Methods in

Molecular Biology 2751

Carlos Medina
Francisco Javier López-Baena Editors

Host-Pathogen
Interactions
Methods and Protocols
Second Edition
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Host-Pathogen Interactions

Methods and Protocols

Edited by

Carlos Medina and Francisco Javier López-Baena

Department of Microbiology, University of Seville, Sevilla, Spain
Editors
Carlos Medina Francisco Javier López-Baena
Department of Microbiology Department of Microbiology
University of Seville University of Seville
Sevilla, Spain Sevilla, Spain

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-3616-9 ISBN 978-1-0716-3617-6 (eBook)
https://doi.org/10.1007/978-1-0716-3617-6
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2024
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Paper in this product is recyclable.

Dedication

In loving memory to

Pepe Casadesús and Ramón Bellogı́n

Mentors, colleagues, and friends

Preface

Microbes co-evolve with their eukaryotic hosts and develop different molecular adaptations
to live in a close association with them and with other microbes that share the same
ecological niche. On the one hand, in the case of pathogenic microorganisms, this evolu-
tionary race can be focused on the development of new molecular weapons to overcome
host defenses and promote infection, and, on the other hand, commensal and symbiotic
microbes interchange different molecular signals with their hosts to facilitate infection and
promote an association in which both members get benefits of the interaction. Therefore,
the study of these host-microbe interactions is of great environmental, economic, and
public-health interest.
In the case of pathogens infecting animal cells, the identification of the pathogenicity
factors responsible for the development of the disease and the strategies used by these
microbes to evade host defense responses and resist medical treatments, such as the use of
antibiotics, are essential to combat lethal infections, predicted to become the leading cause
of death in the next decades.
The interactions between microbes and plants are also of great interest, since crop
productivity is negatively affected by diverse microbial plagues and the use of chemical
inputs is becoming more restricted and regulated by governments due to their impact on
the environment and human health. Advances in the knowledge of the molecular basis of
pathogenicity and the development of alternatives, based on microbes, to combat plant
pathogens and promote plant growth can help to assure food security to the increasing
world human population.
This book is a multidisciplinary compendium of approaches and techniques employed to
analyze the role of different molecules, processes, or strategies used by different guests to
survive and proliferate in their associations with eukaryotic hosts.
The manual begins with two reviews focused on animal-pathogen interactions. One of
them is an update of current protocols used to study genetic associations for the identifica-
tion of alleles involved in animal infection processes. The other examines host-pathogen
interactions from an evolutionary point of view and describes molecular mechanisms, stages
of interaction, and the development of pharmacological treatments and its impact on public
health.
Virus-host interactions are becoming more attractive for scientists due to their involve-
ment in many diseases as well as the availability of more tools to study their modes of action
or their application. Thus, this book includes advances in live fluorescent microscopy that
have allowed the study of signaling events and pathways as well as the detection and
localization of proteins in virus-infected cell lines, facilitating the assessment of these inter-
actions at longer time periods. In another contribution, an infectious mycovirus, which can
be used for the transfection of fungal protoplasts, has been developed to be used as a viral
expression vector or a virus-inducing silencing vector.
After these four chapters, there is a main plant-microbe interaction section. With respect
to those chapters focused on plant-pathogen interactions, two of them are related to
virulence determinants of Acidovorax species, including the production, precipitation, and
quantification of exopolysaccharides (EPS) and the description of basic protocols to identify

vii
viii Preface

other virulence factors. This section also includes tools to study the relevance of phenotypic
heterogeneity in plant-pathogen interactions as well as detailed protocols to study biocon-
trol agents that use the type 6 secretion system (T6SS) to kill competitive pathogenic
bacteria in natural environments.
Different molecular techniques, initially applied to non-pathogenic interaction but that
can be easily adapted to study other host-pathogen associations, are then described, includ-
ing the quantification of Mixed-Linkage β-Glucans (MLG), the use of surface plasmon
resonance (SPR) to study real-time molecular interactions dynamics, the over-expression
of T3SS effectors and the use of heterologous hosts to study subcellular targeting, methods
to asses bacterial motility, a complete guide to study small RNAs, and protocols to isolate
and quantify extracellular membrane vesicles (EMV) from free-living bacterial cultures and
from bacteroids, and the differentiated state of rhizobia within plant nodules. Finally, there
are three chapters dedicated to rhizobia that feature the isolation of nodulation factors and
their analysis by thin-layer chromatography (TLC), an alternative method for symbiotic
plasmid tagging and transfer, and the encapsulation of rhizobia to improve inoculants and
increase their survival in soils.
In summary, this book contributes to the study of host-pathogen interactions with a
plethora of techniques that can be used in a variety of bacteria with health and/or economic
importance for science.

Sevilla, Spain Carlos Medina

Francisco Javier L
opez-Baena
Contents

Dedication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi

PART I INTRODUCTION

1 Host-Pathogen Interaction: Biology and Public Health. . . . . . . . . . . . . . . . . . . . . . 3

Richard Ponce-Cusi, Leny Bravo, Kevin J. Paez,
Joseph A. Pinto, and Nesstor Pilco-Ferreto
2 Genetic Association Studies in Host-Pathogen Interaction Analysis . . . . . . . . . . . 19
Marina Laplana, José Luis Royo, and Luis Miguel Real

PART II VIRAL-HOST INTERACTIONS

3 Live-Cell Fluorescence Imaging for Virus-Host Interactions . . . . . . . . . . . . . . . . . 33
Francesca J. Scribano, Kristen A. Engevik,
J. Thomas Gebert, and Joseph M. Hyser
4 Construction of a Mycoviral Infectious Clone for Reverse Genetics
in Botrytis cinerea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Laura C
o rdoba, Ana Ruiz-Padilla, Javier Pardo-Medina,
Julio L. Rodrı́guez-Romero, and Marı́a A. Ayll
on

PART III PLANT-PATHOGENS INTERACTIONS

5 Exopolysaccharide Production and Precipitation Method as a Tool

to Study Virulence Factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
Natalia Mielnichuk, Constanza M. Joya,
Marı́a A. Monachesi, and Romina P. Bertani
6 Virulence-Related Assays for Investigation of the Acidovorax
citrulli-Cucurbitaceae Pathosystem. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Francisco Pérez-Montaño, Irene Jiménez-Guerrero,
Dafna Tamir-Ariel, and Saul Burdman
7 Dual-Fluorescence Chromosome-Located Labeling System for Accurate
In Vivo Single-Cell Gene Expression Analysis in Pseudomonas syringae . . . . . . . . 95
Nieves L
o pez-Pagán, José S. Rufián, Javier Ruiz-Albert,
and Carmen R. Beuz
o n
8 A Robust Method to Perform In Vitro and In Planta Interbacterial
Competition Assays: Killing Plant Pathogens by a Potent
Biocontrol Agent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
Cristina Civantos, Adrián Ruiz, and Patricia Bernal

ix
x Contents

PART IV MOLECULAR METHODS FOR PLANT-INTERACTING BACTERIA

9 Quantification of Mixed-Linkage β-Glucan (MLG) in Bacteria. . . . . . . . . . . . . . . . 133

Juan Antonio Marchante, Lucı́a Ruiz-Sáez,
Socorro Muñoz, Juan Sanjuán, and Daniel Pérez-Mendoza
10 Surface Plasmon Resonance as a Tool to Elucidate the Molecular
Determinants of Key Transcriptional Regulators Controlling
Rhizobial Lifestyles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
Laura Tomás-Gallardo, Juan J. Cabrera, and Socorro Mesa
11 Microscope Subcellular Localization of Plant-Interacting Bacterial
Effectors in Animal Cell Cultures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
Irene Jiménez-Guerrero, Francisco Javier L
opez-Baena,
and Carlos Medina
12 A Workflow for the Functional Characterization of Noncoding
RNAs in Legume Symbiotic Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Natalia I. Garcı́a-Tomsig, Sabina K. Guedes-Garcı́a,
and José I. Jiménez-Zurdo
13 Methods for Studying Swimming and Surface Motilities in Rhizobia . . . . . . . . . . 205
Francisco Fuentes-Romero, Cynthia Alı́as-Villegas,
Pilar Navarro-G
omez, Sebastián Acosta-Jurado,
Lydia M. Bernabéu-Roda, Virginia Cuéllar,
Marı́a J. Soto, and José M. Vinardell
14 Isolation, Quantification, and Visualization of Extracellular Membrane
Vesicles in Rhizobia Under Free-Living Conditions . . . . . . . . . . . . . . . . . . . . . . . . . 219
Paula Ayala-Garcı́a, Natalia Moreno-de Castro,
Irene Jiménez-Guerrero, Mathias Müsken, Alejandro Arce-Rodrı́guez,
Francisco Pérez-Montaño, and José Manuel Borrero-de Acuña
15 Isolation of Rhizobial Extracellular Membrane Vesicles from Bacteroids . . . . . . . 229
Paula Ayala-Garcı́a, Irene Jiménez-Guerrero, Mathias Müsken,
Francisco Javier Ollero, José Manuel Borrero-De Acuña,
and Francisco Pérez-Montaño
16 Nod Factor Lipopolysaccharide Purification to Study Nitrogen-Fixing
Bacteria Symbiosis with Legumes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237
Catherine N. Jacott, Sara Lozano-Morillo, and Pablo del Cerro
17 A Novel System to Selective Tagging of Sinorhizobium fredii
Symbiotic Plasmids. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Ana Marı́a Cutiño, Marı́a del Carmen Sánchez-Aguilar,
José Enrique Ruiz-Sáinz, Marı́a del Rosario Espuny,
Francisco Javier Ollero, and Carlos Medina
18 New Inoculation Strategy for Legume Based on Rhizobium-Metabolite
Co-encapsulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261
Adriana B. Cesari, Ver
o nica E. Castilla Marı́n,
Luciana Nieva Muratore, Natalia S. Paulucci,
and Marta S. Dardanelli

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267
Contributors

SEBASTIÁN ACOSTA-JURADO • Centro Andaluz de Biologı́a del Desarrollo, Universidad Pablo

de Olavide, Consejo Superior de Investigaciones Cientı́ficas and Junta de Andalucı́a,
Seville, Spain
CYNTHIA ALÍAS-VILLEGAS • Centro Andaluz de Biologı́a del Desarrollo, Universidad Pablo de
Olavide, Consejo Superior de Investigaciones Cientı́ficas and Junta de Andalucı́a, Seville,
Spain
ALEJANDRO ARCE-RODRÍGUEZ • Institute of Microbiology, Technische Universit€ at
Braunschweig, Braunschweig, Germany
PAULA AYALA-GARCÍA • Department of Microbiology, University of Seville, Seville, Spain
MARÍA A. AYLLÓN • Centro de Biotecnologı́a y Gen
omica de Plantas, Universidad Politécnica
de Madrid (UPM)-Instituto Nacional de Investigaci
on y Tecnologı́a Agraria y
Alimentaria (INIA/CSIC), Madrid, Spain; Departamento de Biotecnologı́a-Biologı́a
Vegetal, Escuela Técnica Superior de Ingenierı́a Agron
omica, Alimentaria y de Biosistemas,
Universidad Politécnica de Madrid (UPM), Madrid, Spain
LYDIA M. BERNABÉU-RODA • Department ofBiotechnology and EnvironmentalProtection,
Estaci
on Experimental del Zaidı́n, Consejo Superior de Investigaciones Cientı́ficas,
Granada, Spain
PATRICIA BERNAL • Departamento de Microbiologı́a, Facultad de Biologı́a, Universidad de
Sevilla, Seville, Spain
ROMINA P. BERTANI • Instituto de Tecnologı́a Agroindustrial del Noroeste Argentino
(ITANOA), Estaci
on Experimental Agroindustrial Obispo Colombres (EEAOC), Consejo
Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET), Tucumán, Argentina
CARMEN R. BEUZÓN • Dpto. Biologı́a Celular, Genética y Fisiologı́a, Instituto de
Hortofruticultura Subtropical y Mediterránea, Universidad de Málaga-Consejo Superior
de Investigaciones Cientı́ficas (IHSM-UMA-CSIC), Málaga, Spain
JOSÉ MANUEL BORRERO-DE ACUÑA • Department of Microbiology, University of Seville,
Seville, Spain
JOSÉ MANUEL BORRERO-DE ACUÑA • Department of Microbiology, University of Seville,
Seville, Spain
LENY BRAVO • Escuela Profesional de Medicina Humana, Universidad Privada San Juan
Bautista, Lima, Peru
SAUL BURDMAN • Department of Plant Pathology and Microbiology, The Robert H. Smith
Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem,
Rehovot, Israel
JUAN J. CABRERA • Department of Soil and Plant Microbiology, Estaci
on Experimental del
Zaidı́n, CSIC, Granada, Spain
MARÍA DEL CARMEN SÁNCHEZ-AGUILAR • Department of Microbiology, University of Seville,
Seville, Spain
VERÓNICA E. CASTILLA MARÍN • Departamento de Biologı́a Molecular, Facultad de Ciencias
Exactas, Fı́sico-Quı́micas y Naturales, INBIAS CONICET, Universidad Nacional de Rı́o
Cuarto, Rı́o Cuarto, C
ordoba, Argentina
PABLO DEL CERRO • Departamento de Microbiologia, Facultad de Biologia, Universidad de
Sevilla, Seville, Spain

xi
xii Contributors

ADRIANA B. CESARI • Departamento de Biologı́a Molecular, Facultad de Ciencias Exactas,

