| Open Peer Review | Genomics and Proteomics | Research Article

Vibrio parahaemolyticus becomes lethal to post-larvae shrimp

via acquiring novel virulence factors
Shuang Liu,1,2,3 Wei Wang,1,2 Tianchang Jia,1,2 Lusheng Xin,1,2,3 Ting-ting Xu,1,2,3 Chong Wang,1,2 Guosi Xie,1,2,3 Kun Luo,1,2 Jun Li,4 Jie
Kong,1,2,3 Qingli Zhang1,2,3

AUTHOR AFFILIATIONS See affiliation list on p. 17.

ABSTRACT Translucent post-larvae disease (TPD), caused by Vibrio parahaemolyticus

(VpTPD), has become an emerging shrimp disease, affecting more than 70%–80% of
coastal shrimp nurseries in China in spring 2020. Here, we investigated the key viru­
lence factors of VpTPD by analyzing protein fragments, related genomic information,
as well as experimental challenge tests. After investigating the toxic effects of puri­
fied protein fragments with different molecular weights (MWs) from VpTPD, we found
that only the protein fragments with MW >100 kDa showed similar lethality to live
VpTPD in the experimental challenge test using post-larvae shrimp. Meanwhile, similar
histopathological changes exhibiting in the hepatopancreas and midgut of the diseased
individuals were observed in the post-larvae shrimp challenged with either bacterial
protein fragments (MW >100 kDa) or live VpTPD. Based on sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry analyses, two
novel proteins, Vibrio high virulent protein (VHVP)-1 and VHVP-2, were identified as
the candidates of key virulence factors to cause TPD. Moreover, VHVP-1 and VHVP-2
were found to be encoded by two genes (vhvp-1 and vhvp-2) tandemly located on a
187,791-bp plasmid and were predicted to depend on the same promoter following a
comparative genomic analysis. Further epidemiological investigation and challenge test
indicated that the V. parahaemolyticus isolate carrying only the vhvp-1 gene and lacking
vhvp-2 gene could not cause mortality of experimental Penaeus vannamei post-larvae.
The mutant (Δvhvp-2) by deleting vhvp-2 gene could only cause 4.92% of accumula­
tive mortality of post-larvae that is similar to the non-VpTPD Vibrio strain. Additionally,
the complemented strains, Δvhvp-2/pBT3-vhvp-2 and Δvhvp-2/pwtCas9-vhvp-2, showed
similar virulence to the wild-type VpTPD. The results demonstrated that V. parahaemolyti­
cus becomes lethal to post-larval shrimp by acquiring the VHVP-2 virulence factor. This
study sheds light on further investigations of the pathogenic mechanism of VpTPD and
the development of strategies for early diagnosis of TPD in shrimp hatcheries.

IMPORTANCE As a severe emerging shrimp disease, TPD has heavily impacted the
shrimp aquaculture industry and resulted in serious economic losses in China since Editor Philip N. Rather, Emory University School of
spring 2020. This study aimed to identify the key virulent factors and related genes of the Medicine, Atlanta, Georgia, USA
VpTPD, for a better understanding of its pathogenicity of the novel highly lethal infectious Address correspondence to Qingli Zhang,
pathogen, as well as its molecular epidemiological characteristics in China. The present zhangql@ysfri.ac.cn.
study revealed that a novel protein, Vibrio high virulent protein-2 (MW >100 kDa), is The authors declare no conflict of interest.
responsible to the lethal virulence of V. parahaemolyticus to shrimp post-larvae. The
See the funding table on p. 17.
results are essential for effectively diagnosing and monitoring novel pathogenic bacteria,
like VpTPD, in aquaculture shrimps and would be beneficial to the fisheries department Received 3 February 2023
in early warning of VpTPD emergence and developing prevention strategies to reduce Accepted 5 September 2023
Published 18 October 2023
economic losses due to severe outbreaks of TPD. Elucidation of the key virulence genes
and genomics of VpTPD could also provide valuable information on the evolution and Copyright © 2023 Liu et al. This is an open-access
article distributed under the terms of the Creative
ecology of this emerging pathogen in aquaculture environments.
Commons Attribution 4.0 International license.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 1

Research Article Microbiology Spectrum

KEYWORDS translucent post-larvae disease (TPD), Vibrio parahaemolyticus-causing

TPD (VpTPD), shrimp, novel virulence factor, Vibrio high virulent protein (VHVP)

F rom late 2019 to early 2020, a new shrimp disease called translucent post-lar­
vae disease (TPD) or glass post-larvae disease appeared in the southern coastal
provinces of China. TPD became more and more prevalent in shrimp post-larvae, causing
collapse of 70%–80% coastal shrimp nurseries in China in the spring of 2020 (1–3).
A highly virulent Vibrio parahaemolyticus strain (Vp-JS20200428004-2) was identified
as the responsible pathogen for the infectious TPD and was provisionally named as
V. parahaemolyticus causing TPD, or VpTPD (4). VpTPD was highly lethal in particular
to post-larvae at 4–7 days old (PL4–PL7). The cumulative mortality of the infected
post-larvae could reach up to 100% in 3 days in a typical disease case. The infec­
ted shrimp post-larvae exhibited typical clinical syndromes, such as pale or colorless
hepatopancreas and empty digestive tract, which made the diseased individuals to
become transparent and translucent; therefore, these diseased individuals were named
“translucent post-larvae” or “glass post-larvae” by local farmers (4).
VpTPD infection in the Penaeus vannamei post-larvae could cause obvious histopatho­
logical changes that are similar to some degree to those of acute hepatopancreatic
necrosis disease (AHPND). The epithelial cells of hepatopancreatic tubules and midgut
were necrotic and sloughed off. A large number of colonized bacteria could be observed
in hepatopancreas and midgut under microscope (4). Whereas, the toxicity of VpTPD
(vp-HL-202005) to the post-larvae of P. vannamei was about 1,000 times higher than that
of the V. parahaemolyticus strain causing AHPND (3).
Until 2023, the prevalence of TPD was still common in P. vannamei nurseries and
farms in the coastal provinces of China. Even though some antibiotics were reported
to be able to kill or inhibit VpTPD, the demand of antibiotic-free shrimp production
prompted the high preference of biosecurity measures, including early detection and
disinfection treatment to prevent the occurrence and prevalence of the TPD. Therefore,
there is an urgent need to investigate the key virulence factor of VpTPD for developing
effective diagnostic techniques and further prevention strategies of TPD.
In the present study, we first carried out investigations for the key virulent proteins
with different molecular weights that contribute to the pathogenicity of VpTPD to
P. vannamei post-larvae via experimental challenge tests. Then, the virulent protein
fragments as potential virulence factors of VpTPD were characterized by mass spectrom­
etry and genome sequencing. Meanwhile, we also investigated the presence of Vibrio
high virulent protein (VHVP) virulence factor in different Vibrio isolates as well as its
occurrence in the TPD cases in different shrimp farms from different geographical areas
of China. The results of our current study should shed insights into the molecular
pathogenic mechanisms of VpTPD in P. vannamei post-larvae.

RESULTS
Inactivation of VpTPD
We first tested the effect of thermal inactivation and ultrasonic disruption to inactivate
VpTPD. The culture of VpTPD (7.1 × 10E8 CFU/mL) was treated for inactivation by different
combinations of two methods, ultrasonic disruption (U) and heating (H) at 65°C for 45
min. The lysate protein extract obtained by ultrasonic disruption of VpTPD (>100 kDa)
was inactivated too. The viability of inactivated VpTPD was tested by inoculating different
treatments onto agar plates, and no bacteria grew on the plates from the treatment
groups of VpTPD + U and H, VpTPD + U and H (>100 kDa), and VpTPD + U (>100 kDa),
which indicated that VpTPD could be effectively inactivated via various combination
methods of sonication and pasteurization in the present study.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 2

Research Article Microbiology Spectrum

Pathogenicity of the candidate virulence factors of VpTPD determined by the

challenge test
The cumulative mortality rates of challenged P. vannamei post-larvae with both live
VpTPD and its protein fractions with different molecular weights are shown in Fig. 1b.
During a 40-h experimental period, no death occurred in the negative control (NC)
group; however, dead post-larval shrimps in the group challenged with 7.1 × 105 CFU/mL
of VpTPD were observed at 8 h, and the mortality reached 100% after 24 h of challenge.
The mortality of shrimps in the group of VpTPD + U (>100 kDa) began at 16 h post
of challenge and then reached 90% after 32 h. In contrast, the cumulative mortality
of post-larvae in all the groups of VpTPD + U (50–100 kDa), VpTPD + U (30–50 kDa),
VpTPD + U (10–30 kDa), and VpTPD + U (<10 kDa) did not exceed 10% even after 32 h
of challenge (Fig. 1b). The results indicated that only VpTPD + U (>100 kDa) proteins
showed a similar virulent effects to P. vannamei post-larvae as live VpTPD, which means
the efficient virulence factors of VpTPD should be in the fraction (MW >100 kDa) of the
lysate protein extract by ultrasonic disruption of VpTPD + U.

Histopathological analysis of samples from different challenged groups

Histopathological examination revealed severe necrosis and sloughing of epithelial cells
in both hepatopancreatic tubules and midgut of the infected post-larvae with live VpTPD
at 24 h post challenge (Fig. 1c). In the group challenged with VpTPD + U (>100 kDa),
mild necrosis and sloughing of epithelial cells were observed in both hepatopancreatic
tubules and midgut at 16 and 24 h post challenge, and severe necrosis and sloughing
of epithelial cells occurred at 32 and 40 h post challenge (Fig. 1d); the most severe
histopathological changes were seen in the midgut at 32 h post challenge, and severe
necrosis of epithelial cells causes epithelial cells to fall off the basement membrane of
the midgut and scatter into the cavity of the midgut (Fig. 1d). In contrast, there were no
obvious histopathological changes in the hepatopancreatic tubules and midgut of the
post-larval individuals from the control group (Fig. 1c).

