Article

pubs.acs.org/jpr

Virulent and Vaccine Strains of Streptococcus equi ssp. zooepidemicus

Have Different Influences on Phagocytosis and Cytokine Secretion of
Macrophages
Peng Jie,⊥,† Ma Zhe,*,⊥,†,‡ Hua Chengwei,† Lin Huixing,†,‡ Zhang Hui,§ Lu Chengping,†
and Fan Hongjie*,†,‡
†
College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
‡
Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou
225009, China
§
China Animal Health and Epidemiology Center, Qingdao 266032, China
*
S Supporting Information

ABSTRACT: Swine streptococcosis is a significant threat to

the Chinese pig industry, and Streptococcus equi ssp.
zooepidemicus (SEZ) is one of the major pathogens. SEZ
ATCC35246 is a classical virulent strain, while SEZ ST171 is a
Chinese attenuated vaccine strain. In this study, we employed
stable isotope labeling by amino acids in cell culture and liquid
chromatography−mass spectrometry (LC−MS) to determine
the differential response of macrophages to infection by these
two strains. Eighty-seven upregulated proteins and 135
downregulated proteins were identified. The proteomic results
were verified by real-time polymerase chain reaction for 10
chosen genes and Western blotting for three proteins. All
differentially abundant proteins were analyzed for their Gene
Ontology and Kyoto Encyclopedia of Genes and Genomes
annotations. Certain downregulated proteins were associated
with immunity functions, and the upregulated proteins were related to cytomembrane and cytoskeleton regulation. The
phagocytosis rate and cytokine genes transcription in Raw264.7 cells during SEZ ATCC35246 and ST171 infection were
detected to confirm the bioinformatics results. These results showed that different effects on macrophage phagocytosis and
cytokine expression might explain the different phenotypes of SEZ ATCC35246 and ST171 infection. This research provided
clues to the mechanisms of host immunity responses to SEZ ST171and SEZ ATCC35246, which could identify potential therapy
and vaccine development targets.
KEYWORDS: Streptococcus equi ssp. zooepidemicus, quantitative proteomics, macrophage, pathogen, vaccine

1. INTRODUCTION avirulent vaccine strain ST171 via 171 generations of artificial

Streptococcus equi ssp. zooepidemicus (SEZ) belongs to Lance- passage at 45 °C of SEZ virulent strains isolated from Guangdong
field’s group C of catalase-negative, coagulase-negative bacteria. province. ST171 has a great immunoprotective effect: it prevents
pigs from being infected by virulent SEZ strains with few adverse
It is an opportunistic pathogen of a wide variety of important
reactions.
domesticated animals such as horses, pigs, cats, and dogs.1,2
Both pathogenic and attenuated live vaccines invade the
Humans are also suitable hosts for SEZ infection, which causes
mammalian host and activate the innate immune system initially.
bacteremia and meningitis. SEZ-infected domestic animals are a
As a part of the first line of host innate immune system defense,
significant threat to human health. In recent years, many SEZ
macrophages play vital roles in antigen presentation and
outbreaks in animals and humans have been reported worldwide
elimination. Most pathogens have strategies to fight against
including in Spain, South Korea, and Germany.3−6 In China, SEZ macrophage such as manipulating surface receptor molecules
is an important swine pathogen that has caused significant related to macrophage adhesion and phagocytosis or directly
economic losses since the 1970s. SEZ caused approximately
300 000 pig deaths within 2 weeks in Sichuan province in 1975.
Special Issue: The Immune System and the Proteome 2016
SEZ strain ATCC35246 was isolated from these dead pigs7 and
was determined as virulent not only to pigs, but also to many Received: June 22, 2016
other species.8 In 1978, Liao and colleagues developed a SEZ