Fı́sico-Quı́micas y Naturales, INBIAS CONICET, Universidad Nacional de Rı́o Cuarto,
Rı́o Cuarto, C
ordoba, Argentina
CRISTINA CIVANTOS • Departamento de Microbiologı́a, Facultad de Biologı́a, Universidad de
Sevilla, Seville, Spain
LAURA CÓRDOBA • Centro de Biotecnologı́a y Gen
omica de Plantas, Universidad Politécnica
de Madrid (UPM)-Instituto Nacional de Investigaci
on y Tecnologı́a Agraria y
Alimentaria (INIA/CSIC), Madrid, Spain
VIRGINIA CUÉLLAR • Department ofBiotechnology and EnvironmentalProtection, Estaci
on
Experimental del Zaidı́n, Consejo Superior de Investigaciones Cientı́ficas, Granada, Spain
ANA MARÍA CUTIÑO • Department of Microbiology, University of Seville, Seville, Spain
MARTA S. DARDANELLI • Departamento de Biologı́a Molecular, Facultad de Ciencias Exactas,
Fı́sico-Quı́micas y Naturales, INBIAS CONICET, Universidad Nacional de Rı́o Cuarto,
Rı́o Cuarto, C
ordoba, Argentina
KRISTEN A. ENGEVIK • Department of Molecular Virology and Microbiology, Baylor College of
Medicine, Houston, TX, USA
FRANCISCO FUENTES-ROMERO • Department of Microbiology, Faculty of Biology, University of
Seville, Seville, Spain
NATALIA I. GARCÍA-TOMSIG • Structure, Dynamics and Function of Rhizobacterial Genomes
(RhizoRNA Lab), Estaci
on Experimental del Zaidı́n, Consejo Superior de Investigaciones
Cientı́ficas (CSIC), Granada, Spain
J. THOMAS GEBERT • Department of Molecular Virology and Microbiology, Baylor College of
Medicine, Houston, TX, USA
SABINA K. GUEDES-GARCÍA • Structure, Dynamics and Function of Rhizobacterial Genomes
(RhizoRNA Lab), Estaci
on Experimental del Zaidı́n, Consejo Superior de Investigaciones
Cientı́ficas (CSIC), Granada, Spain
JOSEPH M. HYSER • Department of Molecular Virology and Microbiology, Baylor College of
Medicine, Houston, TX, USA; Center for Metagenomics and Microbiome Research, Baylor
College of Medicine, Houston, TX, USA
CATHERINE N. JACOTT • Departamento de Microbiologia, Facultad de Biologia, Universidad
de Sevilla, Seville, Spain
IRENE JIMÉNEZ-GUERRERO • Department of Microbiology, University of Seville, Seville, Spain
JOSÉ I. JIMÉNEZ-ZURDO • Structure, Dynamics and Function of Rhizobacterial Genomes
(RhizoRNA Lab), Estaci
on Experimental del Zaidı́n, Consejo Superior de Investigaciones
Cientı́ficas (CSIC), Granada, Spain
CONSTANZA M. JOYA • Instituto de Tecnologı́a Agroindustrial del Noroeste Argentino
(ITANOA), Estaci
on Experimental Agroindustrial Obispo Colombres (EEAOC), Consejo
Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET), Tucumán, Argentina
MARINA LAPLANA • Departament de Ciències Mèdiques Ba ` siques, Universitat de Lleida,
Lleida, Spain
FRANCISCO JAVIER LÓPEZ-BAENA • Department of Microbiology, University of Seville, Seville,
Spain
NIEVES LÓPEZ-PAGÁN • Dpto. Biologı́a Celular, Genética y Fisiologı́a, Instituto de
Hortofruticultura Subtropical y Mediterránea, Universidad de Málaga-Consejo Superior
de Investigaciones Cientı́ficas (IHSM-UMA-CSIC), Málaga, Spain
SARA LOZANO-MORILLO • Departamento de Microbiologia, Facultad de Biologia,
Universidad de Sevilla, Seville, Spain
 Contributors xiii

JUAN ANTONIO MARCHANTE • Department of Soil and Plant Microbiology, Estaci
on

Experimental del Zaidı́n, CSIC, Granada, Spain
CARLOS MEDINA • Department of Microbiology, University of Seville, Seville, Spain
SOCORRO MESA • Department of Soil and Plant Microbiology, Estaci
on Experimental del
Zaidı́n, CSIC, Granada, Spain
NATALIA MIELNICHUK • Instituto de Ciencia y Tecnologı́a Dr. César Milstein, Fundaci
on
Pablo Cassará, Consejo Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET),
Ciudad Aut
onoma de Buenos Aires, Argentina
MARÍA A. MONACHESI • Instituto de Tecnologı́a Agroindustrial del Noroeste Argentino
(ITANOA), Estaci
on Experimental Agroindustrial Obispo Colombres (EEAOC), Consejo
Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET), Tucumán, Argentina
NATALIA MORENO-DE CASTRO • Department of Microbiology, University of Seville, Seville,
Spain
SOCORRO MUÑOZ • Department of Soil and Plant Microbiology, Estaci
on Experimental del
Zaidı́n, CSIC, Granada, Spain
LUCIANA NIEVA MURATORE • Departamento de Biologı́a Molecular, Facultad de Ciencias
Exactas, Fı́sico-Quı́micas y Naturales, INBIAS CONICET, Universidad Nacional de Rı́o
Cuarto, Rı́o Cuarto, C
ordoba, Argentina
MATHIAS MÜSKEN • Central Facility for Microscopy, Helmholtz Centre for Infection Research,
Braunschweig, Germany
PILAR NAVARRO-GÓMEZ • Department of Microbiology, Faculty of Biology, University of
Seville, Seville, Spain
FRANCISCO JAVIER OLLERO • Department of Microbiology, University of Seville, Seville, Spain
KEVIN J. PAEZ • Escuela Profesional de Medicina Humana – Filial Ica, Universidad Privada
San Juan Bautista, Ica, Peru
JAVIER PARDO-MEDINA • Centro de Biotecnologı́a y Gen
omica de Plantas, Universidad Polité
cnica de Madrid (UPM)-Instituto Nacional de Investigaci
on y Tecnologı́a Agraria y
Alimentaria (INIA/CSIC), Madrid, Spain; Departamento de Genética, Facultad de
Biologı́a, Universidad de Sevilla, Sevilla, Spain
NATALIA S. PAULUCCI • Departamento de Biologı́a Molecular, Facultad de Ciencias Exactas,
Fı́sico-Quı́micas y Naturales, INBIAS CONICET, Universidad Nacional de Rı́o Cuarto,
Rı́o Cuarto, C
ordoba, Argentina
DANIEL PÉREZ-MENDOZA • Department of Soil and Plant Microbiology, Estaci
on
Experimental del Zaidı́n, CSIC, Granada, Spain
FRANCISCO PÉREZ-MONTAÑO • Department of Microbiology, University of Seville, Seville,
Spain
NESSTOR PILCO-FERRETO • Unidad de Posgrado. Facultad de Medicina, Universidad
Nacional de San Agustı́n de Arequipa, Arequipa, Peru
JOSEPH A. PINTO • Escuela Profesional de Medicina Humana – Filial Ica, Universidad
Privada San Juan Bautista, Ica, Peru
RICHARD PONCE-CUSI • Escuela Profesional de Medicina, Facultad de Ciencias de la Salud,
Universidad Nacional de Moquegua, Moquegua, Peru
LUIS MIGUEL REAL • Departamento de Especialidades Quirúrgicas, Bioquı́mica
e Inmunologı́a. Facultad de Medicina, Universidad de Málaga, Málaga, Spain; Unidad
Clı́nica de Enfermedades Infecciosas y Microbiologı́a, Hospital Universitario de Valme,
Sevilla, Spain; Centro de Investigaci
on en Red de Enfermedades Infecciosas
(CIBERINFEC), Madrid, Spain; Instituto de Biomedicina de Sevilla, Sevilla, Spain
xiv Contributors

JULIO L. RODRÍGUEZ-ROMERO • Centro de Biotecnologı́a y Gen
omica de Plantas,

Universidad Politécnica de Madrid (UPM)-Instituto Nacional de Investigaci
on y
Tecnologı́a Agraria y Alimentaria (INIA/CSIC), Madrid, Spain; Departamento de
Biotecnologı́a-Biologı́a Vegetal, Escuela Técnica Superior de Ingenierı́a Agron
omica,
Alimentaria y de Biosistemas, Universidad Politécnica de Madrid (UPM), Madrid, Spain
MARÍA DEL ROSARIO ESPUNY • Department of Microbiology, University of Seville, Seville,
Spain
JOSÉ LUIS ROYO • Departamento de Especialidades Quirúrgicas, Bioquı́mica e Inmunologı́a.
Facultad de Medicina, Universidad de Málaga, Málaga, Spain
JOSÉ S. RUFIÁN • Dpto. Biologı́a Celular, Genética y Fisiologı́a, Instituto de
Hortofruticultura Subtropical y Mediterránea, Universidad de Málaga-Consejo Superior
de Investigaciones Cientı́ficas (IHSM-UMA-CSIC), Málaga, Spain
ADRIÁN RUIZ • Departamento de Microbiologı́a, Facultad de Biologı́a, Universidad de
Sevilla, Seville, Spain
JAVIER RUIZ-ALBERT • Dpto. Biologı́a Celular, Genética y Fisiologı́a, Instituto de
Hortofruticultura Subtropical y Mediterránea, Universidad de Málaga-Consejo Superior
de Investigaciones Cientı́ficas (IHSM-UMA-CSIC), Málaga, Spain
ANA RUIZ-PADILLA • Centro de Biotecnologı́a y Gen
omica de Plantas, Universidad Polité
cnica de Madrid (UPM)-Instituto Nacional de Investigaci
on y Tecnologı́a Agraria y
Alimentaria (INIA/CSIC), Madrid, Spain
LUCÍA RUIZ-SÁEZ • Department of Soil and Plant Microbiology, Estaci
on Experimental del
Zaidı́n, CSIC, Granada, Spain
JOSÉ ENRIQUE RUIZ-SÁINZ • Department of Microbiology, University of Seville, Seville, Spain
JUAN SANJUÁN • Department of Soil and Plant Microbiology, Estaci
on Experimental del
Zaidı́n, CSIC, Granada, Spain
FRANCESCA J. SCRIBANO • Department of Molecular Virology and Microbiology, Baylor
College of Medicine, Houston, TX, USA
MARÍA J. SOTO • Department ofBiotechnology and EnvironmentalProtection, Estaci
on
Experimental del Zaidı́n, Consejo Superior de Investigaciones Cientı́ficas, Granada, Spain
DAFNA TAMIR-ARIEL • Department of Plant Pathology and Microbiology, The Robert
H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of
Jerusalem, Rehovot, Israel
LAURA TOMÁS-GALLARDO • Proteomics and Biochemistry Unit, Andalusian Centre for
Developmental Biology, CSIC-Junta de Andalucı́a-Pablo de Olavide University, Seville,
Spain
JOSÉ M. VINARDELL • Department of Microbiology, Faculty of Biology, University of Seville,
Seville, Spain
 Part I

Introduction
 Chapter 1

Host-Pathogen Interaction: Biology and Public Health

Richard Ponce-Cusi, Leny Bravo, Kevin J. Paez, Joseph A. Pinto,
and Nesstor Pilco-Ferreto

Abstract
Interactions between host and pathogenic microorganisms are common in nature and have a significant
impact on host health, often leading to several types of infections. These interactions have evolved as a result
of the ongoing battle between the host’s defense mechanisms and the pathogens’ invasion strategies. In this
chapter, we will explore the evolution of host-pathogen interactions, explore their molecular mechanisms,
examine the different stages of interaction, and discuss the development of pharmacological treatments.
Understanding these interactions is crucial for improving public health, as it enables us to develop effective
strategies to prevent and control infectious diseases. By gaining insights into the intricate dynamics between
pathogens and their hosts, we can work towards reducing the burden of such diseases on society.

Key words Public health, Malaria, Immune system, Tuberculosis, SARS-CoV-2, Antibiotic resistance

1 Introduction

Host-pathogen interactions play a critical role in the maintenance

of biodiversity but can also have significant impacts on public
health. In this chapter, the evolution of host-pathogen interactions,
their molecular mechanisms, stages of interaction, and the devel-
opment of pharmacological treatments have been examined. The
coevolution of hosts and pathogens has led to the development of
complex defense systems and invasion mechanisms. Hosts have
evolved strategies to recognize and respond to pathogens, while
pathogens have developed strategies to evade or suppress the host
response [1]. The search for understanding the molecular mechan-
isms underlying host-pathogen interactions has led to the discovery
of pathogen-associated molecular patterns (PAMPs) recognition by
host pattern recognition receptors (PRRs), the secretion of viru-
lence factors by pathogens to manipulate host signaling pathways,
and the activation of adaptive immune responses by the host to
target-specific pathogens [2]. Pharmacological treatments have

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

3
4 Richard Ponce-Cusi et al.

been developed to target various stages of host-pathogen interac-

tions, from preventing infection to treating established disease.
However, the emergence of antibiotic-resistant pathogens poses a
significant challenge to the development of effective treatments
[3]. The impact of host-pathogen interactions on public health
cannot be overstated, with infectious diseases responsible for a
significant proportion of global morbidity and mortality. Under-
standing the mechanisms of host-pathogen interactions and devel-
oping effective treatments are essential to mitigate the impact of
infectious diseases on global public health.

2 Mechanisms of the Evolution of Pathogen-Host Interaction

The interaction between the host and the pathogens is in constant

evolution. This linkage is so close that there is a coevolution
between hosts and pathogens. While hosts develop resistance
mechanisms, pathogens increase their genetic diversity to overcome
their defenses. This interaction is very strong and can even shape
the geographical distribution of genotypes. A well-known phenom-
enon is the distribution of blood groups [4, 5]. Group O is more
resistant to Plasmodium falciparum infection. The distribution of
group O is higher in South America and Africa, where malaria is
endemic. In contrast, groups A, B, and A/B are more frequent in
geographical areas where P. falciparum is not frequent or absent
[6]. A similar phenomenon is seen in the relationship between the
prevalence of Plasmodium vivax and the distribution of Duffy
blood groups. The Fy genotype (ab-) is highly frequent in
P. vivax endemic areas of Africa, mainly in sub-Saharan Africa [7].
In complex organisms, such as Homo sapiens, adaptation to
pathogens involves the evolution of an immune system. Interest-
ingly, in contrast to the distribution of blood groups and malaria,
there is no evidence that phenotypes could shape the distribution of
tuberculosis around the world. Instead, several lineages of Mycobac-
terium tuberculosis (Mtb) show a geographical distribution [8]. On
the other hand, tuberculosis (TB) is related to socioeconomic
status, which could be related to sanitization and the status of the
immune system [9]. The proof of this is that HIV-infected patients
are more susceptible to tuberculosis. On the other hand, Mtb
presents an interesting feature since this microorganism is an old
pathogen of human species with a long coevolutionary history.
Older Mtb lineages are adapted to specific human populations,
whereas modern TB lineages are more successful in geographical
spread [10].
All organisms must adapt and evolve to survive; it involves the
ability of the host to escape pathogens and deal with competitors
and, on the other hand, the ability of pathogens to escape host
defenses [11]. There is a reciprocal effect on the evolution between
 The Biology of Host-Pathogen Interaction 5

the host and the pathogens. This process is called coevolution. It

means that changes in gene distribution in one population affect
the gene distribution in another [1]. The mechanistic processes
that lead to coevolution may be diverse. Host defense mechanisms
can trigger genomic instability in the pathogen that produces
genetic diversity and more chances to overcome host defenses
[12]. Coevolutionary changes are also affected by the population
size of the host [13].
Genetic evaluation of genes involved in susceptibility could be
complicated. In the case of Mtb, it has lineages with the phylogeo-
graphical structure product of adaptation to different human popu-
lations with different genetic backgrounds. Currently, 19 lineages
and 53 sublineages have been reported. This genetic diversity is the
result of host-pathogen coevolution, where some Mtb lineages
have distinctive characteristics; for example, some lineages have
elevated transmissibility, while some lineages are geographically
restricted [10]. This differential adaptation of Mtb has repercus-
sions on public health and is related to the importance of genetic
characterization of Mtb lineages.
In the case of the COVID-19 pandemic, there was a huge
amount of genomic data available in public repositories. These
data showed a rapid evolutionary process of COVID-19 with global
waves of lineages with different pathogenic capacities and different
immune evasion characteristics and a dynamic intra-host genetic
diversity of SARS-CoV-2 [14]. As a point of public health, these
findings highlight the importance of vaccination. In unvaccinated
patients, SARS-CoV-2 variants have greater genetic diversity than
in vaccinated patients [15]. In the case of humans, the host-
pathogen coevolution process is modified by treatment with antibi-
otic drugs. These treatments may influence the evolution and
spread of multiresistant pathogens [16].

