806 Original article
Expression of the full-length HCV core subgenome from
HCV gentoype-1a and genotype-3a and evaluation of the
antigenicity of translational products
Mohammad A. Ansaria, Mohammad Irshada, Sanjay Kumar Agarwalb
and Kunzang Chosdolc
Background Hepatitis C virus (HCV) infection is a major
public health problem in India. Detection of HCV and its
genotypes by simple and economic assays is a prime
requirement in the planning of antiviral treatments for
patients infected with this virus. Although commercial
assays are available for the detection of both HCV RNA and
genotypes, efforts aimed at the development of simple
and economical systems for these measurements are
still going on.
Aim The present study was designed to clone and express
the HCV CORE gene from HCV genotype-1a and genotype-3a
and use the peptides to develop immunoassays for the
detection of genotype-specific antibodies in sera samples.
Methods One hundred and thirty-five serum samples from
patients with liver and renal diseases were screened for
HCV RNA by real-time PCR, followed by HCV genotyping in
RNA-positive sera by restriction fragment length
polymorphism, sequencing, and phylogenetic analysis. The
HCV CORE gene was amplified from sera carrying HCV
genotype-1a and genotype-3a and cloned and expressed in
the pET19b vector. The translational products were used to
develop a western blot assay for the detection of genotype-
specific anti-HCV antibodies.
Results The HCV CORE gene, from both genotypes,
was cloned and expressed successfully, with production
Introduction
Hepatitis C virus (HCV) is one of the major causes of liver
diseases in India [1]. HCV infection has been detected
globally and poses a major public health problem world-
wide [2]. It causes infections in B3% of the world’s
population, affecting a total of 200 million individuals [3,4].
Almost 80% of patients with HCV infection develop
chronic liver diseases and 20% of them develop serious
liver diseases including cirrhosis of the liver [5]. In India,
15–25% of HCV carriers (nearly 12 million Indians) have
chronic liver disease [1,6]. HCV infection has also been
reported to be an important cause of morbidity and
mortality among patients with end-stage renal disease [7,8].
HCV infection has been reported to be common among
renal transplant recipients worldwide [9,10].
HCV is an enveloped virus and has a linear, single-
stranded, positive-sense RNA genome of 9.6 kb [2]. It is
0954-691X 
c 2013 Wolters Kluwer Health | Lippincott Williams & Wilkins
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
of a 26 kDa recombinant protein in either case. Using
peptides in a western blot assay, 101 sera samples were
tested for the anti-HCV CORE antibody. Each peptide
showed a reaction with anti-HCV total antibody without
showing any genotype-specific binding. This indicates
that individual peptides obtained from different genotypes
do not have a genotype-specific epitope to bind with
antibodies.
Conclusion Cloning and expression of the HCV CORE
gene from genotype-1a and genotype-3a was successful.
However, the peptides formed did not show genotype-
specific binding with anti-HCV. Eur J Gastroenterol Hepatol
25:806–813  c 2013 Wolters Kluwer Health | Lippincott
Williams & Wilkins.
European Journal of Gastroenterology & Hepatology 2013, 25:806–813
Keywords: CORE, expression, genotype, hepatitis C virus, immunoassay
a
Department of Laboratory Medicine, Clinical Biochemistry Division, Departments
of bNephrology and cBiochemistry, All India Institute of Medical Sciences,
New Delhi, India
Correspondence to Mohammad Irshad, PhD, Department of Laboratory Medicine,
Clinical Biochemistry Division, All India Institute of Medical Sciences,
New Delhi 110029, India
Tel: + 91 011 26594981; fax: + 91 011 26588641;
e-mail: drirshad54@yahoo.com
Received 21 November 2012 Accepted 3 January 2013
a member of the genus Hepacivirus of the family
Flaviviridae [11,12]. The HCV genome has a single large
open reading frame of 9033–9099 nucleotides flanked by
two noncoding regions (NCR): 50 NCR and 30 NCR. The
open reading frame encodes a long polyprotein of B3000
amino acids, which produces three structural proteins
(CORE, E1, and E2) at the amino terminus and seven
nonstructural proteins (p7, NS2, NS3, NS4A, NS4B,
NS5A, and NS5B) at the carboxyl terminus [13,14]. The
CORE region is one of the most conserved coding regions
of the HCV genome and plays an important role in
apoptosis, signal transduction, reactive oxygen species
formation, lipid metabolism, transcriptional activation,
transformation, and immune modulation [15].
HCV is classified into six genotypes and several isotypes
[16]. These genotypes cause different pathologies and
vary in response to antiviral therapy [17,18]. On the basis
DOI: 10.1097/MEG.0b013e32835eb9b9

of this information, many attempts have been made to
determine the genotype of HCV in infected patients
before understanding genotype-associated HCV patho-
genesis or planning a strategy of antiviral therapy [19–23].