Identification of VpTPD virulence factors by SDS-PAGE and mass spectrometry

analysis
To screen the candidate virulence factors from this ultrasonic disruption lysate protein
extract with molecular weight >100 kDa in VpTPD, the SDS-PAGE analysis showed three
bands representing three major proteins in the VpTPD + U portion (MW >100 kDa) (Fig.
2a). The three bands, designated as VpTPD_4-2-1, VpTPD_4-2-2, VpTPD_4-2-3, were then
excised from the gel and projected for further analysis by using a mass spectrometer
and were identified as insecticidal toxin complex protein (GenBank: WP_269169668.1),
virulence protein (GenBank: APX09935.1) (Fig. 2b and c), and aconitate hydratase B
(GenBank: KIT24301.1), respectively. Finally, both VpTPD_4-2-1 and VpTPD_4-2-2 were
selected as the candidate virulence factors I and II of VpTPD for further analysis, and
VpTPD_4-2-3 was excluded from subsequent analyses, as aconitate hydratase B is not a
virulence protein according to previous reports.

Genome sequencing and comparative genome analysis of VpTPD and

non-VpTPD strains
To better understand the genetic information of the virulence factors of VpTPD, a
comparative genome analysis of VpTPD and non-VpTPD strains was carried out, and
sequencing results showed that the complete genome of VpTPD consisted of two circular
chromosomes (Fig. 3a) and three plasmids (Fig. 3c). The two circular chromosomes are
3,527,627 bp (chromosome 1) and 1,887,516 bp (chromosome 2) in length, respectively.
The three plasmids of VpTPD are 212,543 bp, 187,791 bp, and 60,506 bp, respectively.
Whereas, the complete genome of the non-VpTPD strain (Vp1616) consisted of two
circular chromosomes (Fig. 3b) and without plasmids. The two circular chromosomes

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 3

Research Article Microbiology Spectrum

FIG 1 Pathogenicity analysis of VpTPD proteins of different molecular weights to Penaeus vannamei post-larvae. (a) Schematic of the protocols used to obtain
VpTPD proteins of different molecular weights. (b) Cumulative mortality of P. vannamei post-larvae induced by different molecular weights of VpTPD proteins in
the immersion challenge test. Each group contained three experimental tanks as three replicates. For each replicate, 15 shrimps were challenged by immersion
with 1× PBS buffer (negative control), live VpTPD (positive control), and the proteins of VpTPD with different molecular weights (VpTPD + U [>100 kDa], VpTPD +
U [50–100 kDa], VpTPD + U [30–50 kDa], VpTPD + U [10–30 kDa], VpTPD + U[(<10 kDa]), respectively. Cumulative mortality of shrimp was shown as the mean
and SD of three replicate data for each experimental group. For each replicate, healthy shrimps were immersed in a concentration of 7.1 × 105 CFU/mL live
VpTPD (infected group) or in a concentration of protein fractions with different molecular weights extracted from 7.1 × 105 CFU/mL VpTPD. (c) Histopathological
photographs of hepatopancreas and intestine of P. vannamei post-larvae from the live VpTPD-challenged group (positive control) and 1× PBS-challenged group
(negative control). (d) Histopathological photographs of hepatopancreas and intestine of P. vannamei post-larvae from VpTPD + U (>100 kDa) challenged group at
different time points post infection (including 8 hpi, 16 hpi, 24 hpi, 32 hpi, and 40 hpi).

are 3,288,162 bp (chromosome 1) and 1,923,178 bp (chromosome 2), respectively. The

comparative analysis of genomic information between VpTPD and Vp1616 demonstrated

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 4

Research Article Microbiology Spectrum

FIG 2 SDS-PAGE and mass spectrometry analysis of VpTPD. (a) Schematic of protein sample analysis of VpTPD. (b) VpTPD proteins revealed by SDS-PAGE
electrophoresis. Lane 1, VpTPD; lane M, protein molecular weight marker (kDa). The major proteins in VpTPD with molecular weights >100 kDa, VpTPD_4-2-1,
VpTPD_4-2-2, and VpTPD_4-2-3, were identified as insecticidal toxin complex protein (GenBank: WP_269169668.1), virulence protein (GenBank: APX09935.1),
and aconitate hydratase B (GenBank: KIT24301.1), respectively. (c) Identification of VpTPD virulence proteins by matrix-assisted laser desorption ionization-time-
of-flight mass spectrometry analysis. Sequences in red font are the peptide sequences identified by mass spectrometry. (d) Identification of VpTPD proteins by
matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis. Part of the secondary mass spectrum of the sequence in red font.

that two putative virulent factor genes (GE005140 and GE005139) only presented in
the VpTPD but not in Vp1616. According to the results of multiple sequence alignment
using the online Blastx program on the NCBI web, the two putative virulent factor genes
(GE005140 and GE005139) were found to encode the deduced candidate virulence
factors I and II, which shared 100% and 99.49% amino acid sequences identity with
the insecticidal toxin protein (GenBank: WP_269169668.1) and the virulence protein
(GenBank: APX09935.1), respectively.

Sequence characterization of the unique virulence factors of VpTPD

Based on the comparative genomic and mass spectrometry analysis, two putative
virulent proteins of VpTPD_4-2-1 and VpTPD_4-2-2, which were encoded by GE005140
and GE005139 in VpTPD, respectively, were named as putative VHVP-1 and VHVP-2.
The genes of GE005140 (vhvp-1) and GE005139 (vhvp-2) were found to be tandemly
located on a 187,791-bp plasmid of the VpTPD genome and are predicted to depend
on the same promoter in the plasmid by using the classic bacterial sigma70 promoter
recognition program. According to the open reading frame (ORF ) finder analysis (https://

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 5

Research Article Microbiology Spectrum

FIG 3 Circular genome and plamid maps of chromosomes of VpTPD and Vp1616, and domain structure
of gene vhvp-1 and vhvp-2 of VpTPD. (a) Circular genome maps of chromosome 1 and chromosome
2 of VpTPD. From inner to outer, the first circle represents the genomic length in 5 kb; the second
and third circles represent the COG function category of the protein-coding sequence on the forward
and reverse strands, respectively; the fourth circle represents the repetitive sequence; the fifth circle
represents tRNA and rRNA, blue is tRNA, and purple is rRNA; the sixth circle represents the GC content;
the innermost circle is the GC skew, dark gray represents the area where the G content is greater than
C, and the red represents the area where the C content is greater than G. (b) Circular genome maps of
chromosome 1 and chromosome 2 of Vp1616. The outermost circle represents the positional coordinates
of the genome sequence. From outside to inside, they are coding genes, gene function annotation
results (including COG, KOG, eggNOG, KEGG, and GO database annotation results information), ncRNA,
genome GC content, and genome GC skew value distribution. Circular genome maps of chromosome 1
and chromosome 2 of Vp1616. The outermost circle represents the positional coordinates of the genome
sequence. From outside to inside, they are coding genes, gene function annotation results (including
COG, KOG, eggNOG, KEGG, and GO database annotation result information), ncRNA, genome GC content,
and genome GC skew value distribution. (c) Circular maps of plasmid 1, plasmid 2, and plasmid 3 of
VpTPD. From inner to outer, the first circle represents the genomic length in 5 kb; the second and
third circles represent the COG function category of the protein-coding sequence on the forward and
reverse strand, respectively; the fourth circle represents the repetitive sequence; the fifth circle represents
tRNA and rRNA, where blue is tRNA, and purple is rRNA; the sixth circle represents the GC content; the
innermost circle is the GC skew, dark gray represents the area where the G content is greater than C,
and the red represents the area where the C content is greater than G. (d) Genome map of plasmid
2 (187,791 bp) of VpTPD. The black circle represents the position of the putative virulence genes of
vhvp-1 (GE005140) and vhvp-2 (GE005139) in the genome. (e) The deduced conserved domain structure
of the proteins encoded by vhvp-1 and vhvp-2 in plasmid 2. VRP1 super family, Salmonella virulence
plasmid 28.1 kDa A protein; Neuramin, neuraminidase-like domain; TcA, TcA receptorbinding domain;
TcA_TcB_BD, Tc toxin complex TcA C-terminal TcB-binding domain. SpvB, Salmonella virulence plasmid
65 kDa B protein; TcdB, bacterial insecticide toxin TcdB.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 6

Research Article Microbiology Spectrum

www.ncbi.nlm.nih.gov/orffinder/) of the vhvp genes, VHVP-1 was composed of 2,544

amino acid residues, with a predicted molecular mass of 283.37 kDa and a predicted
pI of 4.69, and VHVP-2 was composed of 1,421 amino acid residues, with a predicted
molecular mass of 161.34 kDa and a predicted pI of 4.63. Prediction by the online
Conserved Domain Search Service (CD Search) in NCBI revealed that VHVP-1 possessed
the conserved domains of Tc toxin complex TcA C-terminal TcB-binding domain (Pfam
ID: CL39627), TcA receptor-binding domain (Pfam ID: CL139842.1), neuraminidase-like
domain (Pfam ID: pfam18413), and Salmonella virulence plasmid 28.1 kDa A protein
(Pfam ID: CL21676) (Fig. 3e). Meanwhile, VHVP-2 was found to contain the conserved
domains of Salmonella virulence plasmid 65 kDa B protein (SpvB, Pfam ID: pfam03534),
insecticide toxin TcdB middle/C-terminal region (Pfam ID: pfam12255), and insecticide
toxin TcdB middle/N-terminal region domain (Pfam ID: cl13663) (Fig. 3e). VHVP-1 and
VHVP-2 shared 45.16%–99.49% and 71.85%–100% overall sequence identity with other
bacterial virulence factors, respectively.