3 Stages of Pathogen-Host Interaction

The host-pathogen interaction comprises continuous defense,

attacks, and counterattacks which force both sides to select the
best molecular strategies. These interactions can be described in
four stages: (i) host invasion, (ii) evasion of the immune system, (iii)
pathogen in the host, and (iv) pathogen’s control of the pathogen
by the immune system (Fig. 1). These stages are not strictly con-
secutive or isolated events, but overlap with each other because of
the diversity of immune response to achieve elimination of the
invader. Decades of research have elucidated various mechanisms
of host-pathogen interaction in these stages. These are briefly
described below.
6 Richard Ponce-Cusi et al.

Fig. 1 Main events in the stages of host-pathogen interaction. (i) Host invasion begins with pathogen
recognition and endocytosis in most viruses and some other microorganisms. Bacteria use secretion systems
to invade host cells by, for example, breaching the cell membrane and by manipulating the host cellular
processes for their own benefit. (ii) Virulence factors, as a strategy for immune evasion, are ubiquitous in
many pathogens. Virulence factor produced by Mtb avoids phagosome maturation/destruction. (iii) Replication
of HIV may be enhanced by host factors. Furthermore, metabolic changes in host cells can be exploited by Mtb
for replication. (iv) Various immune mechanisms are responsible for the final control pathogen. In SARS-CoV-
2 infection, CD8+ T lymphocytes and natural killer cells play a central role in the pathogen’s control

3.1 Host Invasion Pathogenic or harmless microorganisms enter the host mainly
through natural intrusions (mouth and nose) or through the gas-
tric, genitourinary, and respiratory mucosa. A breach in the conti-
nuity of the skin barrier is another important entry of pathogens.
Chemical barriers, such as the acidic pH of the gastric and genital
tract, and physical barriers, such as mucociliary movement in the
respiratory tract, are responsible for the clearance of most invaders.
However, some microorganisms will overcome these barriers and
will try to colonize the host. Bacteria have nine specialized secretion
systems that facilitate invasion by secreting effect or proteins with
virulence function [17, 18]. For example, the Type III secretion
system is an essential virulence factor in highly pathogenic bacteria
such as Salmonella, Shigella, Pseudomonas [19], E. coli [20], and
Yersinia pestis [21]. On the other hand, many bacteria, viruses, and
parasites, once they have overcome the primary barriers, enter the
host cell through endocytosis facilitated by membrane receptors
[22, 23].
 The Biology of Host-Pathogen Interaction 7

3.2 Evasion of the Host cells have specialized receptors (pattern recognition recep-
Immune System tors) whose function is to detect potential pathogens. Binding of
these receptors to specific pathogen surface molecules (pathogen-
associated molecular patterns) triggers several mechanisms of
innate immunity in the host that trigger the adaptive immune
response to eliminate or contain the invader.
In response, pathogens have developed a variety of strategies to
evade these mechanisms by attacking key signaling pathways of host
immunity [24]. Mtb is one of the pathogens with the most success-
ful mechanisms for innate immune evasion. At the beginning of the
infection, macrophages recognize and phagocytize Mtb, which
activates the host NK-kB signaling pathway, producing activation
of inflammation [2], and other intracellular pathways aimed to
destroy the phagosome. Mtb evades and inhibits the mechanisms
displayed by the host using a broad repertory of virulence factors,
disrupting the ability of host cells to defend themselves [25].
On the other hand, viral strategies for immune evasion involve
the inhibition of signaling pathways related to the expression of
interferon and cytokines. SARS-CoV-2, the virus responsible for
Coronavirus-19 disease, has shown a reduction in interferon induc-
tion through overexpression of antagonist proteins of the innate
immune system (Orf9b, Orf6, N) [26]. In general, SARS-CoV-2 is
highly effective in delaying/inhibiting the innate immune response
[27]. Similarly, HIV-1’s viral protein Vpu is able to limit the activa-
tion of the NF-kB signaling pathway [28]. Likewise, SARS-CoV-2,
HIV, and other viruses overregulate the expression of the major
histocompatibility complex 1 in the infected cell, which allows
them to be “invisible” to cytotoxic T lymphocytes [29, 30]. The
complement plays a central role in the activation of inflammation
and the direct clearance of pathogens.
Some viruses, such as poxvirus, vaccinia, variola, and Borrelia
burgdorferi, have surface structures that mimic the regulator pro-
teins of the complement system, inhibiting its activation and evad-
ing inflammation activation [31, 32], while Pseudomonas and
Streptococcus synthesize proteases that digest the structures of the
complement system. Furthermore, P. falciparum-infected erythro-
cytes have been shown to express RIFIN proteins, which are
immune inhibitors that facilitate immune escape [33].

3.3 Pathogen Once the pathogens have established themselves, they must repli-
Replication in the Host cate and spread to other hosts. In viruses, they have a limited
number of genes and need to use the host’s cellular machinery to
replicate. This is facilitated by factors in the host associated with
pathogen replication. Two independent studies have shown that
there are more than 200 host factors associated with HIV replica-
tion [34, 35].
Metabolic changes in host immune cells as a response to patho-
gens have been known for a long time now. Mtb takes advantage of
8 Richard Ponce-Cusi et al.

this metabolic phenotype characterized by high glucose internali-

zation and high aerobic glycolysis rate in which metabolic inter-
mediates are used for lipid synthesis [36]. In final terms, this serves
as a nutrient source and a niche for Mtb that attenuates the immune
action of the host [37].

3.4 Pathogen Control In a favorable scenario for the host, at some point, the immune
by the Immune System system will control pathogens (even with their sophisticated
mechanisms of immune evasion) that will be controlled by the
immune system. Immune processes such as autophagocytosis,
phagocytosis, dendritic cell action, and the adaptive immune sys-
tem play fundamental roles in the control of pathogens. In Mtb
infection, dendritic cells are essential for T-lymphocyte activation,
which migrate to the infection site and avoid dispersion of bacilli
and increase the clearance capacity by other immune cells. Except
for 5–10% of cases, this led to calcification of the typical granuloma
structure produced by Mtb infection and eventual clearance or
dormant status infection in the absence of lifelong symptoms [38].

4 Therapeutic Approaches

4.1 Tuberculosis Tuberculosis is a global public health problem, and although recent
epidemiological data indicate a slow decline in incidence and prev-
alence, this pathology is trending upwarding regions such as Africa
and Asia where it represents a major issue. Standard of care is the
use of antibiotic combination therapy; however, antibiotic resis-
tance is a common complication. Prevention of disease transmission
through infection control is also important, along with prompt
detection and treatment of infected people [39, 40].
The host-pathogen interaction is a key factor in the spread of
tuberculosis, which affects mainly the lungs. The spread of tuber-
culosis depends on the ability of Mtb to infect new individuals and
its ability to escape the immune response of the host. When
Mt. breaches the lungs, it can survive in macrophages. If the
immune system is unable to detect and eliminate mycobacteria, it
can multiply and form inflammatory lesions called granulomas. If
the immune system cannot remove these granulomas, they can
become a source of latent infection [41]. Therapeutic approaches
to pathogen-host interactions in Mtb focus on understanding how
the bacillus interacts with the host immune system and how this
information can be used to develop new therapies. One of the most
promising therapeutic approaches is the modification of the
immune response, particularly boosting the immune response,
which can help control infection and reduce the duration of treat-
ment. In this context, gamma interferon is used as therapy in
clinical trials. Gamma interferon is a protein naturally produced in
the body; it helps to activate immune cells [42–45].
 The Biology of Host-Pathogen Interaction 9

Other types of therapies directly attack Mtb, such as isoniazid,

rifampicin, pyrazinamide, ethambutol, and streptomycin. Isoniazid
is the most important drug used in all treatments and works by
inhibiting the synthesis of mycolic acids, an important component
of the bacterial cell wall that interferes with the growth and replica-
tion cycle. Rifampicin is used in combination with isoniazid in most
treatment regimens, inhibiting the synthesis of bacterial RNA and
affecting the growth and replication processes of bacteria. Pyrazi-
namide acts by acidifying the intracellular environment of bacteria,
making it difficult to grow. Ethambutol inhibits the synthesis of the
bacterial cell wall. Streptomycin, an aminoglycoside, used in cases
of tuberculosis resistant to first-line drugs, inhibits the synthesis of
bacterial proteins. In general, tuberculosis treatment consists of the
combined administration of the mentioned drugs for a prolonged
period (6 and 9 months), with the aim of eliminating bacteria from
the patient’s tissues and preventing tuberculosis recurrence. Treat-
ment must be supervised by a health professional to ensure adher-
ence to the regimen and also prevent the development of drug
resistance [46, 47].
Antibiotic resistance represents a major threat to public health,
and it is considered one of the leading causes of death from infec-
tious diseases worldwide. Early and accurate diagnosis is crucial to
prevent the emergence of resistant strains and limit their spread.
Complex and multidisciplinary interventions are needed to prevent
and control the spread of drug-resistant tuberculosis, such as
appropriate use of anti-TB drugs, improvement of surveillance
and monitoring systems, implementation of infection control mea-
sures, research and development of new therapies and vaccines, and
promotion of public awareness of tuberculosis and drug resistance
[47–49].

4.2 HIV Antiretroviral therapies (ART) aim to reduce viral load and increase
the number of CD4+ cells. Combination antiretroviral therapy is
the standard of care for HIV treatment. People with HIV are at
increased risk of contracting opportunistic infections, most of them
caused by organisms that are not normally pathogenic in healthy
people. Therefore, prophylactic therapies are used to prevent these
infections in people with HIV [50, 51]. The interaction of HIV
with the host is an active area of research, as new therapies, includ-
ing gene and stem cell therapies and vaccines, prevent infection.
Prevention is a critical aspect of HIV treatment, including the
promotion of condom use and access to preexposure prophylaxis
(PrEP) for people at high risk of contracting the virus. Promotion
of early diagnosis and timely access to ART are important in pre-
venting viral transmission [52].
Reverse transcriptase inhibitors are one of the groups of drugs
used in ART. Reverse transcriptase is a viral enzyme that allows the
reverse transcription of viral RNA into DNA, allowing the virus to
10 Richard Ponce-Cusi et al.

integrate its genetic material into the host genome. Reverse tran-
scriptase inhibitors exert their action by blocking the activity of this
enzyme and preventing viral replication. Within this group of drugs
are nucleoside reverse transcriptase inhibitors (NRTI) and
non-nucleoside reverse transcriptase inhibitors (NNRTIs).
NRTIs, such as zidovudine and lamivudine, act as nucleoside ana-
logues and are incorporated into the viral DNA strand, interrupting
its elongation and preventing the synthesis of new genetic material.
NNRTIs, such as efavirenz and nevirapine, bind to the reverse
transcriptase enzyme and inhibit its activity in a non-competitive
manner. Another group of drugs used is protease inhibitors, which
are essential for the maturation and release of viral particles. Prote-
ase inhibitors block their activity and prevent the production of
infectious viral particles. Protease inhibitors include saquinavir,
ritonavir, and lopinavir [53–56].
Fusion inhibitors, another group of drugs used in ART, work
by inhibiting the fusion of the virus with the host cell, preventing
the entry of the virus into the cell. Enfuvirtide is an example of a
fusion inhibitor. In addition, integrase inhibitors prevent the inte-
gration of the virus genetic material into the host genome or entry
inhibitors, which act by blocking virus entry into the host cell.
Integrase inhibitors include raltegravir and dolutegravir, while mar-
aviroc is an example of an entry inhibitor [53, 56, 57].

4.3 Malaria The current malaria therapeutic plethora includes chloroquine,

which is the oldest and most effective drug against malaria, acting
on the erythrocytic stage of the parasite by inhibiting hemoglobin
digestion in infected erythrocytes, preventing the release of toxic
waste, and leading to death. However, resistance to chloroquine
has emerged in some geographic areas. Artemisinin, derived from
the Artemisia annua plant, acts in the early intraerythrocytic stage,
binding to the iron present in hemoglobin and forming free radicals
that damage the parasite, making this drug highly effective in
combination with chloroquine. Another important combination
of drugs is Atovaquone-Proguanil which also acts on the erythro-
cytic stage. Atovaquone works by inhibiting the mitochondrial
electron transport chain of the parasite, while proguanil inhibits
dihydrofolate reductase, an enzyme essential for DNA synthesis.
Mefloquine works in the late erythrocytic stage of the parasite and
inhibits the formation of hemozoin pigments, which are necessary
for the survival of the parasite. Also, it is effective against
chloroquine-resistant strains. Primaquine exerts its action in the
hepatic stage of the parasite life cycle, eliminating the latent forms
in the liver. It is used for malaria prophylaxis and as a treatment for
Plasmodium vivax and P. ovale. Prevention of malaria is essential to
control its spread, including the use of insecticide-treated bed nets,
indoor insecticide spraying, and the elimination of mosquito breed-
ing sites. Malaria vaccines, such as RTS,S/AS01, have also been
 The Biology of Host-Pathogen Interaction 11

developed and have been shown to be effective in reducing the

number of malaria cases in young children [58–61].