© XXXX American Chemical Society A DOI: 10.1021/acs.jproteome.6b00571

J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
9−11
modulating host signaling pathways. During invasion,
pathogens always induce certain harmful responses in macro-
phage that are beneficial for bacterial immune evasion and tissue
injury,12 while vaccines induce host macrophages to limit
bacterial replication and improve immunity. Foreign micro-
organisms can stimulate macrophages to secrete cytokines that
mediate communication among immune and nonimmune cells.
Manipulation of cytokines expression, and the production and
release of macrophage cytokines, can have profound effects on
the immune response. Inhibiting cytokines secretion will disturb
the response of macrophage to pathogens, while a sudden and
violent inflammatory response with a cytokine storm, such as
TNF-α and IFN-γ, will impair host tissues seriously and could
even cause host death.13,14
During infection, the influence of ATCC35246 and the
diminished virulence of vaccine ST171 to the host immunity
system are completely different. However, the underlying
mechanism of this difference remains unknown. In this study,
we used stable isotope labeling by amino acids in cell culture
(SILAC) coupled with liquid chromatography−tandem mass
spectroscopy (LC−MS/MS) to generate a preliminary map of
the macrophage proteome in the presence of ATCC35246 and
ST171 infection. Determining the proteomic changes in
macrophages infected with ATCC35246 and ST171 would
provide both a valuable data set and, more importantly, a point of
comparison with better characterized SEZ strains. Analysis of
different quantitative proteomics of macrophages might also help
to identify the host immunity responses to ST171, and the
invasive mechanisms used by ATCC3524, to provide informa-
tion for potential vaccine development targets.
2. MATERIALS AND METHODS
2.1. Microorganisms
Streptococcus equi ssp. zooepidemicus (SEZ) ATCC35246 was
isolated from a dead pig in Sichuan province, China, and stored
by the American Type Culture Collection (ATCC, Manassas,
VA, USA). ST171 was an artificially attenuated strain produced
by continuous passaging of SEZ virulent strains from Guangdong
province isolated at high temperature for 171 generations.
Bacteria were cultured in Todd Hewitt Broth (THB) (BD
Biosciences, San Jose, CA, USA) medium at 37 °C.
2.2. Raw264.7 Cell Culture and SILAC Labeling
Raw264.7 macrophage cells were purchased from the ATCC.
This cell line was established from a tumor induced by Abelson
murine leukemia virus and isolated from mice. The cells were
cultured in heavy isotope (Arg13C6, Lys13C6) or light isotope
(Arg12C6, Lys12C6) SILAC Dulbecco’s modified Eagle medium
(DMEM) with 10% FBS (fetal bovine serum; Pierce, Rockford,
IL, USA) at 37 °C and 5% CO2. After being passaged for five
generations, most proteins in Raw264.7 cells should be labeled
by isotopes of L-lysine and L-arginine.15,16
2.3. SEZ Infection and Sample Preparation
SEZ ATCC35246 and ST171 were cultured overnight on THB
solid medium at 37 °C. A fresh single colony was picked into 5
mL of THB medium and grown to an OD600 = 0.6 at 37 °C with
vigorous shaking (180 rpm). The SEZ cultures were centrifuged
at 5000 × g for 5 min at 4 °C, and the pellets retained. The
bacteria were washed with PBS three times and resuspended in
DMEM. The heavy isotope-labeled Raw264.7 cells were infected
with ATCC 35246, and the light isotope-labeled Raw264.7 cells
were infected with ST171 at a multiplicity of infection (MOI) of
B DOI: 10.1021/acs.jproteome.6b00571
Article
1:10 and cultured at 37 °C under 5% CO2. After 4 h, the total
cellular proteins were extracted using M-PER Mammalian
Protein Extraction Reagent (containing a Protease Inhibitor
Cocktail) (Thermo, Waltham, MA, USA). Protein concen-
trations of heavy and light lysates were measured using a BAC
Protein Assay Kit (Pierce, Rockford, IL, USA), and equal
quantities of heavy and light lysates were mixed. Mixed proteins
were separated by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE), and the gel was excised into five
slices; two biological replications were taken in this part
(Supplementary Figure 1).
2.4. Mass Spectrometry Analysis
The gel was cut into 1−2 mm2 slices and sonicated in 100 μL of
50% acetonitrile/25 mmol/L ammonium bicarbonate (Sigma,
St. Louis, MO, USA) for 10 min for distaining. The liquid was
discarded, and 50 μL of 10 mM DTT (dithiothreitol; Bio-Rad,
Hercules, CA, USA) was added and the slices incubated at 56 °C
for 30 min. The liquid was discarded and the slices further
destained using 100 μL of acetonitrile. Then 50 μL of 55 mM
iodoacetamide (Bio-Rad, Hercules, CA, USA) was added, and
the slices were incubated for 30 min in the dark for alkylation.
The slices were washed with 50% acetonitrile/25 mmol/L
ammonium at bicarbonate 5 min and the liquid discarded. The
gel pieces were dried thoroughly using a Vacuum Concentrator
Package (Thermo, Waltham, MA, USA). The dried gel was then
digested with 10−15 μL of 10 ng/μL trypsin (Promega,
Madison, WI, USA) at 4 °C for 30 min and at 37 °C overnight.
The tryptic peptides were extracted with 100 μL of 5%
trifluoroacetic acid (TFA) at 40 °C for 1 h and 100 μL of 2.5%
TFA/50% CAN (Merck, Billerica, MA, USA) at 30 °C for 1 h,
mixed with two samples of supernatant, separately, and dried
using the Vacuum Concentrator Package. The dried peptides
were resuspended in 20 μL of 2% methyl alcohol and 0.1% formic
acid, centrifuged at 12 000 × g for 10 min, and the supernatants
collected. The peptides mixtures were separated using the EASY-
nLC 1000 System (Nano HPLC) (Thermo, Waltham, MA,
USA) on a C18 Acclaim PepMap100 precolumn and C18 EASY-
Spray column. The spray voltage was set to 2.1 kV, the capillary
temperature was set to 250 °C, the ion source was the EASY-
Spray source, and the DP was 100. Full MS with a resolution of
70 000 fwhm was performed, with a full scan AGC target of 1e6,
at full scan max. The IT was 60 ms, and the scan range was 350−
1800 m/z. The dd-MS2 had a resolution of 17 500 fwhm, the
AGC target was 5e6, the maximum IT was 70 ms, and the
intensity threshold was 5.00 × 103. The fragmentation method
was HCD, the NCD was 29%, and the TOP N was 20. The data
were acquired using Q-Exactive software (Thermo).
2.5. Data Bioinformatics Analysis
The data of the two replications were combined together for
further Gene Ontology (GO) and Kyoto Encyclopedia of Genes
and Genomes (KEGG) analysis. The R package “clusterProfiler”
was employed for the bioinformatics analysis.17 The upregulated
and down regulated proteins were analyzed, respectively. Briefly,
all proteins were classified into biological process level 2 GO
terms by GO classification (counts ≥10 and p-value <0.05). An
over-representation test was used here to assess whether the
number of downregulated proteins associated with the GO term
biological process was larger than expected. GO Gene Set
Enrichment Analysis (GO GSEA) aggregated the per protein
statistics across proteins within a protein set, which made it
possible to detect situations where all proteins in a predefined set
change in a small but coordinated way. KEGG pathway analysis
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

