Genetic characterization of high-level aminoglycoside-resistant Enterococcus

faecalis and Enterococcus faecium isolated from retail chicken meat

Yeong Bin Kim,∗ Kwang Won Seo,∗,† Se Hyun Son,∗ Eun Bi Noh,∗ and Young Ju Lee∗,1
∗
College of Veterinary Medicine & Zoonoses Research Institute, Kyungpook National University, Daegu 41566,
Republic of Korea; and † Department of Basic Sciences, College of Veterinary Medicine, Mississippi State
University, Mississippi State 39762, USA

ABSTRACT Retail chicken meat can play a role
in the transfer of drug resistance to humans through
the handling or ingestion of improperly cooked meat
contaminated with resistant enterococci. In fact, high-
level aminoglycoside-resistance (HLAR) in enterococci
identified in human cases. Therefore, the prevalence
and genetic characterization of HLAR in enterococci
in retail chicken meat were investigated in this study.
Of the 345 enterococci strains, 29 (8.7%) showed
HLAR. All HLAR in enterococci carried at least 1 of
2 aminoglycoside-modifying enzyme genes, aac(6ʹ)Ie-
aph(2 )-Ia and ant(6)-Ia. Among the 13 isolates that
carried aac(6ʹ)Ie-aph(2 )-Ia, 3 had pattern A, with
IS256 at both ends, and the other 10 had pattern
D, without IS256 at both ends. All HLAR in ente-
rococci also showed multidrug resistance. Among the
Key words: enterococci, poultry industry, aminoglycoside-resistance, resistance gene, virulence gene
24 erythromycin-resistant enterococci, 19 (79.2%) har-
bored the ermB gene, and one (4.2%) harbored both the
ermB and ermA genes. A total of 21 enterococci were
tetracycline-resistant and harbored one or more of the
following tetracycline resistance genes tet(M), tet(L),
and tet(O). The Int-Tn gene was detected in one iso-
late (3.4%) carrying the tet(M) and ermB genes. All
4 chloramphenicol-resistant isolates carried either the
phenicol resistance gene cfr alone (one isolate), both
cfr and fexA (one isolate), or both fexA and optrA
(2 isolates). Four efflux pump genes, efr(A), efr(B),
emeA, and lsa, were detected in all HLAR in Entero-
coccus faecalis isolates. These results improve our un-
derstanding of the transmission dynamics of HLAR in
enterococci from non-hospital sources to humans.
2019 Poultry Science 98:5981–5988
http://dx.doi.org/10.3382/ps/pez403

INTRODUCTION according to the use of antimicrobials as either thera-

The emergence and spread of drug resistance among
bacteria have increased at an alarming rate over the
past several decades. The prevalence of multidrug-
resistance in bacteria has also increased, which threat-
ens to narrow the effectiveness of antimicrobials for
treating infectious diseases (van den Boaard et al., 2002;
Lee et al., 2003; Kim et al., 2018b).
The Korea Animal Health Products Association re-
ported that 154 tons of antimicrobials were sold for
use in the poultry industry in 2017 (APQA, 2017). In
Korea, most chicken meat is produced by several large
integrated broiler operations that supply about 80%
of the market (KAPE, 2015). These integrated broiler
operations control all phases of chicken production,
including breeder flock management, hatcheries, feed
management, broiler slaughter, and retail distribution
(Choi et al., 2014; Kim et al., 2018c). The prevalence of
antimicrobial resistance may vary between operations
© 2019 Poultry Science Association Inc.
Received February 13, 2019.
Accepted June 18, 2019.
1 Corresponding author: youngju@knu.ac.kr
peutic or preventative measures.
Aminoglycosides, such as gentamicin, kanamycin,
and streptomycin, are broad-spectrum antimicrobials
(Krause et al., 2016). In Korea, gentamicin, kanamycin,
and streptomycin are frequently used in poultry opera-
tions. Gentamicin is commonly injected subcutaneously
with either Marek’s or infectious bursal disease vaccines
into day-old chicks in hatcheries. Kanamycin and strep-
tomycin are also administered to chickens in drinking
water or as an intramuscular or subcutaneous injection
(EMA, 2016; APQA, 2017; Liljebjelke et al., 2017).
Enterococci are normal inhabitants of the gastroin-
testinal tract of humans and animals and are com-
monly found in food and the environment. Although
they were considered to be safe microorganisms for
many years, nosocomial infections by enterococci have
recently emerged as an important public health prob-
lem (Lee et al., 2003). Enterococci show intrinsic low-
level cross resistance to aminoglycosides due to their de-
creased uptake of antimicrobials (Murray et al., 2003),
and they can acquire high-level resistance to amino-
glycosides (Adhikari, 2010). Especially, human cases
of high-level aminoglycoside-resistance (HLAR) in