The CORE gene of HCV has a conserved domain and is
assumed to be useful in developing a diagnostic assay and in
HCV genotyping [24–26]. Although several reports are
available on various aspects of the CORE gene, including the
expression and physicochemical characteristics of the CORE
protein, its use in developing assays to detect genotype-
specific anti-HCV antibodies has not been reported. The
present study was designed to clone and express the HCV
CORE region from two different genotypes, genotype-1a
and genotype-3a, which are commonly prevalent in India,
and develop an immunoassay for the detection of genotype-
specific anti-HCV antibodies using the expressed peptides
as antigens. The aim was to develop simple, economical, and
easy to use assays that can be used in many laboratories
conducting HCV genotyping of patient sera.
Materials and methodology
Patients and blood samples
A total of 135 patients with liver diseases, including
chronic renal failure, chronic liver diseases, cirrhosis of
liver, and hepatocellular carcinoma, and 25 healthy
controls (with serum samples negative for viral markers)
were included in this study. Blood samples were collected
after obtaining consent from the patients.
Venous blood (6–10 ml) was drawn from HCV-positive
patients and transferred into plain tubes without an
anticoagulant. The patients were adults and both sexes
were included. They attended either the Outpatient
Department or had been admitted to the Gastroentero-
logy Unit/Haemodialysis Unit of the All India Institute of
Medical Sciences, New Delhi. These patients were
evaluated clinically and biochemically and their sera were
tested for various hepatitis markers. The diagnosis of
different types of diseases was made on the basis of
accepted clinical, biochemical, and histological criteria.
Detection of hepatitis viral markers
Sera were investigated for hepatitis B surface antigen
(HBs-Ag), IgM antibodies to the hepatitis B core antigen
(IgM anti-HBc), and total antibodies against HCV (anti-
HCV). The serological analysis was carried out using
enzyme immunoassay kits of high sensitivity and
specificity obtained from internationally known firms.
Kits for detection of HBs-Ag and IgM anti-HBc were
purchased from Abbot Laboratories (Abbott Park, Illinois,
USA). Anti-HCV was detected using a highly sensitive
third-generation enzyme-linked immunosorbent assay
(ELISA) kit from Ortho Clinical Diagnostics, High
Wycombe, UK. This anti-HCV kit used peptides specific
to CORE, NS3, NS4, and NS5 regions of the HCV
genome as antigens to coat the ELISA plate.
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Expression of genotype specific HCV core protein Ansari et al. 807
RNA extraction and cDNA synthesis
HCV RNA was extracted from 200 ml of a serum sample
using the High Pure Viral Nucleic Acid Kit (Roche
Applied Science, Mannheim, Germany) following the
manufacturer’s instructions. The RNA extracted was
denatured at 651C for 10 min before the reverse
transcription step. cDNA was synthesized using the
Transcriptor High Fidelity cDNA Synthesis Kit (Roche
Applied Science) at 421C for 50 min using 60 mmol/l of
a random hexamer primer.
HCV RNA detection by real-time PCR
Patients’ sera were screened for HCV RNA by real-time
PCR (LightCycler 2.0; Roche) using primers and probes
specific to highly conserved region of the HCV genome:
forward primers 50 -CGG GTG TAC TCA CCG GTT
CCG-30 ; reverse primer 50 -AGC GTC TAG CCA TGG
CGT-30 and fluorescent-labeled probe MCY-CCC CCT
YCC GGG AGA GCAT_ _DB (Roche Applied Science).
All positive and negative controls were tested in parallel
with the test samples for all the procedures.
HCV genotyping by the RFLP method
Amplification of the CORE region of the HCV genome
and subsequent genotyping were carried out as detailed
in our previous publication [27].
Amplification of the full CORE region
The amplification of the full CORE region of HCV
genotype-1a and genotype-3a was carried out using serum
positive for the corresponding genotypes. The standard
PCR reaction mixture of 25 ml contained Taq polymerase
(0.75 U), 1  Q-buffer, 1  PCR buffer, 0.3 mmol/l dNTPs,
1 mmol/l MgCl2, 0.5 mmol/l each of the primer, and
10–50 ng of the cDNA as the template. The primers
(Integrated DNA Technology, Coralville, Iowa, USA)
used for amplification were specific to the CORE region
of genotype-1a and genotype-3a. The second round primers
had restriction enzyme sites: NdeI (CATATG) site in the
forward primer and BamHI (GGATCC) site in the reverse
primer. The amplicons were resolved on a 1.5% agarose gel
and identified as a band of B588 and 573 bp for genotype-1a
and genotype-3a, respectively. The primer sequences
and amplification conditions of each gene are shown
in Table 1.
