s) in a C Abscisic acid Callus
single gene. D Cytokinin Somatic embryo
Q16 HELP
Auxin and cytokinin is added to the nutrient
Which of the following statements are true about
agar to stimulate the cells of the explant to
all stem cells?
divide by mitosis to form a callus.
al Stem cells can be induced to differentiate
by environmental signals.
2 Stem cells are easily isolated and propa- Q18
gated. To see the range of cell types a single hemato-
3 Stem cells are able to develop into whole poietic stem cell can generate, an investigator
organisms if implanted into the womb. suggested the use of a modified retrovirus which
carries a marker gene. The rationale behind this
4 Stem cells make more stem cells under
is
appropriate conditions.
A _ retroviruses will inject its genome into the
Avot and 4 B 2 and 3
cell which will then move into the nucleus
Cc Ja 3 ande4 Digits 2263 candn4 to be replicated.
B___ retroviruses will cause the genome of the
HELP stem cell to disintegrate ad synthesize its
viral genetic material which will be pass
Statement 1: Stem cells can be induced to on to new cells as it divides.
differentiate by environmental signals, giving
rise to specialized cell types. E.g. hemato- C retroviruses will insert its own genome into
poietic stem cells that are found in the bone the chromosomes of the cell it infects and
marrow can give rise to red blood cells and as the cell divides, it is possible to trace
white blood cells. all the progeny of the cell.
Statement 4: Stem cells are capable of D retroviruses will replace the equivalent of
dividing indefinitely and producing copies of the marker gene in the stem cell through
themselves. the process of genetic recombination
thereby causing all progeny produced to
Statement 2: Stem cells cannot be easily carry a copy of the marker gene.
isolated.
W Level 1000 Biology MCQ with HELPs ? 263 Frequently Examined Questions |
HELP HELP
Retroviral delivery method increases the Genetic engineering refers to a special set
chance of incorporating DNA into host of technologies that alter the genetic makeup
genome. of animals, plants or bacteria.
The isolated hematopoietic stem cell is in- Genetic engineering involving bacteria con-
fected with the retrovirus containing RNA copy taining recombinant plasmids can be used
of a marker gene. Once the virus has in- to produced insulin.
fected the target cell, the RNA copy of the Genetic engineering involving mammals such
marker gene is reverse transcribed (by as cows, producing substances eg. Bovine
retrovirus’ own reverse transcriptase) into the somatotrophin (BST) can be used to improve
normal DNA copy of the gene. The DNA is milk yield.
inserted into the chromosomal DNA of the
Genetic engineering involving transgenic
hematopoietic stem cell. Whenever the stem
cell divides via semi-conservative replication, plants can be used to improve crop yield or
the marker gene will be replicated and be improve quality of crop plants eg. glyphosate-
present in all the progeny of the cell. resistant soy crop plants.
Q19 Q21
Which of the following statements regarding Which statement describes a unique feature of
stem cells is false? stem cells in adult humans?
A One potential side effect of any embryonic A They can differentiate into different cell
stem cell-based therapy is the formation of types.
tumour. B They can undergo meiosis.
B Stem cells are present within various or- C They have a complete human genome.
gans of the adult body. D They have multiple copies of active genes.
C Stem cells can develop into a whole or-
ganism when implanted into the womb.
HELP
D Stem cells can be grown and expanded
indefinitely in culture under appropriate Option B: Only germ cells undergo meiosis.
culture conditions. Option C and D: All cells and not only stem
cells have a complete human genome as
well as have multiple copies of active genes.
HELP
Option A: Stem cells can undergo differen-
Only zygotic stem cells are totipotent cells,
tiation giving rise to different cell types.
that is, only they have the ability to differ-
entiate into any cell type to form whole
organisms.
Q20
Large quantities of useful products can be pro-
duced through genetic engineering involving
A bacteria containing recombinant plasmids.
B mammals.
C transgenic plants.
D All of the above.
W Level 1000 Biology MCQ with HELPs P 264 Frequently Examined Questions
O22
The figure below gives some of the possible experimental manipulations in the culture of cells
from Petunia plants.
Anther
culture
Cg
Root
i formation
;
Root : XY R
ormation Be2, Haploid
ey peice) Pe pe olen
Haploid /
Beg
Shoot a) callus
|
Paton
Ts
formation
vey |8
ee) Diploid callus

formation De
ceeSS a
Which of the following correctly identifies the stage for each of the events taking place in the
culture of Petunia plant cells?
Restoration Removal and

