MANAGEMENT AND PRODUCTION

Heat shock protein 70 protects the quail cecum against oxidant stress,
inflammatory injury, and microbiota imbalance induced by cold stress

Chunpeng Liu,∗,†,‡ Maria Tabassum Chaudhry,§ Dan Zhao,‡ Tong Lin,‡ Yunbo Tian,∗,†,1 and
Jing Fu∗,†,‡,1
∗
Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China; † Guangdong Province Key
Laboratory of Waterfowl Healthy Breeding, Guangzhou 501225, China; ‡ College of Animal Science and
Technology, Northeast Agricultural University, Harbin 150030, China; and § Faculty of Veterinary Sciences,
Bahauddin Zakariya University, Multan 60000, Pakistan

ABSTRACT The intent of this study was to inves-
tigate the effects of cold stress on oxidative indexes,
inflammatory factors, and microbiota in the quail ce-
cum. A total of 192 male quails (15-day-old) were ran-
domly divided into 12 groups (16 in each group) and
were exposed to acute (up to 12 h) and chronic (up
to 20 D) cold stress at 12 ± 1◦ C. After cold stress
treatment, we examined morphological damage, oxida-
tive stress indexes, inflammatory factors, and intesti-
nal microbiota. Results of morphological examination
showed that both acute and chronic cold stress can
lead to cecal tissue injury. In addition, both acute and
chronic cold stress, especially chronic cold stress can in-
fluence the activity of oxidative stress mediators. Glu-
tathione (GSH) and glutathione peroxidase (GSH-Px)
Key words: cold stress, quails, intestinal inflammatory injury, microbiota, heat shock protein70
activities decreased significantly (p < 0.05), while the
nitric oxide (NO) content and inducible nitric oxide
synthase (iNOS) activity increased significantly (p <
0.05). Moreover, mRNA levels of inflammatory factors
cyclooxygenase-2 (COX-2), prostaglandin E synthase
(PTGES), and heat shock protein 70 (Hsp70) were
higher in both acute and chronic cold stress groups
when compared with the control group (p < 0.05). Fur-
thermore, the intestinal microbiota was changed in both
the acute and chronic cold stress groups. These results
suggested that cold stress caused oxidative stress and
inflammatory injury in cecal tissues, influenced cecal
microbiota, and increased expression of Hsp70, which
may contribute in protecting the cecum against cold
stress in quails.
2019 Poultry Science 98:5432–5445
http://dx.doi.org/10.3382/ps/pez327

INTRODUCTION sue damage, and ultimately death (Dhanalakshmi et al.,

Cold temperature, one of the main restraining factors
that influence animals’ health and limits animal pro-
duction in cold areas (Morris et al., 2017). The stress
correlated with cold temperatures regulates antioxidant
system, neuroendocrine system, immune system, and
inflammatory responses (van den Brand et al., 2010).
These transformations can affect the health, well-being,
and productivity of animals. Moreover, cold stress is
one of the main factors that causes onset of various dis-
eases. Cold stress inevitably emerges as the surrounding
temperature drops below 18◦ C, driving down the body
temperature and the body is unable to warm itself. It
later causes severe cold-related sickness, irreversible tis-

C 2019 Poultry Science Association Inc.
Received January 4, 2019.
Accepted June 4, 2019.
1
Corresponding authors: fujing@neau.edu.cn (JF); tyunbo@126.
com (YT)
5432
2007).
The gastrointestinal (GI) tract possesses an epithe-
lial layer, which is the functional unit that provides
a regulatory barrier when exposed to a variety of
nutrients, microbes, and exogenous toxins (Hirata et
al., 2007; Melo et al., 2017). Cold-stress-induced ep-
ithelial cell proliferation and inflammation in the small
intestine of rats (Kaushik and Kaur, 2005). In addition,
in our previous study, we found that prolonged cold
stress resulted in increased oxidative stress (OS), mor-
phological damage, and inflammation in the duodenum,
jejunum, and ileum of quails (Fu et al., 2013a, b), how-
ever, there was no data recorded about OS, morpho-
logical damage, inflammation index, and microbiota in
the caecum of quails.
Nitric oxide (NO) is recently documented as a power-
ful inter- and intra-cellular effector molecule that plays
a key role in physiology and pathology. Nitric oxide
plays a critical role in several physiological functions
in the GI tract and gut responses to injury. It is gen-
erated in nerve cells of central and enteric nervous
 EFFECTS OF COLD STRESS ON QUAILS
systems, where it serves as neurotransmitter to regu-
late functions ranging from digestion to blood flow and
to memory and vision (Rodeberg et al., 1995). The data
obtained from animal studies proposed that NO plays
an essential role in protecting the gut from destruction.
Intrinsic NO in neurons in the myenteric and sub-
mucosal regions participates in modulation of smooth
muscle tone and regulation of intestinal peristal-
sis (Di Lorenzo and Krantis, 2001). Tumor necro-
sis factor-alpha (TNF-α) is a pro-inflammatory
cytokine, produced by macrophages in response to bac-
terial endotoxins (Raabe et al., 1998). Cyclooxyge-
nases (COXs) are key enzymes for the biosynthesis
of prostanoids, which play important roles in the gut.
There are 3 known isoforms of cyclooxygenase: COX-1,
COX-2, and COX-3. COX-1 and COX-3 are constitu-
tively expressed, whereas COX-2 expression is induced
by cytokines and stresses (Lugo et al., 2007; Wang et
al., 2018). Liu et al. (2011) found that cold treatment
induced a significant increase in TNF-α production in
mouse ileal tissue (Liu et al., 2011). Furthermore, in our
previous study, we found that cold stress affected COX-
2 gene expression in the quail intestine (duodenum, je-
junum, and ileum). Therefore, it can be observed that
COX-2 and TNF-α are important pro-inflammatory cy-
tokines and play an important role during intestinal tis-
sue injury induced by stress. Oxidative stress can induce
mRNA expression of heat shock protein 70 (Hsp70)
in the early stage and heat shock proteins (Hsps) are
composed of a family of highly conserved stress proteins
that are present in every organism and play important
roles in stressed cells (Zhao et al., 2017). Hsp70 has been
widely reported to be an evaluation index in cold stress
studies and mRNA expression of Hsp70 was increased
significantly in heart and immune organs of chickens ex-
posed to cold stress (Zhao et al., 2013, 2014). Moreover,
several studies have demonstrated that Hsp70 plays an
important role in the process of OS and inflamma-
tory response. It was found that increased expression
of Hsp70 protected the spleen against OS and inflam-
matory damage induced by cold stress in quails (Ren et
al., 2018). Moreover, experimental study by Bianchi et
al. revealed that OS increased the expression of Hsp70
and some inflammatory mechanisms, such as COX-2 ex-
pression and NF-kappaB (NF-κB) pathway (Bianchi
et al., 2014). However, until now not much of the lit-
erature is available to elaborate the correlation among
Hsp70, OS, inflammatory injury, and intestinal flora in
quails cecum exposed to cold stress.
The gut microbiota is known to affect the health and
growth of host animals. In healthy animals, the balance
of intestinal microbiota remains stable. However, this
stability is affected greatly by environmental stresses
(e.g., extremely high or low temperatures, overcrowd-
ing, poor feeding, and transportation; Lan et al., 2004).
To our knowledge, there are no studies on the effects
of cold stress on intestinal microbiota in quails. As we
know, the cecum has a high density of bacteria of nu-
merous types in birds (Gong et al., 2007). In addition,
cecal microbiota helps to protect quails against enteric
5433
diseases caused by pathogenic bacteria, and the mi-
croorganisms normally present in the small intestine fa-
cilitates intestinal functioning, including digestion and
absorption of nutrients, which ultimately affects the
growth and performance of chickens (Gong et al., 2002).
As the environmental stressors can influence the sus-
ceptibility of birds to temperature, it is important
to learn how stressors affect the quail cecum. There-
fore, the present study, which was based on a model
of acute and chronic cold stress in quails, identified
changes in morphology and intestinal flora, antioxi-
dant responses [glutathione (GSH) and glutathione
peroxidase (GSH-Px)], NO content and inducible ni-
tric oxide synthase (iNOS) activity, COX-2, TNF-α,
and Hsp70 mRNA levels in the quail cecum after cold
treatment. The presence of OS, inflammation, and dys-
bacteriosis led us to explore quail cecal injury induced
by cold stress.
MATERIALS AND METHODS
Birds, Exposure to Cold Stress, and Sample
collection
A total of 192 Shaweimate male quails (1-day-old)
were purchased from Xiangyang Co., Ltd. (Harbin,
China). Quails were treated according to the rule of
animal welfare, wherein the birds were housed in an
environmentally controlled enclosure, the whole animal
house was kept clean, bacteria free, and non-polluted
feed and water were supplied freely. Moreover, all the
experiment procedures, including the prior ethical ap-
proval was followed by Northeast Agricultural Univer-
sity (approved protocol number SRM-11). All quails
were fed in cages (16 quails in each cage). Feeding ex-
periment was conducted according to meat quails feed-
ing management manual. For light protocol, 24 h of
light was provided in the first 7 D, after that the pho-
toperiod was changed to 16 h light and 8 h dark. For
temperature, the brooding temperature was maintained
at 37 to 36◦ C during 1 to 6 D of age, 36 to 35◦ C dur-
ing 7 to 10 D of age, 34 to 33◦ C during 11 to 15 D
of age and decreased 1◦ C per day from day 16, until
it reached room temperature i.e., 28◦ C. Humidity in
the house was maintained at 65 to 70%. The diet con-
sisted of commercial corn−soybean-based feed that met
all NRC requirements (Nation Research Council, 1994).
In the whole experimental period 2 kinds of diets were
used. From day 1 to 21 (ME was 11.95 MJ/Kg and
crude protein content was 23.97%), from day 22 to 35
(ME was 12.37 MJ/Kg and crude protein content was
22.15%). Composition of basal diets is shown in Table 1.
At 15 D of age, quails were selected to establish cold
stress model and the cold stress temperature was 12 ±
1◦ C. For acute cold stress, the duration of cold stress
was 0.5, 1, 3, 6, and 12 h. For chronic cold stress, the
duration of the cold stress was 5, 10, and 20 D. Quails
in control group were maintained at 28◦ C, which is a
natural temperature for quails in the brooding period.
5434 LIU ET AL.
Table 1. Composition of basal diets.