5981
5982
enterococci are continually being identified (Kawalec
et al., 2007; Mittal et al., 2016). Several studies have
reported HLAR in enterococci in retail chicken meat
(Hayes et al., 2003; Choi and Woo, 2013; Donado-
Godoy et al., 2015; Tyson et al., 2018), which could be
a serious threat to human health (Kim et al., 2018b),
because antimicrobial resistance genes and virulence
genes can be transferred between humans and animals
through the consumption of contaminated animal food
products (Kwon et al., 2012). In Korea, there have been
only a few studies characterizing HLAR in enterococci
isolated from retail chicken meat. Therefore, the aim of
this study was to investigate the prevalence of HLAR
in enterococci from retail chicken meat and genetically
characterize the detected strains.
MATERIALS AND METHODS
Bacterial Strains
In 2016 and 2017, 200 samples of retail chicken meat
were purchased from retail markets in South Korea as
described previously (Kim et al., 2018a). These meats
originated from 50 different farms and 7 different broiler
operations that supply about 80% of the broiler chick-
ens in Korea. If several isolates of the same origin
showed the same antimicrobial susceptibility patterns,
only 1 isolate was randomly chosen for analysis. A total
of 335 Enterococcus faecalis (E. faecalis) and 10 Ente-
rococcus faecium (E. faecium) isolates were selected for
this study.
Antimicrobial Susceptibility Testing
Enterococci isolates were screened for susceptibil-
ity to a panel of nine antimicrobial drugs [ampicillin
(10 µg), chloramphenicol (30 µg), ciprofloxacin (5 µg),
doxycycline (30 µg), erythromycin (15 µg), penicillin
(10 units), rifampin (5 µg), tetracycline (30 µg), and
vancomycin (30 µg)] on Mueller-Hinton agar (BD Bio-
sciences, Sparks, MD, USA) by using the disc diffu-
sion method. Susceptibility tests were conducted ac-
cording to Clinical and Laboratory Standards Institute
(CLSI) guidelines. Staphylococcus aureus ATCC 25,923
was used as a control. Susceptibility results were in-
terpreted according to CLSI standards (CLSI, 2013).
Multidrug resistance (MDR) was defined as acquired
non-susceptibility to 3 or more antimicrobial categories.
Detection of High-Level
Aminoglycoside-Resistant Enterococci
The minimum inhibitory concentration (MIC) val-
ues for gentamicin, kanamycin, and streptomycin were
determined by the agar dilution method on brain
heart infusion agar at concentrations ranging of 256–
2048 μg/mL (serial 2-fold dilutions). Enterococcus fae-
calis ATCC 29,212 was used as a control. Break-
points for gentamicin (≥500 µg/mL) and streptomycin
KIM ET AL.
(≥2000 µg/mL) were set according to the guidelines of
the CLSI (CLSI, 2013). For kanamycin, the breakpoints
(≥500 µg/mL) was proposed by the Société Française
de Microbiologie (SFM, 2011).
Identification of Antimicrobial Resistance
and Virulence Gene
The isolates were tested for the presence of
macrolides resistance genes (ermB, ermA, and mef),
tetracyclines resistance genes [tet(L), tet(M), and
tet(O)], efflux pump genes [efr(A), efr(B), emeA,
and lsa], Tn916/1545-like and Tn5397-like transposons
genes (Int-Tn and tndX, respectively), phenicols resis-
tance genes (cfr, fexA, and optrA) and aminoglycoside
modifying enzyme (AME) genes [aac(6 )-Ie–aph(2 )-
Ia, aph(2 )-Ib, aph(2 )-Ic, aph(2 )-Id, ant(3 )-Ia, and
ant(6)-Ia] by PCR. Table 1 lists the primers used to
detect resistance, transposon, and AME genes as pre-
viously described (Clark et al., 1999; Vakulenko et
al., 2003). In addition, virulence genes, including ace
(a collagen-binding protein), asa1 (aggregation sub-
stance), cylA (cytolysin activator), efaA (cell wall-
associated protein involved in immune evasion), esp (en-
terococcal surface protein), gelE (gelatinase), and hyl
(glycoside-hydrolase) were also determined by PCR as
previously described (Agarwal et al., 2009).
Analysis of IS256-Flanking Pattern for
aac(6 )-Ie–aph(2 )-Ia
The IS256-flaking patterns were investigated in
HLAR in enterococci harboring aac(6 )-Ie–aph(2 )-Ia.
PCR to determine the IS256-flanking pattern was per-
formed by using 2 primer pairs as reported by Watan-
abe et al. (2009).
RESULTS
Multidrug-Resistance Phenotypes of
Enterococci
Table 2 shows the prevalence of MDR among ente-
rococci isolated from chicken meats from 7 integrated
broiler operations. Of the 345 isolates, 136 (39.4%) were
resistant to 3 or more antimicrobial classes. In particu-
lar, isolates from operations Ⅵ (52.6%, 10 of 19 isolates)
and III (50.9%, 29 of 57 isolates) showed a higher pro-
portion of MDR than isolates from the other operations.
In addition, all 4 E. faecium isolates from operation I
were MDR. Fig 1 shows the distribution of resistance
to each antimicrobial class among the MDR enterococci
from the seven integrated broiler operations. Resistance
to three antimicrobial classes was a frequent phenotype,
with a prevalence rate of 23.8 to 42.1%. One isolate each
from operations I and III showed resistance to 6 antimi-
crobial classes, and one isolate from operation I showed
resistance to 7 antimicrobial classes.
 HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI 5983
Table 1. Primer sequences used for the amplification.