4.4 SARS-CoV-2 Therapeutic approaches to pathogen-host interactions in SARS-

CoV-2 have focused on the development of treatments to mitigate
the severity of the disease and reduce its mortality. In general, the
goal is to reduce the viral load on the patient and avoid the exag-
gerated immune response that can cause tissue damage. One of the
most studied therapeutic approaches has been the use of monoclo-
nal antibodies, artificial proteins produced in a laboratory that bind
to the S protein of SARS-CoV-2, preventing the virus from infect-
ing human cells. Monoclonal antibodies have been used both to
prevent infection and to treat disease in hospitalized patients.
Another therapeutic approach is the use of antivirals. Remdesivir
clinical trials reduce hospitalization duration and improve recovery
in patients with COVID-19. Other antivirals, such as ribavirin and
favipiravir, are being investigated. Convalescent antibody therapy
has also been used to treat COVID-19, which consists of adminis-
tering blood plasma from recovered patients to patients infected
with SARS-CoV-2 [62, 63].
In addition, corticosteroids have also been used to treat the
exaggerated inflammatory response experienced by some patients
due to SARS-CoV-2 infection. Corticosteroids reduce inflamma-
tion and can prevent tissue damage. In general, research around
therapeutic approaches to pathogen-host interactions in SARS-
CoV-2 is constantly evolving, and clinical trials are underway to
assess the efficacy and safety of new treatments. The implementa-
tion of these therapies can have a significant impact on reducing the
severity and mortality of the disease, which has important implica-
tions for public health worldwide [47, 63].

5 Challenges in Public Health

Public health is a discipline that studies the determinants of health

disease and involves research and practice of disease prevention,
health promotion, and the development of public policies
[64]. Some diseases, such as SARS-CoV-2, have a high rate of
human-to-human contagion and are provoked by several strains
[65]. Understanding these host-pathogen interactions is important
for public health because it identifies the most vulnerable people
and establishes strategies to prevent and control spread [66].

5.1 Tuberculosis Tuberculosis mainly affects middle- and low-income countries and
is one of the main causes of morbidity and mortality because Mtb is
found in the host without causing symptoms, in the form of latent
tuberculosis. It is estimated that approximately 1.7 billion people
are in this condition, making it difficult to detect
12 Richard Ponce-Cusi et al.

[67]. Furthermore, people in middle countries, such as immigrants

and having immunosuppressive treatments, have an increased risk
of infection [38]. In low-income countries, it is more common in
rural areas of poverty, in people with a low level of education, in
HIV high incidence, and/or with alcoholism problems
[68, 69]. Drug resistance is a main mortality factor, making Mtb
a growing public health problem in the most affected countries.
Antibiotic resistance makes difficult to treat infection and aggra-
vates the condition of patients, prolongs treatment, overloads the
health system by increasing the costs of medical care, and increases
the risk of infection due to the appearance of new strains [3, 70].
The COVID-19 pandemic has negatively affected the progress
against tuberculosis by increasing from 10.1 to 10.6 million
infected, 1.6 million deaths (including people with HIV), 3.6%
increase in incidence in 2021 compared to 2020, and 3% increase
in drug-resistant cases between 2020 and 2021 [40].
Efforts to eradicate this disease are based mainly on three main
measures; (a) primary healthcare focused on timely diagnosis of
high-risk people, treatment, monitoring of drug resistant forms,
vaccination, and patient care support; (b) health policies and sup-
port measures through the financing of prevention, care, and health
promotion programs with the integration of the inhabitants; and
(c) the lines of basic and applied research in different fields of
health, such as biological and social, to generate new forms of
intervention, improve the use of resources, and establish health
promotion strategies [71].
In addition, there have been good results in the application of
measures at different governmental levels in decision making for its
management, as established by the WHO with the END TB plan.
However, the control of latent cases and the treatment of drug-
resistant tuberculosis continue to be a global concern [72]. Further-
more, interventions that change the context are necessary to reduce
the main risk factors such as anemia, alcoholism, smoking, and
malnutrition. In low-income countries, anemia increases the
chances of developing diseases due to low immune levels [73]. In
contrast, the nutritional conditions of obesity and overweight are
associated with a lower probability of developing TB [74].

5.2 COVID-19 Initially, COVID-19 treatment included anti-inflammatory drugs

such as dexamethasone, colchicine, and acetylsalicylic acid, obtain-
ing promising results. Plasma from convalescent patients was eval-
uated in several trials, but without evidence of efficacy
[63]. Vaccination continues to be the best alternative against viral
pathogens; this result has been very favorable because it prevents
infection and protects people up to 95% [75]. In addition, mono-
clonal antibodies and antiretrovirals are a very good option because
they prevent complications and slow the progression of the disease
in hospitalized patients [76, 77].
 The Biology of Host-Pathogen Interaction 13

Fig. 2 Deaths caused by global diseases from 2010 to 2020. During 2010 to 2019, there was a negative trend
in mortality from tuberculosis (TB), malaria, and HIV diseases. According to the WHO, TB mortality decreased
by 14% during this period, equivalent to a decrease of 1.5 million deaths. HIV decreased by 39%, equivalent to
a decrease of 770,000 deaths. Regarding malaria, the mortality rate decreased by 11%, representing a
decrease of 79,000 deaths. In the case of COVID-19, since the beginning of 2020, during the first year, 1.8
million deaths have been reported

The emergence of new viral diseases continues due to animal

farms and markets creating conditions for mutation and transmis-
sion in intermediate hosts such as civets [78] and natural reservoirs
most likely to pangolins [79]; therefore, it is necessary to continue
with molecular epidemiological surveillance to find possible muta-
tions that give greater evasion to vaccines, the immune system, or
existing treatments and thus be able to make early decisions [80].
This pandemic has caused the death of millions around the
world in the first year (Fig. 2). The transmission of the virus is
high and is primarily spread through respiratory droplets released
by coughing, sneezing, or speaking. Although many people have
mild or asymptomatic diseases, others develop severe diseases that
can lead to hospitalization and death. The pandemic has affected
the global economy, changing the way people work, study, and
socialize, and has led to the adoption of isolation measures such
as physical distancing, use of masks, and vaccination. The SARS-
CoV-2 vaccine is crucial to control the spread of the virus and
minimize the impact on the population. Also, early use of antiviral
therapies and other treatments can help prevent disease progression
and reduce the number of hospitalizations and deaths. The ability
to access and distribute these therapeutic approaches in an equita-
ble way for all countries is fundamental for global public health
[63, 81].
14 Richard Ponce-Cusi et al.

5.3 HIV To date, 40.1 million people infected aged between 15 and 49 years
have died from HIV. In 2021, 1.5 million people were infected and
650,000 people died worldwide [82]. Several actions were imple-
mented to reduce HIV spread, i.e., early access to screening tests,
antiretroviral treatment, prevention of mother-child transmission,
awareness of needle use in case of drug addiction, sex education,
and condom use [78–81]. WHO proposed the 90-90-90 plan to
determine that 90% of HIV cases should be detected, 90% of them
should be treated with TAR, and 90% should have had good results
in 2020. However, there are difficulties in reaching these goals, for
example, access to diagnostic tests [83].
Therapeutic approaches to HIV are important to reduce mor-
tality and improve quality of life. In addition, ART also reduces viral
load and therefore the risk of HIV transmission, which is essential
in preventing the spread of infection. Prevention and access to
medical care are also crucial aspects in controlling HIV infections.
The majority of affected people live in low- and middle-income
countries, where access to medical care and ART drugs is limited.
Furthermore, HIV affects vulnerable populations, such as men who
have sex with men, sex workers, and people addicted to drugs [84].
HIV infection affects quality of life and has an economic and
social impact on society. Therefore, prevention and treatment
efforts have a significant impact on reducing disease. These strate-
gies suppress the viral load and prevent the progression of HIV to
AIDS (acquired immunodeficiency syndrome). Access to ART
remains a challenge, and efforts must focus on ensuring equitable
access to appropriate healthcare [85].

5.4 Malaria It represents an important problem in different parts of the world,

particularly in sub-Saharan Africa, where 450,000 deaths were
reported in 2010 to 200,000 in 2016. In addition, different Amer-
ican countries, South Asia Pacific and Eastern, and even some
South African regions have managed to eradicate the epidemic.
However, the regions of Southeast Asia and Africa are the most
affected, despite the fact that in recent decades international efforts
have partially mitigated incidence and mortality [86].
Some challenges against malaria include the following:
(a) Economic factors: insufficient economic resources to acquire
physical and chemical barriers such as mosquito nets, insecti-
cides, and spraying, especially in low-income countries.
(b) Research and treatment: lack of development of more effective
treatments including antiparasitic and vaccines.
(c) Human resources: limited trained personnel in medicine to
reduce mortality through access to effective treatment, diag-
nosis, healthcare, and awareness programs [87, 88].
 The Biology of Host-Pathogen Interaction 15

Generally, most high-incidence countries are the poorest and

have less access to health and educational resources where early
children and pregnant women are at high risk. Malaria exerts a
substantial impact on the economy and development of nations
by decreasing productivity and increasing healthcare costs. Addi-
tionally, this disease requires a comprehensive and collaborative
approach at both national and international levels to improve the
health infrastructure, increase education on disease prevention and
treatment, and improve access to medical care and antimalarial
drugs [89, 90].

6 Conclusion

In summary, it has been shown a comprehensive overview of the

complex interactions between hosts and pathogens, highlighting
the importance of understanding molecular mechanisms, including
the evasion of the immune system by pathogens and the modula-
tion of host immune responses. It is vital to know about the
development of pharmacological treatments for infectious diseases,
including the use of drugs that target specific molecular mechan-
isms involved in host-pathogen interactions. This chapter empha-
sized the development of new treatments that are effective against a
wide range of pathogens with minimal side effects, indicating the
need for continued research into the molecular mechanisms
involved in host-pathogen interactions, as well as the development
of new technologies for the rapid diagnosis and treatment of infec-
tious diseases. In general, this chapter reviewed valuable insights
into the complex interactions between hosts and pathogens and the
molecular mechanisms involved in these interactions, highlighting
the importance of interdisciplinary research in the fields of micro-
biology, immunology, and pharmacology for the development of
new treatments for infectious diseases and concluding in the need
for continued research and collaboration in these areas to address
the ongoing threat of infectious diseases to global health.