was used to determine the relationship of differentially abundant infection. Total protein of the cells was extracted, and the protein
proteins and signal pathways. The “clusterProfiler” also helped us concentration was measured using a BAC Protein Assay Kit
to identify the relationship among these GO terms and pathways. (Pierce) and diluted to the same concentration. Proteins were
2.6. Quantitative Real-Time Polymerase Chain Reaction and boiled for 5 min in SDS-PAGE sample buffer. After the samples
Western Blotting were separated by SDS-PAGE, the proteins were transferred to
0.22 μm polyvinylidene difluoride membranes (Roche, Basel,
Quantitative real-time polymerase chain reaction (qPCR) was Switzerland) and blocked in 5% skimmed milk (BD Biosciences,
performed to detect the expression level of gene encoding San Jose, CA, USA) for 2 h at room temperature. Antibodies
differentially abundant proteins and cytokines in Raw 264.7 cells recognizing STAT3, Pgst2 and Mcl-1 (Abcam, Cambridge, MA,
after infection. The genes representing the 10 downregulated USA), and GAPDH (internal control; CMCTAG, USA) were
proteins were chosen according to their functions such as used as detection antibodies. After being washed with TBST,
immunity and signal transduction. Total RNA of cells was membranes were incubated with HRP Goat anti-Mouse or
extracted using RNAiso Plus (Takara, Tokyo, Japan) according Rabbit IgG antibodies (ABGENT, San Diego, CA, USA) for 1 h.
to the manufacturer’s protocol. cDNA was synthesized using Specific bands were visualized using the ECL Western Blotting
PrimeScript first strand cDNA Synthesis Kit (Takara). cDNA Substrate (Pierce).
was mixed in a 20 μL final volume with 10 μL of SYBR Premix EX
2.7. Phagocytosis Test
TaqII, 0.4 μM of each primer and ROX Reference Dye II
(Takara), and detected using an ABI PRISM 7300 real-time PCR A fresh bacterial colony (from SEZ ATCC 35246 and ST171)
system (Applied Biosystems by Thermo, Waltham, USA). The was inoculated into 5 mL of THB medium and grown to an OD
sequences of the qPCR primers are listed in Table 1. To detect of 0.6 at 37 °C with vigorous shaking (180 rpm). The bacteria
the gene expression levels, cell samples were used for RNA were then washed with PBS three times and resuspended. The
extraction after 4 h of infection, while for cytokine detection, the Raw264.7 cells in 12-well culture plate (105 cells per well) were
same extraction was done after 6 h of infection. infected by SEZ at an MOI 1:10. The plates were centrifuged at
Western blotting was performed to detect the expression levels 500 × g for 10 min to allow the bacteria to contact the surface of
of differentially abundant proteins in Raw 264.7 cells after cells and were then incubated at 37 °C in 5% CO2 for 2 and 4 h.
After the cells were washed three times with PBS, 1 mL of
Table 1. Sequence of Primers for RT-PCR DMEM medium containing 100 μg/mL gentamicin and 10 μg/
mL penicillin G was added to each well, and incubation
genes primers continued for another 2 h to kill the extracellular bacteria. The
STAT3-F TTTACCACGAAAGTCAGGTTGC
macrophage cells were disrupted by 1 mL of sterile ddH2O and
STAT3-R TGCCCAGAATGTTAAATTTCCG
plated onto THB agar medium. For inhibition of endocytosis as
Mcl1-F GGCCTTCCTCACTCCTGACTTCC
control, before being infected by SEZ, cells were treated with an
Mcl1-R CTCCGCAGGCCAAACATGGTC
endocytosis inhibitor cytochalasin D (2 μM) (Gene Operation,
Ptgs2-F TGTGCGACATACTCAAGCAG Wuxi, Jiangsu, China) at 37 °C for 1 h. The phagocytosis percent
Ptgs2-R TGTTGCACGTAGTCTTCGAT was calculated as “(CFU on plate count)/(CFU in original
IL1β-F TCTGAAGCAGCTATGGCAAC inoculum) × 100”.18
IL1β-R TTCATCTTTTGGGGTCCGTCA
SHIP1-F TCTTCCCAAGCTAAAGCCCAT 3. RESULTS
SHIP1-R AGCCTTCACCATAGGACTCGT
Hmox1-F AGGTACACATCCAAGCCGAGA 3.1. Protein Identification and Quantification
Hmox1-R AGCCATCACCAGCTTAAAGCC All isotope labeled macrophage proteins identified by LC−MS
CnA-F GATCTCCTGCCAACACTCGCTA are listed in Supplementary Table 1. As mentioned above, two
CnA-R GTGCCTACATTCATGGTTTCCG replications were processed in this experiment to obtain more
Arrb1-F AGCGAGACTCCAGTAGACACCA proteins. In the first replication, 1737 proteins were identified,
Arrb1-R TCCTTGTCATCCTTCATGCCTT 127 of which had different abundances between SEZ
LSC-F ACTTGACTCACCTACGGCAGA ATCC35246 and ST171-treated Raw264.7 cells. A total of
LSC-R TTGTCTTTGGTCACTCGCCAC 1510 proteins were identified in the second replication, 114 of
Cd44−F ATCCTCGTCACGTCCAACACC which were differentially abundant proteins. Among the total 222
Cd44-R TAGCGAGTACCATCACGGTT differentially abundant proteins, 87 were upregulated, with a
IL1α-qF TGACCTGCAGTCCATAACCC heavy/light ratio ≥1.5, and 135 proteins were downregulated,
IL1α-qR TGACAAACTTCTGCCTGACGAG with heavy/light ratio ≤0.67 (Supplementary Figure 1). All
IL1β-qF TTTGAAGTTGACGGACCCCAA differentially abundant proteins are listed in Supplementary
IL1β-qR ACAGCCACAATGAGTGATACTGC Table 2. The SILAC ratio distribution for all identified and
IL4-qF CAAACGTCCTCACAGCAACGA quantified proteins is shown in Supplementary Figure 2. Most of
IL4-qR TGCAGCTCCATGAGAACACT heavy/light ratios of the proteins were distributed around 1,
IL6-qF AAGAAAGACAAAGCCAGAGTCCT which indicated that Raw264.7 cells were labeled fully, and the
IL6-qR TCTGTGACTCCAGCTTATCTGT heavy and light labeled cells were mixed equally. The cutoff ratios
IL12α-qF CCTGCACTGCTGAAGACATCG were selected according to the distribution of ratios in a control
IL12α-qR TAGCCAGGCAACTCTCGTTC sample of labeled and unlabeled Raw246.7 cells lysates mixed
L12β-qF TTTGTTCGAATCCAGCGCAAG equally. The standard deviation (S.D.) was 0.28, the cutoff value
IL12β-qR CAGACATTCCCGCCTTTGCAT of heavy/light should be 20.56 and 2−0.56, equal to 1.474 and 0.678,
TNFα-qF GCCTCTTCTCATTCCTGCTTGTG so we chose 1.5 and 0.67 as the cutoff values, which was
TNFα-qR GGAGGCCATTTGGGAACTTC consistent with other studies.19,20
C DOI: 10.1021/acs.jproteome.6b00571
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

Figure 1. GO analysis of differentially abundant proteins. (A) Level 2 GO classification. Proteins were classified into level 2 different biological process
GO terms. The x-axis indicates the proteins number of each GO term. (B) The GO over-representation test of immunity related downregulated
proteins. In the bar graph, the x-axis represents the protein number of the selected proteins; a p-value <0.01 indicated that the association of these
proteins with the corresponding GO term is larger than expected. (C) GO Gene Set Enrichment Analysis (GO GSEA) results and their networks. Gene
sets in the green areas had positive enrichment score and were termed the upregulated gene sets, while those in the red areas had negative enrichment
scores and were termed downregulated gene sets. The color of each circle represents the p-value: as the red fades, the significance decreases.