Target gene Sequence (5 -3 ) Size (bp) Referenece

ermA F: TAACATCAGTACGGATATTG 200 Di Cesare et al., 2013
R: AGTCTACACTTGGCTTAGG
ermB F: CCGAACACTAGGGTTGCTC 139 Di Cesare et al., 2013
R: ATCTGGAACATCTGTGGTATG
mef F: AGTATCATTAATCACTAGTGC 348 Di Cesare et al., 2013
R: TTCTTCTGGTACTAAAAGTGG
tet(L) F: ATAAATTGTTTCGGGTCGGTAAT 1077 Choi and Woo, 2015
R: AACCAGCCAACTAATGACAATGAT
tet(M) F: GTTAAATAGTGTTCTTGGAG 657 Choi and Woo, 2015
R: CTAAGATATGGCTCTAACAA
tet(O) F: GATGGCATACAGGCACAGAC 614 Choi and Woo, 2015
R: CAATATCACCAGAGCAGGCT
cfr F: TGAAGTATAAAGCAGGTTGGGAGTCA 746 Kehrenberg and Schwarz, 2006
R: ACCATATAATTGACCACAAGCAGC
fexA F: GTACTTGTAGGTGCAATTACGGCTGA 1272 Kehrenberg and Schwarz, 2006
R: CGCATCTGAGTAGGACATAGCGTC
optrA F: AGGTGGTCAGCGAACTAA 1395 Kehrenberg and Schwarz, 2006
R: ATCAACTGTTCCCATTCA
eme(A) F: AGCCCAAGCGAAAAGCGGTTT 123 Choi and Choi 2017
R: CCATCGCTTTCGGACGTTCA
efr(A) F: GTCTGTTTCGTTTAATGGCAGCAGCC 258 Choi and Choi 2017
R: CGAATAGCTGGTTCATGTCTAAGGC
efr(B) F: ATGTTCTTAATCAATCCGCTGATGGC 345 Choi and Choi 2017
R: CATAGTAACTACCAAGGACAGCTACCC
lsa F: GTGACTTCTTTTGAACAGTGGGA 232 Choi and Choi 2017
R: TTCAGCCACTTGTTGTCTGCC
aac(6’)Ie-aph(2 )-la F: CAGAGCCTTGGGAAGATGAAG 348 Vakulenko et al., 2003
R: CCTCGTGTAATTCATGTTCTGGC
aph(2 )-Ib F: CTTGGACGCTGAGATATATGAGCAC 867 Vakulenko et al., 2003
R: GTTTGTAGCAATTCAGAAACACCCTT
aph(2 )-Ic F: CCACAATGATAATGACTCAGTTCCC 641 Vakulenko et al., 2003
R: CCACAGCTTCCGATAGCAAGAG
aph(2 )-Id F: GTGGTTTTTACAGGAATGCCATC 284 Vakulenko et al., 2003
R: CCCTCTTCATACCAATCCATATAACC
ant(3 )-Ia F: TGATTTGCTGGTTACGGTGAC 284 Clark et al., 1999
R: CGCTATGTTCTCTTGCTTTTG
ant(6)-Ia F: ACTGGCTTAATCAATTTGGG 596 Clark et al., 1999
R: GCCTTTCCGCCACCTCACCG

Table 2. Distribution of multidrug-resistant and high-level aminoglycoside resistant enterococci from 7 integrated broiler operation.a

Integrated broiler operation

Ⅰ Ⅱ Ⅲ Ⅳ Ⅴ Ⅵ Ⅶ Total
No. of Enterococcus faecalis 100 70 54 51 21 18 21 335
No. of MDR (%) 34 (34.0) 23 (32.9) 28 (51.9) 20 (39.2) 7 (33.3) 10 (55.6) 8 (38.1) 130 (38.8)
No. of HLAR (%) 9 (9.0) 3 (4.3) 8 (14.8) 5 (9.8) 1 (4.8) 0 (0.0) 2 (9.5) 28 (8.4)
No. of Enterococcus faecium 4 –b 3 2 – 1 – 10
No. of MDR (%) 4 (100.0) – 1 (33.3) 1 (50.0) – 0 (0.0) – 6 (60.0)
No. of HLAR (%) 0 (0.0) – 0 (0.0) 1 (50.0) – 0 (0.0) – 1 (10.0)
Total 104 70 57 53 21 19 21 345
No. of MDR (%) 38 (36.5) 23 (32.9) 29 (50.9) 21 (39.6) 7 (33.3) 10 (52.6) 8 (38.1) 136 (39.4)
No. of HLAR (%) 9 (8.7) 3 (4.3) 8 (14.0) 6 (11.3) 1 (4.8) 0 (0.0) 2 (9.5) 29 (8.7)
a
MDR, multidrug-resistance; HLAR, high-level aminoglycoside resistance.
b
-, Not detected.

