Available online at www.sciencedirect.

com

ScienceDirect
Procedia Chemistry 18 (2016) 69 – 74

Molecular and Cellular Life Sciences: Infectious Diseases, Biochemistry and Structural Biology
2015 Conference, MCLS 2015

Secretion of Geobacillus thermoleovorans IT-08

Į-L-Arabinofuranosidase (AbfA) in Saccharomyces cerevisiae
by Fusion with HM-1 Signal Peptide
I Nengah Wirajanaa,e, Tetsuya Kimurab, Kazuo Sakkab, Eddy Bagus Wasitoc,
Soekry Erfan Kusumac, and Ni Nyoman Tri Puspaningsiha,d*
a
Laboratory of Proteomic, Institute of Tropical Disease (ITD), Universitas Airlangga, Kampus C, Surabaya, Indonesia
b
Faculty of Bioresources, Mie University, 1515 Kamihama-cho, Tsu, Mie, 514-8507, Japan
c
Faculty of Medicine, Universitas Airlangga, Kampus A, Surabaya, Indonesia
d
Department of Chemistry, Faculty of Sciences and Technology, Universitas Airlangga, Kampus C, Surabaya, Indonesia
e
Department of Chemistry, Faculty of Mathematics and Natural Sciences, Udayana University, Jimbaran-Badung Bali, Indonesia

Abstract

Two different expression vectors were constructed to investigate two signal peptides on secretion of Geobacillus
thermoleovorans IT-08 Į-L-arabinofuranosidase (AbfA) in Saccharomyces cerevisiae. They were designed to direct the secretion
of AbfA by the aid of one of the following signal peptides, the ĮF signal peptide in the plasmid YEpFLAG1-Af and HM-1 signal
peptide in the plasmid pYHM1-Af. Although some successful results have been reported in proteins secretion with ĮF leader
sequence, in this research no Į-L-arabinofuranosidase activity could be observed in recombinants S. cerevisiae YEpFLAG1-Af.
The HM-1 leader sequence, originated from Hansenula mrakii IFO 0895 killer toxin, showed the capability to AbfA secretion.

©©2016
2015TheTheAuthors. Published
Authors. Publishedby by
Elsevier B.V.B.V.
Elsevier This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the organizing committee of the Molecular and Cellular Life Sciences: Infectious Diseases,
Peer-review
Biochemistry under
andresponsibility of the organizing
Structural Biology 2015 (MCLScommittee
2015).of the Molecular and Cellular Life Sciences: Infectious Diseases,
Biochemistry and Structural Biology 2015 (MCLS 2015)
Keywords: Saccharomyces cerevisiae; signal peptides; Į-L-arabinofuranosidase

* Corresponding author. Tel.: .+62-8113452009; fax: -.

E-mail address: nyomantri@yahoo.com

1876-6196 © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the organizing committee of the Molecular and Cellular Life Sciences: Infectious Diseases, Biochemistry and
Structural Biology 2015 (MCLS 2015)
doi:10.1016/j.proche.2016.01.012
70 I Nengah Wirajana et al. / Procedia Chemistry 18 (2016) 69 – 74

1. Introduction

Alpha-L-Arabinofuranosidases (Į-L-arabinofuranosidase arabinofuranohydrolase, EC 3.2.1.55, AF) are accessory