3.2. GO Analysis and GO Term Relationship
In this research, our focus was on the macrophage immunity
related proteins that had different abundances between SEZ
ATCC35246 and ST171 infections. Level 2 GO analysis showed
that there were 10 proteins belonging to immune system process;
however, no immunity related GO terms were found among the
upregulated proteins (Figure 1A). All GO terms and genes were
listed in Supplementary Table 3. In a further analysis, we focused
on the immunity-related functions of the downregulated
D DOI: 10.1021/acs.jproteome.6b00571
proteins. Besides these immune related proteins, we also chose
some concerned downregulated genes for the GO over-
representation test. This approach was used to identify GO
terms and assess whether the number of selected proteins
associated with a GO term is larger than expected. Figure 1, panel
B shows these GO terms. The relationships of these GO terms
and their proteins are shown in Figure 1, panel B, and the details
of each GO term are listed in Table 2. All of these GO terms had
connections with the others and formed a complex network. This
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

Table 2. Details of GO Over-representation Test Results

GO term ID description p-value geneID count
GO:0030888 regulation of B cell proliferation 0.003 Inpp5d/Nfatc2/Ptprc 3
GO:0050871 positive regulation of B cell activation 0.004 Inpp5d/Nfatc2/Ptprc 3
GO:0006897 endocytosis 0.006 Arrb1/Ehd1/Il1b/Apobr/Picalm/Necap2/Snx9 7
GO:0002821 positive regulation of adaptive immune response 0.008 Cd44/H2−K1/Ptprc 3
GO:0050776 regulation of immune response 0.008 Cd44/H2−K1/Hmox1/Inpp5d/Irg1/Nfatc2/Ptprc 7
GO:0001818 negative regulation of cytokine production 0.008 Arrb1/Hmox1/Inpp5d/Irg1 4
GO:0006954 inflammatory response 0.009 Cd44/Hmox1/Il1b/Irg1/Ptgs2/Stat3/Hnrnpa0 7
GO:0032635 interleukin-6 production 0.011 Arrb1/Il1b/Inpp5d 3
GO:0002684 positive regulation of immune system process 0.011 Cd44/H2−K1/Hmox1/Il1b/Inpp5d/Irg1/Nfatc2/Ptprc 8
GO:0001816 cytokine production 0.011 Arrb1/Hmox1/Il1b/Inpp5d/Irg1/Nfatc2/Ptgs2 7
GO:0042100 B cell proliferation 0.013 Inpp5d/Nfatc2/Ptprc 3
GO:0050864 regulation of B cell activation 0.014 Inpp5d/Nfatc2/Ptprc 3
GO:0002526 acute inflammatory response 0.014 Il1b/Ptgs2/Stat3 3
GO:0002819 regulation of adaptive immune response 0.021 Cd44/H2−K1/Ptprc 3
GO:0001817 regulation of cytokine production 0.021 Arrb1/Hmox1/Il1b/Inpp5d/Irg1/Ptgs2 6
GO:0002683 negative regulation of immune system process 0.024 Cd44/Hmox1/Inpp5d/Irg1/Ptprc 5
GO:0034097 response to cytokine 0.028 Il1b/Irg1/Mcl1/Ptgs2/Ptprc/Stat3 6
GO:1903039 positive regulation of leukocyte cell−cell adhesion 0.028 Cd44/Il1b/Ptprc 3
GO:0002699 positive regulation of immune effector process 0.034 H2−K1/Hmox1/Ptprc 3
GO:0002250 adaptive immune response 0.034 Cd44/H2−K1/Inpp5d/Ptprc 4
GO:0002703 regulation of leukocyte mediated immunity 0.034 H2−K1/Hmox1/Ptprc 3
GO:0050778 positive regulation of immune response 0.034 Cd44/H2−K1/Irg1/Nfatc2/Ptprc 5
GO:0002443 leukocyte mediated immunity 0.036 H2−K1/Hmox1/Inpp5d/Ptprc 4
GO:0042098 T cell proliferation 0.041 Il1b/Ptprc/Dock8 3

network should be related to macrophenomenon concerning
immunity functions. Using GO GSEA, we analyzed profiles of all
the differentially abundant proteins that could be matched with
Entrez IDs. Gene sets related to immunity function and cellular
cytoskeleton are listed in Table 3. Figure 1, panel C shows the
relationships of these gene sets, and the results agreed with the
GO over-representation test: most of the downregulated gene
sets were associated with immunity functions. The upregulated
gene sets were related to cytomembrane and cytoskeleton
regulation.
3.3. KEGG Pathway Analysis and Pathways Interaction
Network
We employed the KEGG pathway analysis tools to identify
relationships among the differentially abundant proteins and
signal pathways and illuminate their connections. Upregulated
and down regulated proteins were analyzed separately. The
pathways involving upregulated proteins and their connections
are shown in Figure 2, panel A. Most of pathways belonged to
metabolism, except the “Bacterial invasion of epithelial cells
pathway”. The downregulated proteins-related pathways caught
our attention, especially the immunity related pathways (Figure
2B). The connections between proteins and immunity-related
pathways are shown in Figure 2, panel C. Three of the concerned
KEGG pathways map to the downregulated proteins shown in
Supplementary Figure 3, including the T cell and B cell receptor
signaling pathways and antibody mediated phagocytosis. All were
related to host immunity defense.
3.4. Verification of the Expression Levels Genes Encoding
Downregulated Proteins
We chose 10 of the downregulated proteins from the LC−MS
results and checked the expressions of their encoding genes using
qPCR. Figure 3, panel A shows that all 10 genes had lower
transcript levels in SEZ ATCC35246-infected Raw264.7 cells
than ST171-infected cells. Although some of them did not match
E DOI: 10.1021/acs.jproteome.6b00571
the 1.5-times difference criterion, the tendency was the same as
the LC−MS results. In addition, Western blotting was used to
detect the protein abundances of three selected proteins. The
results showed that the expression levels of Ptgs2, Mcl1, and
STAT3 in SEZ ATCC35246-infected Raw264.7 cells were lower
than in ST171-infected cells (Figure 3B), which agreed with the
proteomics and transcription results.
3.5. Raw264.7 Cells Phagocytosis Rate and Cytokine Genes
Transcription in Response to SEZ ATCC35246 and ST171
Infection
Compared with SEZ ATCC35246, Raw264.7 cells more easily
ingest ST171. The plate counting results are shown in Figure 4,
panel A, which suggested that SEZ ATCC35246 has significantly
higher phagocytosis resistance than ST171.
qPCR detected four kinds of cytokines. The transcription
levels of IL-1α, IL-1β, and IL-6 in Raw264.7 cells infected with
SEZ ATCC35246 were significantly lower than in cells infected
with ST171. However, the transcript level of TNF-α showed no
difference. The result is shown in Figure 4, panel B, and indicated
that SEZ ST171 infection might cause a stronger inflammatory
response by inducing the increased expressions of certain
cytokines. However, the cytokine storm-related cytokine TNF-
α did not increase significantly.
4. DISCUSSION
Swine streptococcosis is prone to outbreaks in the Chinese pig
industry, especially when pigs have been infected by
immunosuppressive viruses such as porcine reproductive and
respiratory syndrome virus (PPRSV) and porcine circovirus 2
(PCV2).21−23 SEZ may cause swine streptococcosis, and
vaccines have been developed to protect pigs against SEZ
infection including ST171, which is an artificially attenuated
strain that with a good protection rate. This ST171 vaccine strain
has been used in China widely for many years. In this study, we
employed the SILAC and LC−MS technology to identify the
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