Distribution of High-Level Aminoglycoside Phenotypes, Genotypes, and Virulence

Resistance in Enterococci
A total of 29 (8.7%) isolates, including 28 E. faecalis
and one E. faecium strain, showed HLAR, as shown
in Table 2. A higher prevalence of HLAR in entero-
cocci isolates was observed from operation Ⅲ (14.0%,
8 of 57 isolates), and HLAR was not detected from
operation Ⅳ.
Genes of High-Level Aminoglycoside
Resistance in Enterococci
The characteristics of the 29 HLAR in enterococci
are shown in Table 3. All HLAR in enterococci car-
ried at least 1 of 2 AME genes, aac(6ʹ)Ie-aph(2 )-Ia
and ant(6)-Ia. Especially, 13 isolates showed high-level
resistance to gentamicin and kanamycin and harbored
5984
Figure 1. Distribution of multidrug resistance of 136 enterococci isolated from 7 integrated broiler operations.
aac(6ʹ)Ie-aph(2 )-Ia gene, 3 of isolates had pattern A,
with IS256 at both ends, and the other 10 isolates had
pattern D, without IS256 at both ends.
All HLAR in enterococci were also MDR, and
the most common resistance pattern included re-
sistance to ciprofloxacin, erythromycin, and tetracy-
cline. Among 24 erythromycin-resistant enterococci,
19 (79.2%) harbored ermB and 1 (4.2%) harbored
both ermB and ermA. All 21 enterococci showed
tetracycline-resistance, and they harbored 1 or more
of the tetracycline resistance genes, tet(M), tet(L), and
tet(O). The Int-Tn gene was detected in one isolate
(3.4%) carrying the tet(M) and ermB genes. All 4
chloramphenicol-resistant isolates carried phenicol re-
sistant genes; 1 isolate harbored cfr only, 1 isolate har-
bored both cfr and fexA, and 2 isolates harbored both
fexA and optrA. All 4 efflux pump genes, efr(A), efr(B),
emeA, and lsa, were detected in all HLAR E. faecalis
isolate; the tndX gene, which is related to a transposon,
was not detected in any HLAR in enterococci isolate.
All HLAR isolates possessed at least 1 of the follow-
ing 4 virulence genes, ace (86.2%), gelE (82.8%), efaA
(79.3%), and asa1 (65.5%). Two isolates were positive
for cylA. However, the esp and hyl genes were not de-
tected in any HLAR in enterococci isolate.
DISCUSSION
Enterococci are normal commensals in poultry and
other domestic animals. However, enterococci may be
transmitted to humans through the handling and con-
sumption of contaminated retail chicken meat (Aslam
et al., 2012; Choi et al., 2014). Importantly, zoonotic
transmission of enterococci from food animal may be
KIM ET AL.
related to antimicrobial resistance(Mannu et al., 2003;
Yılmaz et al., 2016).
Previous studies have suggested that a high propor-
tion of enterococci in poultry meats are resistance to
multiple antimicrobials (Aslam et al., 2012; Donado-
Godoy et al., 2015; Kilonzo-Nthenge et al., 2015). In
this study, 34.9% of the 345 enterococci isolates showed
resistance to 3 or more antimicrobial classes, and 2
of the 7 broiler operations showed a high proportion
(≥50%) of MDR isolates. The difference in the resis-
tance patterns at the various operations may reflect
their antimicrobial usage during poultry production
(Tyson et al., 2018; Kim et al., 2018c). This suggests
that tracking and management of what and how an-
timicrobials are being used and misused by operations
is the most important factor for reduction the incidence
of resistant pathogens in poultry production.
Although enterococci are intrinsically resistant to
penicillins, cephalosporins, and low levels of clin-
damycin and aminoglycosides, some HLAR in ente-
rococci acquired resistance to chloramphenicol, ery-
thromycin, and high-levels of clindamycin, tetracycline,
penicillin, fluoroquinolones, and vancomycin due to the
release of various AME (Mendiratta et al., 2008). The
presence of AME genes in those isolates implies that
neither streptomycin nor gentamicin can be synergisti-
cally used with a glycopeptide or beta-lactam for the
treatment of enterococcal infections (Udo et al., 2004).
Aac(6’)Ie-aph(2 )-Ia and ant(6)-Ia are the most com-
monly detected genes in high-level gentamicin-resistant
enterococci and high-level streptomycin-resistant en-
terococci, respectively (Chow, 2000). In this study,
the aac(6’)Ie-aph(2 )-Ia gene was detected in all 13
isolates with a gentamicin MIC >2048 μg/mL, and
the ant(6)-Ia gene was detected in 21 isolates with a
Table 3. Characteristics of high-level aminoglycoside resistant 28 Enterococcus faecalis and 1 Enterococcus faecium from retail chicken meat.

Integrated IS256- Other resistance MIC (μg/mL)b

broiler flanking
Phenotypea Genotype G S k
Strain operation pattern AME gene Virulence factor
E. faecalis
EFS 18–1 Ⅰ -c ant(6)-Ia AM-C-CIP-DOX-E-P-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, cylA, gelE <256 >2048 >2048
EFS 18–2 Ⅰ – ant(6)-Ia CIP-DOX-E-TE ermB, tet(L), tet(M), tet(O), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 25–2 Ⅳ – ant(6)-Ia DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 30–1 Ⅱ – ant(6)-Ia C-CIP-DOX-E-TE ermB, tet(L), tet(M), cfr, efr(A), efr(B), emeA, lsa ace, efaA, gelE <256 >2048 >2048
EFS 35–1 Ⅲ – ant(6)-Ia DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 38–1 Ⅱ A aac(6’)Ie-aph(2 )-la CIP-DOX-TE tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, efaA, gelE >2048 <256 >2048
EFS 46–1 Ⅰ – ant(6)-Ia CIP-E-TE ermB, tet(M), efr(A), efr(B), emeA, lsa gelE >2048 >2048 >2048
EFS 51–1 Ⅰ – ant(6)-Ia E-TE tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 57–1 Ⅳ D aac(6’)Ie-aph(2 )-la, CIP-E ermB, efr(A), efr(B), emeA, lsa ace, efaA, gelE >2048 2048 >2048
ant(6)-Ia
EFS 67–1 Ⅲ – ant(6)-Ia CIP-E ermB, efr(A), efr(B), emeA, lsa ace, efaA, gelE >2048 <256 >2048
EFS 77–2 Ⅳ A aac(6’)Ie-aph(2 )-la CIP-TE-RA tet(M), efr(A), efr(B), emeA, lsa ace, efaA, >2048 <256 >2048
EFS 79–2 Ⅳ – ant(6)-Ia DOX-E-TE tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, efaA, gelE <256 >2048 >2048
EFS 83–2 Ⅲ D aac(6’)Ie-aph(2 )-la, CIP-E efr(A), efr(B), emeA, lsa ace, asa1, gelE >2048 2048 >2048
ant(6)-Ia
EFS 84–1 Ⅲ – ant(6)-Ia C-CIP-DOX-E-TE ermB, tet(L), tet(M), Int-Tn, cfr, fexA, efr(A), efr(B), ace, efaA, <256 >2048 >2048
emeA, lsa
EFS 90–1 Ⅳ – ant(6)-Ia CIP-DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 98–1 Ⅰ – ant(6)-Ia DOX-E-TE ermA, ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, cylA, efaA, gelE <256 >2048 >2048
EFS 120–1 Ⅰ D aac(6’)Ie-aph(2 )-la, C-E ermB, fexA, optrA, efr(A), efr(B), emeA, lsa asa1, gelE >2048 >2048 >2048
ant(6)-Ia
EFS 122–1 Ⅶ – ant(6)-Ia CIP-TE tet(O), efr(A), efr(B), emeA, lsa asa1 <256 >2048 <256
EFS 124–1 Ⅶ A aac(6’)Ie-aph(2 )-la CIP-DOX-TE tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 2048 >2048
EFS 125–1 Ⅲ D aac(6’)Ie-aph(2 )-la, CIP-E ermB, efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 <256 >2048
ant(6)-Ia
EFS 131–2 Ⅱ D aac(6’)Ie-aph(2 )-la, CIP-E ermB, efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 >2048 >2048
ant(6)-Ia
EFS 133–2 Ⅲ D aac(6’)Ie-aph(2 )-la, CIP-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 >2048 >2048
ant(6)-Ia
EFS 135–1 Ⅲ D aac(6’)Ie-aph(2 )-la, CIP-E ermB, efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 <256 >2048
ant(6)-Ia
EFS 140–1 Ⅰ – ant(6)-Ia DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI

