Rapid and visible detection of Mycoplasma synoviae using a novel

polymerase spiral reaction assay

Qianqian Wu,∗,1 Xin Xu,∗,1 Qinxi Chen,∗ Kejing Zuo,† Yiting Zhou,∗ Zhibin Zhang,∗ Yunchao Kan,∗
Lunguang Yao,∗ Jun Ji ,∗,2 Yingzuo Bi,‡ and Qingmei Xie‡
∗
Henan Provincial Engineering Laboratory of Insects Bio-reactor, China-UK-NYNU-RRes Joint Laboratory of
Insect Biology, Nanyang Normal University, Nanyang 473061, PR China; † Veterinary Laboratory, Guangzhou
Zoo, Guangzhou 510642, PR China; and ‡ College of Animal Science, South China Agricultural University,
Guangzhou 510642, PR China

ABSTRACT In this study, a rapid, specific, and sen-
sitive detection assay for Mycoplasma synoviae (MS)
was established using a polymerase spiral reaction
(PSR) method. A pair of primers were designed ac-
cording to the conserved region of the vlhA gene of MS,
and PSR results were assessed using agarose gel elec-
trophoresis and color rendering with a dye indicator.
The optimum reaction temperature and time for PSR
using the specific primers were 62◦ C and 40 min in a
water bath, respectively. The sensitivity of the PSR as-
Key words: molecular detection, Mycoplasma synoviae, polymerase spiral reaction
say for MS detection was 100 times more than that of
the polymerase chain reaction assay based on agarose
gel electrophoresis results and color change detected
by the naked eye. Further experiments demonstrated
that the primers specifically detected MS and showed
no cross-reaction with other prevalent avian pathogens.
Clinical sample testing confirmed that the MS–PSR as-
say is simple, rapid, specific, and sensitive, and thereby
very suitable for application and promotion in the field
and laboratories of grassroots units.
2019 Poultry Science 98:5355–5360
http://dx.doi.org/10.3382/ps/pez356

INTRODUCTION preventing and controlling the spread of this disease.

Mycoplasma synoviae (MS), which is widely dis-
tributed throughout the world, has imposed huge eco-
nomic losses to the poultry industry (Mohammed et al.,
1987). Chicken and turkey are natural hosts of MS
(Kleven, 2008). Typically, acute or chronic infectious
synovitis, air sacculitis synovitis, and eggshell apex ab-
normality develop following MS infection which result
in reduced egg production (Zhu et al., 2017; Kursa
et al., 2019). In addition, MS infection can produce
subclinical symptoms and lead to co-infection with My-
coplasma gallisepticum (MG), Newcastle disease virus
(NDV), infectious bronchitis virus (IBV), and other
avian pathogens (Sun et al., 2017; Ball et al., 2018;
Derksen et al., 2018). Currently, control treatments for
MS include the use of vaccines and antibiotics, and
doxycycline, oxytetracycline, tylvalosin, tylosin, and
pleuromutilins are sensitive antimicrobial agents for
MS; however long-term drug use can lead to drug re-
sistance (Kreizinger et al., 2017). Therefore, rapid and
accurate MS diagnosis is one of the key factors for
C 2019 Poultry Science Association Inc.
Received February 6, 2019.
Accepted June 1, 2019.
1
Both authors contributed equally to this work.
2
Corresponding author: jijun020@126.com
Diagnostic methods include isolation culture, serologi-
cal diagnosis, and molecular detection (Ramirez et al.,
2006; Haesendonck et al., 2014; Xue et al., 2017). My-
coplasma isolation and serological diagnosis are rela-
tively less sensitive and time-consuming, requiring key
reagents, skilled labor, and well-equipped laboratories
(Kleven et al., 2001). Molecular analysis, such as that
using conventional or real-time PCR, is more sensitive.
Real-time PCR detection is a particularly rapid and
sensitive method (Mekkes and Feberwee, 2005; Muham-
mad et al., 2018); however, these methods require so-
phisticated thermal cyclers that might be expensive for
most basic laboratories and highly skilled technicians,
both of which render them unsuitable for widespread
use in the field. To counteract these disadvantages,
isothermal molecular methods for MS detection have
been developed, including methods based on loop-
mediated isothermal amplification (LAMP) and in-
sulated isothermal polymerase chain reaction (iiPCR)
(Kaewphinit et al., 2013; Kuo et al., 2017; Kursa et al.,
2015). LAMP requires 6 complementary primers for
MS detection and is performed in a water bath (Kaew-
phinit et al., 2013). However, the use of multiple primers
greatly increases the design difficulty and development
cost (Notomi et al., 2000; Kaewphinit et al., 2013). The
iiPCR assay for MS detection can be accomplished in
1 h, but it requires a specific device to partly restrict the