Table 3. GO Sets of GO GSEA Analysis professional phagocytes with exceptionally high endocytic
activity. Many kinds of bacteria have evolved strategies to escape
set enrichment
ID description size score p-value the bactericidal mechanisms associated with phagocytosis. In a
previous study, the antiphagocytosis ability of SEZ was found to
GO:0006904 vesicle docking involved in 2 0.815 0.040
exocytosis be connected with alternative complement pathways; however,
GO:0090002 establishment of protein 3 0.779 0.020 SEZ antiphagocytosis should involve other mechanisms.24
localization to plasma Picalm (phosphatidylinositol-binding clathrin assembly protein)
membrane
and Snx9 (sorting nexin 9) both function to recruit clathrin and
GO:0030041 actin filament polymerization 3 0.739 0.020
adapter protein complex 2 (AP2) to cell membranes at the sites
GO:0030832 regulation of actin filament 3 0.739 0.020
length of coated-pit formation and clathrin-vesicle assembly.25,26 Other
GO:0030833 regulation of actin filament 3 0.739 0.020 proteins, such as Apobr (apolipoprotein B receptor), are
polymerization participate directly or indirectly in macrophage phagocytosis.27
GO:0008064 regulation of actin 3 0.739 0.020 One reason for the differentiation of virulence between SEZ
polymerization or ATCC35246 and ST171 might be their different effects on
depolymerization
macrophage phagocytosis. SEZ ATCC35246 has many anti-
GO:0008154 actin polymerization or 4 0.655 0.030
depolymerization phagocytosis strategies,24,28 while ST171 might have lost some of
GO:0007009 plasma membrane 7 0.637 0.010 these functions and could be ingested more easily by macro-
organization phages. The characteristics of these two bacteria might affect
GO:0032956 regulation of actin 4 0.598 0.030 their infection processes: SEZ ATCC35246 avoided the host
cytoskeleton organization
immune defense and caused the disease, while SEZ ST171 was
GO:0032970 regulation of actin filament- 4 0.598 0.030
based process ingested by macrophages and presented to lymphocytes as
GO:0002262 myeloid cell homeostasis 5 0.574 0.020 antigens, providing immune protection to the host.
GO:0030029 actin filament-based process 8 0.569 0.020 In the GO GSEA results, some of the upregulated genes sets
GO:0030036 actin cytoskeleton 8 0.569 0.020 were related to cytomembrane and cytoskeleton regulation.
organization Macrophages can adjust their cellular membrane and cytoske-
GO:0007015 actin filament organization 5 0.559 0.040 leton, which make the macrophage stable and efficient, and
GO:0002520 immune system development 10 0.359 0.040 bacteria might cause the cellular membrane to lose its integrity or
GO:0061024 membrane organization 15 0.350 0.020 disturb the cytoskeleton to facilitate bacterial infection.29
GO:0007010 cytoskeleton organization 14 0.322 0.030 Upregulated proteins Rab10, Rhog, and Rap2a belong to small
GO:0002376 immune system process 20 0.265 0.030 G protein superfamily that is involved in regulation of actin
GO:0007165 signal transduction 36 0.211 0.050 dynamics and the maintenance of cell membrane and
GO:0006954 inflammatory response 7 −0.567 0.020 cytoskeleton. Basal small G protein activity is required for
GO:0050777 negative regulation of 4 −0.585 0.050 homeostatic functions in physiological conditions; however,
immune response sustained overactivation of small G proteins or the spatiotem-
GO:0002237 response to molecule of 4 −0.596 0.050 poral deregulation of small G proteins activity has pathological
bacterial origin
GO:0032496 response to 4 −0.596 0.050
consequences for cells including apoptosis and loos of
lipopolysaccharide integrity.30−32 In addition, upregulated proteins Tbcd, Sptbn1,
GO:0009617 response to bacterium 5 −0.605 0.040 and Txlna are related to the cellular cytoskeleton. Thus, we
GO:0042035 regulation of cytokine 2 −0.832 0.030 considered that the SEZ ATCC35246 might escape phagocytosis
biosynthetic process by influencing the cell membrane and cytoskeleton of macro-
GO:0042089 cytokine biosynthetic process 2 −0.832 0.030 phages, decreasing their immunity functions.33,34
GO:0042107 cytokine metabolic process 2 −0.832 0.030 Among the upregulated proteins, the KEGG pathways were
GO:0042226 interleukin-6 biosynthetic 2 −0.832 0.030 related to metabolism, except the “Bacterial invasion of epithelial
process
cells pathway”. Many pathogenic bacteria can invade phagocytic
GO:0045408 regulation of interleukin-6 2 −0.832 0.030
biosynthetic process cells and colonize them intracellularly, then becoming
GO:0070487 monocyte aggregation 2 −0.867 0.040 disseminated to other cells.35 Streptococcus might express
GO:0014904 myotube cell development 2 −0.954 0.010 proteins on their surfaces that interact with cellular receptors,
initiating signal cascades that result in the close apposition of the
cellular membrane around the entering bacteria.36 SEZ
differential proteomic response of macrophages to infection with ATCC35246 might also infect hosts by this method. The
the SEZ virulent strain ATCC35246 and the vaccine strain downregulated proteins formed a network, including “T/B cell
ST171. We also tried to explain how SEZ ATCC35246 affects receptor signaling pathways”, “Fc gamma R-mediated phag-
macrophages and why ST171 lost its virulence. We believed that ocytosis”, and “Natural killer cell mediated cytotoxicity”. These
using the TripleTOF 5600, cutting five slices of gels, and using pathways are linked directly to immunity functions. Inhibited
two replications, we would obtain sufficient protein information. host immune defense might be an important reason for the high
Ultimately, the LC−MS provided more than 2700 isotope virulence of SEZ ATCC35246.
labeled proteins and among them, 222 proteins were identified as There were some notably differentially abundant proteins.
differentially abundant proteins. CD44 and Irg1 (Immune responsive gene 1) were down-
We analyzed these differentially abundant proteins by GO and regulated during SEZ ATCC35246 infection. CD44 is a cellular
KEGG analysis. The GO analysis results for downregulated surface protein37 and is a receptor of hyaluronic acid, which is the
proteins identified many immune GO terms, especially the basis of SEZ and Group A streptococcus (GAS) capsules.
endocytosis GO term and some other cytokine, inflammatory, Downregulation of CD44 would decrease the adherence ability
and immune response-related GO terms. Macrophages are of host cells to the bacteria.38 If macrophages lost their ability to
F DOI: 10.1021/acs.jproteome.6b00571
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