Nutrition level
Ingredients Day1 to 21 Day22 to 35 Day1 to 21 Day22 to 35

Corn 51.16 54.5 ME(MJ/kg) 11.95 12.37

Soybean meal 32 31 CP(%) 23.97 22.15
Fish meal 3.5 3.5 M-AA(%) 0.52 0.5
Corn gluten meal 5 2.5 L-AA(%) 1.32 1.3
Bran 3.5 2 Ca(%) 1.03 1.02
Soybean oil 1 2.6 AP(%) 0.46 0.45
Salt 0.3 0.3 NaCl (%) 0.46 0.47
Limestone 1.3 1.3
Calcium phosphate dibasic 1.3 1.3
DL-methionine 0.12 0.14
lysine 0.15 0.19
Choline chloride 0.12 0.12
Mineral premix 0.5 0.5
Vitamin premix 0.05 0.05

Table 2. Primers used for quantitative real-time PCR.

Target gene Primer sequence (5 -3 ) Product size (bp)

 
COX-2 Forward 5 - TGTCCTTTCACTGCTTTCCAT-3 84
Reverse 5 - TTCCATTGCTGTGTTTGAGGT-3
TNF-α Forward 5 - GCCCTTCCTGTAACCAGATG-3 71
Reverse 5 - ACACGACAGCCAAGTCAACG-3
Hsp70 Forward 5 -CGGGCAAGTTTGACCTAA-3 250
Reverse 5 -TTGGCTCCCACCCTATCTCT-3
GAPDH Forward 5 - TGATGCTCCCATGTTCGTGA-3 146
Reverse 5 - TAAGACCCTCCACGATGCC-3