5355
5356
Table 1. Primer sets for PSR and PCR.
Primer name
S1 acgaattcgtacatagaagtatag-GTGATCAAACTCCR1 GCACCTGC
S2 gatatgaagatacatgcttaagca-ACCTGGGTTTTCTGGGTTTCCT
P1 GTGATCAAACTCCR1 GCACCTGC
P2 ACCTGGGTTTTCTGGGTTTCCT
(Lower-case letters stands for the stuffing sequences; 1 the italic stands for the de-
generate oligonucleotide, R = A+G).
detection throughput and a fluorescent probe, which
raise the detection cost (Kuo et al., 2017). In this
study, we detected MS using polymerase spiral reac-
tion (PSR), a novel nucleic acid isothermal amplifica-
tion method invented by Liu Wei (Liu et al., 2015).
PSR has the advantages of both PCR and LAMP,
but it requires only 1 pair of routine primers to ef-
ficiently amplify nucleic acids using a water bath,
which reduces detection cost and increases practical
application.
MATERIALS AND METHODS
Viruses and Clinical Samples
Samples were acquired from respiratory laryngeal
swabs or synovial fluid of chickens suspected to have
MS infection or from the trachea or synovial bursa of
chickens suspected to have died from MS infection. Res-
piratory swabs or tissues were collected under ster-
ile conditions and stored at −80◦ C until further use.
MG, MS-H (commercial live attenuated vaccine strain),
NDV, infectious laryngotracheitis virus (ILTV), H9
subtype avian influenza virus (H9 AIV), and IBV,
as described above, were stored in the Henan Provin-
cial Engineering Laboratory of Insects Bio-reactor,
Nanyang Normal University.
DNA and RNA Extraction
The respiratory laryngeal swabs and synovial fluid
swabs were washed with PBS. The obtained trachea
or synovial bursa was ground using an appropriate
amount of liquid nitrogen and suspended in PBS. Ge-
nomic DNA was extracted from each clinical sam-
ple (ChargeSwitch gDNA Mini Tissue Kit; Invitrogen
Biotech, Waltham, MA) according to the manufac-
turer’s instructions and stored at −20◦ C. Total RNA
from positive samples loaded with control viruses (IB,
ND, and H9 AIV) was extracted (RNAiso reagent;
TaKaRa Biotechnology, Dalian, China) according to
the manufacturers’ instructions. RNA was reverse tran-
scribed into cDNA and stored at −20◦ C.
Primer Design
Primer design was based on a previous description
(Liu et al., 2015). Conserved region of the vlhA gene was
used as the target for primer design, which was retrieved
WU ET AL.
Sequence 5 -3
from the Chinese MS strain (CHN-QZ114-1-2013) in
the NCBI database (Accession number: KU572389).
A pair of specific primers for PSR and PCR was de-
signed using Oligo 7.37. The primers were synthesized
by Hongxun Technology Co., Ltd (Suzhou, China). Se-
quences of primers used in this study are listed in
Table 1.
PSR Optimization
Reaction mixture (25 uL) included 10 mM
(NH4 )2 SO4 , 50 mM KCl, 0.1% v/v Tween-20, 1.4 mM
dNTPs, 0.8 M Betaine, 4 mM MgSO4 , 8 U Bst
DNA polymerase, and 0.8 uM forward and reverse
PSR primers (S1 and S2). A pH-sensitive dye (1 μL;
0.025 mM phenol red and 0.08 mM cresol red) was
added to each tube. Additionally, 25 uL mineral oil was
added to prevent product volatilization. To evaluate the
best reaction conditions, temperature optimization was
performed using the reaction temperature gradient at
60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, and 65◦ C. Time opti-
mization PSR was performed at gradients of 20, 30, 40,
50, and 60 min. Reaction results were discriminated ac-
cording to the clarity and brightness of bands obtained
using 2% agarose gel electrophoresis.
PCR Assay
The PCR reaction system (20 μL) included 1 μL
DNA template, 0.25 mM upstream and downstream
primers (P1 and P2), 10 × PCR buffer, and 2.5 mM
dNTPs. The PCR reaction program comprised 3 min
pre-denaturation at 94◦ C for 1 cycle, followed by 30 s
denaturation at 94◦ C, 40 s at 53◦ C, 40 s extending
at 72◦ C for 30 cycles, and final extension at 72◦ C for
10 min. Then, 2% agarose gel electrophoresis was used
to identify amplification products.
Sensitivity and Specificity of the PSR Assay
The 369-bp conserved fragment of the vlhA gene
of a Chinese MS strain (CHN-QZ114-1-2013, Acces-
sion number: KU572389) was cloned into a commercial
clone vector pMD 18-T (TaKaRa Biotech Corporation,
Dalian, China) to develop a standard plasmid (MS-
vlha). It was diluted 10 times from 8.97 × 106 copies
to 8.97 copies to evaluate the sensitivity of the PSR
assay compared with that of conventional PCR. PSR
 VISIBLE DETECTION OF MS USING PSR ASSAY 5357
and routine PCR were performed in parallel, and reac-
tion products were detected using 2% gel electrophore-
sis.
The specificity of the PSR assay was evaluated using
the DNA of MS, MG, and MS-H and cDNA of NDV,
ILTV, H9 AIV, and IBV; results were assessed using
agarose gel electrophoresis and color rendering with a
dye indicator.