References
1. Woolhouse MEJ, Webster JP, Domingo E et al
(2002) Biological and biomedical implications
of the co-evolution of pathogens and their
hosts. Nat Genet 32:569–577
2. Cohen SB, Gern BH, Delahaye JL et al (2018)
Alveolar macrophages provide an early myco-
bacterium tuberculosis niche and initiate dis-
semination. Cell Host Microbe 24:439–446
3. Singh R, Dwivedi SP, Gaharwar US et al
(2020) Recent updates on drug resistance in
mycobacterium tuberculosis. J Appl Microbiol
128:1547–1567
4. Anstee DJ (2010) The relationship between
blood groups and disease. Blood 115:4635–
4643
5. Franchini M, Bonfanti C (2015) Evolutionary
aspects of ABO blood group in humans. Clin
Chim Acta 444:66–71
6. Rowe JA, Handel IG, Thera MA et al (2007)
Blood group O protects against severe
16 Richard Ponce-Cusi et al.
plasmodium falciparum malaria through the
mechanism of reduced rosetting. Proc Natl
Acad Sci U S A 104:17471–17476
7. Howes RE, Patil AP, Piel FB et al (2011) The
global distribution of the Duffy blood group.
Nat Commun 2:226
8. Stucki D, Brites D, Jeljeli L et al (2016) Myco-
bacterium tuberculosis lineage 4 comprises
globally distributed and geographically
restricted sublineages. Nat Genet 48:1535–
1543
9. Duarte R, Lönnroth K, Carvalho C et al
(2018) Tuberculosis, social determinants and
co-morbidities (including HIV). Pulmonology
24:115–119
10. Freschi L, Vargas R, Husain A et al (2021)
Population structure, biogeography and trans-
missibility of mycobacterium tuberculosis. Nat
Commun 12:1–11
11. Sironi M, Cagliani R, Forni D, Clerici M
(2015) Evolutionary insights into host-
pathogen interactions from mammalian
sequence data. Nat Rev Genet 16:224–236
12. Smith AC, Morran LT, Hickman MA (2022)
Host defense mechanisms induce genome
instability leading to rapid evolution in an
opportunistic fungal pathogen. Infect Immun
90:e0032821
13. Papkou A, Schalkowski R, Barg MC et al
(2021) Population size impacts host-pathogen
coevolution. Proc Biol Sci 288:20212269
14. Lin MJ, Rachleff VM, Xie H et al (2022) Host-
pathogen dynamics in longitudinal clinical spe-
cimens from patients with COVID-19. Sci Rep
12:1–11
15. Gu H, Quadeer AA, Krishnan P et al (2023)
Within-host genetic diversity of SARS-CoV-
2 lineages in unvaccinated and vaccinated indi-
viduals. Nat Commun 14:1–14
16. Seid A, Berhane N, Abayneh T, Tesfaye S
(2021) Impacts of pathogen-host-drug inter-
action in the evolution and spread of
antimicrobial-resistant pathogens. Microbes
Infect Dis 3:286–295
17. Rapisarda C, Tassinari M, Gubellini F, Fronzes
R (2018) Using Cryo-EM to investigate bacte-
rial secretion systems. Annu Rev Microbiol 72:
231–254
18. Costa TRD, Felisberto-Rodrigues C, Meir A
et al (2015) Secretion systems in gram-negative
bacteria: structural and mechanistic insights.
Nat Rev Microbiol 13:343–359
19. Miletic S, Goessweiner-Mohr N, Marlovits TC
(2020) The structure of the type III secretion
system needle complex. Curr Top Microbiol
Immunol 427:67–90
20. Slater SL, Sågfors AM, Pollard DJ et al (2018)
The type III secretion system of pathogenic
Escherichia coli. In: Frankel G, Ron E (eds)
Escherichia coli, a versatile pathogen, Current
topics in microbiology and immunology, vol
416. Springer, Heidelberg, pp 51–72
21. Plano GV, Schesser K (2013) The Yersinia pes-
tis type III secretion system: expression, assem-
bly and role in the evasion of host defenses.
Immunol Res 57:237–245
22. Maginnis MS (2018) Virus-receptor interac-
tions: the key to cellular invasion. J Mol Biol
430:2590–2611
23. Grove J, Marsh M (2011) The cell biology of
receptor-mediated virus entry. J Cell Biol 195:
1071–1782
24. Handschuh J, Amore J, Müller AJ (2020)
From the cradle to the grave of an infection:
host-pathogen interaction visualized by intravi-
tal microscopy. Cytometry A 97:458–470
25. Chandra P, Grigsby SJ, Philips JA (2022)
Immune evasion and provocation by mycobac-
terium tuberculosis. Nat Rev Microbiol 20:
750–766
26. Thorne LG, Bouhaddou M, Reuschl AK et al
(2022) Evolution of enhanced innate immune
evasion by SARS-CoV-2. Nature 602:487–495
27. Santacroce L, Charitos IA, Carretta DM et al
(2021) The human coronaviruses (HCoVs)
and the molecular mechanisms of SARS-CoV-
2 infection. J Mol Med 99:93–106
28. Bour S, Perrin C, Akari H, Strebel K (2001)
The human immunodeficiency virus type
1 Vpu protein inhibits NF-κB activation by
interfering with βTrCP-mediated degradation
of IκB. J Biol Chem 276:15920–15928
29. Zhang Y, Chen Y, Li Y et al (2021) The ORF8
protein of SARS-CoV-2 mediates immune eva-
sion through down-regulating MHC-I. Proc
Natl Acad Sci U S A 118:1–12
30. Piguet V, Trono D (2001) Living in oblivion:
HIV immune evasion. Semin Immunol 13:51–
57
31. Bernet J, Ahmad M, Mullick J et al (2011)
Disabling complement regulatory activities of
vaccinia virus complement control protein
reduces vaccinia virus pathogenicity. Vaccine
29:7435–7443
32. Liszewski MK, Leung MK, Hauhart R et al
(2006) Structure and regulatory profile of the
monkeypox inhibitor of complement: compar-
ison to homologs in vaccinia and Variola and
evidence for dimer formation. J Immunol 176:
3725–3734
33. Saito F, Hirayasu K, Satoh T et al (2017)
Immune evasion of plasmodium falciparum
 The Biology of Host-Pathogen Interaction
by RIFIN via inhibitory receptors. Nature 552:
101–105
34. Zhou H, Xu M, Huang Q et al (2008)
Genome-scale RNAi screen for host factors
required for HIV replication. Cell Host
Microbe 4:495–504
35. Brass AL, Dykxhoorn DM, Benita Y et al
(2008) Identification of host proteins required
for HIV infection through a functional geno-
mic screen. Science 319:921–926
36. Appelberg R, Moreira D, Barreira-Silva P et al
(2015) The Warburg effect in mycobacterial
granulomas is dependent on the recruitment
and activation of macrophages by interferon-
γ. Immunology 145:498–507
37. Singh V, Jamwal S, Jain R et al (2012) Myco-
bacterium tuberculosis-driven targeted recali-
bration of macrophage lipid homeostasis
promotes the foamy phenotype. Cell Host
Microbe 12:669–681
38. Boom HW, Schaible UE, Achkar JM (2021)
The knowns and unknowns of latent mycobac-
terium tuberculosis infection. J Clin Invest 131:
e136222
39. Glaziou P, Floyd K, Raviglione MC (2018)
Global epidemiology of tuberculosis. Semin
Respir Crit Care Med 39:271–285
40. Bagcchi S (2023) WHO’s global tuberculosis
report 2022. Lancet Microbe 4:e20
41. Khan A, Singh VK, Hunter RL, Jagannath C
(2019) Macrophage heterogeneity and plastic-
ity in tuberculosis. J Leukoc Biol 106:275–282
42. Suárez I, Fünger SM, Rademacher J et al
(2019) The diagnosis and treatment of tuber-
culosis. Dtsch Arztebl Int 116:729–735
43. Dheda K, Gumbo T, Maartens G et al (2017)
The epidemiology, pathogenesis, transmission,
diagnosis, and management of multidrug-
resistant, extensively drug-resistant, and incur-
able tuberculosis. Lancet Respir Med 5:291–
360
44. Sia JK, Rengarajan J (2019) Immunology of
mycobacterium tuberculosis infections. Micro-
biol Spectr 7:1–37
45. Berns SA, Isakova JA, Pekhtereva PI (2022)
Therapeutic potential of interferon-gamma in
tuberculosis. ADMET DMPK 10:63–73
46. Alsultan A, Peloquin CA (2014) Therapeutic
drug monitoring in the treatment of tubercu-
losis: an update. Drugs 74:839–854
47. Zumla A, Chakaya J, Centis R et al (2015)
Tuberculosis treatment and management-an
update on treatment regimens, trials, new
drugs, and adjunct therapies. Lancet Respir
Med 3:220–234
17
48. Menzeis D, Pai M, Comstock G (2007) Meta-
analysis: new tests for the diagnosis of latent
tuberculosis infection: areas of uncertainty and
recommendations for research. Ann Intern
Med 146:340–354
49. Bouzeyen R, Javid B (2022) Therapeutic vac-
cines for tuberculosis: an overview. Front
Immunol 13:1–10
50. UNAIDS. Fact Sheet (2022) World tuberculo-
sis day. UNAIDS
51. Chou R, Evans C, Hoverman A et al (2019)
Preexposure prophylaxis for the prevention of
HIV infection: evidence report and systematic
review for the US preventive services task force.
J Am Med Assoc 321:2214–2230
52. Thompson MA, Aberg JA, Hoy JF et al (2012)
Antiretroviral treatment of adult HIV infec-
tion. J Am Med Assoc 308:387–402
53. HHS panel on antiretroviral guidelines for
adults and adolescents. Guidelines for the use
of antiretroviral agents in adults and adoles-
cents with HIV (2022) 1–604.
Available from: https://clinicalinfo.hiv.gov/
en/guidelines/adult-and-adolescent-arv
54. Meek TD (1992) Inhibitors of HIV-1 prote-
ase. J Enzyme Inhib Med Chem 6:65–98
55. Keedy KS, Pharm AD, Margolis DM (2010)
Therapy for persistent HI. Trends Pharmacol
Sci 31:206–211
56. Atta MG, De Seigneux S, Lucas GM (2019)
Clinical pharmacology in HIV therapy. Clin J
Am Soc Nephrol 14:435–444
57. Saag MS, Gandhi RT, Hoy JF et al (2020)
Antiretroviral drugs for treatment and preven-
tion of HIV infection in adults: recommenda-
tions of the international antiviral society-USA
panel. J Am Med Assoc 324:1651–1669
58. Olliaro P, Wells TNC (2009) The global port-
folio of new antimalarial medicines under
development. Clin Pharmacol Ther 85:584–
595
59. Expanded Table: Drugs for Malaria Prophy-
laxis (online only) (2023) The Medical Letter
Inc. [Internet]. Available from: https://secure.
medicalletter.org/TML-article-1575e
60. Wells TNC, Van Huijsduijnen RH, Van Voor-
his WC (2015) Malaria medicines: a glass
half full? Nat Rev Drug Discov 14:424–442
61. Palacpac NMQ, Horii T (2020) Malaria vac-
cines: facing unknowns. F1000Research 9:
F1000
62. Wang C, Horby PW, Hayden FG, Gao GF
(2020) A novel coronavirus outbreak of global
health concern. Lancet 395:470–473
63. Drożdżal S, Rosik J, Lechowicz K et al (2021)
An update on drugs with therapeutic potential
18 Richard Ponce-Cusi et al.
for SARS-CoV-2 (COVID-19) treatment.
Drug Resist Updat 59:100794
64. Binns C, Low WY (2015) What is public
health? Asia-Pac J Public Heal 27:5–6
65. Halaji M, Farahani A, Ranjbar R et al (2020)
Emerging coronaviruses: first SARS, second
MERS and third SARS-COV-2. Epidemiologi-
cal updates of COVID-19. Infez Med 28:6–17
66. Cai J, Deng X, Yang J et al (2022) Modeling
transmission of SARS-CoV-2 omicron in
China. Nat Med 28:1468–1475
67. Houben RMGJ, Dodd PJ (2016) The global
burden of latent tuberculosis infection: a
re-estimation using mathematical modelling.
PLoS Med 13:1–13
68. Rengganis Wardani DWS, Wahono EP (2017)
Prediction model of tuberculosis transmission
based on its risk factors and socioeconomic
position in Indonesia. Indian J Commun Med
42:204208
69. Bastos SH, Taminato M, Fernandes H et al
(2019) Sociodemographic and health profile
of TB/HIV co-infection in Brazil: a systematic
review. Rev Bras Enferm 72:1389–1396
70. Lange C, Chesov D, Heyckendorf J et al
(2018) Drug-resistant tuberculosis: an update
on disease burden, diagnosis and treatment.
Respirology 23:656–673
71. World Health organization. Global Tuberculo-
sis report (2022) license: c. 2022. 68 p
72. Zou Z, Liu G, Hay SI et al (2022) Time trends
in tuberculosis mortality across the BRICS: an
age-period-cohort analysis for the GBD 2019.
eClinicalMedicine 53:101646
73. Gelaw Y, Getaneh Z, Melku M (2021) Anemia
as a risk factor for tuberculosis: a systematic
review and meta-analysis. Environ Health Prev
Med 26:1–15
74. Yen YF, Hu HY, Lee YL et al (2017) Obesity/
overweight reduces the risk of active tubercu-
losis: a nationwide population-based cohort
study in Taiwan. Int J Obes 41:971–975
75. Polack FP, Thomas SJ, Kitchin N et al (2020)
Safety and efficacy of the BNT162b2 mRNA
Covid-19 vaccine. N Engl J Med 383:2603–
2015
76. Hooper AT, Somersan-Karakaya S, McCarthy
SE et al (2022) Casirivimab and imdevimab
treatment reduces viral load and improves clin-
ical outcomes in seropositive hospitalized
COVID-19 patients with non-neutralizing or
borderline neutralizing antibodies. MBio1 3:
1–13
77. Beigel JH, Tomashek KM, Dodd LE et al
(2020) Remdesivir for the treatment of
Covid-19 – final report. N Engl J Med 383:
1813–1826
78. Cheng VCC, Lau SKP, Woo PCY, Kwok YY
(2007) Severe acute respiratory syndrome
coronavirus as an agent of emerging and ree-
merging infection. Clin Microbiol Rev 20:
660–694
79. Liu P, Jiang JZ, Wan XF et al (2020) Are pan-
golins the intermediate host of the 2019 novel
coronavirus (SARS-CoV-2)? PLoS Pathog 16:
1–13
80. Tosta S, Moreno K, Schuab G et al (2023)
Global SARS-CoV-2 genomic surveillance:
what we have learned (so far). Infect genet
Evol 108:105405
81. Lu R, Zhao X, Li J et al (2020) Genomic
characterisation and epidemiology of 2019
novel coronavirus: implications for virus ori-
gins and receptor binding. Lancet 395:565–
574
82. World Health Organization. HIV. THE
GLOBAL HEALTH OBSERVATORY
(2023). Available from: https://www.who.
int/data/gho/data/themes/hiv-aids
83. Sohail M, Levitan EB, Rana AI et al (2020)
Estimating the first 90 of the UNAIDS
90-90-90 goal: a review. J Int Assoc Provid
AIDS Care 19:2325958220919290
84. HIV (2023). Available from: https://www.
who.int/data/gho/data/themes/hiv-aids
85. World Health Organization (2016) Consoli-
dated guidelines on the use of antiretroviral
drugs for treating and preventing HIV infec-
tion: recommendations for a public health
approach. WHO, France
86. Murray CJL, Rosenfeld LC, Lim SS et al
(2012) Global malaria mortality between
1980 and 2010: a systematic analysis. Lancet
379:413–431
87. Barofsky J, Anekwe TD, Chase C (2020)
Malaria eradication and economic outcomes
in sub-Saharan Africa: evidence from Uganda.
J Health Econ 44:118–136
88. Shretta R, Avanceña ALV, Hatefi A (2016) The
economics of malaria control and elimination: a
systematic review. Malar J 15:1–14
89. Snow RW, Guerra CA, Noor AM et al (2005)
The global distribution of clinical episodes of
plasmodium falciparum malaria. Nature 434:
214–217
90. Alonso PL, Brown G, Arevalo-Herrera M et al
(2011) A research agenda to underpin malaria
eradication. PLoS Med 8:e1000406
 Chapter 2

Genetic Association Studies in Host-Pathogen Interaction

Analysis
Marina Laplana, José Luis Royo, and Luis Miguel Real

Abstract
Studying host-pathogen interactions at a molecular level has always been technically challenging. Identify-
ing the different biochemical and genetic pathways involved in the different stages of infection traditionally
require complex molecular biology tools and often the use of costly animal models. In this chapter, we
illustrate a complementary approach to address host-pathogen interactions, taking advantage of the natural
interindividual genetic diversity. The application of genetic association studies allows us to identify alleles
involved in infection progression or resistance. Thus, this strategy may be useful to unravel new molecular
pathways underlying host-pathogen interactions. Here we present the general steps that might be followed
to plan, execute, and analyze a population-based study in order to identify genetic variants affecting human
exposition to pathogens.

Key words Host-pathogen genetics, Association study, Case-control study, Study design, Suscepti-
bility, Polymorphism, Human genetics

1 Introduction

The main interest that leads to host-pathogen interaction studies

relies in the development of new strategies for infection treatment
and prevention, which require as an initial step the identification of
the molecular pathways involved in these interactions. However, it
is well established that the study of host-pathogen interactions is
technically challenging and requires complex molecular biology
tools that are discussed along the different chapters of this volume.
A different approach may take advantage of the variability in the
susceptibility to the infection, or the altered infection progression
from a population genetics perspective to discover novel molecular
pathways underlying host-pathogen interactions. Both phenotypes,
low susceptibility to infections and disease progression rate, are
complex traits that depend on two factors, the environment
(including pathogen related) and host genetic variability. Previous

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_2,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

19
20 Marina Laplana et al.

works analyzing the contribution of the host genetic component to

susceptibility to different infectious diseases such as tuberculosis,
type-B hepatitis, leprosy, and poliomyelitis provided an estimation
ranging from 32 to 53% depending on the population studied and
the infectious agent [1]. These results highlight the importance of
host genetic factor backgrounds, although this may have a different
role depending on the pathogen [2]. One of the most relevant
examples was found in the late 1990s for the Human Immunodefi-
ciency Virus (HIV). Authors found a relatively common mutation
consisting of a deletion of 32 base pairs within the CCR5 gene, a
coreceptor of the HIV, that confers to the homozygotes carriers an
almost absolute resistance to HIV infection [3, 4]. This finding
paved the road to the development of Maravidoc™, an antagonist
of CCR5, which is currently used as a treatment of HIV infection.
Moreover, this discovery based the new genetic therapy strategies
for the total eradication of HIV infection. More recently, several
studies have been addressed to fight the Covid-19 pandemic. In
this urgent scenario, the identification of host genetic variants
involved in virus spread and disease severity was crucial. The Severe
Covid-19 GWAS Group reported associated genetic variants that
contribute to Covid-19 susceptibility in patients with respiratory
failure at loci3p21.31 and 9q34.2, the last one containing the ABO
blood-group locus [5], whose role in the disease is still under
discussion. Thus, the study of the role of genetic variants in com-
plex traits can provide valuable information about the molecular
processes affecting host-pathogen interactions. Moreover, some of
them might have a translational potential and be relevant from the
clinical point of view. Here we present the general steps that might
be followed to plan, execute, and analyze a population-based study
to identify genetic variants affecting human exposure to pathogens.