enzymes that cleave Į-L-arabinofuranosidic linkages and act synergistically with other hemicellulases and pectic
enzymes for the complete hydrolysis of hemicelluloses and pectins. This enzyme warrant substantial research efforts
because it represents potential rate-limiting enzyme in the degradation of lignocelluloses from agricultural residues1,
2, 3
.
Many Į-L-arabinofuranosidase genes have been cloned and sequenced from various sources such as bacteria,
fungi and plants. A xylanolytic gene cluster from the thermophilic bacterium Geobacillus thermoleovorans IT-08
was isolated that contains a number of potentially useful hemicellulolytic enzymes. One of them was D-L-
arabinofuranosidase gene (AbfA) from Geobacillus thermoleovorans IT-08 that successfully cloned into the plasmid
pTP510 in Escherichia coli DH5D4.
For the application of this enzyme in the food production, we use yeasts, mainly Saccharomyces cerevisiae as
host, that has been used for centuries in food production. They are considered as Generally Recognized As Safe
(GRAS). By contrast, prokaryotic organisms may have toxic cell wall pyrogens (endotoxins) and mammalian cells
may contain oncogenic or viral DNA. The advantages of S. cerevisiae are that it produces practically no hydrolases
attacking polymeric (hemi)cellulosic substrates and that possible background activities against oligosaccharides can
be easily checked5.
Secretion is the preferred mode of protein production due to ease of product recovery. Signal sequence mediates
co-translational translocation into the endoplasmic reticulum. Some authors have used the original signal sequence
to direct the secretion of foreign proteins in yeasts. Other authors have argued that the homologous leader sequences
of the yeast itself are preferable for this purpose. It has also been suggested that choice of the signal sequence to be
used should be based on the protein to be secreted or on the size of the product. Until now, few systematic
approaches to elucidate the effect of the signal peptide on the total amount of heterologous protein have been
explored6. Expression and secretion of various proteins in yeast have been reported. However, recombinant proteins
are not always secreted from yeast, which is dependent on the target protein, host strain, and secretion-signal
sequence. The choice of a suitable secretion-signal sequence for a given protein is an important factor in the final
yield of secreted protein7. For secretory production of ȕ-xylosidase (XylB) from Bacillus sp. in S. cerevisiae, in-
frame fusion of the exoinulinase signal sequence (INUls) of Kluyveromyces marxianus to upstream of xylB was
constructed8. In this research, we constructed the secretion vector of G. thermoleovorans IT-08 Į-L-
arabinofuranosidase (AbfA) for S. cerevisiae from a recombinant plasmid containing the G. thermoleovorans abfA
gene.

2. Methods

2.1. Microbial strains, plasmids, and culture conditions

A yeast host strain used in this study was S. cerevisiae BJ1824 (MATa ura3 trp1 leu2 pep4). The plasmid pTP510
was used for the source of the abfA gene, which was originated from G. thermoleovorans IT-084. For the
construction of yeast expression plasmids, the plasmid pYES2 (Invitrogen Co., USA) and the plasmid YEpFLAG-1
(Sigma) were used. The genome of Hansenula mrakii strain IFO 0895 was used for the source of the killer toxin
signal sequence. Yeast host cells were grown on YPD medium (2% Bactopeptone, 1% yeast extract, and 2%
glucose). For the selection and maintenance of yeast transformants, YNB selective medium (0.67% yeast nitrogen
base without amino acids supplemented with appropriate nutrients and 2% glucose) was used. YNB selective
medium with 2% galactose (YNBG) was used for the expression of Į-L-arabinofuranosidase from yeast
transformants using a pYES2 derivative.

2.2. Cloning and construction of expression vector

Construction of plasmids in this research is summarized in schema in Fig. 1. The abfA gene of 1.5 kb was
amplified by PCR, in which the plasmid pTP510 was used as a template. For construction of S. cerevisiae
expression vector, PCR was done with a sense SacI-linker primer 1a (5’GCGAGCTCATGGCTACAAAAAAA
GCAACC-3’) and an antisense XhoI-linker primer 1b (5’GCCTCGAGTTATCGTTTTCCTAAACGAATCAC-3’).
 I Nengah Wirajana et al. / Procedia Chemistry 18 (2016) 69 – 74 71

After amplification, the abfA gene was treated with SacI and XhoI and then subcloned to the pYES2 plasmid, which
was previously digested with SacI and XhoI. The recombinant plasmid was designed as pY-Af. The plasmid was
propagated first in E. coli and then transformed into yeast for AbfA production. The vector also includes the E. coli
ampicillin resistance gene and the yeast selectable marker URA3. Yeast transformation was carried out with a
modified Lithium Acetic method as described by Gietz9, followed by plating on YNB selective medium and
incubation at 30°C for 48-72 h to recover transformants.
On the other construction, the open reading frame (ORF) of the abfA gene was amplified and then subcloned into
the YEpFLAG-1vector. Polymerase Chain Reaction (PCR) was done with a sense XhoI-linker primer (5’-
GCCTCGAGATGGCTACAAAAAAAGCAACC-3’) and an antisense BamHI-linker primer (5’-GCGGATCC
TTATCGTTTTCCTAAACGAATCAC-3’). The resulting plasmid was designed as YEpFLAG1-Af. In this plasmid,
expression of AbfA was under the control of the ADH2 promoter and yeast selectable marker TRP1.
The abfA gene was also fused in-frame to full length leader sequence of secretion signal of the Hansenula mrakii
strain IFO 0895 killer toxin (HM-1)10 that was amplified by PCR, in which genome of H. mrakii strain IFO 0895
was used as a template. Polymerase Chain Reaction was done with a sense HindIII-linker primer (5’-
GGCCAAGCTTCCGCCCAACATGAAATTTTCCTTC-3’) and an antisense SacI-linker primer (5’-AATT
GAGCTCACGCTTCTCCAATGCACTTCTTTCA-3’). The product of PCR, a 117-bp fragment encoding the HM-1
signal sequence was treated with HindIII and SacI and then subcloned to the pY-Af plasmid, which was previously
digested with HindIII and SacI. This expression construct is referred to as pYHM1-Af.