Detection of VpTPD by PCR

In order to develop a PCR detection method for VpTPD, PCR primers were designed
for targeting vhvp-1 and vhvp-2 genes (Fig. 4a; Table 3). Both DNA samples from the
VpTPD isolate and shrimp tissues suffered with TPD could be amplified and produced
362, 351, and 303 bp amplicons using the VpTPD-vhvp-1-F1/R1, VpTPD-vhvp-2-F1/R1,
and VpTPD-vhvp-2-F2/R2 primer sets, respectively (Fig. 4a). Specificity analysis of the
primers was performed by using DNA samples from the non-VpTPD strains, including
V. parahaemolyticus-0421B, Pseudoalteromonas flavipulchra (CDM8), V. parahaemolyticus
causing AHPND (VpAHPND, 20200610006-16), V. alginolyticus (20150606001-2), V. harveyi
(20170902102-3), V. owensii (20150709001-2), and V. campbellii (20150606027-2). The
results showed that no expected PCR products were amplified when using DNA from
non-VpTPD strains as templates, which indicated that the PCR primer sets are only specific
for VpTPD (Fig. 4b).

Epidemiological analysis of VpTPD

A total number of 179 shrimp samples were collected from different shrimp farms in
China. Field epidemiological investigations and laboratory histopathological analyses
revealed that the TPD occurred in shrimp farms in Hebei, Shandong, Jiangsu, Hainan,
and Xinjiang provinces (Fig. 4c). All DNA samples extracted from 179 shrimp samples
were subjected to molecular epidemiological investigations using the specific VpTPD
PCR assay. The PCR results showed that the targeted vhvp-1 (containing VRP1, neurami­
nidase, and TcA domains) and vhvp-2 gene (containing SpvB and TcdB domains) could
only be amplified in the shrimp samples with typical TPD cases but not from the
healthy or non-TPD shrimp samples (Fig. 4c). In addition, the V. parahaemolyticus isolate
20211213002-3 that was isolated from shrimp farm in Hunan Province and carry only the
vhvp-1 gene but no vhvp-2 gene could not cause mortality of experimental P. vannamei
post-larvae in the challenge test (Fig. 5a). The results showed that the vhvp-2 gene, rather
than the vhvp-1 gene, is the actual key virulence gene in the VpTPD.

Confirmation of the key virulence factor of VpTPD

The nucleotide sequence of the coding sequences (CDS) of the vhvp-2 gene shared 100%
to 71.85% sequence identity with its homologs in Vibrio campbellii, Vibrio parahaemo­
lyticus, Photobacterium damselae, Vibrio owensii, Photobacterium iliopiscarium, Aliivibrio
fischeri, Yersinia ruckeri, and Enterobacter asburiae. To confirm the key virulence factor
of VpTPD, an isogenic mutant of VpTPD (∆vhvp-2) was constructed. And in the ∆vhvp-2,
including the entire insecticide toxin TcdB middle/N-terminal region domain, from the
106th amino acid residue of conserved domain of the Salmonella virulence plasmid
65 kDa B protein to the 79th residue of the conserved domain of the insecticide toxin
TcdB middle/C-terminal region was successfully deleted. The lethal effects of ∆vhvp-2

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 7

Research Article Microbiology Spectrum

FIG 4 Sites schematic of PCR primers of VpTPD virulence factor genes and the molecular epidemiological analysis based on vhvp gene of VpTPD. (a) Schematic
of the VpTPD virulence factor (vhvp) gene vhvp-1 and vhvp-2 and the detection primers targeting the vhvp genes. (b) Electrophoretogram of molecular detection
of the vhvp genes encoding the conserved domain of TcdA in vhvp-1 gene, SpvB and TcdB in vhvp-2 gene in different marine pathogens. Lane 1, VpTPD; lane 2,
Vibrio parahaemolyticus-0421B; lane 3, Pseudoalteromonas (CDM8); lane 4, Vibrio parahaemolyticus causing AHPND (20200610006-16); lane 5, Vibrio alginolyticus
(20150606001-2); lane 6, Vibrio harveyi (20170902102-3); lane 7, Vibrio owensii (20150709001-2); lane 8, Vibrio campbellii (20150606027-2); lane M, molecular
weight marker (bp). (c) VpTPD prevalence in different shrimp aquaculture regions with different prevalence rates (left). VpTPD prevalence rates in different
sampling province in the TPD epidemiological survey (right). Shrimp samples were collected from the shrimp farms in Hebei, Shandong, Jiangsu, Hainan,
Xinjiang, Hunan, Hubei, and Guangdong provinces of China from April, 2020 to 2021. VpTPD prevalence rates in the histogram only represent the positive
detection rate of the vhvp-2 gene in the collected samples and not the actual prevalence condition of the TPD in the local areas. The map in panel C was created
using ArcGIS 10.4.

and VpTPD to post-larval shrimp were compared by experimental challenge, and the
results showed that at the same dose of pathogen, VpTPD caused 81.89% mortality
at 32 h post challenge, ∆vhvp-2 caused 4.92% mortality, while the negative control
caused no death (Fig. 5b). The cumulative mortality induced by VpTPD was significantly
different from that of ∆vhvp-2 and NC. Furthermore, the mortality induced by NC was
significantly lower than the two complement strains Δvhvp-2/pBT3-vhvp-2 and Δvhvp-2/
pwtCas9-vhvp-2, and the wild-type VpTPD (Fig. 5b). The results indicate that the protein
of VHVP-2 is key to the pathogenic effect of VpTPD, and therefore it was considered as the
key virulence factor of VpTPD.

DISCUSSIONS
TPD, a new emerging disease mainly affecting the post-larvae of shrimp with typical
syndromes of pale or colorless hepatopancreas and digestive tract, had become an
urgent threat to the shrimp farming industry in China (4). In a recent study, a novel V.
parahaemolyticus (VpTPD) was confirmed as the causative agent of the emerging TPD
based on the isolation, identification, and testing of the pathogenic agent, according to
the four criteria of Koch’s postulates (4). However, the pathogenic mechanism of VpTPD

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 8

Research Article Microbiology Spectrum

FIG 5 Identifying the key virulence factor of VpTPD. (a) Cumulative mortality of Penaeus vannamei post-larvae immersed in NC, VpTPD, and Vibrio parahaemolyti­
cus strain 20211213002-3. P. vannamei post-larvae were immersed with the wild-type Vibrio parahaemolyticus strain VpTPD carrying vhvp-2 gene or the Vibrio
parahaemolyticus strain 20211213002-3 lacking vhvp-2 gene at the same pathogen dose. Shrimps were monitored daily for mortality. Cumulative shrimp
mortality was shown as the average mean and SD of two replicate data for each experimental group. (b) Cumulative mortality of P. vannamei post-larvae
immersed in NC, VpTPD, Δvhvp-2, Δvhvp-2/pwtCas9-vhvp-2, and Δvhvp-2/pBT3-vhvp-2. The post-larvae of P. vannamei were immersed with VpTPD, the vhvp-2
gene deletion mutant ∆vhvp-2, or the vhvp-2 gene complement strain Δvhvp-2/pwtCas9-vhvp-2 and Δvhvp-2/pBT3-vhvp-2 at the same pathogen dose. Shrimps
were monitored daily for mortality. Cumulative mortality of shrimp was shown as the average mean and SD of three replicate data for each experimental group.
(c) Schematic of the procedures used to identify the key virulence factor of VpTPD.

was not fully understood yet, which limited the effective prevention and control of
VpTPD in actual shrimp farming practice. In this study, we carried out in-depth investiga­
tions, including immersion challenge tests, mass spectrometry analysis, histopathologi­
cal analysis, and comparative genomic analysis, in order to identify the specific virulence
factors of VpTPD causing translucent post-larvae disease in P. vannamei. The results
showed that novel toxin protein, designated as VHVP-2 (MW >100 kDa), containing the

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 9

Research Article Microbiology Spectrum

conserved domains of Salmonella virulence plasmid protein, insecticidal toxin complex