2 Case and Control Selection and Power Estimation

In the early 1920s, Sir Ronald Fisher showed that a complex

quantitative trait could be explained by Mendelian inheritance if
several genes affect the trait [6]. A single locus with two alleles of
equal frequency results in three genotypes (Fig. 1a). Assuming a
simple relationship in which the allelic effects are additive, the three
genotypes produce three phenotypes. For qualitative traits such as
those studied by Mendel, the allelic effects showed complete dom-
inance, and therefore, only two phenotypes were observed. Assum-
ing additive effects, two loci generate nine genotypes and five
phenotypes (Fig. 1b), and three loci generate 27 genotypes and
seven phenotypes [7]. Following this rationale, complex quantita-
tive traits with a significant genetic component have a polygenic
nature (Fig. 1c).
 Host-Pathogen Genetics 21

Fig. 1 Complex quantitative traits can be explained by Mendelian laws consid-

ering a polygenic nature. Increasing the number of genes (panels a–c) affecting
a quantitative trait generates the wide spectrum of phenotypes observed in
natural populations

The objective of genetic association studies is the identification

of genetic variants involved in the appearance of these traits. The
design behind these studies is based on the higher frequency of
such variants in groups of affected individuals if compared with
groups of individuals who do not show the trait (non-affected).
This means finding loci in which cases are “identical by state” (that
is, the fact of sharing a genotype because of sharing a phenotype).
22 Marina Laplana et al.

Therefore, it is very important to establish strict selection criteria

that allow us to clearly define which individuals must be considered
as cases and which ones must be considered as controls. To do so, it
is important to consider beforehand other variables that could
affect the results such as age, gender, or ethnic background
among others, to have a similar distribution in cases and controls
and avoid results bias. In addition, the possibility of sharing a
genotype based on potential inbreeding (“identical by descent,”
that is, the fact of sharing a genotype because of relationship)
should be controlled, and those individuals with familiar relation-
ship with another participant must be excluded. The critical issue in
our study will be inherent to the phenotype we may be interested
in. If the cases share the same ancestral causative variant, we face
what is called a “founder effect,” and our chances to distinguish an
altered allele frequency increase. The trait under study may, how-
ever, be the independent consequence of genetic changes in multi-
ple loci (Fig. 2a). This is known as genetic heterogeneity and may
compromise the statistical power, since only a small proportion of
our cases will be showing the mutant genotype. On top of this, each
locus may have more than one mutant allele (Fig. 2b). This is called
allelic heterogeneity, and since each mutant allele may be in a
different haplotype, we might not be detecting the enrichment in
the mutant allele in the cases subseries. In these situations, a large
sample of cases and controls could increase the statistical power to
detect them.

Fig. 2 Genetic versus allelic heterogeneity. Panel (a) reflects genetic heterogeneity, where mutant alleles
influence the appearance of the studied phenotype. Panel (b) shows a typical case of allelic heterogeneity,
where different haplotypes harbor different mutations
 Host-Pathogen Genetics 23

Fig. 3 Graphical representation of the infection risk of a population. Panel (a)

represents a theoretical normal distribution of a hypothetical random population.
Panels (b) and (c) represent the bias on the infection risk, therefore changing the
genetic pool when compared to the random population

To study the low susceptibility or resistance to infection, the

cases are usually defined as those individuals who have been in
contact with a pathogen without getting infected (exposed but
not infected or ENI), whereas controls are represented by infected
individuals. This scenario is the ideal one, since genetic differences
between both groups are maximized (Fig. 3). As controls we can
also use non-selected individuals from general population when
ENI individuals are scarce. Because ENI individuals exist as part
of the general population, this kind of controls will reduce the
probability of finding statistically significant differences (discussed
below). However, the results obtained will be more robust since
they were observed despite the existence of a bias in the control
group. Another advantage of using non-selected population con-
trols is that there is a lower probability of introducing a bias during
the selection of individuals.
As aforementioned, finding ENI individuals is a critical point to
obtain significant results, especially in the verification of the truly
exposition to the pathogen that allows us to classify them as geneti-
cally resistant. For instance, to select hepatitis C virus (HCV) ENI
individuals, it has been proposed a score mainly based on the
24 Marina Laplana et al.

frequency and duration of risk habits [8]. Similarly, in the case of

the resistance to HIV infection, different criteria have been estab-
lished to select those HIV ENI individuals mainly based in the
period of time practicing risk habits [9, 10].
Instead, infected individuals could be selected as controls (with
no genetic variants for infection resistance) and individuals from
general population as cases assuming that, despite no exposure to
infection, some will have variants for resistance. This type of
approach can only be implemented to detect genetic variants with
a strong effect due to its low statistical power. Therefore, this
strategy has been used when resistant individuals are very scarce
[4, 11]. Another relevant point in genetic association studies is the
required number of individuals that must be included in the study.
Whenever a genetic comparison between two populations is per-
formed, two potential results can arise. We may find a statistically
significant difference (p-value obtained lower than our alpha
threshold) or not (p-value greater than our alpha). In the last
case, we may consider the possibility of being in front of a false-
negative result given a low statistical power. A false negative can be
defined as the likelihood of assuming that cases and controls have
the same genetic distribution when they are truly different. This is
also known as type II error. In order to have a good experimental
design, it is recommended to calculate a priori the statistical power
of your study which will contribute to select the appropriate num-
ber of individuals. Some easy tools can be used for this purpose
(Episheet20015, Kenneth Rothman, Spread sheets for the analysis
of Epidemiological data, www.krothman.org/episheet.xls); also
there are R packages that can perform the calculations [12] (pwr,
simr, osDesign, epiR, samplesizelogisticcasecontrol). Intuitively,
we can assume that the larger the sample size and the less conserva-
tive we are in setting an alpha, the higher sensitive our study will
be. This means that we will be able to detect as statistically signifi-
cant even small differences in allele frequencies. Statistical power
also depends on parameters such as the allele frequency in the study
population and the case-control ratio. Since economic issues must
also be considered, it is generally assumed as correct to have 80%
detection power.

3 Gene Variant Selection

From all reported variants in the genome, not all have a functional
impact that affects protein expression or enzyme activity. Several
bioinformatics approaches have been proposed to select for analysis
only those genetic markers with a higher likelihood of being asso-
ciated to a certain phenotype. However, the reality is that functional
variants must be captured using statistical approaches. The main
 Host-Pathogen Genetics 25

principle that should be clear is that whenever during evolution a

functional variant appeared, it laid in a particular haplotype and no
other. As centuries passed, meiotic events subjected that particular
chromosome to a number of recombination events that split the
information in linkage blocks (Fig. 2). Nowadays, the identification
of an overrepresented genetic variant in a group of individuals
under study indicates that on the same haplotype from its linkage
disequilibrium block, there is a functional variant that contributes
to explain our phenomenon. Depending on the project strategy,
the genetic component of the phenotype under study, and, obvi-
ously, the available budget, researchers may choose to conduct a
candidate-gene approach or a genome-wide association study. Can-
didate gene studies can be designed following two different strate-
gies. The first one centers the analysis in the evaluation of genetic
variants assigned as potentially functional based on information
reported in previous studies. The second strategy involves the
selection of tag markers. This is a selection of genetic variants that
capture the haplotypic diversity described in the population. Using
the first approach, we may have significant results with relatively
small sample sizes; however if an unreported or unknown func-
tional variant is present in a non-analyzed haplotype, we face a
negative result even when the gene is highly involved in the studied
phenotype. On the contrary, using single-tag nucleotide poly-
morphisms (SNPs) usually requires larger series of patients and
controls. The advantage in this way comes from the certainty of
analyzing the entire haplotypic diversity of a selected gene. The
higher exponent of this strategy is the genome-wide association
study (GWAS). The most remarkable characteristic of these studies
is that they are considered “hypothesis-free.” In other words, there
is no prior assumption about the relation of a gene with the studied
phenotype. GWAS can involve SNPs distributed all over the
genome ranging from hundreds of thousands of variants when
using arrays to millions when performing next-generation sequenc-
ing. We can therefore assure that a high proportion of the haplo-
typic diversity is captured. The major drawback is, as can be
anticipated, data analysis. There is some software such as Plink
(http://pngu.mgh.harvard.edu/purcell/plink/) [13] specially
designed for performing these genetic studies. However, given
the large amount of assays, the number of false positives is huge.
A common strategy is to use more stringent p-values, following, for
instance, multiple testing corrections. The consequence is that this
increases the number of false-negative results. Therefore, the com-
mon strategy involves an initial GWAS, the selection of a set of the
best candidates, and a replication study on an independent group of
patients and controls. All this makes this type of study expensive
and long-lasting.
26 Marina Laplana et al.

4 Data Analysis Strategies

The initial steps of data analysis involve quality control of the

experiment. Routinely, DNA markers with a genotyping call rate
below 90% are excluded. In a similar way, samples with missing
genotypes above 20% of the markers are also excluded, especially
when a high number of markers are being analyzed. Moreover, and
depending on the cohort size, we recommend including in the
experiment between 3 and 5% duplicated samples, normally at the
end of the well plates. This will allow to detect potential genotyping
errors. A common accepted threshold for duplicate concordance is
above 95%. The next step in the quality control will be to test the
Hardy-Weinberg equilibrium (HWE) in cases and controls. If the
genotypic distribution is in accordance with HWE, especially in
controls, we could assume that we have not introduced bias in
their selection processes. Moreover, the HWE is an additional
control of the genotyping work since a deviation of this equilibrium
could be indicating a cross-contamination of DNA samples or a
problem in the genotyping design. These assumptions are applica-
ble to the control group, since a deviation of the HWE exclusively
found among cases could indicate a high effect of the genetic
variant in the complex trait analyzed. Genetic association studies
are based in the comparison of genotypic distribution between
cases and controls. This allows us to know if a genetic variant is
more represented in a group and, therefore, if it is associated with
the presence of the trait analyzed. To do that, when a small number
of SNPs are interrogated, we can employ web-assisted tools like
Openepi, an Open Source Software for Public Health (www.
OpenEpi.com) [14] in which the analysis must be performed one
by one, or using software like SNPstats, developed at the University
of Barcelona (http://bioinfo.iconcologia.net/SNPstats) [15]. This
last tool does a systematic comparison of the genotype distribution
between cases and controls, assuming recessive, dominant, and
codominant models of inheritance to determine the best-fitting
genetic model. For a larger number of SNPs (hundreds to
millions), specialized software shall be used. The most extended
one is, as aforementioned, Plink [13]; GEMMA software is also
commonly used for GWAS [16]. Both are command-based applica-
tions that have been proven to be extremely powerful. All these
tools also calculate the HWE for cases and controls. If the analysis
approach is Bayesian (probabilistic) rather than frequentist, other
software such as BayesR can be used [17]. For a further characteri-
zation and subsequent analyses, we recommend the use of more
conventional statistical software such as SPSS (IBM Corporation,
Somers, NY, USA) or STATA (STATA Corporation, College Sta-
tion, TX, USA) or R software if big amounts of data should be
employed.
 Host-Pathogen Genetics 27

5 Limitations of Genetic Association Studies

The occurrence of false-positive results in genetic association stud-

ies is an inherent problem. There are two possible ways to limit the
effect of this problem: application of multiple testing corrections to
the obtained p-values and validation of the results in a different
sample set. Actually, it is quite common to apply both strategies if
the number of evaluated variants is very large, like in GWAS or
sequencing approaches. Correcting for multiple testing is specially
required by GWAS. As a consequence, it is necessary to analyze
large sample sets to detect low penetrant mutations [18]. This is
another reason why these studies are costly. Despite this, the results
obtained by genetic association studies must be validated in an
independent series or, alternatively, make a random selection in
two groups and determine if the difference observed is consistently
detected in both subseries with identical genetic effect. Despite
these problems, we have to take into account that an interaction
between different genetic variants could be underlying the effect of
the host genetics on the onset of complex traits (epistasis). This will
require to make use of tools that allow us to identify such genetic
interactions. Although some groups have developed different
approaches to evaluate epistatic interactions [19, 20], the analysis
and interpretation is still arduous. Finally, the advantage of the
association studies is to determine which are the most important
genes involved in a particular trait. Therefore, although these stud-
ies do not give clues about the mechanism that underlie the associ-
ation, they point out where we must focus the research to
understand these mechanisms.

6 Illustrative Examples

The hepatitis C virus (HCV) is spontaneously cleared by the 30% of

the infected individuals, whereas the rest of them become chroni-
cally infected. Using a GWAS approach, the rs8099917 genetic
variant, close to IFNL3 and INFL4 genes, was associated to this
outcome [21]. Previously, other GWAS associated the rs12979860
variant, in strong linkage disequilibrium with rs8099917 and
mapped within IFNL4 and close to INFL3, with the response to
treatment against HCV [22]. In fact, rs12979860 genotyping
provided useful information for individualizing the management
of patients with chronic hepatitis C [23, 24]. These approaches
point out that these interferons are important to understand the
interaction of human immune system and HCV. Interestingly, none
of these variants have been proven to have functional role, but these
studies focused the attention on the molecular mechanism that has
to be explored. Consequently, it has been reported that
28 Marina Laplana et al.

rs368234815, a genetic variant in high linkage disequilibrium with

rs12979860, has a functional effect that could explain the associa-
tion previously reported [25]. In addition, it has been hypothesized
that these interferons could also have an important role in the
susceptibility to HIV infection. Recently, a candidate gene
approach based on this hypothesis has reported an association
between a lower susceptibility to HIV infection and the
rs368234815 genetic variant [9]. This result reinforces the impor-
tance of these molecules in the fight against these retroviruses.
During the Covid-19 pandemic, the research community rap-
idly focused the efforts in deciphering the mechanisms behind Sars-
CoV-2 infection and disease progression. Among the incredible
number of studies launched at that time, host-pathogen interaction
and host genetic analysis were key to start to understand the
mechanisms of infection susceptibility, risk of respiratory failure,
and increased risk of mortality. Among these studies, a GWAS
reported 2 loci, 3p21.31 and 9q34.2, associated to Covid-19 sus-
ceptibility in patients with respiratory failure [5]. The lead SNP
rs11385942 located in LZTFL1 geneat 3p21.31 was the highest
signal of an associated region containing SLC6A20, LZTFL1,
CCR9, FYCO1, CXCR6, and XCR1 genes. Similar results were
found for rs11385942, reported as an important risk factor for
hospitalization in Colombian population [26]. A different study
reported rs17713054 as a probable causative variant in 3p21.31
affecting an enhancer sequence causing upregulation of LZTFL1
gene [27]. LZTFL1 plays an important role in a key pathway for
viral response in lung cells, thus becoming an interesting candidate
for therapeutic approaches. This is a recent example of how unex-
pected genes identified by GWAS that have been validated in a
different sample may have a key role in the development of thera-
peutic strategies of infectious diseases.