2.3. Expression and secretion of Į-L-arabinofuranosidase

Expression of AbfA was under the control of the inductive GAL1 promoter in the plasmid pYHM1-Af. In the
plasmid YEpFLAG1-Af, expression of AbfA was under the control of the ADH2 promoter. Yeast growth was
monitored turbidometrically at 600 nm. The yeast culture broth was centrifuged, and then the supernatant was used
for the measurement of extracellular Į-L-arabinofuranosidase activity and intracellular fraction was prepared by
glass beads treatment of cells.

Fig. 1. Scheme of plasmids construction in this research. pYES2 and YEpFLAG1 are as a parental vector. These vectors carry the 2ȝ origin of
replication and are maintained episomally in high copy. pYES2 vector and YEpFLAG1 vector contain the URA3 and the TRP selection marker,
respectively, for selection in yeast.

2.4. Enzyme assay

The Į-L-arabinofuranosidase activity was assayed by measuring the amount of p-nitrophenol (pNP) released from
p-nitrophenyl-Į-L-arabinofuranoside (pNPA) (Sigma) at pH 6.0 (in 50 mM phosphate buffer) and 70°C for 30
minutes. One unit of the enzyme activity was defined as the amount of enzyme liberating 1 ȝmol pNP from pNPA
per min under assay condition.
72 I Nengah Wirajana et al. / Procedia Chemistry 18 (2016) 69 – 74

3. Results and discussion

The open reading frame (ORF) of the abfA gene from G. thermoleovorans IT-08 was amplified and then
subcloned into the pYES2 vector. However, when the resulting plasmid pY-Af was introduced into S. cerevisiae
cell, no Į-L-arabinofuranosidase activity could be detected in extracellular fractions of yeast transformant (data not
shown). Its activity was only detected in intracellular fraction (data not shown). The Į-L-arabinofuranosidase in
recombinant E. coli DH5Į (pTP510) and E. coli BL21 (pET-abfA) were produced as an intracellular form11.
The ORF of the abfA gene was amplified and then subcloned into the YEpFLAG-1 vector, when the resulting
plasmid YEpFLAG1-Af was introduced into S. cerevisiae cell, however, no Į-L-arabinofuranosidase activity could
be detected in either of extracellular or intracellular fraction of yeast transformants. The HM-1 signal sequence was
subcloned to the pY-Af plasmid and got the pYHM1-Af. The result of this construction was analysed by gel agarose
electrophoresis, and the electrophoregram of plasmids were showed in the Fig. 2. The abfA gene and HM-1 signal
sequence in this plasmid was sequenced. The nucleotide sequence of 1509-bp region containing the abfA gene
appeared in the GenBank DNA sequence database with the accession no. DQ387046.

Fig. 2. The Electrophoregrams of plasmids were isolated from E. coli transformants, (A) 1. Marker DNA Ȝ HindIII, 2. pYHM1-Af cut by SacI
and XhoI, 3. pYHM1-Af cut by HindIII and XhoI, 4. uncut plasmid; (B) 1. Marker DNA Ȝ HindIII, 2. pYHM1-Af cut by KpnI, 3. pY-Af was cut
by KpnI, 4. uncut plasmid, 5. pYES2 cut by KpnI, 6. uncut plasmid, 7). The abfA gene (1,5 kb).