protein, and neuraminidase, was the key virulence factor of VpTPD (Fig. 5c).
The immersion challenge tests in the present study showed that a specific protein
fraction, in which MW >100 kDa from the lysate of VpTPD, could cause a similar lethality
to the shrimp post-larvae as the live pure culture of VpTPD. This result initially indicated
that the virulence factor of VpTPD should be in the protein fraction with MW >100 kDa.
In addition, the supernatant of VpTPD culture did not show any significant virulent
effects to shrimp post-larvae in comparison to that of PBS in our experimental challenge
tests, which indicated that the key virulent protein of VpTPD was likely not secretory
(data not shown) under the cultured condition of the present study. Previous studies
reported that SDS-PAGE and mass spectrometry analysis have been widely applied for
the identification of bacteria virulent proteins with different sizes. For example, PirA-
and PirB-like proteins of 13 kDa and 50 kDa were identified as the virulence factor of
VpAHPND by SDS-PAGE and LC-MS/MS in the investigation of the shrimp pathogen of
AHPND (5). In addition, proteomic analysis using LC-MS/MS was also applied to elucidate
the pathogenesis of Edwardsiella tarda (6) as well as to map lysine acetylation sites in
revealing their virulent role in V. alginolyticus (7). Similarly, SDS-PAGE and mass spectrom­
etry analysis were also successfully applied in the present study to identify virulent
proteins of VpTPD. Among three major protein fragments (MW >100 kDa) in VpTPD
based on SDS-PAGE analysis, two of them (VpTPD_4-2-1 and VpTPD_4-2-2) were found to
share high sequence similarity with the known virulence factor by mass spectrometry
analysis, and they were determined to be the candidate virulence factor of VpTPD.
Interestingly, the highly homologous proteins of the candidate virulence protein of
VpTPD, including WP_269169668.1 and APX09935.1, were submitted to NCBI GenBank by
other researchers in 2017, suggesting that the strains carrying them should have started
to spread in some areas of the world before 2017 or earlier. Regarding the bacteria strains
carrying the homologous virulent protein, their distribution, transmission mode, and
their pathogenic effects to aquatic animals are worthy of further investigation.
It has been well recognized that the methodologies, such as genome sequencing,
comparative genomic analysis, and proteomic analysis, play crucial roles in investigating
the pathogenesis of AHPND in shrimp (8–11). For example, genome sequence analysis
was used to reveal two virulence genes (pirA- and pirB-like) of VpAHPND in the plasmid
pVA1 of VpAHPND (8, 10, 12, 13), and proteomic analysis confirmed the pir toxin-like
proteins encoded by the two genes (5). Moreover, comparative genome analysis further
addressed that the virulence genes carrying the transferable plasmids not only exist in
VpAHPND but also in other non-V. parahaemolyticus AHPND strains and also contribute
to its pathogenesis (13–15). For example, a draft genome sequence showed that a V.
harveyi isolate could cause AHPND in shrimp in northern Vietnam (16). Studies showed
that plasmid-mediated interspecies transfer of the hazard genes could have occurred in
different Vibrio species, including V. parahaemolyticus, V. campbellii, and V. owensii (17,
18) and that conjugative transfer of the AHPND-causing pVA1-type plasmid carrying
the hazard genes is mediated by a novel self-encoded type IV secretion system (19).
Such methodologies provide direct guidelines for uncovering the virulence factors and
pathogenic mechanism of VpTPD. Our current study based on the abovementioned
methods demonstrated that the plasmid containing the virulent vhvp gene of VpTPD
also carried traG, traE, traB, traC, and other binding transfer-related genes (data not
shown), indicating that the virulence gene of vhvp in VpTPD might be able to transfer
via conjugation among different Vibrio species. Our recent nationwide epidemiological
surveys (the data are not shown) also revealed that the vhvp gene was identified in a
variety of dominant Vibrio species, including V. natriformis, V. Campbellii, and V. alginolyti­
cus, which were isolated from diseased shrimps with typical TPD symptoms. Our findings
suggest that TPD was caused by different pathogens carrying the same transferable vhvp
genes, and therefore we need to pay more attention on the VpTPD for its higher risk of
horizontal transmission.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 10

Research Article Microbiology Spectrum

The conjoint analysis of mass spectrometry, complete genome sequencing, and

comparative genome of VpTPD indicated the amino acid sequence of the two potential
virulence factors of VpTPD (VpTPD_4-2-1 and VpTPD_4-2-2) annotated by mass spectrome­
try analysis shared 100% and 99.49% identity with the deduced protein sequence of the
two potential candidate virulence genes, GE005140 and GE005139, in the VpTPD plasmid.
Thus, the VpTPD_4-2-1 and VpTPD_4-2-2 proteins were determined to be the putative
key toxins of VpTPD, and the genes of GE005140 (vhvp-1) and GE005139 (vhvp-2) in the
187,791 bp plasmid were identified as the putative virulence genes of VpTPD. VpTPD
vhvp-1 genes were predicted to encode the four conserved protein domains including
SpvA (GenBank: CL21676), neuraminidase (GenBank: pfam18413), TcA receptor binding
(GenBank: CL139842.1), and TcA/TcB super family (GenBank: cl39627), and VpTPD vhvp-2
genes were predicted to encode the three conserved domains including SpvB (GenBank:
pfam03534), TcdB_toxin_midC (GenBank: pfam12255), and TcdB_toxin_midN superfamily
(GenBank: cl13663).
The Spv protein has been identified as one of the most important virulence factors
of Salmonella (20–22), and the SpvB protein was reported to act as an intracellular
toxin that covalently modified monomeric actin, leading to loss of F-actin filaments
and depolymerization of the cytoskeleton in Salmonella-infected human macrophages
(23–25). The C-terminal domain of SpvB was reported to contain ADP-ribosyl transfer­
ase activity, which modifies G-actin monomers and prevents their polymerization into
F-actin filaments (25, 26), and SpvB has been shown to increase cell damage mainly
through its F-actin depolymerization-associated function and induction of apoptotic
cell death (27-28, 29). The insecticidal toxin complex protein was composed of several
subunits including TcA, TcB, TcC, and TcD; TcA facilitates receptor-toxin interaction and
membrane permeation; TcB and TcC form a toxin-encapsulating cocoon (30–32). It has
been reported that the TcdB toxin may act synergistically with another glycosylating
toxin, TcdA. First, TcdA acts to disrupted epithelial integrity and then allows TcdB to enter
and mediate toxic effects within the host (31, 33, 34). In addition, TcdB has been shown
to disrupt epithelial integrity and cause tissue damage in human colon explants (35,
36). During infection, it is likely that TcdB first engages NECTIN3 and frizzled proteins
to enter and intoxicate the colonic epithelium. Following epithelial damage or loss
of tight junctions, the toxin could gain access to CSPG4 in the subepithelial myofibro-
blasts, causing further mucosal damage (37–39). A previous study on VpTPD showed that
necrosis and sloughing of the epithelial cells occurred in the hepatopancreatic tubules
and midgut of naturally infected or immersion-challenged P. vannamei post-larval
individuals (4). Correspondingly, the same histopathological changes, including necrosis
and sloughing of the hepatopancreatic and enteric epithelial cells, also occurred in P.
vannamei post-larvae from the live VpTPD-challenged group and the >100 kDa proteins
of VpTPD-challenged group in the present study. That is, the above pathological changes
in the TPD-affected shrimp individuals were consistent with the known pathological
characteristics induced by the predicted novel virulence gene vhvp-2, encoding the
domains of Spv plasmid toxin and Tc toxins. The epidemiological studies indicated that
the vhvp-2 gene was only present in the diseased shrimps with typical TPD syndromes.
Moreover, experiments of deletion and complement mutants of the vhvp-2 gene in
VpTPD further confirmed that the vhvp-2 gene plays a key role in the realization of VpTPD
virulence. Meanwhile, the results of the epidemiological investigation and challenge test
indicated that the V. parahaemolyticus isolate carrying only the vhvp-1 gene and lacking
vhvp-2 gene could not cause mortality of experimental P. vannamei post-larvae. All the
abovementioned results indicated that vhvp-2 was the key virulence gene of VpTPD
in P. vannamei. The functional mechanism of the virulence factor VHVP-2 in causing
the shedding of intestinal epithelial cells of VpTPD-infected shrimp deserves further
investigation.
Salmonella infection (salmonellosis) is a common bacterial disease that affects
intestinal tract of animals and humans (40), and the most frequent infection route in
humans is through consuming contaminated water or foods (41, 42). Recent reports have

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 11

Research Article Microbiology Spectrum

shown that farmed shrimps may serve as potential reservoirs and carriers of Salmonella
bacteria and, therefore, pose a potential risk to public health (43–47). The present study
showed that VpTPD becomes lethally virulent to shrimp post-larvae because it acquired
vhvp-2 gene encoding the domain of Salmonella virulence plasmid 28.1 kDa A protein
and 65 kDa B protein (SpvB). Meanwhile, these results suggested that the shrimp infected
by VpTPD could pose potential risks to public health as well as the other farmed or wild
animals via spreading the virulent vhvp-2 gene in the aquatic environment.
In summary, we preliminarily demonstrated that a novel virulence protein, VHVP-2,
was the key toxin of VpTPD, and it was encoded by vhvp-2 gene located on a 187,892-bp
plasmid of the VpTPD genome. This means that the opportunistic pathogen V. parahae­
molyticus becomes lethally virulent to shrimp post-larvae by acquiring the virulence
factor of VHVP-2. In addition, this study established a PCR detection method of VpTPD for
early warning of TPD. These results proved new insights into the pathogenic mechanism
of VpTPD and provided the first molecular detection method for VpTPD. The present study
would be helpful for further investigation of VpTPD in terms of its diagnostic technique
and pathogenic mechanism, as well as for the prevention and control of TPD.

MATERIALS AND METHODS

Experiment shrimp
The specific pathogen-free P. vanmamei post-larvae (PL3, body length 4–6 mm) were
collected from the Haixingnong Shrimp Breeding Northern Base of BLUMP Seed Industry
Technology Co., Ltd in Weifang, Shandong Province. P. vanmamei post-larvae were
acclimated to the laboratory conditions for 2 days in 10 L glass tanks with continuous
aeration (at 24°C, salinity 26 ± 3 g/L), fed three times a day with pelleted commercial
feed, and then used for the challenge test.

Bacterial strains and growth conditions

V. parahaemolyticus of VpTPD (Vp-JS20200428004-2) was isolated from moribund P.
vannamei suffering from translucent post-larvae disease and stored in 15% (vol/vol)
glycerol tubes at −80°C in the authors’ laboratory (4). The strain was inoculated into
tryptic soy broth tubes (Land Bridge Technology, Beijing, China), supplemented with 2%
NaCl, and incubated for 12 h at 28°C, 200 rpm (shaking). E. coli strains were obtained from
the American Type Culture Collection (ATCC) and grown in Luria-Bertani broth medium
at 37°C. Ampicillin, kanamycin, and chloramphenicol concentrations were supplemented
at 100, 50, and 34 µg/mL, respectively. The bacterial strains in this study were listed
in Table 1. The two Escherichia coli strains DH5α λpir and S17–1 λpir were provided by
professor Qiyao Wang from East China University of Science and Technology.