TA cloning and sequence analysis
The purified amplicons of the CORE region were
subjected to TA cloning using the pGEM T Easy vector
kit (Promega Corp., Madison, Wisconsin, USA). A 10 ml
reaction mixture was concocted using 50 ng (1 ml) of the
pGEM T Easy vector, insert, 1  ligation buffer, and
3 Weiss units (1 ml) of T4 DNA ligase. After transforma-
tion, the cells were grown overnight at 371C on an Luria-
Bertani (LB) agar plate containing ampicillin, and
colonies were screened for confirmation of insertion by
colony-PCR analysis and sequencing.
808 European Journal of Gastroenterology & Hepatology 2013, Vol 25 No 7
Table 1 Primers and thermal conditions used for the amplification of the full CORE region of HCV genotype-1a and genotype-3a
Gene Primer Steps
CORE (genotype-1a) Forward First round
Reverse
Forwarda Second round
Reversea
CORE (genotype-3a) Forward First round
Reverse
Forwarda Second round
Reversea
Underlined sequences represent restriction enzyme sites introduced in the primers.
a
Primers are used for sequencing.
b
In each PCR, initial denaturation was at 951C for 7 min and final extension at 721C for 10 min.
Construction of the recombinant expression vector
(His6-CORE-pET19b)
Purified amplicons and expression vector pET19b (Novagen,
Darmstadt, Germany) were digested at 371C using
NdeI and BamHI restriction enzymes to facilitate the
ligation of the target gene into the vector, and ligation
was carried overnight at 41C using T4 DNA ligase
(Fermentas, Waltham, Massachusetts, USA). The recom-
binant vector was transformed into Escherichia coli DH5a
cells using the heat-shock method and selected on LB
plates containing ampicillin (100 mg/ml). Again, positive
clones were confirmed by colony-PCR, restriction diges-
tion, and sequence analysis. Plasmid isolation was per-
formed using the Qiagen plasmid isolation kit (Qiagen,
Hilden, Germany). Thereafter, the recombinant expres-
sion vector carrying the target gene (His6-CORE-
pET19b) was transformed into E. coli BL21 cells, and
the culture was induced to produce the target protein.
Expression of the HCV His6-CORE gene in the E. coli
host system
The CORE region was expressed as a fusion protein
containing histidine residues at the N-terminal of the
desired protein. The positive clones were grown in 5 ml
LB broth containing 100 mg/ml ampicillin and then
allowed to grow for 6 h after induction at 371C, with
the addition of isopropyl-b-D-thiogalactoside (IPTG) at a
concentration of 1 mmol/l. Expression conditions were
optimized with different IPTG concentrations (0.5 and
1.0 mmol/l), and clones were allowed to grow for 6 h after
induction at 371C. For temperature optimization, the
culture was induced with 1.0 mmol/l IPTG and allowed to
grow at 37 and 161C for 6 and 22 h, respectively. A parallel
culture was set up as a control without the addition of
IPTG and was processed under conditions similar to
those used for the induced culture. Finally, the induced
and the control cultures were harvested by centrifugation
at 5000g for 10 min at 41C, and the cell pellets were
stored at – 801C.
Protein expression analysis by SDS-PAGE
and western blotting
To analyze the expression of the recombinant His6-CORE
protein, 12% SDS-PAGE was carried out in duplicate: one
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Primer sequence (50 –30 ) Cycling parametersb Amplicon length
GTAGTGTTGGGTCGCGAAAGG Annealing at 501C, 60 s 588 bp
TAGGGCAATCATTGGTGACA Extension at 721C, 90 s
CGTGCACCATATGAGCACGAATCCTAAACC Annealing at 651C, 60 s
TTGGGATCCTTAGGCTGAAGCGGGCACA Extension at 721C, 70 s
GACGAAGCTTACGCAGCACACTTCCTAAACCTC Annealing at 531C, 60 s 573 bp
CAGACGTATTCCGCCACTCT Extension at 721C, 90 s
TGCACATATGAGCACACTTCCTAAAC Annealing at 551C, 60 s
AGAGGATCCTTAGGCTGCTGGATGAAT Extension at 721C, 70 s
gel was stained with Coomassie Brilliant Blue and the other
was used for western blotting. The blot was developed by
incubation with a 1 : 7000 dilution of mouse anti-His6
monoclonal antibodies (Qiagen) at 41C overnight with
shaking, followed by incubation with a 1 : 4000 dilution of
the HRP-conjugated anti-mouse IgG antibodies (Santa
Cruz Biotechnology, Santa Cruz, California, USA). Finally,
diaminobenzidine and H2O2 (SRL, Maharashtra, India)
were used to visualize the protein bands.