Quails were killed with sodium pentobarbital after
limosis for overnight, following exposure to cold stress
for the specified durations. A total of 5 quails were
randomly selected from each treatment group and
cecal tissues were collected immediately under a sterile
environment. The cecal tissues were fixed for use
in light and electron microscopy, which were used
for morphological evaluation; the intestinal contents
from 5 additional quails in each group were collected
and were then mixed evenly for analysis of microbial
community by denaturing gradient gel electrophoresis
(DGGE). These samples were dissolved in sterile
water to obtain a concentration of 50 ng/mL and were
then stored at −20◦ C, with some other surplus tissues
stored at −80◦ C for q-PCR.
Microscopic and Ultrastructural
Observation
For light microscopy, after the dissection of 3 quails,
cecum tissues were removed and washed, fixed in 4%
buffered formaldehyde, and processed in paraffin. Each
tissue was sliced into thin sections (5 to 6 μm), mounted
onto the glass slides, and were stained with hematoxylin
and eosin (H&E). Finally these histological slides were
observed under an Olympus light microscope.
For electron microscopy, cecum tissue specimens from
the same quails were washed, fixed in 2.5% glutaralde-
hyde, dehydrated, embedded, stained, and observed un-
der a transmission electron microscope.
Determination of Antioxidant Enzyme
Activities
Quail cecums were homogenized on ice in physio-
logical saline and centrifuged at 750 × g and the su-
pernatants were collected. Here, we detected metabolic
enzymes such as GSH-Px, GSH, NO, and iNOS as an
index of oxidative damage. Commercial assay kits for
all the antioxidant indexes were provided by Jiancheng
Biotechnology Research Institute (Nanjing, China) and
the assays were performed according to the manufac-
turer’s instructions.
Quantitative real-time PCR (qPCR)
The methods for total RNA extraction and real-time
quantitative reverse-transcription PCR were the same
as those used in our previous study (Fu et al., 2013b).
The primer sequences are shown in Table 2.
Diversity Analysis of the Intestinal
Microbiota
Extracting Total Bacterial DNA The bacterial ge-
nomic DNA was extracted using Qiagen DNA extrac-
tion kit (Qiagen, Hilden, Germany) as per the manu-
facturer’s protocol. The total DNA concentration was
measured with a nucleic acid quantification system and
was stored at −20◦ C.
 EFFECTS OF COLD STRESS ON QUAILS
Figure 1. Histopathological lesions in cecum of quails exposed to acute cold stress (A and C) and chronic cold stress (B and D), stained with
hematoxylin and eosin (HE).
PCR-DGGE Assay Primers V3–3 (5 -CGCCCGC
CGCGCGCGGCGGGCGGGGCGGGGGCACGGGG
GGCCTACGGGAGGCAGCAG-3 ) and V3-2 (5 -
ATTACCGCGGCTGCTGG-3 ) were used to amplify
the V3 region of 16S rDNA (Liao et al., 2015). The
PCRamplification was performed in a 25-μL reaction
system containing 1 μL of DNA template (50 ng), 1 μL
(25 pmol) of each primer, 2.5 μL of 10 × PCR buffer,
2 μL of dNTPs, 1.5 μL of Taq DNA polymerase, and
15 μL of ddH2 O. The PCR program was performed
following the protocol of Xie et al. (Yong-Zhu and Cui,
2011). The PCR-DGGE profile was generated using
the Dcode System from Bio-Rad (Shanghai Invitrogen
Biotechnology Co., Ltd., China). The electrophoresis
was performed using 40 to 55% denaturing gradient
with 100% corresponding to 6 M urea and 40%
formamide on 8% polyacrylamide gel; the gel was run
at 80 volts for 1 h, followed by 200 volts for 5 min and
then 60 volts for 11 h at 60◦ C. After the PCR-DGGE
step, a dendrogram was constructed for clustering of
the PCR-DGGE profile according to the method used
in a previous study (Ruengsomwong et al., 2014). To
identify the bacterial species, the bands of interest were
cut and eluted in sterile pure water. Each eluted band
was then reamplified with V3-3-GC and V3-2 primers
and run on the DGGE system at a suitable gradient
concentration to check the purity of the cut band.
Following the purity check, each band was reamplified
without a GC clamp and was then purified using a
QIAquick PCR Purification kit (Shanghai Invitrogen
Biotechnology Co., Ltd., China). The purified PCR
products were analyzed by direct sequencing analysis
performed by Huada Biotechnology Company (Beijing,
China).
5435
Statistical Analysis
In Statistical analysis, acute stress was analyzed
among 6 periods of time and chronic stress was
analyzed comparing stressed against their correspond-
ing control.
For the PCR-DGGE assay, the similarities between
the PCR-DGGE profiles were analyzed based on the
locations of DNA bands on PCR-DGGE gel using
SYNGENE Gene Tools ver. 4.03 (b) and SYNGENE
Gene Directory Application ver. 2.01(c) from SYN-
GENE INTL. LTD (Bengaluru, India), a division
of Synoptic Ltd., Dice similarity coefficient and un-
weighted pair group method with arithmetic mean
(UPGMA). In addition, the obtained sequences were
subjected to BLAST search of GenBank database
(http://www.ncbi.nlm.nih.gov).
The statistical analysis of OS and gene expression
data were performed using SPSS for Windows (SPSS,
Chicago, IL) and was completed similarly to analyses
in our previous study (Fu et al., 2013b).
RESULTS
Pathological Observations
The results from histopathological observation under
light microscopy showed that cecal histology manifes-
tation structures of quails in control groups (cold stress
for 0 h, A; without cold stress, B) (×100) were clear
and intact, and no obvious histopathological changes
were observed in mucosa, lamina propria, submucosa,
and muscular layers. By contrast, obvious histopatho-
logical changes in cecum of quails in the group exposed
5436
Figure 2. Histopathological effects of cold stress as observed by electron microscopy. Acute cold stress (A and C) and chronic cold stress (B
and D). The arrows show the morphological changes after cold exposure.
to acute (C, × 400) and chronic cold stress were ob-
served (D, × 400). For the group of acute cold stress,
the cecal mucosal epithelial cells displayed vacuolar
degeneration (→), even diffused necrosis (←), and the
muscular fibers in muscular layers fused and homog-
enized (↑) (C, × 400). For the group of chronic cold
stress, the histopathology changes in mucosal layer was
obvious, the intestinal villi became shrunk (↓), and the
arrangement of damaged villi were disordered (#) (D,
× 400) (Figure 1).
The results from histopathological observation un-
der electron microscopy showed that the cecal histol-
ogy manifestation structures of quails in control groups
(cold stress for 0 h, A; without cold stress, B) (× 10,000)
were observed that the subcellular organelles appeared
to be regular and dense in the cecum of control birds. In
the control group, we saw that epithelial cell nuclei were
clear and ovoid in shape, mitochondrial cristae were ar-
ranged regularly, and inner and outer membranes were
clearly visible. In contrast, in acute cold stress groups,
the nuclei of the cecum appeared karyorrhexis (C, ×
10,000), while the cecum from the chronic cold stress
birds showed that the mitochondria were damaged and
some nuclei were deformed (D, × 10,000). The arrows
show the morphological changes after cold exposure.
Changes in the Antioxidant Enzyme Activity
The effects of acute cold stress on GSH and GSH-
Px activity in the cecum are presented in Figures 3A
LIU ET AL.
and 3B. The results showed that there was decrease
in GSH levels, while GSH-Px levels fluctuated; there
was an increase from 0.5 to 6 h followed by a de-
crease to 12 h. The effects of chronic cold stress on
the GSH and GSH-Px activity levels in the cecum are
presented in Figures 3C and 3D. The results showed
that activity of both GSH and GSH-Px was signif-
icantly lowered (p < 0.05) after 5, 10, and 15 D
in the chronically stressed quails than in the control
quails.
Changes in the NO Content and iNOS
Activity
The effects of acute cold stress on NO content and
iNOS activity in cecum are presented in Figures 4A and
4B. The results showed that NO content fluctuated; it
originally increased, then decreased at 3 h and later in-
creased again. The iNOS activity showed an increasing
tendency and there was significant increase (p < 0.05)
in iNOS activity in quails exposed to cold stress after
12 h as compared to the control quails. The effects of
chronic cold stress on NO content and iNOS activity in
cecum are presented in Figures 4C and 4D. The results
showed that NO content and iNOS activity were signif-
icantly higher (p < 0.05) after 5, 10, and 15 D in the
chronically stressed quails than in the control quails.
 EFFECTS OF COLD STRESS ON QUAILS 5437

Figure 3. Effects of cold stress on glutathione (GSH) activity and glutathione peroxidase (GSH-Px) levels in the cecum. (A) The effect of
acute cold stress on GSH activity. (B) The effect of acute cold stress on GSH-Px levels. (C) The effect of chronic cold stress on GSH activity.
(D) The effect of chronic cold stress on GSH-Px levels. The different letters in panels A and B and the ∗ in panels C and D indicate that there
were significant differences (p < 0.05) between any 2 groups. Each value represents the mean ± SD for 5 individual birds.