Figure 2. The KEGG pathway analysis. These results showed the relationships of the differentially abundant proteins to signal pathways and illuminated
their connections. (A) The pathways of upregulated proteins and their connections; (B) the pathways of downregulated genes and their connections. In
panels A and B, the color of each circle represents the p-value: as the red fades, the significance decreases. (C) The network of proteins and immunity
related pathways are shown in the blue area.

adhere to SEZ, this would decrease their ability to phagocytose
the bacteria. Irg1 is highly expressed in mammalian macrophages
during inflammation, its downregulation in macrophages
resulted in significantly reduced antimicrobial activity during
bacterial infections,39,40 and this might be beneficial to SEZ
ATCC35246 infection. Meanwhile, the abundance of these two
proteins in SEZ ST171-infected macrophages allowed this
vaccine strains to be treated like a common antigen by
macrophages.
The expression trend of Ptgs2 was interesting. Ptgs2 is
responsible for the production of inflammatory prostaglandins,
which are immunosuppressive factors. 41,42 In the SEZ
ATCC35246-infected macrophages, Ptgs2 was present in low
levels compared with the control and SEZ ST171-treated
macrophages. This reduction in immunosuppression might be
necessary for macrophages to fight against SEZ infection. By
contrast, SEZ ST171, as a vaccine strain, was handled more easily
by the macrophages; therefore, in these macrophages, the Ptgs2
expression level was not as low as in SEZ ATCC35246 infected
macrophage, but a little lower than the control. Among the
G DOI: 10.1021/acs.jproteome.6b00571
upregulated genes, Tbcd, Rhog, and Rab10 were related to
cytoskeleton dynamic stability, which suggested that the chaos of
macrophage cytoskeleton adjustment would lead to decreased
phagocytosis.43
To verify the bioinformatics results, we detected the
phagocytosis rate and cytokine genes transcription responses
to SEZ ATCC35246 and ST171 infection in the Raw264.7 cells.
Raw264.7 found it harder to ingest SEZ ATCC35246 and
induced less cytokine expression, which was in accordance with
the GO analysis results. The phagocytosis rate was higher for
SEZ ST171, leading to its presentation to lymphocytes as an
antigen, causing Raw264.7 to express higher levels of cytokines
and providing immune protection to the host.
In conclusion, by using SILAC coupled to LC−MS/MS and
bioinformatics analysis, the differential proteomics of SEZ
ATCC35246 and ST171 infected Raw264.7 cells were analyzed.
Further experiments were designed to confirm the bioinfor-
matics results. According to these results, the virulent strain
caused cytoskeleton related genes upregulation that might
influence the macrophage phagocytosis efficiency; on the other
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
Figure 3. Verification of the downregulated expression genes after 4 h of
infection. (A) Genes representing 10 of the downregulated proteins
were chosen to verify the LC−MS results using qPCR. The gene
transcription level in SEZ ST171 treated cells was regarded as 100% and
was represented by the whole column, then the gene transcription level
of SEZ ATCC35246 treated cells was compared with it and shown in
blue column; (B) Ptgs2, Mcl1, and STAT3 were chosen to verifying the
protein expression levels. β-actin or GAPDH were used as control
proteins. The grayscale of the reactive protein bands was measured by
software and a ratio = grayscale of target protein/grayscale of control
protein was produced. 1, Negative control; 2, SEZ ATCC35246 treated
cells; 3, SEZ ST171 treated cells.
hand, many cytokines related genes reduced the immune
response of the macrophage. The different influences on
macrophage phagocytosis and cytokine expression might be
important reasons for different infection phenotypes of SEZ
ATCC35246 and ST171.
H DOI: 10.1021/acs.jproteome.6b00571
Article
Figure 4. Raw264.7 cells phagocytosis rate and cytokine genes
transcription in response to SEZ ATCC35246 and ST171 infection.
(A) The phagocytic rate of Raw264.7 cells to SEZ ATCC35246 and
ST171 at 2 and 4 h, cytochalasin D treated cells were used as control;
(B) the transcription levels of IL-1α, IL-1β, and IL-6 genes in Raw264.7
cells infected with SEZ ATCC35246 and ST171 at 6 h. (∗∗∗ represents
significant different compared to SEZ ATCC35246 treated group, p-
value <0.001).
■
*
ASSOCIATED CONTENT
S Supporting Information
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.jproteo-
me.6b00571.
Information for all proteins identified by LC−MS and
differentially abundant proteins; details of GO classifica-
tion results; diagram of Raw264.7 cells isotope labeling,
SEZ infection, and proteomics analysis by LC−MS; ratio
distribution of identified proteins; illustration of KEGG
pathways involving three downregulated proteins (ZIP)
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
■ AUTHOR INFORMATION
Corresponding Authors
*E-mail: fhj@njau.edu.cn.
*E-mail: mazhe@njau.edu.cn.
Author Contributions
⊥
These authors contributed equally to this work.
Notes
The authors declare no competing financial interest.
■ ACKNOWLEDGMENTS
This work was supported by the National Natural Science
Foundation of China (31302093, 31172319, 31272581);
National Key Research and Development Program
(2016YFD0501607); the Natural Science Foundation of Jiangsu
Province (BK20130676); the Ph.D. Program of the Foundation
of the Ministry of Education of China (20130097120024); the
Key Project of Independent Innovation of the Fundamental
Research Fund for the Central Universities of Nanjing
Agricultural University (Y0201600144, KYZ201630); and the
Priority Academic Program Development of Jiangsu Higher
Education Institutions (PAPD).
■ REFERENCES
(1) Gruszynski, K.; Young, A.; Levine, S. J.; Garvin, J. P.; Brown, S.;
Turner, L.; Fritzinger, A.; Gertz, R. E., Jr.; Murphy, J. M.; Vogt, M.; Beall,
B. Streptococcus equi subsp. zooepidemicus infections associated with
guinea pigs. Emerging Infect. Dis. 2015, 21, 156−158.
(2) Acke, E.; Midwinter, A.; Lawrence, K.; Gordon, S.; Moore, S.;
Rasiah, I.; Steward, K.; French, N.; Waller, A. Prevalence of
Streptococcus dysgalactiae subsp. equisimilis and S. equi subsp.