Purification of the HCV CORE protein expressed
For protein purification, large-scale expression was gener-
ated. A 350 ml induced bacterial culture (E. coli BL21) was
harvested 6 h after induction by centrifugation at 5000g
for 10 min at 41C, and the cell pellet was resuspended in
ice-cold lysis buffer (50 mmol/l NaH2PO4, 300 mmol/l
NaCl, 10 mmol/l imidazole, pH 8.0). The resuspended
cells were treated with 1 mg/ml lysozyme on ice for 30 min
and then subjected to six cycles of sonication on ice
(2-min bursts/2-min cooling/200–200 W in a Branson
Sonicator, Swedesboro, New Jersey, USA). The lysate
was centrifuged at 21 000g for 20 min at 41C, and the clear
supernatant and cellular debris (inclusion bodies or pellet)
were separated. The supernatant fraction was poured into
an Ni2 + –NTA column containing Ni2 + -nitriloacetate
agarose resin (Qiagen) and mixed gently by shaking (on a
rotary shaker) for 1 h on ice. The column was washed ex-
tensively with 15 bed volumes of wash buffer (50 mmol/l
NaH2PO4, 300 mmol/l NaCl, 40 mmol/l imidazole, pH
8.0) to remove nonspecifically bound proteins. The bound
His6-CORE protein was eluted by adding four bed
volumes of the elution buffer (50 mmol/l NaH2PO4,
300 mmol/l NaCl, 250 mmol/l imidazole, pH 8.0) and
analyzed on a 12% SDS-PAGE gel. The protein concen-
tration was determined using Bradford’s method with BSA
as the standard [28].
Blot assay for anti-HCV antibodies using the CORE
protein as an antigen
The protein was transferred from the gel onto a poly-
vinylidene difluoride (PVDF) membrane using a mini-
trans blot (Biorad, Hercules, California, USA). The
membrane was blocked with 3% BSA in PBST and
incubated at 41C overnight. Healthy human sera (1 : 500)

and HCV-infected human sera of different dilutions
(1 : 500, 1 : 1000, 1 : 3000, 1 : 5000, and 1 : 10 000) were
added to the membrane and incubated at room tempera-
ture for 2 h with shaking. Secondary antibody (anti-
human IgG HRP-conjugated antibody) was added at a
1 : 4000 dilution in PBST and incubated for 2 h at room
temperature. The substrate (diaminobenzidine) was
added for the detection of the antigen–antibody complex.
The development of the band confirms the binding of
antibodies from human sera to the CORE protein,
showing the reactivity of the CORE protein with human
sera. All the HCV-infected sera were used at a dilution of
1 : 2000.
Ethics statement
The Ethics Committee of the All India Institute of
Medical Sciences, New Delhi, India, approved this study.
Results
One hundred and thirty-five serum samples from patients
with different liver and renal diseases were screened for
the presence of anti-HCV antibodies using a fourth-
generation EIA system (Ortho Clinical Diagnostic). This
EIA system used peptides specific to CORE, NS3, NS4,
and NS5 regions of the HCV genome as antigens to coat
the ELISA plate. Of all the serum samples, 101 were
found to be positive for the anti-HCV antibody. All these
anti-HCV-positive sera were analyzed for HCV RNA by
real-time PCR using primers and probes against the most
conserved part of 50 NCR and found to be positive for
HCV RNA. This was followed by the determination of
HCV genotypes in 58 RNA-positive sera using a
Fig. 1
L1 L2 L3
1000 bp
500 bp
200 bp
50 bp
Amplification of the full CORE region of HCV genotype-1a and genotype-3a. Genotype-specific primers with NdeI and BamHI restriction enzyme
sites were used to amplify the CORE region of HCV genotype-1a and genotype-3a, respectively. Lanes 1 and 5, low-molecular-weight DNA marker;
lanes 2 and 6, no template control; lanes 3 and 4, band of 588 bp corresponding to genotype-1a; lane 7 and 8, band of 573 bp corresponding
to genotype-3a. HCV, hepatitis C virus.
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Expression of genotype specific HCV core protein Ansari et al. 809
restriction fragment length polymorphism (RFLP) assay.
The results of RFLP indicated that 27 serum samples
were positive for genotype-1, one for genotype-2, 25 for
genotype-3, and two for genotype-4. Three serum
samples had mixed HCV infection with genotype-1
and genotype-3 (Table 2). Genotypes determined by
RFLP were also confirmed by sequencing and phyloge-
netic analysis using the Basic Local Alignment Search
Tool program of the National Center for Biotechno-
logy Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and
CLUSTAL-X version 2.0 of MEGA5. All these data clearly
show that genotype-1 and genotype-3 are the most
common genotypes in the Indian population.