Clinical Sample Testing

To further evaluate the efficiency of the PSR assay, Figure 1. PSR products at different temperatures in 2% gel elec-
329 clinical samples (including laryngeal swabs, syn- trophoresis, 1 to 6: 60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, 65◦ C, respectively;
ovial fluid swabs, synovial bursa tissues, and trachea M: 2,000 marker; N: negative control.
tissues) collected from flocks suspected to have MS
infection from Henan, Hubei, and Jiangsu provinces
of China were identified using PSR and conventional
PCR; positive detection rates were calculated and com-
pared. Samples singly or doubly negative detected by
the PCR and PSR assays were tested by MS isola-
tion and culture in Frey Mycoplasma Broth (BD Bio-
sciences, Franklin Lakes, NJ) supplemented with 10%
porcine serum, as described in a previous report (Sun
et al., 2017).

Ethics Statement
Swabs collecting and the autopsy protocols for dead Figure 2. PSR products at different intervals in 2% gel elec-
chickens were conducted in accordance with the recom- trophoresis, 1 to 5: 20, 30, 40, 50, 60 min, respectively; M: 2,000 marker;
N: negative control.
mendations of the Guide for the Care and Use of Lab-
oratory Animals of the National Institutes of Health.
The approval of using animals during the process of this
study was obtained from South China Agricultural Uni-
versity Committee for Animal Experiments (approved
ID: SYXK-2014-0136).