Inactivation of VpTPD
Following the abovementioned steps, both of the lysate protein extracts by ultrasonic
disruption of VpTPD + U and the upper filtrate of lysate protein extract by ultrasonic

TABLE 1 The bacterial strains used in this study

Strains Temperature Source or reference

V. parahaemolyticus strains
VpTPD (Vp-JS20200428004-2) 28°C Zou et al. (4)
Δvhvp-2 28°C This study
Δvhvp-2/pwtCas9-vhvp-2 28°C This study
Δvhvp-2/pBT3-vhvp-2 28°C This study
Escherichia coli strains
DH5α λpir 37°C Ma et al. (48)
S17–1 λpir 37°C Ma et al. (48)

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 12

Research Article Microbiology Spectrum

disruption of VpTPD + U (MW >100 kDa) were prepared. After being filtered through
a 0.22 µm pore size syringe filter, the liquid of lysate protein extract by ultrasonic
disruption of VpTPD + U was treated by heating at 65°C for 45 min and designed as the
group of VpTPD + U and H. The upper filtrate portion of VpTPD + U (>100 kDa) with the
same heat treatment was used as the group of VpTPD + U and H (>100 kDa). To determine
the inactivation effect of different inactivation methods on VpTPD, the viable bacteria
in pure cultured VpTPD (VpTPD), the inactivated VpTPD treated by ultrasonic disruption
treatment (VpTPD + U), and the inactivated VpTPD treated by ultrasonic disruption and
pasteurization (VpTPD + U and H) were investigated by using plate-spreading technique.

Preparation of VpTPD protein fragments with different molecular weights

The pure culture of VpTPD was centrifuged at 6,000 rpm for 10 min, the pellet was
washed twice with 1× PBS and then resuspended in 1× PBS. The concentration of
VpTPD was adjusted to 1.0 of OD600 (approximately equivalent to 109 CFU/mL) using a
microplate reader, and the accurate concentration of VpTPD was then confirmed by plate
colony counting method. The VpTPD preparation was used as live VpTPD for experimental
challenge with immersion method. To obtain different molecular weight proteins of
VpTPD, the VpTPD suspension was disrupted using an ultrasonic homogenizer (Xinzhi,
Ningbo, China), and the VpTPD ultrasonic disruption liquid was then filtered through a
0.22-µm filter to eliminate residuals of VpTPD. The filtrate was then transferred to an
ultrafiltration tube with a cut-off molecular weight of 100 kDa and centrifuged at 5,000
× g for 20 min. After centrifugation, the liquid in the upper portion above the filter
in the ultrafiltration tube was resuspended and washed, then pooled together as the
larger bacterial proteins (VpTPD + U, MW >100 kDa). The filtrated part of the liquid at
the bottom of the ultrafiltration tube was transferred to a new ultrafiltration tube with a
cut-off molecular weight of 50 kDa and centrifuged at 7,500 × g for 20 min. Similarly, the
top portion of liquid was resuspended and collected as the group of VpTPD + U (MW: 50–
100 kDa). Following the same abovementioned protocols, the groups of VpTPD + U (MW:
30–50 kDa), VpTPD + U (MW:10–30 kDa), and VpTPD + U (MW <10 kDa) were prepared
by using proper size ultrafiltration tubes, respectively. The procedure and protocol for
preparing the different molecular weight proteins of VpTPD for experimental challenge
are shown in Fig. 1a.

SDS-PAGE analysis of the lysate protein extract of ultrasonic disrupted VpTPD

The lysate protein extracts VpTPD were analyzed by sodium dodecyl sulfate-polyacryla­
mide gel electrophoresis using the SurePAGE precast gel (GenScript, Nanjing, China),
according to the manufacturer’s instructions. Then the gel was visualized after being
stained with Coomassie brilliant blue R-250.

Identification of virulence factor using mass spectrometer

To identify the suspected virulent factor(s) causing TPD, the target bands with a
molecular weight greater than 100 kDa were excised from the gel using a sterile scalpel
and then subjected to enzymatic hydrolysis of the protein, according to the previous
methods (49–51). The digested samples were analyzed through mass spectrometer by
using Easy-nLC 1200 (Thermo Scientific, P/N LC140) and Orbitrap Exploris 480 (Thermo
Scientific, P/N BRE725533). Following extraction of the mass spectra data with Proteome
Discover software, the database was searched using the Sequest search engine. The
search parameters were as follows: the database was the Vibrio protein library; trypsin
digestion, the maximum missed cut was 2; the mass error of the primary precursor ion
was 10 ppm; the mass error of the secondary fragment ion was 0.02 Da; methionine
(M) oxidation and asparagine (N) deamination were set as variable modifications as
described in the previous research (52).

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 13

Research Article Microbiology Spectrum

Genomic DNA preparation and whole-genome sequencing

To clarify the virulence genes encoding the unique virulence protein of VpTPD, the
complete genome sequencing and comparative genome analysis of VpTPD and a
non-virulent V. parahaemolyticus isolate (ATCC 33847, designed as Vp1616) were carried
out. The genomic DNAs of VpTPD and Vp1616 were extracted using TIANamp Bacteria
DNA Kit (Tiangen Biotech Co., Ltd, Beijing, China) and sequenced using Biomarker
Technologies Corporation (Beijing, China) Nanopore Sequencing Technology Platform.
The genome sequences of VpTPD (GenBank: SRR23329176) and Vp1616 (GenBank:
CP127846 and CP127847) have been deposited to NCBI.

Genome composition prediction, comments, and comparative genome

analysis
Genome composition prediction was mainly divided into three sections including coding
regions, non-coding RNA, and repetitive sequences. Repetitive sequences were predicted
based on the principle of de novo sequencing using Tandem Repeats Finder (TRF)
(53). Coding regions in the genome were identified using Glimmer (54), then related
genes were predicted. All predicted genes were used as an input for NR, Swiss-Prot, GO,
Cluster of Orthologous Groups (COG), EuKaryotic Orthologous Groups (KOG), and Kyoto
Encyclopedia of Genes and Genomes (KEGG) databases (55, 56). The deduced proteins
from the VpTPD strain genome were aligned to that of the Vp1616 strain genome using
Blastp software (v2.5.0).

Plasmid construction, gene deletion, and complementation

The plasmid pDM4 was provided by professor Qiyao Wang from East China
University of Science and Technology. The plasmids pBT3 and pwtCas9 were
provided by professor Li Sun from Institute of Oceanology of the Chinese Acad­
emy of Sciences. The plasmids, as well as the primers used in detecing and
gene deletion, were listed in Tables 2 and 3, respectively. The primers used for
the complementation experiment are 5139-C-F (5'-AGAAAAGAATTCAAAAGATCTAAA­
GAGGAGAAAGGATCTATGCAAAATATAAATAATCTG-3') and 5139-C-R (5'-GCCTGGAGATCCT­
TACTCGAGTCATGCGGTATCGTTTTCATCTTCATTGA-3'), respectively. The primers used
for the gene overexpression experiment are 5139-OE-F (5'-GGAGATATACATATGGATAT­
CATGCAAAATATAAATAATCTGAAAC-3') and 5139-OE-R (5'-GTGGTGGTGCTCGAGGATATCT­
CATGCGGTATCGTTTTC-3'), respectively.
For deletion of the virulence gene (vhvp) of VpTPD, pDM4 was used for in-frame
deletion as previously described (59). In brief, fragments upstream and downstream
of the CDS of the vhvp-2 gene were amplified and overlapped by PCR and then
inserted into pDM4 at the indicated endonuclease sites (Table 3). The deletion mutant,
Δvhvp-2, was generated by two-step homologous recombination and verified by PCR
and sequencing.
For the construction of the vhvp-2 gene complement strain, pBT3 was used as
previously reported (60). Briefly, the vhvp-2 gene was cloned with primers 5139 C-F/
5139 C-R and then inserted into pBT3 at the EcoRV site. The resulting plasmid pBT3-
vhvp-2 was then electroporated into Δvhvp-2 to yield the complement strain Δvhvp-2/

TABLE 2 The plasmids used in this study

Plasmid Source or reference Antibiotic used in this study

pDM4 Ma et al. (48) 34 µg/mL chloramphenicol
pBT3 Zhang et al. (57) 100 µg/mL ampicillin
pwtCas9 Liu et al. (58) 100 µg/mL ampicillin
pDM4vhvp-2 This study 34 µg/mL chloramphenicol
pBT3vhvp-2 This study 100 µg/mL ampicillin
pwtCas9vhvp-2 This study 100 µg/mL ampicillin

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 14

Research Article Microbiology Spectrum

TABLE 3 The PCR primers based on the vhvp gene for detecting VpTPDa

Targeted gene Name of primers Sequence of primers (5′−3′) Source

vhvp-1 VpTPD-vhvp-1-F1 GAGGAGAGTGTTGACCGAAATC This study
VpTPD-vhvp-1-R1 CTGCGCCAGTAGTAACGATAAG
vhvp-2 VpTPD-vhvp-2-F1 GGAGTATTGGTGGGCTGAAA This study
VpTPD-vhvp-2-R1 GGTAGGCATGGACCGTAAAG
vhvp-2 VpTPD- vhvp-2-F2 CTAAGCCTTGGCTCCTGAAA This study
VpTPD-vhvp-2-R2 CGGTCAGAATATCGGTATCGTAAA
vhvp-2 Δ5139upF TTAGTCGACGGAGTATTGGTGGGCTGAAA (SalI) This study
Δ5139upR TCCATACTCATGGTAGGCATGGACCGTAAAG
Δ5139doF CCATGCCTACCATGAGTATGGACTGCCGTTAAG
Δ5139doR GGAAGATCTGTCAGCAAAGTATCTCGGTAAGA (BglII)
a
Underlined nucleotides are restriction sites of the enzymes indicated in the brackets at the ends.

pBT3-vhvp-2. Positive colonies were selected based on the ampicillin resistance, PCR, and
sequencing analyses.
For gene overexpression, the PCR product of vhvp-2 gene was inserted into pwtCas9
bacterial between the BglII and XhoI sites to allow inducible expression of the gene
under a tetracycline promoter. The resulting plasmid was introduced into the indicated
Δvhvp-2 strain by electroporation. Where appropriate, the expression was induced by
the addition of 2 µL of anhydrotetracycline.