Meiotic py of somatic | subsequent culture
division ei eall number of of individual cells
chromosomes | from microshoots
HELP
Step P: Diploid plant giving rise to anther is a result of meiosis. It is the process by which a cell
nucleus divides to produce four daughter nuclei each containing half the number of chromosomes
found in the original nucleus.
Step Q: Protoplast are plant cells with their cell wall removed.
Step T: A haploid callus being restore to diploid callus suggests that the somatic number of
chromosomes has been restored.
Step S: With differentiation of individual cells of callus into particular tissues (shoot and roots), a
plantlet is form.
| ‘N Level 1000 Biology MCQ with HELPs ? 265 Frequently Examined Questions
@25 HELP
Sexual reproduction will cause genetic varia-
Which of the following disorders would gene
tion. Transgenic plants are not produced by
therapy be most effective?
sexual reproduction. It is difficult to produce
A Cystic fibrosis plants that breed true — homozygous for
B Cancer desired traits when sexual reproduction is
used.
C Schizophrenia
Instead, the cells of these clones divide by
Type II diabetes
y mitosis to maintain genetic stability. Plants
produced via cloning are genetically identi-
HELP cal and all posses the desirable features of
the stock plants.
Gene therapy is a technique for introducing
a copy of normal functional gene/allele into
target cells with non-functional genes and Q25
works better when there is/are defect(s) in a
single gene. Which of the following are reasons for scien-
tists to employ the method of plant cloning?
Cystic fibrosis arises as a result of a genetic
disorder. Cystic fibrosis is a result of genetic 1 change the phenotype of an organism
disorder when there is defect in the cystic 2 create smaller genetic changes at a much
fibrosis transmembrane conductance regula- more rapid pace
tor (CFTR) gene found on chromosome 7
coding for CFTR. Thus treatment with gene : pee oe of large amount of pharmaceu-
therapy will be effective. WTEEU
Cancer, schizophrenia and Type II diabetes 4 selective breeding is too slow
are types of multifactorial and polygenic AC) 1 -andeZ
(complex) disorder where manifestation of ye 1 anae
disease may be dependent on the effects of
multiple genes in combination with lifestyle C 1, 2 and 3
and environmental factors. Thus treatment Do 1223.and.4
with gene therapy will not be effective. This
is because it is impossible to introduce many
functional genes at the same time. HELP
Statement 1 and 2: Plant cloning can be
24 linked to genetic engineering which refers to
Q a special set of technologies that alter the
The following are advantages of transgenic genetic makeup (phenotype) of organisms
plants except: such as animals, plants or bacteria at a much
rapid pace.
A A gene for a desirable characteristic can : aS
beidenhifiedsandwclotied: Statement 3 and 4: Rapid multiplication of
plants allows for production of large amount
B- All the beneficial characteristics of an
of pharmaceuticals. Plants with desired traits
existing variety can be kept and just the
can be multiplied rapidly than can be done
desired new gene can be added.
using conventional breeding methods such
o>) Sexual reproduction is necessary. as selective breeding, which rely on sexual
D_ Transgenics is much faster than conven- reproduction.
tional breeding.
‘\ Level 1000 Biology MCQ with HELPs ? 266 Frequently Examined Questions |
Q26 Which of the following options are characteris-