7 Conclusions

Our goal with this chapter is to illustrate the different tools available
for population genetics to discover genes or pathways involved in
host-pathogen interactions. A schematic diagram is represented in
Fig. 4. The strategy successfully followed led to the identification of
a handful of human genetic variants that confer some individuals a
certain degree of protection against pathogens. Importantly, the
hypothesis free association studies, or GWAS, applied to this field
can identify unexpected important relations that would be hard to
discover using other approaches. This fact accelerates the knowl-
edge of host genetic interactions and open ways for the develop-
ment of new therapeutic strategies.

Fig. 4 Genetic association studies analysis flowchart
References
1. Cooke GS, Hill AV (2001) Genetics of suscep-
tibility to human infectious disease. Nat Rev
Genet 2:967–977
2. Kimman T (2001) Genetics of infectious dis-
ease susceptibility. Springer, Berlin
3. Dean M, Carrington M, Winkler C et al (1996)
Genetic restriction of HIV-1 infection and pro-
gression to AIDS by a deletion allele of the
CKR5 structural gene. Haemophilia growth
and development study, multicenter AIDS
cohort study, multicenter Haemophilia cohort
study, San Francisco City Cohort, ALIVE
study. Science 273:1856–1862
4. Samson M, Libert F, Doranz BJ et al (1996)
Resistance to HIV-1 infection in Caucasian
Host-Pathogen Genetics 29
individuals bearing mutant alleles of the
CCR-5 chemokine receptor gene. Nature
382:722–725
5. The Severe Covid-19 GWAS Group (2020)
Genome-wide association study of severe
Covid-19 with respiratory failure. N Engl J
Med 383:1522–1534
6. Fisher A (1918) The correlation between rela-
tives on the supposition of Mendelian inheri-
tance. Trans R Soc Edinb 53:399–433
7. Plomin R, Haworth CM, Davis OS (2009)
Common disorders are quantitative traits. Nat
Rev Genet 10:872–878
8. Sugden PB, Cameron B, Luciani F, Lloyd AR
(2014) Exploration of genetically determined
30 Marina Laplana et al.
resistance against hepatitis C infection in high-
risk injecting drug users. J Viral Hepat 21:e65–
e73
9. Real LM, Herrero R, Rivero-Juárez A et al
(2015) IFNL4 rs368234815 polymorphism is
associated with innate resistance to HIV-1
infection. AIDS 29:1895–1897
10. Sironi M, Biasin M, Gnudi F et al (2014) A
regulatory polymorphism in HAVCR2 modu-
lates susceptibility to HIV-1 infection. PLoS
One 9:e106442
11. McLaren PJ, Coulonges C, Ripke S et al
(2013) Association study of common genetic
variants and HIV-1 acquisition in 6,300
infected cases and 7,200 controls. PLoS
Pathog 9:e1003515
12. R Core Team (2022) R: a language and envi-
ronment for statistical computing. R Founda-
tion for Statistical Computing, Vienna.
https://www.R-project.org/
13. Purcell S, Neale B, Todd-Brown K et al (2007)
PLINK: a tool set for whole-genome associa-
tion and population-based linkage analyses.
Am J Hum Genet 81:559–575
14. Sullivan KM, Dean A, Soe MM (2009) Open-
Epi: open source epidemiologic statistics for
public health. Public Health Rep 124:471–474
15. Solé X, Guinó E, Valls J et al (2006) SNPStats:
a web tool for the analysis of association stud-
ies. Bioinformatics 22:1928–1929
16. Zhou X, Stephens M (2012) Genome-wide
efficient mixed-model analysis for association
studies. Nat Genet 44:821–824
17. Moser G, Lee SH, Hayes BJ et al (2015) Simul-
taneous discovery, estimation and prediction
analysis of complex traits using a Bayesian mix-
ture model. PLoS Genet 11:e1004969
18. Wellcome Trust Case Control Consortium
(2007) Genome-wide association study of
14,000 cases of seven common diseases and
3,000 shared controls. Nature 447:661–678
19. Saha S, Perrin L, Röder L et al (2022)
Epi-MEIF: detecting higher order epistatic
interactions for complex traits using mixed
effect conditional inference forests. Nucleic
Acids Res 50:e114
20. Ponte-Fernández C, González-Domı́nguez J,
Carvajal-Rodrı́guez A, Martin MJ (2022) Eval-
uation of existing methods for high-order epis-
tasis detection. IEEE/ACM Trans Comput
Biol Bioinform 19:912–926
21. Rauch A, Kutalik Z, Descombes P et al (2010)
Genetic variation in IL28B is associated with
chronic hepatitis C and treatment failure: a
genome-wide association study. Gastroenterol-
ogy 138:1338–1345
22. Ge D, Fellay J, Thompson AJ et al (2009)
Genetic variation in IL28B predicts hepatitis
C treatment-induced viral clearance. Nature
461:399–401
23. Mandorfer M, Neukam K, Reiberger T et al
(2013) The impact of interleukin 28B
rs12979860 single nucleotide polymorphism
and liver fibrosis stage on response-guided
therapy in HIV/HCV-coinfected patients.
AIDS 27:2707–2714
24. Real LM, Neukam K, Herrero R et al (2014)
IFNL4 ss469415590 variant shows similar per-
formance to rs12979860 as predictor of
response to treatment against hepatitis C virus
genotype 1 or 4 in Caucasians. PLoS One 9:
e95515
25. Prokunina-Olsson L, Muchmore B, Tang W
et al (2013) A variant upstream of IFNL3
(IL28B) creating a new interferon gene
IFNL4 is associated with impaired clearance
of hepatitis C virus. Nat Genet 45:164–171
26. Angulo-Aguado M, Corredor-Orlandelli D,
Carrillo-Martı́nez JC et al (2022) Association
between the LZTFL1 rs11385942 polymor-
phism and COVID-19 severity in Colombian
population. Front Med 9:910098
27. Downes DJ, Cross AR, Hua P et al (2021)
Identification of LZTFL1 as a candidate effec-
tor gene at a COVID-19 risk locus. Nat Genet
53:1606–1615
 Part II

Viral-Host Interactions
 Chapter 3

Live-Cell Fluorescence Imaging for Virus-Host Interactions

Francesca J. Scribano, Kristen A. Engevik, J. Thomas Gebert,
and Joseph M. Hyser

Abstract
Recent technological advances in microscopy have facilitated novel approaches to investigate host-pathogen
interactions. In particular, improvements in both microscope hardware and engineered biosensors have
helped to overcome barriers to live-cell imaging with fluorescence microscopy. Live fluorescent microscopy
allows for the detection of discrete signaling events and protein localization, improving our ability to assess
the effects of pharmacologic agents, microbes, or infection with high temporal resolution. Here we describe
a protocol for long-term live-cell fluorescence imaging of virus infected cell lines.

Key words Fluorescence, Microscopy, Cell, Virus, Host-pathogen, Live-cell imaging

1 Introduction

Fluorescence microscopy (see Note 1) is a powerful tool to measure

the concentration, distribution, and localization of molecules of
interest with high spatial and temporal resolution [1]. The quality
and quantity of data collected using a fluorescence microscope
depends on both fluorophore-specific parameters (brightness and
photostability, excitation/emission spectra, kinetics of activation)
and microscope-specific parameters (filter compatibility, imaging
frequency, light source exposure time and power). Because many
biological samples are weakly fluorescent, molecules or structures
of interest require conjugation to a strongly fluorescent compound
(fluorophore) for meaningful detection by a fluorescence micro-
scope [2]. Fluorophores can be introduced into cell lines in the
form of chemical dyes or fluorescent proteins. In general, organic
dyes are brighter and more stable compared to fluorescent proteins;
however, they are often less specific and have higher background
fluorescence, making it difficult to dissect signals [2, 3]. While dyes
must be loaded for each experiment, fluorescent proteins can be
genetically encoded and integrated into the host genome,

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_3,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

33
34 Francesca J. Scribano et al.

improving reproducibility. Likewise, where dyes generally target a

specific protein or localize to a cellular compartment, genetically
encoded fluorescent proteins can be conjugated to a wide variety of
cellular proteins. Conversely, recombinant expression of biosensors
or tagged proteins must be done judiciously so as to not produce
overexpression artifacts. The choice between fluorescent dyes and
proteins should be carefully considered for each individual experi-
ment, accounting for both the target of interest, and the kinds of
measurements that need to be performed. A list of experimental
considerations for fluorophore selection and microscope setup is
summarized in Table 1.
Live-cell fluorescence microscopy is a valuable tool to monitor
viral infections and unveil dynamic cellular responses overtime
[4, 5]. Calcium imaging is a particularly powerful application of
live fluorescence microscopy, owing to the spatial and temporal
nature of calcium signals, the integral role these signals play in cell
signaling, and the variety of robust calcium-responsive engineered
fluorophores. Using rotavirus as our model system, here we
describe our protocol for long-term live imaging of infected cells
expressing the EGFP-based genetically encoded calcium indicator,
GCaMP6s [6, 7] as a tool to understand host signaling during viral
infection. Though any change to the protocol necessitates optimi-
zation, this protocol can also be adapted for other live imaging
experiments.

2 Materials

All solutions should be prepared in a biosafety cabinet, with proper

aseptic technique to avoid microbial contamination. Diligently
follow all waste disposal regulations.

2.1 Cell Culture 1. Cell line of interest: For rotavirus studies, investigators fre-
quently use African green monkey (MA104) cells (see Note
2). We have utilized lentivirus transduction to stably express
the cytosolic calcium indicator, GCaMP6s, in these cells.
2. Sterile Dulbecco’s phosphate-buffered saline (PBS), phenol
red free. Store at 4 °C.
3. 0.25% Trypsin EDTA solution: Combine 400 mL of trypsin
diluent buffer with 40 mL of 100 mM (2%) Versene EDTA and
10 mL of Enzar trypsin (pH 3.3). Once combined, sterilize the
solution through vacuum filtration using a 0.2 μm pore, poly-
ethersulfone membrane filter. Aliquots can be kept at 4 °C for
short-term use and -20 °C for long-term storage.
4. 10% FBS DMEM medium: Combine 450 mL of Dulbecco’s
Modified Eagle Medium (DMEM) with 50 mL of fetal bovine
serum (FBS) and 5 mL of 100X antibiotic-antimycotic. Store at
4 °C.

Table 1
List of fluorophore- and microscope-specific parameters to consider in designing a live-cell
fluorescence imaging experiment
Fluorophore and microscope-
specific factors Important considerations
Signal-to-noise ratio (SNR)
Brightness and photostability
Excitation/emission spectra
On/off kinetics
Live-Cell Fluorescence Imaging 35
Designing your imaging parameters to optimize the signal-to-noise
ratio (SNR) will improve the quality of the data generated [10]. To
optimize the SNR, a fluorophore should have a strong signal when
activated with minimal emission at baseline. Background
fluorescence should be minimized as it degrades the SNR. To
estimate the SNR, compare the intensity of a true signal to the
standard deviation of the “noise.” to determine this experimentally,
capture an image of a signaling event using a predefined laser power
and exposure time. Measure the average intensity of the signal by
drawing an ROI over pixels capturing the signal. Measure the
standard deviation within a small region of background. Divide the
signal intensity by the standard deviation of the background. Note
that most microscope softwares will generate these values for a defined
ROI. This can also be done in FIJI or ImageJ. Adjust the exposure time
or laser power to optimize SNR, but balance this with considerations of
photobleaching/toxicity
Intensity signal
SNR =
σ backgound
If your fluorescence detection is weak, due to either intrinsic properties
of the fluorophore or the concentration of your target, you may need
to use a high light source power or long exposure time. These
parameters make photobleaching/toxicity more likely, thus proper
controls are critical. Factors that contribute to the intrinsic
brightness of a given fluorophore include the extinction coefficient
(photons absorbed) and quantum yield (ratio of photons emitted to
photons absorbed) [8]
Good fluorophores should have distinct excitation and emission spectra
to ensure that the light that is used to excite your fluorophore can be
distinguished from the emitted light. In addition, when imaging
more than one fluorophore simultaneously, ensure minimal overlap
of each fluorophore’s excitation and emission spectra. This will
ensure minimal “bleed-through” on each channel. FPbase is a great
resource for selecting compatible fluorophores [11]
Genetically encoded fluorescent indicators can have variable kinetics of
activation, meaning that they can undergo slow or fast changes in
fluorescence upon target binding [12]. Consider the kinetics of the
phenomenon that you are trying to capture. An appropriate
fluorophore will have on-off kinetics that well exceed the temporality
of the signal. However, note that the trade-off between fast kinetics
and low target affinity may impact the sensitivity of your fluorescent
indicator. Kinetics may have to be compromised to resolve
low-amplitude signals
(continued)
36 Francesca J. Scribano et al.

Table 1
(continued)

Fluorophore and microscope-

specific factors Important considerations
Filter cube compatibility
Light source power and
exposure time
Imaging frequency
It is important to ensure that the excitation/emission spectra of your
selected fluorophore(s) are compatible with the filter cubes that are
available on the microscope that you will be using for imaging.
Likewise, if using multiple fluorophores, the filters used on each
channel should minimize the potential for bleed-through
[13]. Normally, we use a single multiband bandpass emission filter
and then program the light source to change only the excitation
wavelength between acquisitions on different channels
Imaging with higher light source power or exposure time may increase
the excitation and therefore emission intensity of your fluorophore
but may also cause photobleaching or phototoxicity
[14]. Photobleaching occurs when a fluorophore undergoes light-
induced damage or degradation, and phototoxicity occurs when live
cells experience light-induced damage or death. Likewise, increasing
power and exposure time can increase background fluorescence. The
ideal power and exposure time achieves the maximum SNR, but
photobleaching and phototoxicity may preclude this [10]
When performing live imaging, acquisition frequency, or sampling rate
is an important parameter. According to the Nyquist theorem, the
sampling rate should be no less than twice the frequency of the
observed phenomenon. For rare events however, the sampling rate
must far exceed the signal frequency. The ideal sampling rate will also
be influenced by the on-off rate of the fluorophore and signaling
event, as longer off rates may allow less frequent sampling. As
discussed above, high-frequency imaging can also cause significant
photobleaching or phototoxicity. As always, you should include
appropriate controls and normalizations to compare images taken
over multiple time points [15]

5. FluoroBrite-plus(FluoroBrite+)medium: Combine 500 mL of

FluoroBrite DMEM, 5 mL of 100× MEM nonessential amino
acids, 5 mL of 100× L-glutamine, 5 mL of 100 mM sodium
pyruvate, and 7.5 mL of 1 M HEPES. Store at 4 °C.
6. 15 mL conical tube.
7. Automated cell counter or hemocytometer.
8. Optical grade imaging slide (see Note 3).