Experimental challenge by immersion

The healthy post-larvae of P. vannamei were randomly divided into seven groups
(negative control, PBS), positive control (live VpTPD), VpTPD + U (>100 kDa), VpTPD + U
(50–100 kDa), VpTPD + U (30–50 kDa), VpTPD + U (10–30 kDa), VpTPD + U (<10 kDa), 15
shrimp individuals per group with three replicates for each group. The average body
length of the shrimp was 5.5 mm ± 0.2 mm (n = 10). The immersion challenge test
was performed as previously described by Tran et al. (61) with minor modifications. To
determine the pathogenicity of the virulent protein fractions of VpTPD with different
molecular weights to post-larvae of P. vannamei, mortalities were monitored every 8 h for
40 h. The moribund shrimps were also collected for histopathological analysis.
V. parahemolyticus Δvhvp-2 was cultured as above described and harvested at OD600
1.0. For Δvhvp-2 motility analysis, P. vannamei (P5-P7) were randomly divided into three
groups (10 shrimps/group). Shrimps from group 1 (NC) were immersed in seawater.
The shrimps in the groups 2 and 3 were similarly immersed with 900 µL of VpTPD and
Δvhvp-2, respectively, in 900 mL seawater, and the mortalities of shrimp were recorded
for 32 h.
V. parahemolyticus VpTPD, Δvhvp-2/pBT3-vhvp-2, and Δvhvp-2/pwtCas9-vhvp-2 were
cultured as above described and collected at OD600 0.5. To examine the mortality-induc­
ing capacity of the V. parahemolyticus strains, shrimps from four groups (10 shrimps/
group) were immersed with VpTPD, Δvhvp-2/pBT3-vhvp-2, and Δvhvp-2/pwtCas9-vhvp-2,
and their mortalities were recorded as described above for 32 h.

Histopathology
The moribund post-larval shrimps were fixed in 4% paraformaldehyde (PFA)–phosphate-
buffered saline (PBS) (PFA-PBS) fixative solution for 24 h and then dehydrated through a
gradient of ethanol solutions (4). The treated shrimps were then immediately embedded
in paraffin. Paraffin sections (3 µm) of each sample were prepared and stained with
hematoxylin-eosin (H&E), according to the routine histological procedures described
by Lightner (62). The histopathological changes of each sample were visualized and
recorded using the Pannoramic MIDI section scanning system (3DHISTECH Ltd, Budapest,
Hungary).

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 15

Research Article Microbiology Spectrum

PCR detection of VpTPD

Based on the sequences of VpTPD, three pairs of PCR primers (VpTPD-vhvp-1-F1/R1,
VpTPD-vhvp-2-F1/R1, and VpTPD-vhvp-2-F2/R2, Table 3) were designed to detect the
virulence gene of vhvp in the strain of VpTPD. Total genomic DNA extracted from VpTPD
was used as a template for the PCR assay. The reaction mixture contained 1 µL genomic
DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 4 mM MgCl2, 1.5 mM dNTP, 0.4 µM primers
(VpTPD-vhvp-1-F1/R1, VpTPD-vhvp-2-F1/R1, or VpTPD-vhvp-2-F2/R2), 2.5 U TaKaRa EX Taq
DNA polymerase (TaKaRa, Dalian, China). The PCR was performed at 94°C for 4 min,
followed by 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 40 s, ending with
72°C for 7 min. The PCR products were then analyzed in a 1.5% agarose gel containing
GeneFinder (Bio-V, Xiamen, China). The expected PCR amplicons of the three sets of
primers (VpTPD-vhvp-1-F/R, VpTPD-vhvp-2-F1/R1, and VpTPD-vhvp-2-F2/R2) were 362 bp,
351 bp, and 303 bp in length, respectively.

Epidemiological analysis of VpTPD

Shrimp samples were collected from the shrimp farms in Hebei, Shandong, Jiangsu,
Hainan, Xinjiang, Hunan, Hubei, and Guangdong provinces of China from April 2020 to
2021. The samples collected from each pond were divided into three parts: the first part
was preserved in 95% ethanol for nucleic acid preparation, the second part was used for
histopathological assay, and the third part was used for bacterial isolation. The dominant
bacterial strains were isolated from the samples, according to the method described
previously (4). Shrimp samples were disinfected with 75% alcohol, washed three times
with 1× PBS buffer (pH 7.2; Solarbio, Shanghai, China), and then homogenized in 1× PBS
buffer. Bacteria in the homogenized liquid were inoculated onto Marine 2216 agar plates
for further growth at 28°C. The dominant bacterial strains were further proliferated in
Marine 2216 broth and then used for genomic DNA preparation. The PCR method was
applied for diagnosis of the presence of VpTPD in the DNA samples acquired directly from
the shrimp tissues or from the bacterial cultures from the shrimp samples.

Statistical analysis
All experiments were performed in triplicate. Statistical analyses were performed using
GraphPad Prism 6 (GraphPad Software, USA). Data were analyzed using Student’s t-test or
one-way ANOVA. Statistical significance was defined as P < 0.05.

ACKNOWLEDGMENTS

The authors would like to thank Professor Li Sun from Institute of Oceanology of the
Chinese Academy of Sciences for her generous help in the experiment of complement
mutant of VpTPD, thank Professor Qiyao Wang from East China University of Science and
Technology for his generous help in the experiment of isogenic mutant of VpTPD, and
thank Dr. Xiao Fan and Dr. Yongwei Yan for their generous help in the genomic sequence
search and analysis.
This work was supported by the Central Public-interest Scientific Institution Basal
Research Fund, CAFS (no. 2020TD39; 2021XT0602), earmarked fund for CARS-48,
Project of Species Conservation from the Ministry of Agriculture and Rural Affairs-
Marine fisheries resources collection and preservation, Central Public-interest Scientific
Institution Basal Research Fund, YSFRI, CAFS (no. 20603022021022 & 20603022023009),
and Qingdao Postdoctoral Researcher Applied Research Project.
Q.Z. designed the study. S.L., W.W., T.-T.X., T.J., W.W., and C.W. executed the experi­
ment. K.L. and J.K. supplied the SPF shrimp post-larvae. S.L. and L.X. screened the
location of related genes in the genome. G.X. helps to isolate the original VpTPD strain.
S.L. wrote the manuscript. Q.Z. and J.L. revised the manuscript. All authors interpre­
ted the data, critically revised the manuscript for important intellectual contents, and
approved the final version.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 16

Research Article Microbiology Spectrum

AUTHOR AFFILIATIONS
1
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea
Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, Shandong,
China
2
Laboratory for Marine Fisheries Science and Food Production Processes, Laoshan
Laboratory, Qingdao, Shandong, China
3
Key Laboratory of Marine Aquaculture Disease Control, Key Laboratory of Sustainable
Development of Marine Fisheries, Ministry of Agriculture and Rural Affairs, Yellow Sea
Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, Shandong,
China
4
School of Sciences and Medicine, Lake Superior State University, Sault Ste. Marie,
Michigan, USA

AUTHOR ORCIDs

Shuang Liu http://orcid.org/0000-0002-2610-4030

Qingli Zhang http://orcid.org/0000-0002-0406-8825

FUNDING

Funder Grant(s) Author(s)

MOA | CAFS | Central Public-interest Scientific 2020TD39 Qingli Zhang
Institution Basal Research Fund, Chinese Academy
of Fishery Sciences (Central Public-interest Scientific
Institution Basal Research Fund, CAFS)
MOA | CAFS | Central Public-interest Scientific 2021XT0602 Qingli Zhang
Institution Basal Research Fund, Chinese Academy
of Fishery Sciences (Central Public-interest Scientific
Institution Basal Research Fund, CAFS)
China Agricultural Research System (CARS) CARS-48 Qingli Zhang
MOA | CAFS | Central Public-interest Scientific 20603022021022 Qingli Zhang
Institution Basal Research Fund, Chinese Academy
of Fishery Sciences (Central Public-interest Scientific
Institution Basal Research Fund, CAFS)

AUTHOR CONTRIBUTIONS

Shuang Liu, Data curation, Formal analysis, Investigation, Methodology, Validation,

Visualization, Writing – original draft | Wei Wang, Formal analysis, Investigation,
Methodology, Validation | Tianchang Jia, Investigation, Resources, Validation | Lusheng
Xin, Investigation, Methodology | Ting-ting Xu, Data curation, Investigation, Methodol­
ogy | Chong Wang, Investigation, Methodology, Validation | Guosi Xie, Methodology,
Resources | Kun Luo, Methodology, Resources | Jun Li, Methodology, Writing – review
and editing | Jie Kong, Resources, Supervision | Qingli Zhang, Conceptualization, Data
curation, Formal analysis, Funding acquisition, Investigation, Project administration,
Resources, Supervision, Validation, Writing – review and editing

DATA AVAILABILITY

All the high-throughput sequencing has been deposited in GenBank, and the accession
numbers have been listed in the context of the paper. The genome sequences of VpTPD
(GenBank: SRR23329176) and Vp1616 (GenBank: CP127846 and CP127847) obtained in
the present study have been deposited at NCBI.

ADDITIONAL FILES

The following material is available online.