EFS 146–2 Ⅲ – ant(6)-Ia DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa asa1, gelE <256 >2048 >2048
EFS 154–1 Ⅴ – ant(6)-Ia CIP- DOX-E-TE ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE <256 >2048 >2048
EFS 171–2 Ⅰ D aac(6’)Ie-aph(2 )-la, C-CIP-DOX-E-TE ermB, tet(L), tet(M), fexA, optrA, efr(A), efr(B), ace, efaA >2048 >2048 >2048
ant(6)-Ia emeA, lsa
EFS 174–2 Ⅰ D aac(6’)Ie-aph(2 )-la, CIP-E efr(A), efr(B), emeA, lsa ace, asa1, efaA, gelE >2048 <256 >2048
ant(6)-Ia
E. faecium
EFM 1–2 Ⅳ D aac(6’)Ie-aph(2 )-la CIP-TE-P tet(L), tet(M) ace, efaA >2048 <256 >2048

a
AM, ampicillin; C, chloramphenicol; CIP, ciprofloxacin; DOX, doxycycline; E, erythromycin; P, penicillin; TE, tetracycline; RA, rifampin.
b
G, gentamicin; S, streptomycin; K, kanamycin.
C
-, Not applicant.
5985
5986 KIM ET AL.
streptomycin MIC ≥2048 μg/mL. For the Tn5281-
like elements, the 2 representative IS256-flanking pat-
terns, A and D, detected in the present study were
previously detected in clinical isolates of enterococci
(Simjee et al., 1999; Klibi et al., 2006), and the pattern
D was predominant among HLAR in enterococci har-
boring the aac(6’)Ie-aph(2 )-Ia gene. Pattern A, with
IS256 at both ends, was the most frequent pattern de-
tected in the 1990s; however, in recent reports, pat-
tern C, which lacks IS256 at the 5ʹ-end, and pattern
D, which lacks IS256 at both ends, are predominant
(Leelaporn et al., 2008; Zhang et al., 2018). Our re-
sults suggested that plasmid or transposons harbor-
ing aac(6ʹ)Ie-aph(2 )-Ia with IS256-flanking pattern D
may be predominant in the poultry industry in Korea,
although no evidence for an association was found be-
tween IS256-flanking pattern and resistance to amino-
glycosides, or the presence of virulence determinant
genes (Watanabe et al., 2009).
In this study, the most common tetracycline and
erythromycin resistance genes identified in the resis-
tant strains were tet(L), tet(M), and ermB, which was
in agreement with previous studies of isolated from
chicken meat (Cauwerts et al., 2007; Diarra et al., 2010;
Choi and Woo, 2015). Cauwerts et al. (2007) reported
that transposons associated with tet(M) and ermB in
enterococci can be easily transferred. In addition, the
optrA gene, which encodes an ATP-binding cassette
transporter and confers transferable resistance to flu-
orinated and non-fluorinated phenicols (Wang et al.,
2015), and the cfr gene, which confers resistance to
5 chemically unrelated antimicrobial classes including
phenicols, were also detected in this study. The emer-
gence of optrA and cfr in enterococci from food animals
is a serious concern as they could be transmitted to hu-
man via the food chain, and the spread of these genes
could significantly limit treatment options for MDR
bacteria (Liu et al., 2012; Tamang et al., 2017). Re-
garding the multidrug efflux pump genes efr(A), efr(B),
emeA, and lsa (Lee et al., 2003; Sánchez Valenzuela et
al., 2013), 100% of the HLAR E. faecalis strains in this
study possessed these genes, whereas the E. faecium
strains did not. Multidrug efflux pumps also contribute
to the growing problem of antimicrobial resistance in
bacteria (Schindler and Kaatz, 2016). Multidrug efflux
pumps have emerged as elements relevant to the intrin-
sic and acquired antimicrobial resistance of bacterial
pathogens (Martinez et al., 2009).
A number of virulence factors have been described
in enterococci (McGowan-Spicer et al., 2008; Diarra et
al., 2010), and in this study, the ace, efaA, gelE, and
asa1 genes were the most prevalent in HLAR in ente-
rococci, as was reported previously (McGowan-Spicer
et al., 2008; Han et al., 2011; Yılmaz et al., 2016). The
high prevalence of the gelE gene in isolates from ready-
to-eat food is considered to be a food safety risk be-
cause the gelE gene is associated with human infection
(Guerrero-Ramos et al., 2016; Chaj˛ ecka-Wierzchowska
et al., 2018).
Although the presence of HLAR in enterococci in
chicken meat in Korea may not be important for the
poultry industry, monitoring of HLAR in enterococci is
needed because it may contribute to the evolution and
spread of these strains and resistance-conferring genes
to humans. Determination of the molecular character-
istics of isolates from non-hospital sources, especially
poultry, will also help to define the transmission dynam-