In subsequent steps following HCV genotyping, an
attempt was made to clone and express the HCV CORE
region from genotype-1a and genotype-3a. The sera
positive for these genotypes were selected for amplifica-
tion of the HCV CORE region. The experimental details
including the set of primers used in each case are
provided in the Materials and methods section. The
amplified products were run on a 2% agarose gel. Bands of
588 and 573 bp corresponding to the HCV CORE region
from genotype-1a and genotype-3a, respectively, were
obtained as shown in Fig. 1. These bands were gel
purified and subsequently cloned in TA cloning vector.
Cloning in a TA vector was confirmed by colony-PCR
and sequence analyses. For colony-PCR analysis, a single
colony was dissolved in distilled water and heated at
951C for cell lysis. Centrifugation of the mixture at
10 000 rpm for 5 min separated the supernatant and cell
debris, and 5 ml of the supernatant was used in the PCR
reaction mixture. The sequencing was performed in both
L4 L5 L6 L7 L8
588 bp
573 bp
810 European Journal of Gastroenterology & Hepatology 2013, Vol 25 No 7
directions using gene-specific primers. Both the proce-
dures confirmed successful cloning of HCV CORE
amplicons in the TA vector. The results of sequence
analysis showed almost 97% sequence homology of the
cloned product with the known sequences reported from
genotype-1a and genotype-3a, respectively. The clones of
both the CORE regions were preserved for use in
subsequent experiments.
The cloned sequences from both genotypes were
expressed by the pET19b expression vector. pET19b is
a commonly used vector with a multiple cloning site and
an N-terminal His tag required during the detection and
purification of the translation product. Both cloned
amplicons from genotype-1a and genotype-3a were
expressed under the conditions described in the Materi-
als and methods section. The expression products were
resolved on a 12% SDS-PAGE gel. The results are shown
in Fig. 2. In both cases, a single band of 26 kDa was
obtained. It corresponded to the peptide obtained after
the expression of CORE by both genotype-1a and
Fig. 2
M L1 L2 L3 L4
130 kDa
72 kDa
26 kDa
28 kDa
17 kDa
Expression of recombinant HCV CORE protein. The HCV CORE gene
from genotype-1a and genotype-3a was inserted into the expression
vector to form the recombinant CORE-expressing pET19b plasmid.
The recombinant protein with an N-terminal histidine tag was expressed
in BL21 cells. Expressed protein samples were separated on 12%
SDS-PAGE gels and stained with Coomassie blue dye. A 26 kDa
protein band on SDS-PAGE confirms the expression of HCV CORE.
M, prestained protein marker; L1, uninduced sample of HCV G-1a;
L2, uninduced sample of HCV G-3a; L3, induced sample of HCV G-1a;
L4, induced sample of HCV G-3a. HCV, hepatitis C virus.
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
genotype-3a. The presence of these peptides was further
confirmed by western blotting in which anti-His was used
for the detection of the expressed product. The results
are shown in Fig. 3. These results clearly demonstrate
successful expression of the CORE region from both the
HCV genotypes used. After confirmation by western
blotting, these peptides were purified using an Ni-NTA
purification column with 250 mmol/l imidazole in the
elution buffer and were subsequently used to develop an
immunoassay for the detection of anti-HCV in serum
samples (Fig. 4).
A total of 126 serum samples were analyzed for anti-HCV
by western blotting using 26 kDa peptides as antigens.
The results of the western blot assay are shown
in Table 2. A replica of a similar spot was obtained in
all the sera analyzed. It was interesting to find that the
western blot assay yielded positive results in all the
genotype-positive sera with each of the peptides used.
This indicated that the peptides formed are not genotype
specific and each of them binds with antibodies deve-
loped against the CORE region of all HCV genotypes.
At the same time, none of the 25 serum samples from
Fig. 3
L4 L3 L2 L1 M
130 kDa
26 kDa
28 kDa
17 kDa
Western blot analysis showing the expression of a 26 kDa histidine-
tagged HCV CORE protein. Cell lysates of uninduced and induced
cultures were run on a 12% polyacrylamide gel. After separation,
proteins were transferred onto a polyvinylidene difluoride membrane
overnight. The membrane was blocked with 3% BSA, followed by
incubation with mouse anti-His antibodies at a dilution of 1 : 7000.
Secondary anti-mouse antibodies were used at a dilution of 1 : 4000.