zooepidemicus in a sample of healthy dogs, cats and horses. N. Z. Vet.
J. 2015, 63, 1−19.
(3) Blum, S.; Elad, D.; Zukin, N.; Lysnyansky, I.; Weisblith, L.; Perl, S.;
Netanel, O.; David, D. Outbreak of Streptococcus equi subsp.
zooepidemicus infections in cats. Vet. Microbiol. 2010, 144, 236−239.
(4) Matz-Rensing, K.; Winkelmann, J.; Becker, T.; Burckhardt, I.; van
der Linden, M.; Kondgen, S.; Leendertz, F.; Kaup, F. J. Outbreak of
Streptococcus equi subsp. zooepidemicus infection in a group of rhesus
monkeys (Macaca mulatta). J. Med. Primatol. 2009, 38, 328−334.
(5) Byun, J. W.; Yoon, S. S.; Woo, G. H.; Jung, B. Y.; Joo, Y. S. An
outbreak of fatal hemorrhagic pneumonia caused by Streptococcus equi
subsp. zooepidemicus in shelter dogs. J. Vet Sci. 2009, 10, 269−271.
(6) Bordes-Benitez, A.; Sanchez-Onoro, M.; Suarez-Bordon, P.;
Garcia-Rojas, A. J.; Saez-Nieto, J. A.; Gonzalez-Garcia, A.; Alamo-
Antunez, I.; Sanchez-Maroto, A.; Bolanos-Rivero, M. Outbreak of
Streptococcus equi subsp. zooepidemicus infections on the island of
Gran Canaria associated with the consumption of inadequately
pasteurized cheese. Eur. J. Clin. Microbiol. Infect. Dis. 2006, 25, 242−246.
(7) Feng ZG, H. J. Outbreak of swine streptococcosis in Sichan
province and identification of pathogen. Anim Husbandry Vet Med. Lett.
1977, 2, 7−12.
(8) Hong-Jie, F.; Fu-yu, T.; Ying, M.; Cheng-ping, L. Virulence and
antigenicity of the szp-gene deleted Streptococcus equi ssp.
zooepidemicus mutant in mice. Vaccine 2009, 27, 56−61.
(9) Rocco, J. M.; Irani, V. R. Mycobacterium avium and modulation of
the host macrophage immune mechanisms. international journal of
tuberculosis and lung disease: the official journal of the International Union
against Tuberculosis and Lung Disease 2011, 15, 447−452.
(10) Horstmann, R. D.; Sievertsen, H. J.; Knobloch, J.; Fischetti, V. A.
Antiphagocytic activity of streptococcal M protein: selective binding of
complement control protein factor H. Proc. Natl. Acad. Sci. U. S. A. 1988,
85, 1657−1661.
(11) Agniswamy, J.; Nagiec, M. J.; Liu, M.; Schuck, P.; Musser, J. M.;
Sun, P. D. Crystal structure of group A streptococcus Mac-1: insight into
I DOI: 10.1021/acs.jproteome.6b00571
Article
dimer-mediated specificity for recognition of human IgG. Structure
2006, 14, 225−235.
(12) Goldstein, E.; Bartlema, H. C. Role of the alveolar macrophage in
pulmonary bacterial defense. Bulletin Europeen de Physiopathologie
Respiratoire 1977, 13, 57−67.
(13) Arango Duque, G.; Descoteaux, A. Macrophage cytokines:
involvement in immunity and infectious diseases. Front. Immunol. 2014,
5, 491.
(14) Moon, M. L.; McNeil, L. K.; Freund, G. G. Macrophages make me
sick: how macrophage activation states influence sickness behavior.
Psychoneuroendocrinology 2011, 36, 1431−1440.
(15) Fan, H.; Ye, Y.; Luo, Y.; Tong, T.; Yan, G.; Liao, M. Quantitative
proteomics using stable isotope labeling with amino acids in cell culture
reveals protein and pathway regulation in porcine circovirus type 2
infected PK-15 cells. J. Proteome Res. 2012, 11, 995−1008.
(16) Treffers, E. E.; Tas, A.; Scholte, F. E.; Van, M. N.; Heemskerk, M.
T.; de Ru, A. H.; Snijder, E. J.; van Hemert, M. J.; van Veelen, P. A.
Temporal SILAC-based quantitative proteomics identifies host factors
involved in chikungunya virus replication. Proteomics 2015, 15, 2267−
2280.
(17) Yu, G.; Wang, L. G.; Han, Y.; He, Q. Y. clusterProfiler: an R
package for comparing biological themes among gene clusters. OMICS
2012, 16, 284−287.
(18) Fang, L.; Shen, H.; Tang, Y.; Fang, W. Superoxide dismutase of
Streptococcus suis serotype 2 plays a role in anti-autophagic response by
scavenging reactive oxygen species in infected macrophages. Vet.
Microbiol. 2015, 176, 328−336.
(19) Vertegaal, A. C.; Andersen, J. S.; Ogg, S. C.; Hay, R. T.; Mann, M.;
Lamond, A. I. Distinct and overlapping sets of SUMO-1 and SUMO-2
target proteins revealed by quantitative proteomics. Mol. Cell. Proteomics
2006, 5, 2298−2310.
(20) Chen, N.; Sun, W.; Deng, X.; Hao, Y.; Chen, X.; Xing, B.; Jia, W.;
Ma, J.; Wei, H.; Zhu, Y.; Qian, X.; Jiang, Y.; He, F. Quantitative
proteome analysis of HCC cell lines with different metastatic potentials
by SILAC. Proteomics 2008, 8, 5108−5118.
(21) Zha, Y.; Xie, J.; Chen, Y.; Wei, C.; Zhu, W.; Chen, J.; Qi, H.;
Zhang, L.; Sun, L.; Zhang, X.; Zhou, P.; Cao, Z.; Qi, W.; Zhang, M.;
Huang, Z.; Zhang, G. Microbiological identification and analysis of
Swine lungs collected from carcasses in Swine farms, china. Indian J.
Microbiol. 2013, 53, 496−498.
(22) Kimman, T. G.; Cornelissen, L. A.; Moormann, R. J.; Rebel, J. M.;
Stockhofe-Zurwieden, N. Challenges for porcine reproductive and
respiratory syndrome virus (PRRSV) vaccinology. Vaccine 2009, 27,
3704−3718.
(23) Steiner, E.; Balmelli, C.; Gerber, H.; Summerfield, A.;
McCullough, K. Cellular adaptive immune response against porcine
circovirus type 2 in subclinically infected pigs. BMC Vet. Res. 2009, 5, 45.
(24) Ma, Z.; Zhang, H.; Zheng, J.; Li, Y.; Yi, L.; Fan, H.; Lu, C.
Interaction between M-Like Protein and Macrophage Thioredoxin
Facilitates Antiphagocytosis for Streptococcus equi ssp. zooepidemicus.
PLoS One 2012, 7, e32099.
(25) Tebar, F.; Bohlander, S. K.; Sorkin, A. Clathrin assembly
lymphoid myeloid leukemia (CALM) protein: localization in endocytic-
coated pits, interactions with clathrin, and the impact of overexpression
on clathrin-mediated traffic. Mol. Biol. Cell 1999, 10, 2687−2702.
(26) Lundmark, R.; Carlsson, S. R. Sorting nexin 9 participates in
clathrin-mediated endocytosis through interactions with the core
components. J. Biol. Chem. 2003, 278, 46772−46781.
(27) Brown, M. L.; Yui, K.; Smith, J. D.; LeBoeuf, R. C.; Weng, W.;
Umeda, P. K.; Li, R.; Song, R.; Gianturco, S. H.; Bradley, W. A. The
murine macrophage apoB-48 receptor gene (Apob-48r): homology to
the human receptor. J. Lipid Res. 2002, 43, 1181−1191.
(28) Yi, L.; Wang, Y.; Ma, Z.; Zhang, H.; Li, Y.; Zheng, J.-x.; Yang, Y.-c.;
Fan, H.-j.; Lu, C.-p. Biofilm Formation of Streptococcus equi ssp.
zooepidemicus and Comparative Proteomic Analysis of Biofilm and
Planktonic Cells. Curr. Microbiol. 2014, 69, 227−233.
(29) Lemichez, E.; Aktories, K. Hijacking of Rho GTPases during
bacterial infection. Exp. Cell Res. 2013, 319, 2329−2336.
J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research Article