RESULTS
Temperature and Time Optimization of the
PSR Assay
The optimum temperature was selected using tem-
peratures ranging from 60◦ C to 65◦ C at a gradient
of 1◦ C. Electrophoresis revealed no remarkable differ-
ences. Finally, the midpoint 62◦ C was selected as the
optimum temperature for PSR assay performing in a
water bath (Figure 1). Optimum time was selected us- Figure 3. (a) PSR-specific products in 2% gel electrophoresis, 1:
ing a gradient of 20, 30, 40, 50, and 60 min. As time in- MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV, and ND; M: 2,000 marker;
creased, the amplification bands became clearer, reach- N: negative control. (b) Visual detection of negative and positive PSR
ing a peak at 40 min. There was no further improvement amplification products, 1: MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV,
and ND; M: 2,000 marker; yellow represents positive and purple rep-
with longer durations, so the optimal time was 40 min resents negative.
(Figure 2). Thus, the optimal PSR time and tempera-
ture settings were 40 min and 62◦ C, respectively.
and ND were used as control pathogens for evaluat-
Specificity of the PSR Assay ing detection specificity (Figures 3a and 3b). Only the
positive control displayed electrophoresis bands and
DNA of MS isolates was used as the template for reaction-liquid turned orange, but other negative con-
positive control, and MS-H, MG, H9 AIV, IB, ILTV, trol displayed no band and reaction-liquid remained
5358 WU ET AL.

template concentration. PSR was more sensitive than

conventional PCR (Figure 4). The concentration limit
detected by PSR was 8.97 × 10 copies, whereas that
detected by PCR was >8.97 × 103 copies. Therefore,
the sensitivity of PSR was 100 times more than that of
the conventional PCR.

Clinical Sample Testing

Routine PCR and PSR were used to detect MS in 329
suspected samples (Table 2). The results highlighted
high prevalence of MS infection in China. The positive
rate of routine PCR was 65.3% (215/329), while that
of PSR was 69.9% (229/329). MS in negative samples
detected by both PCR and PSR assays could not be
isolated and cultured, but MS in 9 samples undetected
by PCR was isolated by the PSR assays. Thus, PSR
was more sensitive and suitable for MS detection in the
field.

Figure 4. (a) PSR sensitivity products in 2% gel electrophore-
sis, 1 to 7: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M:
2,000 marker; N: negative control. (b) Visual detection of negative
and positive PSR amplification products, 1 to 7: 8.97 × 106 to 8.97
copies, diluted 10 times in turn; M: 2,000 marker; N: negative control.
(c) PCR sensitivity products in 2% gel electrophoresis, 1 to 6: 8.97
× 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N:
negative control.
purple-red. Thus, the designed primers had good speci-
ficity.
Sensitivity of the PSR Assay
Under optimum reaction conditions, DNA was di-
luted in the order of 10 gradient to test the sensitiv-
ity of the PSR assay; PCR was performed at the same
DISCUSSION
As one of the major avian mycoplasmas, MS has over-
taken MG in commercial poultry. Recently, MS has be-
come increasingly prevalent in chickens of various age
groups (Moreira et al., 2015). MS is mainly transmit-
ted by contact, and sick chickens are the main source
of infection. MS can spread through food, water, and
feathers (Xue et al., 2017). In addition to horizontal
transmission, MS can be transmitted vertically from
infected hens to their offspring through eggs (Land-
man, 2014). We developed a rapid, sensitive, and ac-
curate assay for MS identification in clinical cases; the
PSR assay could detect MS strains within 40 min, and
the assay could be accomplished using a water bath
at a relatively wide temperature range (60◦ C to 65◦ C).
Furthermore, the primers could specifically detect MS
without cross-reaction with other prevalent pathogens

Table 2. Comparison of the results generated by the PSR and PCR assays using clinical samples.