Figure 4. Effects of cold stress on NO content and iNOS activity in the cecum. (A) The effect of acute cold stress on NO content. (B) The
effect of acute cold stress on iNOS activity. (C) The effect of chronic cold stress on NO content. (D) The effect of chronic cold stress on iNOS
activity. The different letters in panels A and B and the ∗ in panels C and D indicate that there were significant differences (p < 0.05) between
any 2 groups. Each value represents the mean ± SD for 5 individual birds.
5438 LIU ET AL.

Figure 5. Effects of cold stress on COX-2, tumor necrosis factor-alpha (TNF-α ), and heat shock protein (Hsp70) mRNA expression in the
cecum. (A) The effect of acute cold stress on COX-2 expression. (B) The effect of acute cold stress on TNF-α expression. (C) The effect of
acute cold stress on Hsp70 expression. (D) The effect of chronic cold stress on COX-2 expression. (E) The effect of chronic cold stress on TNF-α
expression. (F) The effect of chronic cold stress on Hsp70 expression. The different letters in panels A, B and C and the ∗ in panels D, E, and F
indicate that there were significant differences (p < 0.05) between any 2 groups. Each value represents the mean ± SD of 5 individual birds.

Change in the mRNA Expression Levels of and Hsp70 displayed trends similar to those shown by
COX-2, TNF-α, and HSP70 Genes COX-2.

The effects of acute cold stress on COX-2, TNF-α,

and HSP70 mRNA expression in cecum are presented
in Figures 5A−5C. The results showed that COX-2,
TNF-α, and HSP70 mRNA expressions were higher in
the group exposed to cold stress than in the group not
exposed to cold stress. The effects of chronic cold stress
on COX-2, TNF-α, and HSP70 mRNA expressions in
the cecum are presented in Figures 5C−5E. The re-
sults showed that there was a significant increase in
COX-2 mRNA expression (p < 0.05) after 5, 10, and
15 D in chronically stressed quails when compared with
the control quails. The mRNA expression of TNF-α
Diversity Analysis of the Intestinal
Microbiota
Influence of Acute Cold Stress on Microbial
Populations in the Quail Cecum There were 14 clear
bands in the cecal content from acute cold-stressed
quails (Figure 6). All of these bands were used in se-
quence analysis. From the DGGE schematic, using the
group exposed to 30 min of acute cold stress as the con-
trol group, it is seen that profiles of groups exposed to
cold stress for 0 h, 1 h, 3 h, 6 h, and 12 h displayed
 EFFECTS OF COLD STRESS ON QUAILS 5439

Figure 6. PCR-(DGGE) DNA profiles of the 16S rDNA V3 region from the cecal microbiota of acutely cold-stressed quails. (A) Bands in the
DGGE gel showing the DNA amplified from the bacterial content. (B) Bands corresponding to the pattern numbers, where abscissa 1 refers to
the cold stress exposure of 0 h and abscissas 2, 3, 4, 5, and 6 refer to the cold stress exposures of 30 min, 1 h, 3 h, 6 h, and 12 h, respectively, in
Figure 6A.

Table 3. Diversity index of the cecal microbiota of quails exposed to acute and chronic cold
stress.

Group Cold stress time

Acute Lane 0h 30 min 1h 3h 6h 12 h
0h 100.0
30 min 64.8 100.0
1h 69.9 58.3 100.0
3h 25.1 27.0 17.7 100.0
6h 68.3 58.5 68.7 34.6 100.0
12 h 67.6 62.0 75.9 17.5 72.4 100.0
Chronic Lane 5d 5k 10 d 10 k 20 d 20 k
5d 100.0
5k 12.8 100.0
10 d 21.3 71.2 100.0
10 k 0.0 48.5 59.9 100.0
20 d 17.1 24.5 8.1 15.9 100.0
20 k 20.5 51.9 53.6 64.5 26.9 100.0

64.8%, 58.3%, 27.0%, 58.5%, and 62.0% similarity, re-
spectively, with the profile of the control group. This
result indicated that the bacterial species in the cecum
of quails exposed to cold stress for either 0 h or 30 min
have a high degree of similarity (89.9%). Table 3 (acute
group) shows that there is a higher similarity (75.9%)
between the cecal microbiota of quails exposed to acute
cold stress for 1 h or 12 h than there is between the ce-
cal microbiota of quails exposed to these durations of
acute cold stress and the control quails. The similar-
ity between the cecal microbiota of cold-stressed quails
after 6 h and 12 h is 72.4%.
Influence of Chronic Cold Stress on Microbial
Populations in the Quail Cecum There are 15 clear
bands in the cecal content from acutely cold-stressed
quails (Figure 7). All of these bands were used in se-
quence analysis. From the DGGE schematic, using the
group exposed to chronic cold stress for 5 D as the con-
trol group, it is seen that profiles of 5 k, 10 D, 10 k,
20 D and 20 k groups displayed 12.8%, 21.3%, 0.0%,
17.1%, and 20.5% similarity, respectively, with the pro-
file of the control group. This result indicated that the
bacterial species in the cecum of quails exposed to cold
stress for either 5 D or 10 D have a high degree of sim-
ilarity. Table 3 (chronic group) shows that there is a
higher similarity (71.2%) between the cecal microbiota
of chronically cold-stressed quails in 5 k or 10 D groups
than there is between cecal microbiota of quails in other
5440 LIU ET AL.

Figure 7. PCR-(DGGE) DNA profiles of the 16S rDNA V3 region from the cecal microbiota of chronically cold-stressed quails. (A) Bands
in the DGGE gel showing the DNA amplified from the bacterial content. (B) Bands corresponding to the pattern numbers, where abscissas 1, 3,
and 5 refer to the 5 d, 10 d, and 20 d chronic cold stress groups, respectively, and abscissas 2, 4, and 6 refer to the 5 k, 10 k and 20 k chronic
cold stress groups, respectively. d, control group; k, cold stress group.