tics of the form of treatment shown above?
The genetically engineered super salmon was
created from Atlantic salmon stocks and are 1 Easy to extract in laboratory
capable of growing to a large size in 14 months. 2 Readily available
Which of the following is not a benefit intended 3 Difficult to control
from the crop?
4 Limited longevity
A Higher yield for farmers
A 3 only
B- Minimising pollution
B 3 and 4
C Decreasing the food consumption of the
crops in their lifetime Gl) deands3
D Increase in supply to meet world’s demand De alec sand
HELP HELP
Growth hormone is produced all year round In gene therapy, there is problem with con-
in these genetically engineered super salmon, trolling the activity of gene expression. The
resulting in them growing to their maximum concerns include the possibility that trans-
size 3-6X faster than their wild counterparts/ ferred genes could be ‘overexpressed’, pro-
normal farmed salmon. Thus, these salmons ducing so much of the missing protein as to
take half the time to grow to market size. be harmful. Thus ensuring correct dosage of
This decreases the food consumption of the genes to be introduced is a challenge in order
crops in their lifetime as well as results in an for gene therapy to become effective.
increase in yield for the farmers. The larger The rapidly dividing nature of many somatic
salmons also results in an increase in supply cells prevents gene therapy from achieving
to meet world’s demand. long-term benefits. The short-lived nature of
gene therapy might result in patients having
to be treated on a frequent basis or undergo
Q27 multiple rounds of gene therapy.
Haematopoietic
Stem cells multiplied

in cell culture
ws Zz
i
q .
4 Transplant into
Inside the patient UL the patient
Erythrocytes Myeloid Muftipotent Pluripotent
(Red blood cells) progenitor stem cell =
ce
| ‘NX Level 1000 Biology MCQ with HELPs ? 267 Frequently Examined Questions
4
Q28 HELP
As the stem cells harvested could not differ-
Which statement best describes the characteris-
entiate into any other cell except for fat, bone
tic of a pluripotent cell?
and cartilage. This shows that the stems cells
A Cells that can differentiate into embryonic only have ability to differentiate into a limited
and extra embryonic cell types. range of cell type and is thus a multipotent
B- Cells that can differentiate into all the cells cell.
found in various tissues of the body.
C Cells that can only produce closely related
family of cells.
Q30
A patient suffering from cystic fibrosis under-
D_ Cells that can produce only one cell type
went gene therapy using a viral mediated deliv-
but have the property of self-renewal.
ery system. The treatment failed and you were
asked to troubleshoot the problem.
HELP Which of the following could not be the expla-
Option A describes a totipotent cell. nation behind the failure in the treatment?
Option B describes a pluripotent cell. Pluri- A Failure of the expressed protein to be folded
potent cell have the ability to differentiate into the correct conformation.
into almost any cell type to form any organ B_Integration of the target gene in the en-
or type of cell in the body. hancer region.
Option C describes a multipotent cell. C Rejection of the vector by the host immune
Option D describes a unipotent cell. system.
D The CFTR protein was not expressed in
Q29 adequate amount.
Liposuction waste has been reported to contain

HELP
50-100 million stem cells per 250 g. When these
stem cells were harvested, they could not dif- Functional CFTR protein must be in the correct
ferentiate into any other cell except for fat, bone conformation and sufficient amount of CFTR
and cartilage. proteins be embedded into cell membrane
before the treatment is successful. If the con-
Which of the following statements best explains
formation of the protein is incorrect or there
this?
is insufficient amount, the protein will still not
A It is a multipotent adult stem cell which be able to transport Cl- ions, hence prevent-
can only specialise into limited cell types. ing the normal efflux of chloride ions out of
B- It is a multipotent embryonic stem cell the epithelial cells and CF symptoms are not
which can specialise into almost all the cell alleviated.
types. If there is rejection of the vector by the host
C It is a pluripotent embryonic stem cell immune system, the normal functional CFTR
which can specialise into almost all the cell allele is not released into the cytoplasm of
types. cells and no functional CFTR protein will be
synthesized.
D_ It is a pluripotent adult stem cell which
can specialise into almost all the cell types.
‘ Level 1000 Biology MCQ with HELPs ? 26g Frequently Examined Questions
Q31 especially difficult to treat effectively using