Positive rates
Sampling place Breeds Date Sample type PSR PCR

Henan Nanyang Layer 2017.04 Laryngeal swabs 25/39 21/39

Hubei Xiangyang Layer 2017.09 Joint fluid swabs 17/29 17/29
Hubei Suizhou Broiler 2017.10 Synovial bursa tissues 7/8 7/8
Henan Anyang Layer 2017.10 Trachea tissues 5/7 5/7
Henan Xuchang Broiler 2017.11 Joint fluid swabs 23/41 18/41
Hubei Jingmen Layer 2018.01 Synovial bursa tissues 11/13 11/13
Jiangsu Huaian Layer 2018.01 Trachea tissues 14/15 14/15
Henan Shangqiu Layer 2018.01 Synovial bursa tissues 4/6 4/6
Henan Yuzhou Layer 2018.03 Synovial bursa tissues 9/12 9/12
Henan Nanyang Layer 2018.03 Laryngeal swabs 7/19 6/19
Hubei Yichang Broiler 2018.03 Trachea tissues 5/8 5/8
Hubei Xiaogan Broiler 2018.09 Joint fluid swabs 13/14 13/14
Henan Hebi Layer 2018.09 Synovial bursa tissues 9/9 9/9
Henan Xinyang Layer 2018.10 Trachea tissues 8/13 8/13
Jiangsu Xuzhou Layer 2018.11 Trachea tissues 12/14 12/14
Henan Luoyang Layer 2018.11 Trachea tissues 15/19 15/19
Henan Nanyang Layer 2018.11 Laryngeal swabs 31/48 27/48
Henan Nanyang Layer 2018.12 Synovial bursa tissues 14/15 14/15
 VISIBLE DETECTION OF MS USING PSR ASSAY
as well as the live vaccine strain MS-H, and its sensitiv-
ity was 100 times higher than that of the routine PCR
assay.
Reportedly, the PSR assay has great potential to
rapidly detect Mycobacterium tuberculosis, canine
parvovirus 2, and bovine herpesvirus 1 in clinical
laboratories for point-of-care diagnosis in low-resource
settings (Gupta et al., 2017; Liu et al., 2018; Malla
et al., 2018). Compared with other established molecu-
lar methods for MS detection, MS–PSR has advantages
in terms of practical application. The LAMP assay
for MS detection requires 6 primers to target at least
6 sequence regions, strict primer coordination, and
low primer mismatch tolerance for a more conserved
sequence. MS–PSR requires only 1 pair of primers for
amplification, which reduces the method amend cost
for primer updates against mismatching caused by
MS gene variations. Additionally, MS–PSR results can
be observed through color change using a phenol red
indicator which shows change in the pH of reaction
mixture caused by massive amounts of pyrophosphatic
acid byproducts (Tanner et al., 2015). Although LAMP
assay results for MS detection can be observed with
the naked eye using SYBR Green, the inhibitory effect
determining SYBR Green I must be added after the
reaction termination. Opening-cap for analysis of
detection results increases the probability of aerosol
contamination by LAMP-amplified products because
both PSR and LAMP assays are very sensitive.
In this study, all field isolates positive for MS–PCR
(n = 215) could be accurately detected using the novel
assay. Of the 14 samples positive for PSR but nega-
tive for PCR, 9 were finally confirmed by MS isolation
and 5 positive for PSR remained negative by MS iso-
lation. In sample type analysis, all samples were swabs
(n = 14), which might contain less MS load than did
tissue samples, suggesting that the sensitivity of PCR
was lower than that of PSR for MS detection in field
samples. Meanwhile, MS isolation from field samples
was not as simple as that from bacterial cultures owing
the lack of bacterial cell walls and strict requirements of
growth environment, both of which reduce the culture
sensitivity. Despite these factors, tissue samples from
dead birds of the same flocks were confirmed to be pos-