groups. The similarity between the cecal microbiota of
cold-stressed quails in 10 k and 20 k groups is 64.5%.
Cloning, Sequencing and Identification of
Advantageous Microbiota Under Cold
Stress Conditions
Compared to that in the group of quail exposed to
acute cold stress conditions, the normal microbiota in
the quail cecum is simpler and more stable in the con-
trol group. After 30 min of cold stress, normal flora
gradually disappeared and new flora emerged. After 1
h of cold stress, original flora present at the 0 h time
point was recovered. After 3 h of cold stress, new flora
emerged including Sinorhizobium sp. and Ochrobac-
trum sp. (determined by sequencing), both of which
belong to class α-Proteobacteria. After 6 h of cold
stress, complement of bacteria present looked similar
to that present at 3 h and after 12 h of cold stress,
intestinal flora gradually returned to population found
in the control group, however, new bacteria also ap-
peared. This result indicated that acute cold stress did
not significantly affect the quail cecal microbial flora.
Analysis of intestinal microbiota composition showed
that there were 8 types of bacteria, majority of dom-
inant bacterial community comprised of Pseudomonas,
Clostridiaceae, Weissella, Lactobacillus casei, an un-
cultured bacterium clone, Enterococcus, Streptomyces,
Bifidobacterium, and an uncultured Lachnospiraceae
bacterium (Table 4 and Figure 6). The advantageous
quail cecal microbiota present after acute cold stress
was similar. There were 2 main groups; M1, M4, M9,
M10, M3, M6, and M8 comprised 1 group; M14, M13,
M12, M2, M5, M11, and M7 comprised the other group
(Figure 8, acute cold stress).
The cecal microbiota in the control group was sim-
ple. However, after 5 D of cold stress, complexity of
cecal microbiota increased gradually and was unsta-
ble, while that of the control group remained same.
After 10 D of cold stress, cecal microbiota was sim-
ple in the control group but increased gradually and
was unstable in the stressed group. The fluctuating
microbiota possibly indicated that the quails were un-
accustomed to cold environment. After 20 D of cold
stress, cecal microbiota remained simple in the con-
trol group, while in the stressed group cecal micro-
biota diversity increased gradually and new bacteria
appeared. This result indicated that chronic cold stress
significantly affected the quail cecal microbial flora
(Table 5 and Figure 7). Analysis of intestinal micro-
biota composition showed that majority of dominant
bacterial community comprised of uncultured Lach-
nospiraceae bacterium and uncultured bacterium clone,
Brevibacterium, Microbacterium, Weissella, Bacillus,
an uncultured soil bacterium, and Bifidobacterium. The
 EFFECTS OF COLD STRESS ON QUAILS 5441
Table 4. Intestinal 16S rDNA sequence similarity comparison results for the bowel segment containing the appendix in quail exposed
to acute cold stress.

Lane Accession number Source of the most similar GenBank sequence Similarity (%)

M1 JN637314 Pseudomonas sp. 99

M2 JN173113 Uncultured Lachnospiraceae bacterium, uncultured Clostridia bacterium 99
M3 HM359077 Uncultured Weissella sp. 100
M4 HQ417030 Sinorhizobium sp., Ochrobactrum sp. Pseudochrobactrum sp. 100
M5 JN560900 Enterococcus sp. 98
M6 JN560892 Lactobacillus casei, Enterococcus sp. 100
M7 FJ835153 Uncultured bacterium clone 100
M8 JN560892 Lactobacillus casei, Enterococcus sp. 100
M9 FJ440082 Uncultured Firmicutes bacterium, uncultured Clostridiales bacterium 100
M10 FJ835153 Uncultured bacterium clone 100
M11 HM124318 Uncultured bacterium clone 100
M12 JF703641 Uncultured Streptophyta clone 99
M13 HM359077 Uncultured Weissella sp. 100
M14 JF519651 Bifidobacterium sp. 100

advantageous quail cecal microbiota present after
chronic cold stress was extremely similar. There were
2 main groups: M4, M11, M9, M15, M5, M6, M7, and
M13 comprised 1 group, M8, M2, M1, M12, M3, and
M14 comprised the other group (Figure 8, chronic cold
stress).
DISCUSSION
Cold stress alters physiological responses associated
with oxygen consumption and causes changes in sub-
sequent production of reactive oxygen species (ROS)
(Sun et al., 2016). The increased production of ROS
can damage cellular structures and macromolecules, in
the form of protein carbonylation, lipid peroxidation
(LPO) and DNA oxidation. The human body has a
defensive system to overcome the excessive production
of ROS by increasing the activity of ROS-scavenging
enzymes (Chen et al., 2015). Glutathione is an antioxi-
dant and prevents harm to main cellular components
caused by ROS such as free radicals and peroxides.
GSH-Px is considered an “emergency enzyme”, as it
is the first line of cellular defense which prevents oxida-
tive damage (Ferreccio et al., 1998). Previous studies
reported that exposure to acute and chronic cold caused
oxidative damage in the chicken intestine (Zhang et al.,
2011) and immune organs (Zhao et al., 2014). Addi-
tionally, in our previous study we found that acute and
chronic cold exposure caused oxidative damage in the
quail duodenum, jejunum, and ileum (Fu et al., 2013b).
In the present study, activity of both GSH and GSH-Px
were significantly decreased in the quail cecum, indi-
cating inability to scavenge free radicals and hence, im-
paired antioxidant potential. This finding revealed the
presence of OS in the cecum of quails exposed to low
temperatures. Meanwhile, cecal tissues exposed to cold
stress showed mucosal layer lesions, intestinal villi rup-
ture, and inflammatory cell infiltration that led to mor-
phological damage. As it is well-known, OS can cause
damage to structure and function of biomolecules via
inactivating the antioxidant defense system. Thus, it is
not surprising that our current study findings showed
that cold stress induced oxidative damage in the quail
cecum (Figures 1 and 2) and the morphological damage
in chronic stress is more serious than it in acute cold
stress.
The excessive production of NO gives rise to several
pathological conditions (Walker and Drummond, 2011).
A study by Lee and his group (Lee et al., 2002) re-
ported that immersion of rats in cold water adversely
affected NO content. In another study by Teshfam and
his team (Teshfam et al., 2006) reported that eNOS
and iNOS gene expression was significantly increased
in broiler chicken lungs on exposure to cold. Addition-
ally, a study by Zhang and his team (Zhang et al., 2011)
revealed that the activity of NO in the duodenum fluc-
tuated when induced by cold stress. This variation in
result may be due to numerous factors for example,
extent of cold exposure, exposure temperature, and ge-
netic background of the experimental animal. Similar
to studies described above, our study showed that cold
stress caused an increase in iNOS and NO levels in the
quail cecum. These results indicated that the antioxi-
dant defense system was damaged in vivo under cold
stress conditions, causing excessive production of ROS,
followed by release of a large number of inflammatory
mediators. Moreover, excessive production of NO stim-
ulated an increase in iNOS activity.
To further study the extent of tissue damage and de-
fense mechanisms such as inflammatory reactions in-
duced by cold stress, mRNA expression levels of TNF-α
and COX-2 were examined by qPCR. COX-2 inhibitors
decreased mucosal destruction, thus further indicating
the contribution of prostaglandins in tissue damage and
inflammatory responses (Zheng et al., 2012). Prolonged
and persistent ROS can limit the production of im-
mune system compounds. In addition, immune func-
tions are impaired upon exposure to inflammatory stim-
uli (e.g., LPS) (Su et al., 2018). TNF-α, a potent pro-
inflammatory cytokine and a master regulator of im-
mune system is thought to be produced primarily by
macrophages. Mast cells are also prime source of pre-
formed TNF-α. An increase in TNF-α level will cause
main signs and symptoms of inflammation to occur.
In the present study, it was found that COX-2 and
5442
Figure 8. Phylogenetic tree of the cecal microbial flora from cold-stressed quails.
TNF-α mRNA levels were significantly increased in the
cecal tissue (p < 0.05) in the stressed groups, suggest-
ing that these molecules may contribute in inducing
inflammation on exposure to cold stress. In this exper-
imental study, cold stress increased the expression lev-
els of inflammation-related genes in quails. These genes
exerted pathophysiological effects on the cecum by me-
diating inflammation and tissue injury. Heat shock
proteins are a group of stress proteins induced in a
living cell in response to rise in temperature above the
normal level (Lee et al., 1991) and are also produced
within the cell on exposing to oxidative stresses (Liao
et al., 1994). Among the HSP family members, Hsp70
has been most widely studied because of its promis-
ing protective potential against various forms of stress,
the increased production of these inducible proteins in
stressed cells and organisms play a central role in cellu-
LIU ET AL.
lar homeostasis (Gabriel et al., 2002). Zhao et al. (2013)
reported that the expression of Hsp70 was increased un-
der heat stress in chicken hearts, which suggested that
Hsp70 has a protective role in cells (Zhao et al., 2013).
Yu et al. (2008) found that the chickens exposed to
high temperature stress, the gene for Hsp70 had a high
expression level in the hearts (Yu et al., 2008). In the
present experimental study, we noticed that the Hsp70
mRNA levels were significantly increased in the cecal
tissue (p < 0.05) of birds in the stress groups, this find-
ing is consistent with those of previous studies indicat-
ing that an increase in Hsp70 is linked to the protection
of key proteins from stress sensitivity.
Maintaining the normal intestinal structure and func-
tion is essential to prevent bacterial translocation
from the intestinal tract (Evans et al., 1992). Stresses
have severe effects on overall physiology, productivity,
 EFFECTS OF COLD STRESS ON QUAILS 5443
Table 5. Intestinal 16S rDNA sequence similarity comparison results for the bowel segment containing the
appendix in quail exposed to chronic cold stress.