gene therapy as it is impossible to introduce
Which of the following represents the correct many functional genes at the same time.
plant growth regulator(s) for the formation of
the corresponding plant tissue? The normal functional gene may be inserted
within control elements which affect gene
expression. In addition, there are problem
Plant Formation
with controlling the activity of gene expres-
growth of plant
regulator tissue
sion such as the transferred genes could be
‘overexpressed’, producing so much of the
auxin roots missing protein as to be harmful.
auxin callus
abscisic acid callus Q33
cytokinin somatic embryo
What are some similarities between all cancer
cells and all stem cells?
A They replicate indefinitely, lack cell-cell
HELP
adhesion and are able to move from one
High level of auxin and low level of cytokinin location in the body to another.
triggers formation of roots growth.
B_ They lack contact inhibition, are non-dif-
ferentiated and are regulated by molecular
signals.
O32
C They are able to move from one location
What are some key reasons explaining why gene in the body to another, are regulated by
therapy is not (yet) an effective treatment for molecular signals and can be found in
genetic diseases? various parts of the body.
I lack of knowledge of DNA sequences D_ They replicate indefinitely, are non-differ-
II lack of efficient and safe gene delivery sys- entiated and can be found in various parts
tems of the body.
III cost of the technology
IV some diseases involve multiple genes HELP
V problems with appropriate gene regulation Option A, B and C are properties of cancer
cells. Only cancer cells display a lack of an-
A II only. chorage dependence, a lack of contact in-
B= 1, ill and IV only. hibition and density-dependent inhibition of
cell divisions. In addition, cancer cells are
CII, IV and V only.
able to move from one location in the body
D_ All of the above. to another.
Option D is relevant to both cancer cells and
HELP stem cells. Both these cells can remain un-
differentiated for a long time and are ca-
There is a lack of efficient and safe gene
pable of dividing indefinitely and producing
delivery systems. Virus vector may regain or
copies of themselves.
develop virulence and may present a variety
of potential problems to the patients — tox-
icity, immune and inflammatory responses.
Many genetic diseases are a result of pres-
ence of many defective genes (multigene
disorder). Multigene disorders would be
W Level 1000 Biology MCQ with HELPs ?269 Frequently Examined Questions
Q34 Q36
Gene therapy is used for the treatment of Maize varieties are being developed in which
the leaves produce proteins that are toxic to
(I) cystic fibrosis (CF) and
insects. The DNA coding for these toxic pro-
(II) severe combined immunodeficiency (SCID). teins was inserted into a maize chromosome via
The difference between them is a bacterial plasmid. Many people are opposed
to this process.
A (I) is a transient treatment while (II) can
possibly be a permanent treatment. Which objection is not biologically valid?
B_ (1) usually uses the ex vivo approach while A Beneficial insects may be killed if they eat
(II) usually uses the in vivo approach. genetically modified maize.
isl (I) usually uses adenoviruses as vectors B Genes for antibiotic resistance are present
while (II) usually uses liposomes as vec- in plasmids and these genes may pass to
tors. harmful bacteria.
D_ (J) treats a recessive disorder while (IJ) C Hybridisation may transfer the bacterial
treats a dominant disorder. genes from maize to weeds, giving the weed
species new and harmful characteristics.
D Mutations may be caused in cattle or
HELP
humans that eat the genetically modified
Both the gene therapy for CF and SCID uses maize.
the in vivo approach.
Gene therapy for CF uses liposomes while
HELP
gene therapy for SCID uses retrovirus as
vectors. Mutations do not occur in cattle or humans,
as changes in the maize chromosome can-
Both CF and SCID are recessive disorder.
not be transferred by eating the maize.
Q35
Which of the following is not an example of
genetically modified organisms?
A Aqua Advantage Salmon that grow to adult
size quickly.
B_ Bt corn plants that are insect-resistant.
C Golden Rice that produce high levels of
beta-carotene.
D_ Milk-producing cows injected with bovine
somatotrophin (BST).
HELP
Genetic engineering refers to a special set
of technologies that alter the genetic makeup
of animals, plants or bacteria, giving rise to
genetically modified organisms producing
proteins that are not native in the organisms.
ANSWER KEYS