The development of the 26 kDa band with the anti-His antibody
confirmed the expression of the recombinant protein. M, prestained
protein marker; L1–L2, uninduced samples of HCV G-1a and G-3a,
respectively; L3–L4, induced samples of HCV G-1a and G-3a,
respectively.
 Expression of genotype specific HCV core protein Ansari et al. 811

healthy controls yielded a positive result with the western asymptomatic for quite a long period of time, a high
blot assay. proportion develop chronic liver disease leading to end-
stage liver diseases in later years [29]. In India, almost
15–25% of patients with liver diseases are reported to
Discussion have HCV infection [6]. Thus, HCV infection is an
HCV infection is a major public health problem in India. endemic infection prevalent in all parts of this country.
Almost 1.2% of the population of this country has HCV Because of the lack of a clear-cut policy on the screening
infection. Whereas the majority of patients remain and eradication of this deadly infection, patients with
HCV infection are screened when reporting to a hospital
Fig. 4 with certain ailments. In addition, screening of blood
donors in most blood banks is performed by EIA
S1 S2 S3 S4 S5 S6 S7 screening for anti-HCV, in which chances of a misdiag-
nosis remain quite high. The facility of HCV RNA
detection by PCR is not usually available in laboratories
outside major institutions. Thus, most patients remain
undiagnosed for HCV for quite a long time until this
infection becomes severe or progresses to a chronic stage.
Similarly, the facility for HCV genotyping is not available
at all hospitals in this country.

The present study was designed with the aim to express

Detection of anti-HCV antibodies in HCV RNA and HCV antibody-
positive serum with recombinant HCV CORE protein. Protein
separated on a polyacrylamide gel was transferred onto a PVDF
membrane. The membrane was sliced into thin strips and was blocked
with 3% BSA in PBS with continuous shaking at 41C overnight. These
strips were treated with patients’ sera using the primary antibody at the
following serial dilutions: Strip 1 (S1), PBS buffer; S2 and S3, normal
serum; S4, 1 : 500 dilution; S5, 1 : 1000 dilution; S6, 1 : 3000 dilution;
S7, 1 : 5000 dilution.
the HCV CORE region and develop immunoassays to
detect the anti-HCV CORE antibody for screening sera
at an early stage. In fact, the current assays are based on
the detection of total antibodies against HCV sub-
genomes without any consideration of genotype specificity.
Therefore, the present study was designed to explore the
possibility of detecting genotype-specific antibodies, thus
facilitating the detection of anti-HCV antibodies and also
determination of the genotypes of HCV through this
antibody detection. Although several methods [20,22,23]
are available to determine HCV genotypes, most of them
are cumbersome, expensive, and not easy to use. All liver
units or nephrology centers need an easily available assay
system to determine HCV genotypes in patients so that
a proper therapeutic plan can be developed to treat this
infection. In the current situation, this is not adequate to
test anti-HCV in sera and treat the patients. Both the

Table 2 Detection of anti-HCV CORE antibodies in sera using a western blot assay
Anti-HCV antibody positivity

Genotypes Number of cases G-1a-CORE Aga G-3a-CORE Agb Anti-HCVc HCV CORE-Agd

G1 27 25 27 19 15
G2 1 1 1 1 1
G3 25 24 25 17 16
G4 2 2 2 2 1
Mixed infection 3 3 3 3 1
HCV-positive casese 43 42 43 28 23
Healthy control 25 Nil Nil Nil Nil

The prevalence of the anti-HCV CORE antibody was analyzed by a western blot assay using recombinant HCV CORE protein as an antigen. The purified CORE protein
from genotype-1a and genotype-3a was separated on a polyacrylamide gel and transferred onto a PVDF membrane at a constant voltage of 35 V overnight. The
membrane was cut into thin strips. Sera of a total of 58 patients including genotypes-1, 2, 3, and 4 were tested for the expression of CORE proteins from both the
genotypes.
HCV, hepatitis C virus, PVDF, polyvinylidene difluoride.
a
Sera positive when using the expressed product as an antigen from genotype-1a.
b
Sera positive when using the expressed product as an antigen from genotype-3a.
c
Sera positive when using the commercial anti-HCV kit against total anti-HCV antibodies.
d
Sera positive when using the commercial kit against the HCV CORE antigen.
e
Genotyping was not performed.

Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
812 European Journal of Gastroenterology & Hepatology 2013, Vol 25 No 7
pathogenesis of HCV and the antiviral treatment depend
on the genotype of HCV [17,18]. Patients with chronic
liver diseases and chronic renal failure on hemodialysis
have a very severe magnitude of HCV infection [30] and a
proper strategy of treatment along with control of other
symptoms is urgently required.