Accession
Lane number Source of the most similar GenBank sequence Similarity (%)

M1 AB262681 Bifidobacterium sp. 100

M2 EU459661 Uncultured bacterium clone 100
M3 JN082691 Uncultured Corynebacterium sp. 100
M4 EF703130 Uncultured Lachnospiraceae bacterium 100
M5 JF820124 Rhizobium sp., Mesorhizobium sp., Microbacterium sp. 99
Nanobacterium sp.
M6 HM359077 Uncultured Weissella sp. 100
M7 N635497 Bacillus sp. 99
M8 EF706627 Uncultured Lachnospiraceae bacterium 100
M9 JF905606 Brevibacterium sp. 100
M10 AB254309 Uncultured bacterium clone, uncultured soil bacterium Uncultured 90
Bacillus sp., uncultured Clostridium sp., uncultured Acinetobacter sp.,
uncultured Lactobacillus sp., uncultured Firmicutes bacterium,
uncultured Clostridiaceae, uncultured actinobacterium
M11 CR933232 Uncultured bacterium clone 98
M12 JF519651 Bifidobacterium sp. 100
M13 FR682866 Uncultured soil bacterium, uncultured Chloroflexi bacterium, uncultured 97
Cohnella sp., uncultured Bacillus sp., uncultured Acinetobacter sp.
M14 CR933232 Uncultured bacterium clone 98
M15 JF519651 Bifidobacterium sp., uncultured bacterium clone 97