Qi D Q2 B Q3 D Q4 D Q5 D Q6 D Q7 B Qs D
Qa Cc Q10 C Q11 D Q12 D ehh ce Qi4A Qi5A Q16 A
O17 Q18 D Q19 D Q20 A Q21 B Q22 D Q23 B Q24 D
Q25 A Q26 B Q27 D Q28 C Q29 A Q30 D Q31 D Q32 C
Q33°¢ Q34 A Q35 C Q36 D Q37 A Q38 A Q39 B Q40 C
Q41 C Q42 C Q43 C Q44C Q45 C Q46 C Q47 D Q48 C
Q49 A Q50 B Q51 A Q52 D

O11 D Q2 D O30 Q4 C Qs D Q6 B Q7 A QsA
Qo B Q10 C Qi1 A Qi2 A Q13 C Q14 D Q15 D Qi6 D
O17 AC Q18 D Q19 B Q20 A ayne Q22 B Q23 D Q24 D
Q25 B Q26 A Q27 C Q28 D Q29 B Q30 D OkyIne Q32 B
Q33 C Q34 D Q35 A Q36 C Q37 D Q38 A Q39 D Q40 B
Q41 A Q42 A Q43 D Q44 D Q45 C Q46 B Q47 A Q48 D
Q49 A Q50 D Q51 A Q52 C Q53 D Q54 B Q55 D Q56 C
Q57 D Q58 A Q59 C
Topic 1(c) Enzymes

Qi B Q2 D oer ia) Q4 B Q5 A Q6 A Q7 D QsA
Qo B Q10 C Q11 D 12.6 @i3:C Q14 C Q15 D Q16 B
Q17 D Q18 B Q19 D Q20 C O214C Q22 B Q23 B Q24 D
Q25 A Q26A @278G Q28 C Q29 C Q30 D GRE Q32 A
Q33 B Q34 A Q35 B Q36 D Q37 A Q38 D Q39 D Q40 B
Q41 B Q42 B Q43 B Q44 D Q45 C Q46 D Q47 C Q48 A
Q49 B Q50 A Q51 C Q52 B Q53 C Q54 C Q55 D Q56 A
Q57 D Q58 B Q59 C
W Level 1000 Biology MCQ with HELPs 274

ANSWER KEYS

Qi D Q2 D Ger Xe Q4 A Q5 D Q6 A Q7 B Qs A
Qo A Q10 C Q11 D Q12 A Q13 A Qi4 A Q15 C Qi6 A
Q17 A Q18 D Q19 D Q20 D Q21.¢ Q22 D O24. Q24 B
Q25 C Q26 B Q27 B Q28 A Q29 D Q30 C Q31 B Q32 A
Q33 B Q34 A Q35 D Q36 D O37 C Q38 C Q39 B Q40 C
Q41 A Q42 D Q43 D Q44 A Q45 C Q46 D Q47 B Q48 D
Q49 B Q50 D Q51 D Q52 C Q53 A Q54 D Q55 D Q56 C
Q57 A Q58 D Q59 C Q60 C Q61 C Q62 D Q63 B Q64 C
Q65 B Q66 B Q67 C Q68 C Q69 B Q70 D 74.6

Qigee Q2 C Q3 D Q4 D Q5 D Q6 A Q7 B QsC
Qo B Q10 A Q11 D Q12 C Q13 D Q14 B Q15 A Q16 B
Q17'C Qi8 C Q19 A Q20 B 921-0 Q22 A Q23 D Q24 B
Q25 B Q26 B Q27 A Q28 D Q29 D Q30 B Q31 C Q32 C
Q33 B Q34 B Q35 D Q36 C Q37 C Q38 C Q39 B Q40 C
Q41 A Q42 D Q43 D Q44 C Q45 B