Our results clearly show successful cloning and expression
of the HCV CORE region from genotype-1a and
genotype-3a. Cloning of the CORE amplicon in the TA
vector was carried out to evaluate its successful insertion
into a vector and assess the cloned sequence before
carrying out expression studies. This is done routinely in
our laboratory and has been made a part of the protocol
for all such studies. On expression, we found peptides of
the same molecular size, both from genotype-1a and from
genotype-3a. The expression product of the same
molecular size in both the cases shows that there is no
change in the CORE region, at least in these two
genotypes. Other studies have reported similar find-
ings [31–33]. Of course, further studies are needed to
express the CORE region from several other genotypes
and isotypes as well. Following expression, the purifica-
tion of peptides and their use in western blotting
produced positive results, with the detection of anti-
HCV in sera. Moreover, it is easier than the HCV CORE
antigen detection assay, which is not available commer-
cially nowadays, and this assay has to be developed in
one’s own laboratory for screening purposes. This shows
that the anti-HCV CORE antibody may be a screening
marker for the diagnosis of HCV infection. However, the
results of the present study do not support the geno-
type specificity of the CORE peptides expressed,
particularly because the HCV CORE expression products
from genotype-1a and genotype-3a bind with all types of
anti-HCV antibodies without discriminating them geno-
typewise, and thus rule out the use of these peptides to
develop an immunoassay to determine HCV genotypes.
Our reports are not adequate to support this theory
unless HCV CORE is expressed by all possible geno-
types/isotypes and peptides are assayed for genotype
specificity using an immunoassay developed using them
as antigens. However, all other reports available to date
also rule out the genotype-specific nature of expressed
products [34]. It may be concluded that anti-HCV CORE
detection may be useful only for screening and not for the
detection of genotype-specific antibodies.
Acknowledgements
Conflicts of interest
There are no conflicts of interest.
References
1 Irshad M, Acharya SK, Joshi YK. Prevalence of hepatitis C virus antibodies in
the general population & in selected groups of patients in Delhi. Indian J
Med Res 1995; 102:162–164.
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
2 Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation
of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis
genome. Science 1989; 244:359–362.
3 Alter MJ. Epidemiology of hepatitis C virus infection. World J Gastroenterol
2007; 13:2436–2441.
4 Global surveillance and control of hepatitis C. Report of a WHO
consultation organized in collaboration with the Viral Hepatitis Prevention
Board, Antwerp, Belgium. J Viral Hepat 1999; 6:35–47.
5 Alter MJ, Margolis SH, Krawczynski K, Judson FN, Mares A, Alexander WJ,
et al. The natural history of community acquired hepatitis C in United States.
N Engl J Med 1992; 327:1899–1905.
6 Chakravarti A, Verma V, Jain M, Kar P. Characteristic of dual infection of
hepatitis B and C viruses among patients with chronic liver disease: a study
from tertiary care hospital. Trop Gastroenterol 2005; 26:183–187.
7 Fabrizi F, Takkouche B, Lunghi G, Dixit V, Messa P, Martin P. The impact
of hepatitis C virus infection on survival in dialysis patients: meta-analysis
of observational studies. J Viral Hepat 2007; 14:697–703.
8 Huskey J, Wiseman AC. Chronic viral hepatitis in kidney transplantation.
Nat Rev Nephrol 2011; 7:156–165.
9 Perico N, Cattaneo D, Bikbov B, Remuzzi G. Hepatitis C infection and
chronic renal diseases. Clin J Am Soc Nephrol 2009; 4:207–220.
10 Romero E, Galindo P, Bravo JA, Osorio JM, Pérez A, Baca Y, et al.
Hepatitis C virus infection after renal transplantation. Transplant Proc 2008;
40:2933–2935.
11 James MC, Kumar V, Abbas AK, Fausto N. The Liver and Biliary Tract. In:
Robbins C, editor. In pathologic basis of disease. 7 ed. Philadelphia,
Pennsylvania: Elsevier Saunders; 2005; Vol. 894:p. 19106.
12 Rho J, Ryu JS, Hur W, Kim CW, Jang JW, Bae SH, et al. Hepatitis C virus
(HCV) genotyping by annealing reverse transcription-PCR products with
genotype-specific capture probes. J Microbiol 2008; 46:81–87.
13 Lindenbach BD, Rice CM. Flaviviridae. The viruses and their replication.
Philadelphia, PA: Lippincott Williams & Wikins; 2001. pp. 991–1041.
14 De Francesco R. Molecular virology of the hepatitis C virus. J Hepatol 1999;
31:47–53.
15 Tellinghuisen TL, Rice CM. Interaction between hepatitis C virus proteins
and host cell factors. Curr Opin Microbiol 2002; 5:419–427.