Plasmids pYHM1-Af was introduced into S. cerevisiae BJ1824 cells. Control experiments with vectors pYES2
and pYES2-HM1 were also done. Transformants were grown for 6 days in YNBG selective medium and culture
supernatants were tested for AbfA activity. The AbfA activity was only observed in the cell-free culture supernatant
of S. cerevisiae carrying pYHM1-Af. No enzymatic activity was observed in supernatants from culture of S.
cerevisiae transformed with plasmids pYES2 or pYES2-HM1.
The plasmids YEpFLAG1-Af was constructed for expression of an Į-factor signal peptide-FLAG-abfA fusion
protein in S. cerevisiae. In the plasmid YEpFLAG1-Af, the expression was controlled by the inducible ADH2
promotor. The HM-1 signal sequence of the H. mrakii strain IFO 0895 killer toxin, composed of 37 amino acid
residues, was employed for the secretory expression of abfA gene in yeast. The HM-1 signal sequence was
subcloned into pY-Af, resulting in pYHM1-Af. When the resulting plasmid (pYHM1-Af) was introduced into S.
cerevisiae cell, Į-L-arabinofuranosidase activity could be detected in either of extracellular and intracellular
fractions of yeast transformant.
To investigate the expression level of Į-L-arabinofuranosidase in yeast, S. cerevisiae BJ1824 harboring pYHM1-
Af was cultured in the YNBG selective medium. As shown in Fig. 3, the Į-L-arabinofuranosidase activity was
detected in the growth medium where the recombinant yeast cells were cultured. A maximum activity of 0.18 unit
ml-1 was measured at 64 h in the extracellular fraction. The Į-L-arabinofuranosidase activity in growth medium was
declined to 0.13 unit ml-1 after 144 h.
 I Nengah Wirajana et al. / Procedia Chemistry 18 (2016) 69 – 74 73

Fig. 3. Time profiles of cell growth and extracellular Į-L-arabinofuranosidase activity in culture of S. cerevisiae (pYHM1-Af) (open square and
solid square, respectively) and S. cerevisiae (pYHM1) (open triangle and solid triangle, respectively) that were grown in the YNBG selective
medium at 30 oC for 6 days.

In general, the secretion of heterologous proteins in S. cerevisiae is affected by a variety of genetic and
environmental parameters such as leader peptide, host, promoter, culture conditions, etc. The key variables
determining translocation efficiency are therefore likely to be signal peptide affinity for soluble targeting
components, such as signal recognition particle, and duration of ribosome attachment12. The secretion of
heterologous proteins from yeast is particularly desirable, since the level of endogenous secreted proteins is quite
low, thus greatly simplifying the purification of the desired protein. A number of different leader sequences have
been employed to direct secretion of protein from S. cerevisiae13. In this study, two different expression vectors
were constructed to investigate two signal sequences on secretion of AbfA in S. cerevisiae. They were designed to
direct the secretion of AbfA by the aid of one of the following signal sequences, the ĮF leader in the plasmids
YEpFLAG1-Af, and HM-1 signal sequence in the plasmid pYHM1-Af. Two different types of leader sequences
were used to design secretion vectors: the use of a homologous leader sequence, ĮF leader; and the use of a
heterologous leader peptide, HM-1 signal sequence. Although some successful results have been reported in proteins
expression and secretion with ĮF leader sequence, in this research no Į-L-arabinofuranosidase activity could be
observed in recombinants S. cerevisiae (YEpFLAG1-Af). The HM-1 leader peptide, originated from H. mrakii IFO
0895 killer toxin, has shown secretion of Į-L-arabinofuranosidase. The use of heterologous signal peptide, inulinase
(INU) signal peptide of K. marxianus in S. cerevisiae was successful to direct secretion of significant amounts of
heterologous proteins, such as human lipocortin-1 (LC1) and human interleukin-2 (IL-2), into the culture medium14.
The transcription of fused gene in the plasmid YEpFLAG1-Af was regulated by ADH2 promotor and CYC1
transcription terminator. On the other hand, the Abfa in the plasmid pYHM1-Af was designed to be regulated by
GAL1 promotor and CYC1 transcription terminator. Apparently, in recombinants S. cerevisiae YEpFLAG1-Af, Į-
factor signal peptide-FLAG-abfA fusion protein could not be expressed. It is possible that the enzyme was
expressed but the product could not become active form because of its incorrect folding. However, this possibility
ought to be proved with Western blotting analysis.
The ĮF signal fusions were processed correctly and completely15. This result was inconsistent with the case of
lysozyme7. The ĮF signal has a prepro-structure; Met1-Ala19 and Ala20-Arg85 are pre- and pro sequence,
respectively13. The HM-1 signal used in this study also has the prepro-structure; Met1-Ala19 and Leu20-Arg37 are
pre- and pro-sequences, respectively. The amino acid sequences derived from the HM-1 signal peptide-abfA fusion
gene are shown in Fig. 4. In cases of ĮF leader- and HM-1 leader-directed secretion, the carboxy-terminal dibasic
residue, Lys-Arg, of leader peptides is processed by the action of KEX2 endoproteinase. Signal peptidase cleavage
74 I Nengah Wirajana et al. / Procedia Chemistry 18 (2016) 69 – 74

occurs between residues 19 and 20 of the prepro-structure. In the recombinants S. cerevisiae YEpFLAG1-Af, the ĮF
signal fusions may not be processed correctly and completely, so that the expression product may be degraded.