Qi D Q2 B fone ay) Q4 B Q5 A Qs D Q7 D Qs Cc
Qo A Q10 C Qi1 B Q12 D Q13 D Qi4A Q15 D Q16 B
Q17 B Qi8 D Qi9 D Q20 D Q21 D O22-A. . “O25 Q24 B
Q25 B Q26 C Q27 B Q28 D Q29 D Q30 A Q31 C Q32 D
Q33 C Q34 B Q35 A Q36 C Q37 B Q38 B Q39 C Q40 C
Q41 B Q42 A Q43 D Q44 B Q45 D Q46 B Q47 B Q48 A
Q49 C Q50 D Q51 D Q52 C Q53 A Q54 B

Qi B Q2 A cE) xe Q4 D Os ¢c Of C Q7 D Q8 D
Qo D Q10 B Q11 C Q12 D Oia Q14 A Qi5A Qi6 C
Q17 B Q18 A Q19 A Q20 D Q21 B Q22 D Q23 D Q24 D
Q25 A Q26 B Q27 D Q28 D Q29 B Q30 D Q31 C Q32 B
Q33 B Q34 A Q35 D Q36 A Q37 C Q38 D Q39 D Q40 B
‘® Level 1000 Biology MCQ with HELPs P a7

ANSWER KEYS

Ql B 02 -¢ Q3 D Q4 D Q5 A Q6 D o7 DB QsC
Q9 D Q10 B Q11 A Qi2 A Q13 C Qi4A Q15 C Qi6 D
QI7A Qis D Q19 C Q20 A Q21 C Q22 C Q23 A Q24C
Q25 D Q26 B 276 Q28 A Q29 D Q30 C Q31 B Q32 D
Q33 C Q34 A Q35 C

Qi D O02) B Q3..C Q4 D Q5 A Q6 B Q7 A Qs D
Qo B Q10 C Q11 A Q12 B Q13 A Q1i4 A Q15 B Q16 A
Qi7A Q18 C Q19 B Q20 D Q21A Q22 C Q23 B O27 6
Q25 B Q26 A Q27 B Q28 D Q29 A Q30 A Q31 B Q32 A
Q33 C Q34 C Q35 C Q36 D

Qi D OouG Q3 A Q4 D Q5 A Q6 C Q7 D Qs A
Q9 D Q10 A Q11 A Q12 B @ie_D Q14 B Q15 A Q16 B
Q17 A Qi8 A Q19 D Q20 B Q21 B Q22 D Q23 B Q24 C
Q25 D Q26 A Q27 D Q28 C Q29 D Q30 D Q31 A Q32 A
Q33 C Q34 D Q35 A Q36 C Q37 A Q38 B Q39 C Q40 C
Q41 C Q42 A Q43 A Q44 B Q45 B Q46 B Q47 A Q48 C
Q49 C Q50 C Q51 D Q52 A Q53 C Q54 B Q55 B Q56 C
Q57 A Q58 C Q59 D Q60 C Q61 D Q62 B Q63 A Q64 C
Q65 A Q66 A Q67 D

Qi D Q2 A O36 Qa C Q5 D Ol te Q7 B Qs A
Qo D Q10 C O11 C Q12 C Q13 A Q14 B Q15 D Q16 D
Q17 B Q18 B Qi9 A Q20 A Q21 D Q22 A Q23 A Q24 D
Q25 A Q26 A Q27 B Q28 A Q29 D Q30 B Qs1°C Q32 A
Q33 A Q34 C Q35 D Q36 D Q37 B Q38 C Q39 B Q40 C
Q41 B Q42 B Q43 D Q44 B Q45 C Q46 C Q47 C Q48 A
Q49 B Q50 C Q51 D Q52 C Q53 A
| Level 1000 Biology MCQ with HELPs ? 073