ics of HLAR in enterococci from non-hospital source to
humans.
ACKNOWLEDGMENTS
This work was supported by Korea Institute of Plan-
ning and Evaluation for Technology in Food, Agricul-
ture, Forestry and Fisheries (IPET) through Agricul-
ture, Food and Rural Affairs Research Center Support
Program, funded by Ministry of Agriculture, Food and
Rural Affairs (MAFRA) (716002–7).
REFERENCES
Adhikari, L. 2010. High-level aminoglycoside resistance and reduced
susceptibility to vancomycin in nosocomial enterococci. J. Global
Infect. Dis. 2:231–235.
Agarwal, J., R. Kalyan, and M. Singh. 2009. High-level aminoglyco-
side resistance and beta-lactamase production in enterococci at
a tertiary care hospital in India. Jpn. J. Infect. Dis. 62:158–159.
Animal and Plant Quarantine Agency (APQA), 2017. Antimicro-
bial use and monitoring in animals and animal products. APQA,
gimcheon, Republic of Korea.
Aslam, M., M. S. Diarra, S. Checkley, V. Bohaychuk, and L. Masson.
2012. Characterization of antimicrobial resistance and virulence
genes in Enterococcus spp. isolated from retail meats in Alberta,
Canada, Int. J. Food Microbiol. 156:222–230.
Cauwerts, K., A. Decostere, E. M. De Graef, F. Haesebrouck, and F.
Pasmans. 2007. High prevalence of tetracycline resistance in En-
terococcus isolates from broilers carrying the erm(B) gene. Avian
Pathol. 36:395–399.
Chaj˛ecka-Wierzchowska, W., A. Zadernowska, U. Zarzecka, A.
Zakrzewski, and J. Gajewska. 2019. Enterococci from ready-to-
eat food - horizontal gene transfer of antibiotic resistance genes
and genotypic characterization by PCR melting profile. J. Sci.
Food Agric. 99:1172–1179.
Choi, J. M., and G. J. Woo. 2013. Molecular characterization of high-
level gentamicin-resistant Enterococcus faecalis from chicken meat
in Korea. Int. J. Food Microbiol. 165:1–6.
Choi, J. M., and G. J. Woo. 2015. Transfer of tetracycline resistance
genes with aggregation substance in food-borne Enterococcus fae-
calis. Curr. Microbiol. 70:476–484.
Choi, M. K., and S. S. Choi. 2017. Analysis of antimicrobial resis-
tance pattern and distribution of multi-drug efflux pump genes
and virulence genes in Enterococcus faecalis isolated from retail
meat in Seoul. J. Fd Hyg. Safety. 32:135–140.
Choi, S. W., J. S. Ha, B. Y. Kim, D. H. Lee, J. K. Park, H. N. Youn,
Y. H. Hong, S. B. Lee, J. B. Lee, S. Y. Park, I. S. Choi, and
C. S. Song. 2014. Prevalence and characterization of Salmonella
species in entire steps of a single integrated broiler supply chain
in Korea. Poult. Sci. 93:1251–1257.
Chow, J. W. 2000. Aminoglycoside resistance in enterococci. Clin
Infect Dis. 31:586–589.
Clark, N. C., Ø. Olsvik, J. M. Swenson, C. A. Spiegel, and F. C.
Tenover. 1999. Detection of a streptomycin/spectinomycin adeny-
lyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob.
Agents Chemother. 43:157–160.
Clinical and Laboratory Standards Institute (CLSI), 2013. Perfor-
mance Standards for Antimicrobial Susceptibility Testing, M100-
S23. Clinical and Laboratory Standards Institute, Wayne, PA.
 HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI
Di Cesare, A., G. M. Luna, C. Vignaroli, S. Pasquaroli, S. Tota, P.
Paroncini, and F. Biavasco. 2013. Aquaculture can promote the
presence and spread of antibiotic-resistant Enterococci in marine
sediments. PLoS One. 8:e62838.
Diarra, M. S., H. Rempel, J. Champagne, L. Masson, J. Pritchard,
and E. Topp. 2010. Distribution of antimicrobial resistance and
virulence genes in Enterococcus spp. and characterization of iso-
lates from broiler chickens. Appl. Environ. Microbiol. 76:8033–
8043.
Donado-Godoy, P., B. A. Byrne, M. León, R. Castellanos, C. Vane-
gas, A. Coral, A. Arevalo, V. Clavijo, M. Vargas, J. J. Romero
Zuñiga, M. Tafur, E. Pérez-Gutierrez, and W. A. Smith. 2015.
Prevalence, resistance patterns, and risk factors for antimicrobial
resistance in bacteria from retail chicken meat in Colombia. J.
Food Prot. 78:751–759.
European Medicines Agency (EMA). 2016. Updated advice on the
use of colistin products in animals within the European Union:
development of resistance and possible impact on human and
animal health. Accessed Jun. 2016. https://www.ema.europa.eu/
documents/scientific-guideline/updated-advice-use-colistin-pro
ducts-animals-within-european-union-development-resistance-
possible_en.pdf.
Guerrero-Ramos, E., J. Cordero, D. Molina-González, P. Poeta, G.