November/December 2023 Volume 11 Issue 6 10.1128/spectrum.00492-23 17

Research Article
Open Peer Review
PEER REVIEW HISTORY (review-history.pdf). An accounting of the reviewer comments
and feedback.
REFERENCES
1. L H. 2020. Shrimp hatcheries in China hit by ‘glass post-larvae’: under
currentnews. Available from: https://www.undercurrentnews.com/2020/
04/22/shrimp-hatcheries-in-china-hit-by-glass-post-larvae
2. L H2020. Chinese scientists confirm new virus causes shrimp ‘glass post-
larvae’’. Available from: https://www.undercurrentnews.com/2020/05/
08/Chinese-scientists-confirm-new-virus-causes-shrimp-glass-post-
larvae
3. Yang F, Xu LM, Huang WZ, Li F. 2022. Highly lethal Vibrio parahaemolyti­
cus strains cause acute mortality in Penaeus vannamei post-larvae.
Aquaculture 548:737605. https://doi.org/10.1016/j.aquaculture.2021.
737605
4. Zou Y, Xie G, Jia T, Xu T, Wang C, Wan X, Li Y, Luo K, Bian X, Wang X, Kong
J, Zhang Q. 2020. Determination of the infectious agent of translucent
post-larva disease (TPD) in Penaeus vannamei Pathogens 9:741. https://
doi.org/10.3390/pathogens9090741
5. Han JE, Tang KFJ, Tran LH, Lightner DV. 2015. Photorhabdus insect-
related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the
causative agent of acute hepatopancreatic necrosis disease (AHPND) of
shrimp. Dis Aquat Organ 113:33–40. https://doi.org/10.3354/dao02830
6. Rao PSS, Tan YP, Zheng J, Leung KY. 2006. Unraveling Edwardsiella tarda
pathogenesis using the proteomics approach. Methods Biochem Anal
49:237–244.
7. Pang H, Li W, Zhang W, Zhou S, Hoare R, Monaghan SJ, Jian J, Lin X.
2020. Acetylome profiling of Vibrio alginolyticus reveals its role in
bacterial virulence. J Proteomics 211:103543. https://doi.org/10.1016/j.
jprot.2019.103543
8. Lee C-T, Chen I-T, Yang Y-T, Ko T-P, Huang Y-T, Huang J-Y, Huang M-F, Lin
S-J, Chen C-Y, Lin S-S, Lightner DV, Wang H-C, Wang AH-J, Wang H-C, Hor
L-I, Lo C-F. 2015. The opportunistic marine pathogen Vibrio parahaemo­
lyticus becomes virulent by acquiring a plasmid that expresses a deadly
toxin. Proc Natl Acad Sci U S A 112:10798–10803. https://doi.org/10.
1073/pnas.1503129112
9. Zhang X, Sun J, Chen F, Qi H, Chen L, Sung YY, Huang Y, Lv A, Hu X. 2021.
Phenotypic and genomic characterization of a Vibrio parahaemolyticus
strain causing disease in Penaeus vannamei provides insights into its
niche adaptation and pathogenic mechanism. Microb Genom 7:000549.
https://doi.org/10.1099/mgen.0.000549
10. Prithvisagar KS, Krishna Kumar B, Kodama T, Rai P, Iida T, Karunasagar I,
Karunasagar I. 2021. Whole genome analysis unveils genetic diversity
and potential virulence determinants in Vibrio parahaemolyticus
associated with disease outbreak among cultured Litopenaeus vannamei
(Pacific white shrimp) in India. Virulence 12:1936–1949. https://doi.org/
10.1080/21505594.2021.1947448
11. Luangtrakul W, Boonchuen P, Jaree P, Kumar R, Wang H-C, Somboonwi­
wat K. 2021. Cytotoxicity of Vibrio parahaemolyticus AHPND toxin on
shrimp hemocytes, a newly identified target tissue, involves binding of
toxin to aminopeptidase N1 receptor. PLoS Pathog 17:e1009463. https://
doi.org/10.1371/journal.ppat.1009463
12. Dong X, Wang H, Zou P, Chen J, Liu Z, Wang X, Huang J. 2017. Complete
genome sequence of Vibrio campbellii strain 20130629003S01 isolated
from shrimp with acute hepatopancreatic necrosis disease. Gut Pathog
9:31. https://doi.org/10.1186/s13099-017-0180-2
13. Wang H-C, Lin S-J, Mohapatra A, Kumar R, Wang H-C. 2020. A review of
the functional annotations of important genes in the AHPND-causing
pVA1 plasmid. Microorganisms 8:996. https://doi.org/10.3390/
microorganisms8070996
14. Dong X, Song J, Chen J, Bi D, Wang W, Ren Y, Wang H, Wang G, Tang KFJ,
Wang X, Huang J. 2019. Conjugative transfer of the pVA1-Type plasmid
carrying the pirAB (vp) genes results in the formation of new AHPND-
causing Vibrio. Front Cell Infect Microbiol 9:195. https://doi.org/10.3389/
fcimb.2019.00195
15. Dong X, Bi D, Wang H, Zou P, Xie G, Wan X, Yang Q, Zhu Y, Chen M, Guo
C, Liu Z, Wang W, Huang J. 2017. pirABvp-Bearing Vibrio
November/December 2023 Volume 11 Issue 6
Microbiology Spectrum
parahaemolyticus and Vibrio campbellii pathogens isolated from the
same AHPND-affected pond possess highly similar pathogenic plasmids.
Front Microbiol 8:1859. https://doi.org/10.3389/fmicb.2017.01859
16. Kondo H, Van PT, Dang LT, Hirono I. 2015. Draft genome sequence of
non-Vibrio parahaemolyticus acute hepatopancreatic necrosis disease
strain KC13.17.5, isolated from diseased shrimp in Vietnam. Genome
Announc 3:e00978-15. https://doi.org/10.1128/genomeA.00978-15
17. Kumar V, Roy S, Behera BK, Bossier P, Das BK. 2021. Acute hepatopancre­
atic necrosis disease (AHPND): virulence, pathogenesis and mitigation
strategies in shrimp aquaculture. Toxins (Basel) 13:524. https://doi.org/
10.3390/toxins13080524
18. Dong X, Chen J, Song J, Wang H, Wang W, Ren Y, Guo C, Wang X, Tang
KFJ, Huang J. 2019. Evidence of the horizontal transfer of pVA1-type
plasmid from AHPND-causing V. campbellii to non-AHPND V. owensii.
Aquaculture 503:396–402. https://doi.org/10.1016/j.aquaculture.2019.
01.016
19. Wang D, Wang L, Bi D, Song J, Wang G, Gao Y, Tang KFJ, Meng F, Xie J,
Zhang F, Huang J, Li J, Dong X. 2022. Conjugative transfer of acute
hepatopancreatic necrosis disease-causing pVA1-Type plasmid is
mediated by a novel self-encoded Type IV secretion system. Microbiol
Spectr 10:e0170222. https://doi.org/10.1128/spectrum.01702-22
20. Guiney DG, Fierer J. 2011. The role of the spv genes in salmonella
pathogenesis. Front Microbiol 2:129. https://doi.org/10.3389/fmicb.
2011.00129
21. Buckner MMC, Croxen MA, Arena ET, Finlay BB. 2011. A comprehensive
study of the contribution of Salmonella enterica serovar Typhimurium
SPI2 effectors to bacterial colonization, survival and replication in
typhoid fever, macrophage and epithelial cell infection models.
Virulence 2:208–216. https://doi.org/10.4161/viru.2.3.15894
22. Chu Y, Gao S, Wang T, Yan J, Xu G, Li Y, Niu H, Huang R, Wu S. 2016. A
novel contribution of SpvB to pathogenesis of Salmonella Typhimurium
by inhibiting autophagy in host cells. Oncotarget 7:8295–8309. https://
doi.org/10.18632/oncotarget.6989
23. Sun L, Yang S, Deng Q, Dong K, Li Y, Wu S, Huang R. 2020. Salmonella
effector SpvB disrupts intestinal epithelial barrier integrity for bacterial
translocation. Front Cell Infect Microbiol 10:606541. https://doi.org/10.
3389/fcimb.2020.606541
24. Hochmann H, Pust S, von Figura G, Aktories K, Barth H. 2006. Salmonella
enterica SpvB ADP-ribosylates actin at position arginine-177-characteri­
zation of the catalytic domain within the SpvB protein and a comparison
to binary clostridial actin-ADP-ribosylating toxins. Biochemistry
45:1271–1277. https://doi.org/10.1021/bi051810w
25. Lesnick ML, Reiner NE, Fierer J, Guiney DG. 2001. The Salmonella SpvB
virulence gene encodes an enzyme that ADP‐ribosylates actin and
destabilizes the cytoskeleton of eukaryotic cells. Mol Microbiol 39:1464–
1470. https://doi.org/10.1046/j.1365-2958.2001.02360.x
26. Lesnick ML, Guiney DG. 2001. The best defense is a good offense--
salmonella deploys an ADP-ribosylating toxin. Trends Microbiol 9:2–4.
https://doi.org/10.1016/s0966-842x(00)01902-8
27. Harterink M, da Silva ME, Will L, Turan J, Ibrahim A, Lang AE, van Battum
EY, Pasterkamp RJ, Kapitein LC, Kudryashov D, Barres BA, Hoogenraad
CC, Zuchero JB. 2017. DeActs: genetically encoded tools for perturbing
the actin cytoskeleton in single cells. Nat Methods 14:479–482. https://
doi.org/10.1038/nmeth.4257
28. Yang S, Deng Q, Sun L, Dong K, Li Y, Wu S, Huang R. 2019. Salmonella
effector SpvB interferes with intracellular iron homeostasis via
regulation of transcription factor NRF2. FASEB J 33:13450–13464. https://
doi.org/10.1096/fj.201900883RR
29. Ai K, Gotoh H, Eguchi M, Okada N, Matsuura S, Matsui H, Danbara H,
Kikuchi Y. 2003. Intracellular expression of the Salmonella plasmid
virulence protein, SpvB, causes apoptotic cell death in eukaryotic cells.
Microb Pathog 35:43–48. https://doi.org/10.1016/s0882--
4010(03)00066-4