itive using both PSR and PCR. Therefore, the 5 swab
samples detected negative by PSR assay might be be-
cause the Mycoplasma load was lower than that of the
actually detectable limit of the PSR assay.
In recent years, MS has become widespread, and its
eradication after infection remains challenging. Owing
to the advantages of the PSR assay, such as simple de-
sign, convenient operation, rapid processing, and high
sensitivity and specificity, combined with constant tem-
perature conditions, MS can be detected in the field
without the use of sophisticated equipment to effec-
tively monitor chickens at point-of-need. Therefore, pre-
ventive and treatment measures that allow a timely
response to block MS spread will avoid great economic
losses.
5359
ACKNOWLEDGMENTS
This study was supported by the National Natural
Science Foundation of China (grant numbers 31802185
and 31870917), the Scientific and Technological Project
of Henan Province (grant numbers 182107000040 and
182102110084), the Key Scientific and Technologi-
cal Project of The Education Department of Henan
Province (grant number 18A230012), Key Scientific and
Technological Project of Nanyang City (grant number-
sKJGG2018144 and KJGG2018069), and Technological
Project of Nanyang normal university (grant numbers
16134, 18046, and 2018CX012).
REFERENCES
Ball, C., A. Forresterand, and K. Ganapathy. 2018. Co-circulation
of genetically diverse population of vaccine related and unrelated
respiratory mycoplasmas and viruses in UK poultry flocks with
health or production problems. Vet. Microbiol. 225:132–138.
Derksen, T., R. Lampron, R. Hauck, M. Piteskyand, and R. A. Gal-
lardo. 2018. Biosecurity assessment and seroprevalence of respi-
ratory diseases in backyard poultry flocks located close to and far
from commercial premises. Avian Dis. 62:1–5.
Gupta, V., S. Chakravarti, V. Chander, S. Majumder, S. A. Bhat,
V. K. Guptaand, and S. Nandi. 2017. Polymerase spiral reaction
(PSR): a novel, visual isothermal amplification method for detec-
tion of canine parvovirus 2 genomic DNA. Arch. Virol. 162:1995–
2001.
Haesendonck, R., M. Verlinden, G. Devos, T. Michiels, P. Butaye,
F. Haesebrouck, F. Pasmansand, and A. Martel. 2014. High sero-
prevalence of respiratory pathogens in hobby poultry. Avian Dis.
58:623–627.
Kaewphinit, T., N. Arunrut, W. Kiatpathomchai, S. Santiwatanakul,
P. Jaratsingand, and K. Chansiri. 2013. Detection of Mycobac-
terium tuberculosis by using loop-mediated isothermal amplifi-
cation combined with a lateral flow dipstick in clinical samples.
Biomed Res. Int. 2013:1–6.
Kleven, S. H. 2008. Control of avian mycoplasma infections in com-
mercial poultry. Avian Dis. 52:367–374.
Kleven, S. H., G. N. Rowlandand, and M. C. Kumar. 2001. Poor sero-
logic response to upper respiratory infection with Mycoplasma
synoviae in turkeys. Avian Dis. 45:719–723.
Kreizinger, Z., D. Grozner, K. M. Sulyok, K. Nilsson, V. Hrivnak,
D. Bencina, and M. Gyuraneczand. 2017. Antibiotic susceptibility
profiles of Mycoplasma synoviae strains originating from Central
and Eastern Europe. BMC Vet. Res. 13:342.
Kuo, H. C., D. Y. Lo, C. L. Chen, Y. L. Tsai, J. F. Ping, C. H. Lee, P.
A. Leeand, and H. G. Chang. 2017. Rapid and sensitive detection
of Mycoplasma synoviae by an insulated isothermal polymerase
chain reaction-based assay on a field-deployable device. Poult.
Sci. 96:35–41.