Fig. 4. The sequence of the HM-1 signal peptide-AbfA fusion gene. Lys-Arg of leader peptides is processed by the action of KEX2
endoproteinase and signal peptidase cleavage occurs between residues 19 and 20 of the prepro-structure.

4. Conclusions

The secretion vector by using the HM-1 signal peptide in the plasmid pYHM1-Af for S. cerevisiae was
successful to secrete Į-L-arabinofuranosidase of G. thermoleovorans IT-08. Although some successful results have
been reported in proteins secretion with ĮF leader sequence, in this research no Į-L-arabinofuranosidase activity
could be observed in recombinants S. cerevisiae YEpFLAG1-Af.

Acknowledgements

We are grateful to Directorate General of Higher Education (DGHE) of Indonesia (postgraduate research grant
and sandwich like program) that supported this research.

References

1. Saha BC. Į-L-Arabinofuranosidase: biochemistry, molecular biology and application in biotechnology. Biotechnol Adv 2000;18:403-423.
2. Saha BC. Hemicellulose bioconversion. J Ind Microbiol Biotechnol 2003;30:279-291.
3. Numan MT, Bhosle NB. Į-L-Arabinofuranosidase: the potential applications in biotechnology. J Ind Microbiol Biotechnol 2006;33:247-260.
4. Puspaningsih NNT. Charachterization of Xylanolytic Enzyme and Cloning Xylosidase Gene from Geobacillus thermoleovorans IT-08. Ph.D.
Disertation. Bogor Agricultural Institute, Indonesia 2004.
5. Clark EM, Tenhanen M, Setala TN, Penttila M. Cloning of genes encoding Į-L-arabinofuranosidase and ȕ-xylosidase from Trichoderma
reesei by expression in Saccharomyces cerevisiae. Appl Environ Microbiol 1996;62: 3840-3846.
6. Dominguez A, Ferminan E, Sanchez M, Gonzalez FJ, Campo FMP, Garcia S, Herrero AB, Vicente AS, Cabello J, Prado M, Iglesias FJ,
Choupina A, Burguillo FJ, Lago LF, Lopez MC. Non-conventional yeasts as hosts for heterologous protein production. Internatl Microbiol
1998;1:131-142.
7. Hashimoto Y, Koyabu N, Imoto T. Effects of signal sequences on the secretion of hen lysozyme by yeast: construction of four secretion
cassette vectors. Protein Engng 1998;11:2:75-77.
8. Kim JH, Kim BW, Yoon KH, Nam SW. Expression of Bacillus sp. ȕ-xylosidase gene (xylB) in Saccharomyces cerevisiae. Biotechnol Lett
2000;22:1025-1029.
9. Gietz D, Woods RA, Schiestl RH. Transformation of Yeast by the Liac/SS carier DNA/PEG Method. Methods in Enzymol 2002;350:87-96.
10. Kimura T, Kitamoto N, Kito Y, Iimura Y, Shirai T, Komiyama T, Furuichi Y, Sakka K, Ohmiya K. A novel yeast gene, RHK1, is involved in
the synthesis of the cell wall receptor for the HM-1 killer toxin that inhibits ȕ-1,3-glucan synthesis. Mol Gen Genet 1997;254:139-147.
11. Puspaningsih NNT, Suwanto A, Suhartono MT, Achmadi SS, Yogiara, Kimura T. Cloning, sequencing and characterization of the xylan
degrading enzymes from Geobacillus thermoleovorans IT-08. J Basic Sci 2008; 9:177-187.
12. Arnold CE, Parekh RN, Yang W, Wittrup KD. Leader peptide efficiency correlates with signal recognition particle dependence in
Saccharomyces cerevisiae. Biotechnol. Bioeng 1998;59:286-293.
13. Brake AJ. Į-Factor leader-directed secretion of heterologous proteins from yeast. Methods in Enzymol 1990;185:408-421.
14. Chung BH, Nam SW, Kim BM, Park YH. Highly efficient secretion of heterologous proteins from Saccharomyces cerevisiae using inulinase
signal peptides. Biotechnol Bioeng 1996;49:473-479.
15. Hitzeman RA, Chen CY, Dowbenko DJ, Renz ME, Liu C, Pai R, Simpson NJ, Kohr WJ, Singh A, Chisholm V, Hamilton R, Chang CN. Use
of heterologous and homologous signal sequences for secretion of heterologous proteins from yeast. Methods Enzymol 1990;185:421-440.