10.1128/spectrum.00492-23 18
Research Article
30. Chandrasekaran R, Lacy DB. 2017. The role of toxins in Clostridium
difficile infection. FEMS Microbiol Rev 41:723–750. https://doi.org/10.
1093/femsre/fux048
31. Lyerly DM, Lockwood DE, Richardson SH, Wilkins TD. 1982. Biological
activities of toxins A and B of Clostridium difficile. Infect Immun 35:1147–
1150. https://doi.org/10.1128/iai.35.3.1147-1150.1982
32. Steinemann M, Schlosser A, Jank T, Aktories K. 2018. The chaperonin
TRiC/CCT is essential for the action of bacterial glycosylating protein
toxins like Clostridium difficile toxins A and B. Proc Natl Acad Sci U S A
115:9580–9585. https://doi.org/10.1073/pnas.1807658115
33. Mitchell TJ, Ketley JM, Haslam SC, Stephen J, Burdon DW, Candy DC,
Daniel R. 1986. Effect of toxin A and B of Clostridium difficile on rabbit
ileum and colon. Gut 27:78–85. https://doi.org/10.1136/gut.27.1.78
34. Lyerly DM, Saum KE, MacDonald DK, Wilkins TD. 1985. Effects of
Clostridium difficile toxins given intragastrically to animals. Infect Immun
47:349–352. https://doi.org/10.1128/iai.47.2.349-352.1985
35. Riegler M, Sedivy R, Pothoulakis C, Hamilton G, Zacherl J, Bischof G,
Cosentini E, Feil W, Schiessel R, LaMont JT. 1995. Clostridium difficile toxin
B is more potent than toxin A in damaging human colonic epithelium in
vitro. J Clin Invest 95:2004–2011. https://doi.org/10.1172/JCI117885
36. Savidge TC, Pan W-H, Newman P, O’brien M, Anton PM, Pothoulakis C.
2003. Clostridium difficile toxin B is an inflammatory enterotoxin in
human intestine. Gastroenterology 125:413–420. https://doi.org/10.
1016/s0016-5085(03)00902-8
37. LaFrance ME, Farrow MA, Chandrasekaran R, Sheng J, Rubin DH, Lacy DB.
2015. Identification of an epithelial cell receptor responsible for
Clostridium difficile TcdB-induced cytotoxicity. Proc Natl Acad Sci U S A
112:7073–7078. https://doi.org/10.1073/pnas.1500791112
38. Tao L, Zhang J, Meraner P, Tovaglieri A, Wu X, Gerhard R, Zhang X,
Stallcup WB, Miao J, He X, Hurdle JG, Breault DT, Brass AL, Dong M. 2016.
Frizzled proteins are colonic epithelial receptors for C. difficile toxin B.
Nature 538:350–355. https://doi.org/10.1038/nature19799
39. Gupta P, Zhang Z, Sugiman-Marangos SN, Tam J, Raman S, Julien JP,
Kroh HK, Lacy DB, Murgolo N, Bekkari K, Therien AG, Hernandez LD,
Melnyk R 2. 2017. Functional defects in Clostridium difficile TcdB toxin
uptake identify CSPG4 receptor-binding determinants. J Biol Chem
292:17290–17301. https://doi.org/10.1074/jbc.M117.806687
40. Giannella, R.A. 1996. Chapter 21 Salmonella. In Baron, S., Ed., Medical
Microbiology, 4th Edition, University of Texas Medical Branch at
Galveston, USA.
41. Vågene ÅJ, Herbig A, Campana MG, Robles García NM, Warinner C, Sabin
S, Spyrou MA, Andrades Valtueña A, Huson D, Tuross N, Bos KI, Krause J.
2018. Salmonella enterica genomes from victims of a major sixteenth-
century epidemic in Mexico. Nat Ecol Evol 2:520–528. https://doi.org/10.
1038/s41559-017-0446-6
42. Galán JE. 2021. Salmonella Typhimurium and inflammation: a pathogen-
centric affair. Nat Rev Microbiol 19:716–725. https://doi.org/10.1038/
s41579-021-00561-4
43. Hamilton KA, Chen A, de-Graft Johnson E, Gitter A, Kozak S, Niquice C,
Zimmer-Faust AG, Weir MH, Mitchell J, Gurian P. 2018. Salmonella risks
due to consumption of aquaculture-produced shrimp. Microb Risk Anal
9:22–32. https://doi.org/10.1016/j.mran.2018.04.001
44. Beshiru A, Igbinosa IH, Igbinosa EO. 2019. Prevalence of antimicrobial
resistance and virulence gene elements of Salmonella serovars from
ready-to-eat (RTE) shrimps. Front Microbiol 10:1613. https://doi.org/10.
3389/fmicb.2019.01613
45. Akiyama T, Khan AA, Cheng CM, Stefanova R. 2011. Molecular
characterization of Salmonella enterica serovar Saintpaul isolated from
imported seafood, pepper, environmental and clinical samples. Food
Microbiol 28:1124–1128. https://doi.org/10.1016/j.fm.2011.03.003
46. Beshiru A, Okareh OT, Okoh AI, Igbinosa EO. 2020. Detection of
antibiotic resistance and virulence genes of Vibrio strains isolated from
ready-to-eat shrimps in Delta and Edo States, Nigeria. J Appl Microbiol
129:17–36. https://doi.org/10.1111/jam.14590
November/December 2023 Volume 11 Issue 6
Microbiology Spectrum
47. Hounmanou YMG, Dalsgaard A, Sopacua TF, Uddin GMN, Leekitcharoen­
phon P, Hendriksen RS, Olsen JE, Larsen MH. 2020. Molecular character­
istics and zoonotic potential of Salmonella Weltevreden from cultured
shrimp and tilapia in Vietnam and China. Front Microbiol 11:1985. https:/
/doi.org/10.3389/fmicb.2020.01985
48. Ma R, Liu Y, Gan J, Qiao H, Ma J, Zhang Y, Bu Y, Shao S, Zhang Y, Wang Q.
2022. Xenogeneic nucleoid-associated EnrR thwarts H-NS silencing of
bacterial virulence with unique DNA binding. Nucleic Acids Res 50:3777–
3798. https://doi.org/10.1093/nar/gkac180
49. Shevchenko A, Jensen ON, Podtelejnikov AV, Sagliocco F, Wilm M, Vorm
O, Mortensen P, Shevchenko A, Boucherie H, Mann M. 1996. Linking
genome and proteome by mass spectrometry: large-scale identification
of yeast proteins from two dimensional gels. Proc Natl Acad Sci U S A
93:14440–14445. https://doi.org/10.1073/pnas.93.25.14440
50. Calderaro A, Arcangeletti M-C, Rodighiero I, Buttrini M, Gorrini C, Motta
F, Germini D, Medici M-C, Chezzi C, De Conto F. 2014. Matrix-assisted
laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrome­
try applied to virus identification. Sci Rep 4:6803. https://doi.org/10.
1038/srep06803
51. Xiu L, Zhang C, Wu Z, Peng J. 2017. Establishment and application of a
universal coronavirus screening method using MALDI-TOF mass
spectrometry. Front Microbiol 8:1510. https://doi.org/10.3389/fmicb.
2017.01510
52. Zhao L, Zhang Z, Wang M, Sun J, Li H, Malakar PK, Liu H, Pan Y, Zhao Y.
2018. New insights into the changes of proteome and microbiome of
shrimp (Litopenaeus vannamei) stored in acidic electrolyzed water ice. J
Agric Food Chem 66:4966–4976. https://doi.org/10.1021/acs.jafc.
8b00498
53. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman
DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25:3389–3402. https://doi.
org/10.1093/nar/25.17.3389
54. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifying bacterial
genes and endosymbiont DNA with Glimmer. Bioinformatics 23:673–
679. https://doi.org/10.1093/bioinformatics/btm009
55. Li R, Li Y, Zheng H, Luo R, Zhu H, Li Q, Qian W, Ren Y, Tian G, Li J, Zhou G,
Zhu X, Wu H, Qin J, Jin X, Li D, Cao H, Hu X, Blanche H, Cann H, Zhang X,
Li S, Bolund L, Kristiansen K, Yang H, Wang J, Wang J. 2010. Building the
sequence map of the human pan-genome. Nat Biotechnol 28:57–63.
https://doi.org/10.1038/nbt.1596
56. Blin K, Shaw S, Steinke K, Villebro R, Ziemert N, Lee SY, Medema MH,
Weber T. 2019. antiSMASH 5.0: updates to the secondary metabolite
genome mining pipeline. Nucleic Acids Res 47:W81–W87. https://doi.
org/10.1093/nar/gkz310
57. Zhang W, Sun K, Cheng S, Sun L. 2008. Characterization of DegQVh, a
serine protease and a protective immunogen from a pathogenic Vibrio
harveyi strain. Appl Environ Microbiol 74:6254–6262. https://doi.org/10.
1128/AEM.00109-08
58. Liu X, Wang X, Sun B, Sun L. 2022. The involvement of thiamine uptake in
the virulence of Edwardsiella piscicida. Pathogens 11:464. https://doi.org/
10.3390/pathogens11040464
59. Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. 1996. Flagellin A is
essential for the virulence of Vibrio anguillarum. J Bacteriol 178:1310–
1319. https://doi.org/10.1128/jb.178.5.1310-1319.1996
60. Li MF, Du YT, Jin CD, Li XP, Sun YY. 2012. Edwardsiella piscicida Ail1: an
outer membrane protein required for host infection. Fish Shellfish
Immunol 32:586–592. https://doi.org/10.1016/j.fsi.2012.01.016
61. Tran L, Nunan L, Redman RM, Mohney LL, Pantoja CR, Fitzsimmons K,
Lightner DV. 2013. Determination of the infectious nature of the agent
of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp.
Dis Aquat Organ 105:45–55. https://doi.org/10.3354/dao02621
62. Lighter DV. 1996. A handbook of shrimp pathology and diagnostic
procedures for diseases of cultured penaeid shrimp. World Aquaculture
Society.
10.1128/spectrum.00492-23 19