Igrejas, C. Alonso-Calleja, and R. Capita. 2016. Antimicrobial
resistance and virulence genes in enterococci from wild game meat
in Spain. Food Microbiol. 53:156–164.
Han, D. K., T. Unno, J. H. Jang, K. T. Lim, S. N. Lee, G. P. Ko, M. J.
Sadowsky, and H. G. Hur. 2011. The occurrence of virulence traits
among high-level aminoglycosides resistant Enterococcus isolates
obtained from feces of humans, animals, and birds in South Korea.
Int. J. Food Microbiol. 144:387–392.
Hayes, J. R., L. L. English, P. J. Carter, T. Proescholdt, K. Y. Lee,
D. D. Wagner, G. David, T. Proescholdt, and D. G. White. 2003.
prevalence and antimicrobial resistance of Enterococcus species
isolated from retail meats prevalence and antimicrobial resistance
of Enterococcus species isolated from retail meats. Appl. Environ.
Microbiol. 69:7153–7160.
Kawalec, M., Z. Pietras, E. Daniłowicz, A. Jakubczak, M. Gniad-
kowski, W. Hryniewicz, and R. J. L. Willems. 2007. Clonal struc-
ture of Enterococcus faecalis isolated from Polish hospitals: char-
acterization of epidemic clones. J Clin Microbiol. 45:147–153.
Kehrenberg, C., and S. Schwarz. 2006. Distribution of florfenicol
resistance genes fexA and cfr among chloramphenicol-resistant
Staphylococcus isolates. Antimicrob. Agents Chemother. 50:1156–
1163.
Kilonzo-Nthenge, A., A. Brown, S. N. Nahashon, and D. Long.
2015. Occurrence and antimicrobial resistance of enterococci iso-
lated from organic and conventional retail chicken. J. Food Prot.
78:760–766.
Kim, Y. B., H. J. Seo, K. W. Seo, H. Y. Jeon, D. K. Kim, S. W.
Kim, S.-K. Lim, and Y. J. Lee. 2018. Characteristics of High-
level ciprofloxacin-resistant Enterococcus faecalis and Enterococ-
cus faecium from retail chicken meat in Korea. J. Food Prot.
81:1357–1363.
Kim, Y. B., K. W. Seo, H. Y. Jeon, S. K. Lim, and Y. J. Lee.
2018. Characteristics of the antimicrobial resistance of Staphylo-
coccus aureus isolated from chicken meat produced by different
integrated broiler operations in Korea. Poult. Sci. 97:962–969.
Kim, Y. J., J. H. Park, and K. H. Seo. 2018. Comparison of the
loads and antibiotic-resistance profiles of Enterococcus species
from conventional and organic chicken carcasses in South Korea.
Poult. Sci. 97:271–278.
Klibi, N., K. Ben Slama, A. Masmoudi, S. Gharbi, F. Ruiz-Larrea,
C. Fendri, A. Boudabous, and C. Torres. 2006. Diversity of struc-
tures carrying the aac(6 )-aph(2 ;) gene in clinical Enterococcus
faecalis and Enterococcus faecium strains isolated in Tunisia. J
Chemother. 18:353–359.
Korea Institute for Animal Products Quality Evaluation (KAPE).
2015. Research on the actual conditions of livestock distribution
system 2015. Bundang, Republic of Korea
Krause, K. M., A. W. Serio, T. R. Kane, and L. E. Connolly. 2016.
Aminoglycosides: an overview. Cold spring harb. Perspect. Med.
6:1–19.
5987
Kwon, K. H., S. Y. Hwang, B. Y. Moon, Y. K. Park, S. Shin, C.
Y. Hwang, and Y. H. Park. 2012. Occurrence of antimicrobial
resistance and virulence genes, and distribution of enterococcal
clonal complex 17 from animals and human beings in Korea. J.
VET Diagn. Invest. 24:924–931.
Lee, E. W., M. N. Huda, T. Kuroda, T. Mizushima, and T. Tsuchiya.
2003. EfrAB, an ABC multidrug efflux pump in Enterococcus
faecalis. Antimicrob. Agents Chemother. 47:3733–3738.
Leelaporn, A., K. Yodkamol, D. Waywa, and S. Pattanachaiwit.
2008. A novel structure of Tn4001-truncated element, type V,
in clinical enterococcal isolates and multiplex PCR for detect-
ing aminoglycoside resistance genes. Int. J. Antimicrob. Agents.
31:250–254.
Liljebjelke, K. A., C. L. Hofacre, D. G. White, S. Ayers, M. D. Lee,
and J. J. Maurer. 2017. Diversity of antimicrobial resistance phe-
notypes in Salmonella isolated from commercial poultry farms.
Front. Vet. Sci. 96:1–9.
Liu, Y., Y. Wang, C. Wu, Z. Shen, S. Schwarz, X. D. Du, L. Dai,
W. Zhang, Q. Zhang, and J. Shen. 2012. First report of the mul-
tidrug resistance gene cfr in Enterococcus faecalis of animal origin.
Antimicrob. Agents Chemother. 56:1650–1654.
Mannu, L., A. Paba, E. Daga, R. Comunian, S. Zanetti, I. Duprè, and
L. A. Sechi. 2003. Comparison of the incidence of virulence deter-
minants and antibiotic resistance between Enterococcus faecium
strains of dairy, animal and clinical origin. Int. J. Food Microbiol.
88:291–304.