ANSWER KEYS _| ¢

Ql D Q2 B 63.0 Q4 D Q5 D @6 C Q7 D Qs A
Qo B Q10 C Q11 D Q12 A Q13 B Q14 B Q15 C Q16 D
@17 C Q18 D Q19 D Q20 B oys. O22 D Q23 C Q24 A
Q25 C Q26 D Q27 B Q28 B Q29 A Q30 A Q31 A 32-6
633. Q34 D Q35 D Q36 C Q37 B Q38 B Q39 A Q40 B
Q41 D Q42 D Q43 D Q44 C Q45 D Q46 B Q47 D Q48 D
Q49 D Q50 C Q51 D Q52 C Q53 A Q54 B

Qi D @2 A Q3 C Q4 C Q5 A Q6 A Q7 D jee
Q9 A Q10 A Q11 B Q12 B O1se Q14 B Q15 B Qi6 A
Q17 B Q18 D Q19 A Q20 D Opaey,. Q22 A Q23 D Q24 D
Q25 B Q26 A O27'C O28 C Q29 C Q30 D Q31 B Q32 C
Q33 D Q34 C Q35 D Q36 B Q37 A Q38 C Q39 B Q40 B
Q41 B Q42 B Q43 D

Qi D Q2 A Q3 D Q4 B Q5 B Q6 B Q7 A Qs C
Ose C Q10 C Q11 B Qi2 A Q13 B Q14C Q15C Qi16 C
Q17 D Q18 A Q19 D Q20 B Q21 B Q22 D Q23 C Q24 C
Q25 C Q26 A Q27 A Q28 B Q29 C Q30 C Q31 B Q32 D
Q33 D Q34 A Q35 C Q36 A Q37 D Q38 C

OB Q2 B Oa aC Q4 D Q5 A Q6 D eines Qs A
OG. C Q10 D CuELXe Qi12 A Q13 A Q14 D Q15 D Q16 D
Onan Q18 C Q19 B Q20 A Q21 A Q22 A Q23 B Q24 D
Q25 C Q26 B Q27 C Q28 A Q29 B Q30 D Q31 D Q32 B
Q33 A Q34 B Q35 C Q36 D Q37 B Q38 A Q39 C Q40 C
Q41 D Q42 D Q43 C Q44 D Q45 D Q46 C
W Level 1000 Biology MCQ with HELPs P o7q

ANSWER KEYS

Ql A Q2 A Q3 B Q4 C Q5 B Q6 B Q7¢ Qs A
Qo A Q10 B Q11 B Qi2 A Q13 D Q14 C Q1i5 A Q16 D
Q17 B Q18 D Q19 C Q20 B Q21 D Q22 B Q23 B Q24 B
Q25 B Q26 B Q27 B Q28 C Q29 C Q30 B Q31 A Q32 A
Q33 A Q34 B Q35 D Q36 B Q37 C Q38 C Q39 C Q40 A
Q41 C Q42 C

Oi Q2G Q3 B Q4 C Q5 D Q6 B O78 Q8B
Q9° CG Q10 C Q11 A Q12 C Q13 B Q14 C Q15 D Q16 D
Q17 C Q18 D Q19 B Q20 C Q21 B Q22 B Q23 A Q24 D
Q25 D Q26 C O27.C O28'C Q29 C Q30 D Q31 B Q32 D
Q33 A Q34 C Q35 C Q36 D Q37 B Q38 C Q39 D Q40 D
Q41 D

Orc Q2 B Okun) Q4 A Q5 A Q6 B @7eD QsB
Q9 B Q10 D Q11 B Q12 B Q13 D Q14C Q15 D Qi6 A
Q17 B Q18 C Q19 C Q20 D Q21 A Q22 D Q23 A Q24 C
Q25 D Q26 B Q27 B Q28 B Q29 A Q30 B Q31 A Q32 C
Q33 D Q34 A Q35 D Q36 D
W Level 1000 Biology MCQ with HELPs / 275

; - és
‘. :
i
~
:4 ' UL ,
¢ t
i { P
rs ,
—
| ‘
rn =
—,
——
4
‘ Bs
~y
— ”
_ wat
a
-—
Ge
* Fe
“nN
*
yt
5 ea lt
: a
Frequently
Examined |
Questions
Z 47
ZL
MAINS NONSENRD)
LI
OTS SiS) 10) HS ale D |