health, and well-being of animals. Gastrointestinal tract
is mostly sensitive to stressors, which causes various
changes such as, altering beneficial microbiota and de-
creasing intestinal integrity. The microbiota play a key
role in the intestinal defense system, as the gut mucosa
is the first line of defense against bacteria (Kim et al.,
2011; Lee et al., 2010; Lemonakis et al., 2017). There-
fore, a change in cecal microbiota is a notable marker
of intestinal nonspecific immune response. The cecum
had a high density of bacteria of numerous types (Byrd
et al., 2017). Previous studies conducted using culturing
of bacteria from the cecum revealed that this intestinal
part harbored a complex microbiota (Duggett et al.,
2016). Environmental stressors tend to affect the nutri-
ent requirements, suppress the immunity and produc-
tivity of animals by decreasing food intake, thereby re-
ducing heat production produced during digestion and
absorption of nutrients. This will also alter the GI mi-
crobiota by favoring the multiplication of certain anaer-
obic species (Moro et al., 1998). Our model showing the
induction of massive gut microbial changes and dysbac-
teriosis by cold stress is similar to that suggested in the
previous literature (Zhang et al., 2017). As we know,
abnormal microbial composition or microbial dysbiosis
has been implicated in numerous autoimmune diseases
and in intestinal inflammation (Laffin et al., 2017).
This study indicated that changing habitat factors (cold
stress) lead to altered microbiome compositions, which
could in turn fuel inflammation.
It is well-known that Hsp70 provides protection
against free radical toxicity. Due to its prominent re-
sponse to diverse stressors and increased synthesis of
inducible proteins, it is involved in the protection of
stressed cells and organisms. Thus, several studies have
attempted to discuss the role of Hsp70 in the pro-
cess of OS and inflammatory response. In Hernandez’s
study, the increased Hsp70 has been shown to pro-
tect skeletal cells against OS (Hernandez-Santana et al.,
2014). The study of Bianchi suggested that OS was en-
tirely responsible for the increased expression of Hsp70
and the increased expression of Hsp70 was partly re-
sponsible for some of the inflammatory mechanisms,
such as the NF-κB pathway and COX-2 expression
(Bianchi et al., 2014). In the study of Inflammatory
Bowel Diseases (IBD), it was found that overexpression
of Hsp70 could inhibit the inflammatory response in
large intestinal mucosa (Samborski and Grzymislawski,
2015). In summary, Hsp70 is a key factor in regulating
OS and inflammation.
In our present study, it suggests that antioxidant
defense system could be damaged in the quail ce-
cum by both acute and chronic cold stress. The in-
crease in mRNA expression of pro-inflammatory fac-
tors and change in the intestinal microbiota further
suggests that cold stress damaged the quail cecal tis-
sue. The increased Hsp70 mRNA expression levels ex-
plored that Hsp70 may have the potential to pro-
tect quail cecal tissues from cold stress. However, to
date, the particular cold stress-activated induction and
regulation mechanisms of different Hsps and intesti-
nal microbiota are unclear and needs to be further
studied.
ACKNOWLEDGMENTS
This work was supported by the Creative Talents in
Heilongjiang Province (UNPYSCT-2016002).
REFERENCES
Bianchi, A., D. Moulin, S. Hupont, M. Koufany, P. Netter, P. Reboul,
and J. Y. Jouzeau. 2014. Oxidative stress-induced expression of
5444
HSP70 contributes to the inhibitory effect of 15d-PGJ2 on in-
ducible prostaglandin pathway in chondrocytes. Free Radic. Biol.
Med. 76:114–126.
Byrd, J. A., D. Y. Caldwell, and D. J. Nisbet. 2017. The identifica-
tion of fungi collected from the ceca of commercial poultry. Poult.
Sci. 96:2360–2365.
Chen, X. Y., R. Li, and Z. Y. Geng. 2015. Cold stress initiates
the Nrf2/UGT1A1/L-FABP signaling pathway in chickens. Poult.
Sci. 94:2597–2603.
Dhanalakshmi, S., R. S. Devi, R. Srikumar, S. Manikandan, and
R. Thangaraj. 2007. Protective effect of Triphala on cold stress-
induced behavioral and biochemical abnormalities in rats. Yaku-
gaku Zasshi 127:1863–1867.
Di Lorenzo, M., and A. Krantis. 2001. Altered nitric oxide produc-
tion in the premature gut may increase susceptibility to intestinal
damage in necrotizing enterocolitis. J. Pediatr. Surg. 36:700–705.
Duggett, N. A., G. L. Kay, M. J. Sergeant, M. Bedford, C. I.
Constantinidou, C. W. Penn, A. D. Millard, and M. J. Pallen.
2016. Draft genome sequences of six novel bacterial isolates from
chicken ceca. Genome Announc. 4:e00448–16.
Evans, G. S., N. Flint, A. S. Somers, B. Eyden, and C. S. Potten.
1992. The development of a method for the preparation of rat
intestinal epithelial cell primary cultures. J. Cell Sci. 101:219–
231.
Ferreccio, C., C. Gonzalez Psych, V. Milosavjlevic Stat, G. Marshall
Gredis, and A. M. Sancha. 1998. Lung cancer and arsenic expo-
sure in drinking water: a case-control study in northern Chile.
Cadernos de Saude Publica 14:S193–S198.
Fu, J., C. P. Liu, Z. W. Zhang, W. Liao, and S. W. Xu. 2013a. Effects
of acute and chronic cold stress on expression of cyclooxygenase-2
and prostaglandin E synthase mRNA in quail intestine. Pak. Vet.
J. 33:358–363.
Fu, J., C. P. Liu, Z. W. Zhang, M. W. Xing, and S. W. Xu. 2013.
Influence of inflammatory pathway markers on oxidative stress
induced by cold stress in intestine of quails. Res. Vet. Sci. 95:495–
501.
Gabriel, J. E., A. F. da Mota, I. C. Boleli, M. Macari, and L.
L. Coutinho. 2002. Effect of moderate and severe heat stress
on avian embryonic hsp70 gene expression. Growth Dev. Aging
66:27–33.
Gong, J., R. J. Forster, H. Yu, J. R. Chambers, R. Wheatcroft, P.
M. Sabour, and S. Chen. 2002. Molecular analysis of bacterial
populations in the ileum of broiler chickens and comparison with
bacteria in the cecum. FEMS Microbiol. Ecol. 41:171–179.
Gong, J., W. Si, R. J. Forster, R. Huang, H. Yu, Y. Yin, C. Yang,
and Y. Han. 2007. 16S rRNA gene-based analysis of mucosa-
associated bacterial community and phylogeny in the chicken gas-
trointestinal tracts: from crops to ceca. FEMS Microbiol. Ecol.
59:147–157.
Hernandez-Santana, A., V. Perez-Lopez, J. M. Zubeldia, and M.
Jimenez-del-Rio. 2014. A Rhodiola rosea root extract protects
skeletal muscle cells against chemically induced oxidative stress
by modulating heat shock protein 70 (HSP70) expression. Phy-
tother. Res. 28:623–628.
Hirata, Y., A. H. Broquet, L. Menchen, and M. F. Kagnoff. 2007.
Activation of innate immune defense mechanisms by signaling
through RIG-I/IPS-1 in intestinal epithelial cells. J. Immunol.
179:5425–5432.
Kaushik, S., and J. Kaur. 2005. Effect of chronic cold stress on
intestinal epithelial cell proliferation and inflammation in rats.
Stress 8:191–197.
Kim, G. B., Y. M. Seo, C. H. Kim, and I. K. Paik. 2011. Effect of
dietary prebiotic supplementation on the performance, intestinal
microflora, and immune response of broilers. Poult. Sci. 90:75–82.
Laffin, M., T. Perry, H. Park, N. Hotte, R. N. Fedorak, A. Thiesen,