(30) Loirand, G.; Sauzeau, V.; Pacaud, P. Small G proteins in the

cardiovascular system: physiological and pathological aspects. Physiol.
Rev. 2013, 93, 1659−1720.
(31) Csepanyi-Komi, R.; Levay, M.; Ligeti, E. Small G proteins and
their regulators in cellular signalling. Mol. Cell. Endocrinol. 2012, 353,
10−20.
(32) Fiorentini, C.; Falzano, L.; Travaglione, S.; Fabbri, A. Hijacking
Rho GTPases by protein toxins and apoptosis: molecular strategies of
pathogenic bacteria. Cell Death Differ. 2003, 10, 147−152.
(33) Yuan, M.; Deleuil, F.; Fallman, M. Interaction between the
Yersinia tyrosine phosphatase YopH and its macrophage substrate, Fyn-
binding protein, Fyb. J. Mol. Microbiol. Biotechnol. 2006, 9, 214−223.
(34) Kedzierska, K.; Azzam, R.; Ellery, P.; Mak, J.; Jaworowski, A.;
Crowe, S. M. Defective phagocytosis by human monocyte/macrophages
following HIV-1 infection: underlying mechanisms and modulation by
adjunctive cytokine therapy. J. Clin. Virol. 2003, 26, 247−263.
(35) Iwai, H.; Kim, M.; Yoshikawa, Y.; Ashida, H.; Ogawa, M.; Fujita,
Y.; Muller, D.; Kirikae, T.; Jackson, P. K.; Kotani, S.; Sasakawa, C. A
bacterial effector targets Mad2L2, an APC inhibitor, to modulate host
cell cycling. Cell 2007, 130, 611−623.
(36) Wang, B.; Li, S.; Dedhar, S.; Cleary, P. P. Paxillin phosphorylation:
bifurcation point downstream of integrin-linked kinase (ILK) in
streptococcal invasion. Cell. Microbiol. 2007, 9, 1519−1528.
(37) Ponta, H.; Sherman, L.; Herrlich, P. A. CD44: from adhesion
molecules to signalling regulators. Nat. Rev. Mol. Cell Biol. 2003, 4, 33−
45.
(38) Cywes, C.; Wessels, M. R. Group A Streptococcus tissue invasion
by CD44-mediated cell signalling. Nature 2001, 414, 648−652.
(39) Li, Y.; Zhang, P.; Wang, C.; Han, C.; Meng, J.; Liu, X.; Xu, S.; Li,
N.; Wang, Q.; Shi, X.; Cao, X. Immune responsive gene 1 (IRG1)
promotes endotoxin tolerance by increasing A20 expression in
macrophages through reactive oxygen species. J. Biol. Chem. 2013,
288, 16225−16234.
(40) Michelucci, A.; Cordes, T.; Ghelfi, J.; Pailot, A.; Reiling, N.;
Goldmann, O.; Binz, T.; Wegner, A.; Tallam, A.; Rausell, A.; Buttini, M.;
Linster, C. L.; Medina, E.; Balling, R.; Hiller, K. Immune-responsive
gene 1 protein links metabolism to immunity by catalyzing itaconic acid
production. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 7820−7825.
(41) Kimmel, D. W.; Rogers, L. M.; Aronoff, D. M.; Cliffel, D. E.
Prostaglandin E2 Regulation of Macrophage Innate Immunity. Chem.
Res. Toxicol. 2016, 29, 19−25.
(42) Yanez, R.; Oviedo, A.; Aldea, M.; Bueren, J. A.; Lamana, M. L.
Prostaglandin E2 plays a key role in the immunosuppressive properties
of adipose and bone marrow tissue-derived mesenchymal stromal cells.
Exp. Cell Res. 2010, 316, 3109−3123.
(43) Liu, Y.; Tejpal, N.; You, J.; Li, X. C.; Ghobrial, R. M.; Kloc, M.
ROCK inhibition impedes macrophage polarity and functions. Cell.
Immunol. 2016, 300, 54−62.

J DOI: 10.1021/acs.jproteome.6b00571
J. Proteome Res. XXXX, XXX, XXX−XXX