Kursa, O., A. Pakula, G. Tomczyk, S. Paśkoand, and A. Sawicka.
2019. Eggshell apex abnormalities caused by two different My-
coplasma synoviae genotypes and evaluation of eggshell anoma-
lies by full-field optical coherence tomography. BMC Vet. Res.
15:1.
Kursa, O., G. Wozniakowski, G. Tomczyk, A. Sawickaand, and Z.
Minta. 2015. Rapid detection of Mycoplasma synoviae by loop-
mediated isothermal amplification. Arch. Microbiol. 197:319–
325.
Landman, W. J. 2014. Is Mycoplasma synoviae outrunning My-
coplasma gallisepticum? A viewpoint from the Netherlands.
Avian Pathol. 43:2–8.
Liu, W., D. Dong, Z. Yang, D. Zou, Z. Chen, J. Yuanand, and L.
Huang. 2015. Polymerase Spiral Reaction (PSR): A novel isother-
mal nucleic acid amplification method. Sci. Rep. 5:12723.
Liu, W., D. Zou, X. He, D. Ao, Y. Su, Z. Yang, S. Huang, Q. Zhao,
Y. Tang, W. Ma, Y. Lu, J. Wang, X. Wangand, and L. Huang.
2018. Development and application of a rapid Mycobacterium
5360
tuberculosis detection technique using polymerase spiral reaction.
Sci. Rep. 8:3003.
Malla, J. A., S. Chakravarti, V. Gupta, V. Chander, G. K. Sharma,
S. Qureshi, A. Mishra, V. K. Guptaand, and S. Nandi. 2018. Novel
Polymerase Spiral Reaction (PSR) for rapid visual detection of
Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus
and semen. Gene 644:107–112.
Mekkes, D. R., and A. Feberwee. 2005. Real-time polymerase chain
reaction for the qualitative and quantitative detection of My-
coplasma gallisepticum. Avian Pathol. 34:348–354.
Mohammed, H. O., T. E. Carpenterand, and R. Yamamoto. 1987.
Economic impact of Mycoplasma gallisepticum and M. synoviae
in commercial layer flocks. Avian Dis. 31:477–482.
Moreira, F. A., L. Cardosoand, and A. C. Coelho. 2015. Epidemi-
ological survey on Mycoplasma synoviae infection in Portuguese
broiler breeder flocks. Vet. Ital. 51:93–98.
Muhammad, F., J. Hussain, S. K. Fareed, K. T. Ahmad, K. S. Ah-
madand, and A. Ahmad. 2018. Diagnosis of avian mycoplasmas: a
comparison between PCR and culture technique. Arch Razi Inst
73:239–244.
Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watan-
abe, N. Aminoand, and T. Hase. 2000. Loop-mediated isothermal
amplification of DNA. Nucleic Acids Res. 28:63e.
WU ET AL.
Ramirez, A. S., C. J. Naylor, P. P. Hammondand, and J. M. Brad-
bury. 2006. Development and evaluation of a diagnostic PCR
for Mycoplasma synoviae using primers located in the inter-
genic spacer region and the 23S rRNA gene. Vet. Microbiol. 118:
76–82.
Sun, S. K., X. Lin, F. Chen, D. A. Wang, J. P. Lu, J. P. Qi-
nand, and T. R. Luo. 2017. Epidemiological investigation of My-
coplasma Synoviae in native chicken breeds in China. BMC Vet.
Res. 13:115.
Tanner, N. A., Y. Zhangand, and T. C. J. Evans. 2015. Visual de-
tection of isothermal nucleic acid amplification using pH-sensitive
dyes. BioTechniques. 58:59–68.
Xue, J., M. Y. Xu, Z. J. Ma, J. Zhao, N. Jinand, and G. Z.
Zhang. 2017. Serological investigation of Mycoplasma synoviae
infection in China from 2010 to 2015. Poult. Sci. 96:3109–
3112.
Zhu, L., B. M. Konsak, O. M. Olaogun, R. Agnew-Crumptona, A.
Kanci, M. S. Marenda, G. F. Browningand, and A. H. Noor-
mohammadi. 2017. Identification of a new genetic marker in
Mycoplasma synoviae vaccine strain MS-H and development of
a strategy using polymerase chain reaction and high-resolution
melting curve analysis for differentiating MS-H from field strains.
Vet. Microbiol. 210:49–55.