B. Dicken, and K. L. Madsen. 2018. Prebiotic supplementation
following ileocecal resection in a murine model is associated with
a loss of microbial diversity and increased inflammation. Inflamm.
Bowel Dis. 24:101–110.
Lan, P. T., M. Sakamoto, and Y. Benno. 2004. Effects of two pro-
biotic Lactobacillus strains on jejunal and cecal microbiota of
broiler chicken under acute heat stress condition as revealed
by molecular analysis of 16S rRNA genes. Microbiol. Immunol.
48:917–929.
LIU ET AL.
Lee, K. S., B. V. Lim, M. H. Jang, M. C. Shin, T. H. Lee, Y. P. Kim,
H. S. Shin, S. Y. Cho, H. Kim, M. S. Shin, E. H. Kim, and C.
J. Kim. 2002. Hypothermia inhibits cell proliferation and nitric
oxide synthase expression in rats. Neurosci. Lett. 329:53–56.
Lee, K. W., S. H. Lee, H. S. Lillehoj, G. X. Li, S. I. Jang, U. S.
Babu, M. S. Park, D. K. Kim, E. P. Lillehoj, A. P. Neumann,
T. G. Rehberger, and G. R. Siragusa. 2010. Effects of direct-
fed microbials on growth performance, gut morphometry, and
immune characteristics in broiler chickens. Poult. Sci. 89:203–216.
Lee, Y. J., L. Curetty, and P. M. Corry. 1991. Differences in prefer-
ential synthesis and redistribution of HSP70 and HSP28 families
by heat or sodium arsenite in Chinese hamster ovary cells. J. Cell.
Physiol. 149:77–87.
Lemonakis, L., K. Li, J. M. Adler, and C. Shen. 2017. Microbiolog-
ical quality assessment and validation of antimicrobials against
unstressed or cold-stress adapted Salmonella and surrogate En-
terococcus faecium on broiler carcasses and wings. Poult. Sci.
96:4038–4045.
Liao, C., Z. Y. Peng, J. B. Li, X. W. Cui, Z. H. Zhang, P. K.
Malakar, W. J. Zhang, Y. J. Pan, and Y. Zhao. 2015. Simul-
taneous construction of PCR-DGGE-based predictive models of
Listeria monocytogenes and Vibrio parahaemolyticus on cooked
shrimps. Lett. Appl. Microbiol. 60:210–216.
Liao, F., A. Andalibi, J. H. Qiao, H. Allayee, A. M. Fogelman, and A.
J. Lusis. 1994. Genetic evidence for a common pathway mediating
oxidative stress, inflammatory gene induction, and aortic fatty
streak formation in mice. J. Clin. Invest. 94:877–884.
Liu, Z., X. Sun, J. Tang, Y. Tang, H. Tong, Q. Wen, Y. Liu, and L.
Su. 2011. Intestinal inflammation and tissue injury in response
to heat stress and cooling treatment in mice. Mol. Med. Rep.
4:437–443.
Lugo, B., H. R. Ford, and A. Grishin. 2007. Molecular signaling in
necrotizing enterocolitis: regulation of intestinal COX-2 expres-
sion. J. Pediatr. Surg. 42:1165–1171.
Melo, A. N. F., G. T. Souza, D. Schaffner, T. C. M. Oliveira, J. F.
Maciel, E. L. Souza, and M. Magnani. 2017. Changes in thermo-
tolerance and survival under simulated gastrointestinal conditions
of Salmonella Enteritidis PT4 and Salmonella Typhimurium PT4
in chicken breast meat after exposure to sequential stresses. Int.
J. Food Microbiol. 251:15–23.
Moro, M. H., G. W. Beran, L. J. Hoffman, and R. W. Griffith.
1998. Effects of cold stress on the antimicrobial drug resistance
of Escherichia coli of the intestinal flora of swine. Lett. Appl.
Microbiol. 27:251–254.
Morris, D. M., J. J. Pilcher, and R. B. Powell. 2017. Task-dependent
cold stress during expeditions in Antarctic environments. Int. J.
Circumpolar Health 76:1379306.
National Research Council (NRC). 1994. Nutrient Requirements of
Poultry. 9th rev. ed. National Academy Press, Washington, DC.
Raabe, T., M. Bukrinsky, and R. A. Currie. 1998. Relative contri-
bution of transcription and translation to the induction of tu-
mor necrosis factor-alpha by lipopolysaccharide. J. Biol. Chem.
273:974–980.
Ren, J., C. Liu, D. Zhao, and J. Fu. 2018. The role of heat shock
protein 70 in oxidant stress and inflammatory injury in quail
spleen induced by cold stress. Environ. Sci. Pollut. Res. 25:21011–
21023.
Rodeberg, D. A., M. S. Chaet, R. C. Bass, M. S. Arkovitz, and V. F.
Garcia. 1995. Nitric oxide: An overview. Am. J. Surg. 170:292–
303.
Ruengsomwong, S., Y. Korenori, N. Sakamoto, B. Wannissorn, J.
Nakayama, and S. Nitisinprasert. 2014. Senior Thai fecal micro-
biota comparison between vegetarians and non-vegetarians us-
ing PCR-DGGE and real-time PCR. J. Microbiol. Biotechnol.
24:1026–1033.
Samborski, P., and M. Grzymislawski. 2015. The role of HSP70 heat
shock proteins in the pathogenesis and treatment of inflammatory
bowel diseases. Adv. Clin. Exp. Med. 24:525–530.
Su, Y., X. Zhang, H. Xin, S. Li, J. Li, R. Zhang, X. Li, J. Li, and J.
Bao. 2018. Effects of prior cold stimulation on inflammatory and
immune regulation in ileum of cold-stressed broilers. Poult. Sci.
97:4228–4237.
Sun, W., Z. Wang, J. Cao, H. Cui, and Z. Ma. 2016. Cold
stress increases reactive oxygen species formation via TRPA1
 EFFECTS OF COLD STRESS ON QUAILS
activation in A549 cells. Cell Stress Chaperones 21:367–
372.
Teshfam, M., G. N. Brujeni, and H. Hassanpour. 2006. Evaluation of
endothelial and inducible nitric oxide synthase mRNA expression
in the lung of broiler chickens with developmental pulmonary
hypertension due to cold stress. Br. Poult. Sci. 47:223–229.
van den Brand, H., R. Molenaar, I. van der Star, and R. Meijerhof.
2010. Early feeding affects resistance against cold exposure in
young broiler chickens. Poult. Sci. 89:716–720.
Walker, S., and P. D. Drummond. 2011. Implications of a local over-
production of tumor necrosis factor-alpha in complex regional
pain syndrome. Pain. Med. 12:1784–1807.
Wang, Y., H. Zhao, Y. Shao, J. Liu, J. Li, L. Luo, and M. Xing.
2018. Copper (II) and/or arsenite-induced oxidative stress cas-
cades apoptosis and autophagy in the skeletal muscles of chicken.
Chemosphere 206:597–605.
Yong-Zhu, L. I., and Y. Cui. 2011. Analysis of chicken cecal microbial
flora the structure growth and development of PCR-DGGE. J.
China Agric. Univ. 16:118–126.
Yu, J., E. Bao, J. Yan, and L. Lei. 2008. Expression and localization
of Hsps in the heart and blood vessel of heat-stressed broilers.
Cell Stress Chaperones 13:327–335.
5445
Zhang, C., X. H. Zhao, L. Yang, X. Y. Chen, R. S. Jiang, S. H. Jin,
and Z. Y. Geng. 2017. Resveratrol alleviates heat stress-induced
impairment of intestinal morphology, microflora, and barrier in-
tegrity in broilers. Poult. Sci. 96:4325–4332.
Zhang, Z. W., Z. H. Lv, J. L. Li, S. Li, S. W. Xu, and X. L. Wang.
2011. Effects of cold stress on nitric oxide in duodenum of chicks.
Poult. Sci. 90:1555–1561.
Zhao, F. Q., Z. W. Zhang, J. P. Qu, H. D. Yao, M. Li, S. Li, and
S. W. Xu. 2014. Cold stress induces antioxidants and Hsps in
chicken immune organs. Cell Stress Chaperones 19:635–648.
Zhao, F. Q., Z. W. Zhang, C. Wang, B. Zhang, H. D. Yao, S. Li,
and S. W. Xu. 2013. The role of heat shock proteins in inflamma-
tory injury induced by cold stress in chicken hearts. Cell Stress
Chaperones 18:773–783.
Zhao, P., Y. Guo, W. Zhang, H. Chai, H. Xing, and M. Xing. 2017.
Neurotoxicity induced by arsenic in Gallus Gallus: regulation of
oxidative stress and heat shock protein response. Chemosphere
166:238–245.
Zheng, M., Y. M. Kang, W. Liu, W. J. Zang, C. Y. Bao, and D. N.
Qin. 2012. Inhibition of cyclooxygenase-2 reduces hypothalamic
excitation in rats with adriamycin-induced heart failure. PLoS
One 7:e48771.