1000 Biology MCQ With Helps - Frequently Examined Questions - N - A - 2008 - Singapore - Redspot Publications PTE LTD - 9789810517243 - Anna's Archive

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

1000 Biology MCQ With Helps - Frequently Examined Questions - N - A - 2008 - Singapore - Redspot Publications PTE LTD - 9789810517243 - Anna's Archive

Uploaded by

Copyright:

Available Formats

Digitized by the Internet Archive

in 2022 with funding from

First Published June 2012

© REDSPOT PUBLICATIONS PTE LTD

Cell and Nuclear Division PEs

DNA and Genomics

Gene Mutation and Chromosome Aberration ? 402

Genetics of Viruses and Bacteria P4415

Organisation and Control of Prokaryotic and

Genetic Basis for Variation ? 440

Cellular Physiology and Biochemistry

Structure, Roles and Functions of Membrane ? 488

Homeostasis, Hormonal Control and Cell Signalling ? 201

(e) Nervous Control ? 242

Topic 7 Diversity and Evolution ? 228

Topic 8 Isolating, Cloning and Sequencing DNA ? 239

Topic 9 Applications of Molecular and Cell Biology ? 258

Answer Keys e 271

TOPIC 1 CELLULAR FUNCTIONS

A increased amounts of DNA

Level 1000 Biology MCQ with HELPs fs Frequently Examined Questions

800 g for 10 minutes fraction 1 A x x x

[| sins [tac [ai [ast

Level 1000 Biology MCQ with HELPs Frequently Examined Questions

All eukaryotic cells have organelles that are &ie)

smooth rough Which diagram indicates the

| Level 1000 Biology MCQ with HELPs Pa Frequently Examined Questions

W Level 1000 Biology MCQ with HELPs Pg Frequently Examined Questions a

occurs in the lysosome. The smooth endo-

Which one of the structures A, B, C or D, would

WW Level 1000 Biology MCQ with HELPs g Frequently Examined Questions

chloroplasts | lysosomes nucleus ribosomes mitochondria

HELP A Golgi apparatus

4 Level 1000 Biology MCQ with HELPs 2 49 Frequently Examined Questions

Only organelles which are larger than 0.2 mm

Q22 A Golgi apparatus B_ lysosome

Which cell components, when appropriately C mitochondrion D _siribosome

W Level 1000 Biology MCQ with HELPs ? 44 Frequently Examined Questions

Level 1000 Biology MCQ with HELPs 49 Frequently Examined Questions

B_ DNA is found only in chloroplasts.

D ribosomes and are unable to manufacture B_ the formation of centromeres

W Level 1000 Biology MCQ with HELPs ? 43 Frequently Examined Questions |

‘\ Level 1000 Biology MCQ with HELPs p 14 Frequently Examined Questions

ne iT Prokaryote has no true nucleus. It has single

Wali ki p | an organelle bounded by

C 100 ym D 200 4m an organelle bounded by

W Level 1000 Biology MCQ with HELPs ? 45 Frequently Examined Questions

Option C: Autophagy is carried out by ly-

‘X Level 1000 Biology MCQ with HELPs 46 Frequently Examined Questions

| ‘N Level 1000 Biology MCQ with HELPs 2 17 Frequently Examined Questions |

How do animal and plant cells differ from the HELP

have centrioles do not store glycogen

a network of tubes and

Which of the following is correct?

z chloroplast a aie ribosomes

DNA and RNA pe | RNA DNA and RNA

Inner membrane Crista :

Level 1000 Biology MCQ with HELPs ” 49 Frequently Examined Questions

1(b) Biological Molecules

‘X Level 1000 Biology MCQ with HELPs ? 99 Frequently Examined Questions

Which two of the groups combine to form a Q9

B 1 and 3 A cellulose units.

Gee2- and 3 B_sihexose_ units.