Martinez, J. L., M. B. Sánchez, L. Martínez-Solano, A. Hernandez,
L. Garmendia, A. Fajardo, and C. Alvarez-Ortega. 2009. Func-
tional role of bacterial multidrug efflux pumps in microbial nat-
ural ecosystems. FEMS Microbiol. Rev. 33:430–449.
Mcgowan-Spicer, L. L., P. J. Fedorka-Cray, J. G. Frye, R. J. Mein-
ersmann, J. B. Barrett, and C. R. Jackson. 2008. Antimicrobial
resistance and virulence of Enterococcus faecalis isolated from re-
tail food. J. Food Prot. 71:760–769.
Mendiratta, D. K., H. Kaur, V. Deotale, D. C. Thamke, R. Narang,
and P. Narang. 2008. Status of high level aminoglycoside resistant
Enterococcus faecium and Enterococcus faecalis in a rural hospital
of Central India. Indian J. Med. Microbiol. 26:369–371.
Mittal, S., P. Singla, A. Deep, K. Bala, R. Sikka, M. Garg, and
U. Chaudhary. 2016. Vancomycin and high level aminoglycoside
resistance in Enterococcus spp. in a tertiary health care centre: a
therapeutic concern. J. Pathogens. 2016:1–5.
Murray, P. R., E. J. Baron, J. H. Jorgenson, M. A. Pfaller, and R.
H. Yolken. 2003. Manual of Clinical Microbiology, 8th edition.
Washinton DC.
Sánchez Valenzuela, A., L. Lavilla Lerma, N. Benomar, A. Gálvez,
R. Pérez Pulido, and H. Abriouel. 2013. phenotypic and molec-
ular antibiotic resistance profile of Enterococcus faecalis and En-
terococcus faecium isolated from different traditional fermented
foods. Foodborne Pathog. Dis. 10:143–149.
Schindler, B. D., and G. W. Kaatz. 2016. Multidrug efflux pumps of
gram-positive bacteria. Drug Resist. Updat. 27:1–13.
Simjee, S., A. P. Fraise, and M. J. Gill. 1999. Plasmid heterogeneity
and identification of a Tn5281-like element in clinical isolates of
high-level gentamicin-resistant Enterococcus faecium isolated in
the UK. J. Antimicrob. Chemother. 43:625–635.
Société Française de Microbiologie (SFM), 2011. Comité de
l’Antibiogramme de la Société Française de Microbiologie. Bi-
ologiques, Paris.
Tamang, M. D., D. C. Moon, S. R. Kim, H. Y. Kang, K. Lee, H.
M. Nam, G. C. Jang, H. S. Lee, S. C. Jung, and S. K. Lim.
2017. Detection of novel oxazolidinone and phenicol resistance
gene optrA in enterococcal isolates from food animals and animal
carcasses. Vet Microbiol. 201:252–256.
Tyson, G. H., E. Nyirabahizi, E. Crarey, C. Kabera, C. Lam, C. Rice-
Trujillo, P. F. McDermott, and H. Tate. 2018. Prevalence and
antimicrobial resistance of enterococci isolated from retail meats
in the united states, 2002 to 2014. Appl. Environ. Microbiol. 84:
1–9.
Udo, E. E., N. Al-Sweih, P. John, L. E. Jacob, and S. Mohanakrish-
nan. 2004. Characterization of high-level aminoglycoside-resistant
enterococci in Kuwait hospitals. Microb. Drug Resist. 10:139–
145.
5988 KIM ET AL.
Vakulenko, S. B., S. M. Donabedian, M. Anatoliy, M. J. Zervos, S. A.
Lerner, J. W. Chow, and A. M. Voskresenskiy. 2003. Multiplex
pcr for detection of aminoglycoside resistance genes in entero-
cocci. Antimicrob. Agents Chemother. 47:1423–1426.
van den Boaard, A.E., R. Willems, N. London, J. Top, and E. E.
Stobberingh. 2002. Antibiotic resistance of faecal enterococci in
poultry, poultry farmers and poultry slaughterers. J. Antimicrob.
Chemother. 49:497–505.
Wang, Y., Y. Lv, J. Cai, S. Schwarz, L. Cui, Z. Hu, R. Zhang, J.
Li, Q. Zhao, T. He, D. Wang, Z. Wang, Y. Shen, Y. Li, A. T.
Feßler, C. Wu, H. Yu, X. Deng, X. Xia, and J. Shen. 2015. A
novel gene, optrA, that confers transferable resistance to oxazo-
lidinones and phenicols and its presence in Enterococcus faecalis
and Enterococcus faecium of human and animal origin. J. Antimi-
crob. Chemother. 70:2182–2190.
Watanabe, S., N. Kobayashi, D. Quiñones, S. Nagashima, N. Ue-
hara, and N. Watanabe. 2009. Genetic diversity of enterococci
harboring the high-level gentamicin resistance gene aac(6’)-Ie-
aph(2’’)-Ia or aph(2’’)-Ie in a Japanese hospital. Microb. Drug
Resist. 15:185–194.
Yılmaz, E. Ş., Ö. Aslantaş, S. P. Önen, S. Türkyılmaz, and C.
Kürekci. 2016. Prevalence, antimicrobial resistance and virulence
traits in enterococci from food of animal origin in Turkey. LWT
- Food Sci. Technol. 66:20–26.
Zhang, J.-M., Q. Wang, T.-Y. Han, J.-H. Liu, X.-X. Hu, F. Qiao,
X.-Y. Yang, C.-R. Li, and X.-F. You. 2018. Structure anal-
ysis of transposons carrying aac(6’)-aph(2’’) gene in Entero-
coccus faecalis isolated in Beijing China and comparison of
their transfer efficiency. Int. J. Antimicrob. Agents. 52:799–
804.