16 Pawlotsky JM. Hepatitis C Virus genetic variability: pathogenic and clinical
implications. Clin Liver Dis 2003; 7:45–66.
17 Pukhrambam PD, Singh NB, Singh LH, Devi KS. Pattern of hepatitis C virus
genotypes in HIV infected patients in RIMS, Hospital, Imphal, Manipur.
J Commun Dis 2007; 39:21–24.
18 Zein NN, Rakela J, Krawitt EL, Reddy KR, Tominaga T, Persing DH.
Hepatitis C virus genotypes in the United States: epidemiology,
pathogenicity, and response to interferon therapy. Collaborative Study
Group. Ann Intern Med 1996; 125:634–639.
19 Schroter M, Feucht HH, Schafer P, Zöllner B, Laufs R. Serological
determination of hepatitis C virus subtypes 1a, 1b, 2a, 2b, 3a and
4a by a recombinant immunoblot assay. J Clin Microbiol 1999;
37:2576–2580.
20 Cook L, Sullivan K, Krantz EM, Bagabag A, Jerome KR. Multiplex real-time
reverse transcription-PCR assay for determination of hepatitis C virus
genotypes. J Clin Microbiol 2006; 44:4149–4156.
21 Chevaliez S, Bouvier-Alias M, Brillet R, Pawlotsky J-M. Hepatitis C virus
(HCV) genotype 1 subtype identification in new HCV drug development
and future clinical practice. PLoS One 2009; 4:e8209.
22 Alfaresi MS, Elkoush AA. Determination of hepatitis C virus genotypes by
melting-curve analysis of quantitative polymerase chain reaction products.
Indian J Med Microbiol 2007; 25:249–252.
23 Le Pogam S, Dubois F, Christen R, Raby C, Cavicchini A, Goudeau A.
Comparison of DNA enzyme immunoassay and line probe assays (Inno-LiPA
HCV I and II) for hepatitis C virus genotyping. J Clin Microbiol 1998;
36:1461–1463.
24 Ohno O, Mizokami M, Wu RR, Saleh MG, Ohba K, Orito E, et al. New
hepatitis C virus (HCV) genotyping system that allows for identification of
HCV genotypes 1a, 1b, 2a, 2b, 3a, 3b, 4, 5a, and 6a. J Clin Microbiol 1997;
35:201–207.
25 Okamoto H, Kojima M, Okada S, Yoshizawa H, Iizuka H, Tanaka T, et al.
Genetic drift of hepatitis C virus during an 8.2-year infection in a
chimpanzee: variability and stability. Virology 1992; 190:894–899.
26 Ross RS, Viazov S, Roggendorf M. Genotyping of hepatitis C virus
isolates by a new line probe assay using sequence information from
both the 50 untranslated and the core regions. J Virol Methods 2007;
143:153–160.
27 Ansari Mohammad Ahmad, Lingaiah Raghavendra, Irshad Mohammad.
HCV-core region: its significance in HCV-genotyping and type dependent
genomic expression. Macedonian J Med Sci 2012; 5:30–39.

28 Bradford MM. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem 1976; 72:248–254.
29 Zein N. Clinical significance of hepatitis C virus genotypes. Clin Microbiol
Rev 2000; 13:223–235.
30 Furusyo N, Hayashi J, Kanamoto-Tanaka Y, Ariyama I, Etoh Y, Shigematsu M,
Kashiwagi S. Liver damage in hemodialysis patients with hepatitis C virus
viremia: a prospective 10-year study. Dig Dis Sci 2000; 45:2221–2228.
31 Yousaf MZ, Idrees M, Saleem Z, Rehman IU, Ali M. Expression of core
antigen of HCV genotype 3a and its evaluation as screening agent for HCV
infection in Pakistan. Virol J 2011; 8:364.
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Expression of genotype specific HCV core protein Ansari et al. 813
32 Leon P, Lopez JA, Elola C, Quan S, Echevarria JM. Typing of hepatitis
C virus antibody with specific peptides in seropositive blood donors
and comparison with genotyping of viral RNA. Vox Sang 1997; 72:
71–75.
33 Kazemi B, Bandehpour M, Seyed N, Roozbehi M, Mosaff N. Cloning and
expression of hepatitis C virus core protein in pGemex-1 expression vector.
Arch Iran Med 2008; 11:173–178.
34 Sillanpää M, Melén K, Porkka P, Fagerlund R, Nevalainen K, Lappalainen M,
Julkunen I. Hepatitis C virus core, NS3, NS4B and NS5A are the major
immunogenic proteins in humoral immunity in chronic HCV infection.
Virol J 2009; 6:84.