2.2 Lentivirus 1. HEK293T or HEK293FT cells.

Packaging and 2. 100 mm tissue culture dish.
Concentration
3. Lentiviral packaging plasmids, psPAX2 (Addgene plasmid
#12260); pMD2.G (expresses VSV-G, Addgene plasmid
#12259).
 Live-Cell Fluorescence Imaging 37

4. GCaMP6s in the pLVX lentiviral vector backbone (Addgene

plasmid #164591).
5. 1.5 mL microcentrifuge tube.
6. Opti-MEM reduced serum medium. Store at 4 °C.
7. 1 μg/μL PEI transfection reagent. Store at 4 °C for 1–-
2 months. Long-term storage at -20 °C.
8. 50 mL conical tube.
9. Takara Lenti-X GoStix Plus, or equivalent quantitative lenti-
viral titer test.
10. 0.45 μm polyethersulfone (PES) filter and Luerlock syringe.
11. Polyethylene glycol (PEG)-8000: Make up a solution of 40%
w/v PEG-8000 and 1.2 M NaCl. Dissolve 80 grams of
PEG-8000 and 14 grams of NaCl in 100 mL of PBS. Once
combined, adjust the pH to 7 and bring the total volume to
200 mL using PBS. Filter sterilize the solution using a 0.2 μm
pore, polyethersulfone membrane filter. Store at 4 °C.

2.3 Lentivirus 1. VSV-G pseudotyped GCaMP6s lentivirus. Store at -80 °C,

Transduction avoid repeat freeze/thaw cycles.
2. Opti-MEM reduced serum medium: see 6 in Subheading 2.2.
3. Polybrene (5 mg/mL). Store at -20 °C.
4. 10% FBS DMEM medium: see 4 in Subheading 2.1.
5. FluoroBrite+ medium: see 5 in Subheading 2.1.
6. Adenosine 5′-diphosphate sodium salt: make up a 100 μM
stock of ADP in sterile water and adjust to pH 7 with 1 M
NaOH. Store aliquots at -20 °C. Other GPCR agonists for
validation studies include ATP (100 μM), carbachol (100 μM),
or trypsin (2 μM).
7. 1.5 mL microcentrifuge tube.

2.4 Virus Activation 1. Worthington’s trypsin (1 mg/mL): Dissolve in 0.001 N HCl,

and Infection as per the manufacturer’s instructions. For long-term use, store
aliquots at -80 °C.
2. Rotavirus stock. Store at -80 °C.
3. FluoroBrite+ medium: see 5 in Subheading 2.1.

2.5 Live-Cell 1. Inverted fluorescence microscope.

Imaging 2. Stage-top chamber.
3. Temperature controller.
4. CO2 -air mixer.
5. Active humidity controller.
38 Francesca J. Scribano et al.

3 Methods

3.1 Preparation of To seed cells on a tissue culture plate or an optical grade imaging
Imaging Slides/Plates slide, lift cells from a maintenance flask using 0.25% Trypsin EDTA
solution (see Note 4).
1. For a T-75 flask of adherent cells, remove medium, wash twice
with sterile PBS, and add 2 mL of 0.25% Trypsin EDTA
solution (enough volume to cover the cells). Gently rock the
flask to fully coat the cell layer. Place the flask in a 37 °C
incubator for ~5–10 min, or until the cells lift from the flask
following gentle tapping.
2. Once the cells are detached, add 8 mL of 10% FBS DMEM
medium to the flask (make sure to add, at minimum, a volume
of 10% FBS DMEM that is equal to the volume of 0.25%
Trypsin EDTA solution added in step 1). Using a serological
pipette, gently pipette up and down to break up clumps of cells
and remove any cells that remain attached. Transfer the cell
suspension to a 15 mL conical tube.
3. Using an automated cell counter or a hemocytometer, obtain a
cell count from the cell suspension and calculate final cell seed-
ing density. For MA104 cells, an ideal final cell density in a
1 cm2 well (8-well imaging slide) is between 50,000–100,000
cells. In a 1.9 cm2 well (24-well plate), an ideal density is
200,000–250,000 cells. In a 100 mm dish, an ideal density is
~5,000,000 cells. Under most culture conditions, this will
allow for a confluent monolayer by 1–2 days post seeding.
4. Seed cells in designated wells and incubate in the 37 °C incu-
bator with 5% CO2 for 1–2 days prior to use.
5. If imaging, one day before or on the day of, change the
medium on the imaging slide/plate: remove the 10% FBS
DMEM medium and add FluoroBrite+ medium. Incubate in
the 37 °C incubator with 5% CO2.

3.2 GCaMP6s To generate a stable cell line expressing the calcium indicator,
Lentivirus Packaging GCaMP6s, you will first need to package VSV-G pseudotyped
and Concentration GCaMP6s lentivirus [7]. Below is a protocol for packaging lentivi-
rus in-house. Alternatively, there are numerous commercial com-
panies and academic core resources that offer lentivirus packaging
services.
1. Seed HEK293T cells in a 100 mm tissue culture dish as
described in Subheading 3.1, in a total volume of 10 mL of
maintenance (10% FBS DMEM) medium.
2. One day post seeding, prepare for plasmid transfection by first
calculating the volume of each plasmid needed for packaging.
 Live-Cell Fluorescence Imaging 39

For one 100 mm dish, aliquot 14 μg of pLVX-GCaMP6s, 3 μg

of VSV-G, and 7 μg of psPAX2 into a 1.5 mL
microcentrifuge tube.
3. To the above tube, add enough Opti-MEM medium to bring
the total volume in the tube to 600 μL. Pipette gently to mix.
4. Add 36 μL of 1 μg/mL PEI transfection reagent to the
plasmid/Opti-MEM mixture. Mix the tube by gentle inversion
and incubate at room temperature for 5–10 min.
5. Following the 10-min incubation, distribute the transfection
mixture dropwise to the 100 mm dish, without removing the
maintenance media on the cells.
6. Place the dish in the 37 °C incubator with 5% CO2. Harvest the
cell supernatant at 24-, 48-, and 72-h post-transfection by
carefully decanting the media into a sterile 50 mL conical
tube. Replace the media in the dish with 10 mL of fresh 10%
FBS DMEM. 24-, 48-, and 72-h supernatants can be pooled.
7. Following the last (72 h) supernatant collection, check for
lentivirus production using the Takara Lenti-X GoStix test.
To complete the test, load 20 μL of pooled culture supernatant
into the GoStix cassette, and then add 80 μL (3 drops) of the
provided Chase Buffer. After 10 min, check for the presence of
an indicator band. If present, the band can be scanned to
quantitate approximate viral titers (see Note 5).
8. To clarify the cell supernatants, centrifuge at 1000 ×g for
15 min. Decant the clarified supernatant from the cell debris
and filter using a 0.45 μm PES filter and Luerlock syringe.
9. To concentrate the lentivirus, combine 3 volumes of filtered
supernatant (~30 mL) with 1 volume of PEG-8000 concentra-
tor solution (~10 mL).
10. Incubate the mixture overnight at 4 °C with shaking.
11. Centrifuge the mixture at 1600 ×g for 60 min at 4 °C. After
centrifugation, an off-white pellet should be visible.
12. Carefully remove the supernatant and gently resuspend the
pellet in 1/10th to 1/100th of the original volume in 0%
FBS DMEM or PBS.
13. Store the suspension in single use aliquots at -80 °C.

3.3 Generation of 1. Seed MA104 cells in a 24-well plate as described in

GCaMP6s-Expressing Subheading 3.1.
Cell Lines 2. One-day post-seeding, make up the lentivirus inoculum. Cal-
culate the amount of lentivirus needed per well of transduction
to achieve a MOI 10 (see Note 6).
3. Add the calculated volume of lentivirus to a 1.5 mL microcen-
trifuge tube. Combine the lentivirus with enough Opti-MEM
medium to bring the total volume in the tube to 800 μL.
40 Francesca J. Scribano et al.

4. To an 800 μL tube of dilute lentivirus inoculum, add 0.8 μL of

5 mg/mL polybrene for a final concentration of 5 μg/mL of
polybrene. Mix by gentle pipetting.
5. Remove medium from the cells and distribute the lentivirus
inoculum dropwise. Incubate overnight in the 37 °C incubator
with 5% CO2.
6. One-day post-transduction, remove the lentivirus inoculum
from each of the wells and replace with fresh 10%
FBS-DMEM. Return the plate to the 37 °C incubator.
7. Monitor for GCaMP expression 48–72 h post-transduction.
8. Once GCaMP expression is achieved, split each transduced well
in a 1:2 ratio. Once the cells reach confluency, start antibiotic
selection on half of the wells (see Note 7). Continue to select
and grow up the appropriate wells until there are enough to
seed a maintenance flask.
9. GCaMP-expressing cell clones can be obtained by limiting
dilution or flow sorting.

3.4 Validation of Signaling through Gq-coupled GPCRs results in IP3R-mediated

GCaMP-Expressing release of calcium from the endoplasmic reticulum. Thus, certain
Cell Lines GPCR agonists can be used to validate expression of the cytosolic
calcium indicator, GCaMP6s. ADP is one such agonist and signals
through the GPCR, P2Y1 (Fig. 1).
1. Seed MA104 GCaMP6s cells in an optical grade imaging slide
(see Subheading 3.1). Incubate the slide in the 37 °C incubator
until the cells reach confluency (1–2 days).
2. On the day of agonist treatment, remove the 10% FBS DMEM
medium from each well of the imaging slide, and replace with
180 μL of FluoroBrite+.
3. Prepare a working stock of agonist. In a 1.5 mL microcentri-
fuge tube, combine 1 mL of FluoroBrite+ medium with 1 μL of
100 μM ADP to make a final stock of 100 nM ADP (see Note
8). Vortex to mix.
4. Once all dilutions are made, put the imaging slide on the
microscope. Choose the channel (FITC) and nosepiece (Pla-
nApo 20X/0.75). Set the exposure time and light source
power. For GCaMP6s on our system, this is a 50 millisec
exposure with 50% power on the 488 nm LED light source.
Note that these parameters are microscope specific and may
need to be optimized for your setup. Acquire a single image
and ensure that no pixels have intensity values that approach
saturation. Adjust as needed. Set the loop interval to 2 s.
5. Start the microscope run and collect at least 1 min of baseline
images. After 1 min, without stopping the run, add 20 μL of
 Live-Cell Fluorescence Imaging 41

Fig. 1 Live-cell imaging of MA104-GCaMP6s cells before (a) or after (b) treatment with 10 μM adenosine
diphosphate (ADP). (c) Trace of fluorescence intensity per field of view of the MA104-GCaMP6s cell monolayer
over the imaging run. Red arrow indicates time of ADP addition

100 nM ADP to the well that you are imaging. Continue

imaging until the fluorescence intensity returns to baseline
(1–2 min).
6. Measure the average fluorescence intensity per frame to deter-
mine the maximum change in fluorescence after ADP addition.

3.5 Virus Infection Depending on the kinetics of virus replication and the desired phase
of replication for imaging, infections should be performed either
1 day before or on the day of imaging. For rotavirus infection of
MA104 cells, infections are performed on the day of imaging.
1. Seed MA104 GCaMP6s cells in an 8-well imaging slide as
described in Subheading 3.1.
42 Francesca J. Scribano et al.

Fig. 2 Live-cell fluorescence microscope setup. (a) Components of the controlled stage-top incubator,
including humidity, temperature, and gas controllers. (b) Epifluorescence microscope with stage-top incubator
and 8-well slide chamber insert

2. Trypsin-activate rotavirus. To a 1 mL volume of rotavirus

stock, add 11 μL Worthington’s trypsin for a final concentra-
tion of 10 μg/mL of trypsin. Vortex well, incubate at 37 °C for
45 min to 1 h (see Note 9).
3. Determine the volume of virus stock and FluoroBrite+ needed
to achieve an appropriate multiplicity of infection (MOI) for
your imaging run (see Note 10).
4. Combine the appropriate volumes of rotavirus stock and Fluor-
oBrite+ as calculated in step 3, and vortex to mix.
5. Inoculate the experimental slide wells with the rotavirus/
FluoroBrite+ mixture, and incubate in a 37 °C incubator for
at least 1 h.
6. When the incubation time is completed, gently wash the wells
twice with sterile PBS. Replace with FluoroBrite+ medium.

3.6 Epifluorescence Once virus infection is completed, the cells are ready to be set up for
Microscope Setup long-term imaging (Fig. 2).
1. During the rotavirus inoculation step, adjust the temperature
on the stage-top chamber to 37 °C. Allow the chamber base
and lid to warm up prior to the start of imaging to properly
equilibrate the chamber.
 Live-Cell Fluorescence Imaging 43

2. Once the stage-top chamber has reached 37 °C, and the rota-
virus inoculation is complete, place your imaging slide into the
heated stage-top chamber.
3. Supply the chamber with 5% CO2 by setting the air flow rate to
0.8 L/min and the CO2 flow rate to 0.04 L/min, as per the
manufacturer’s instructions for the OkoLabs chamber.
4. Select the appropriate objective for your imaging. Once this is
determined, bring the cells into focus by raising or lowering the
microscope objective (see Note 11).
5. Select regions of interest within each slide well. If performing
immunofluorescence staining after imaging, save the XYZ
coordinates of each multipoint.
6. Specify the channel(s), exposure time(s), and light power
(s) that are compatible with your cells and fluorophores of
interest. To image MA104 GCaMP6s cells infected with
mRuby-tagged rotavirus, we utilize the GFP/FITC channel
(488 nm excitation, emission filter 515/30) and the TRITC
channel (555 nm excitation; emission filter 595/40). On our
system, we set the exposure time and power to 50 millisec and
50% LED power for both channels. These parameters are
microscope specific and may need to be optimized for your
setup.
7. Collect images. To capture rotavirus-induced calcium signaling
at low MOIs, image in 1-min intervals for at least 8–12 h
(Fig. 3).

Fig. 3 Live-cell imaging of calcium signals in rotavirus-infected monolayers. MA104-GCaMP6s cells were
infected with rotavirus at MOI 0.5 and imaged once per min for 18 h. The cytosolic calcium indicator,
GCaMP6s (green), was imaged in the GFP/FITC channel (488 nm excitation, emission filter 515/30), and the
virus-expressed red fluorescent protein (mRuby3) was imaged in the TRITC channel (555 nm excitation;
emission filter 595/40)
44 Francesca J. Scribano et al.

4 Notes

1. Fluorescence microscopy involves the direction of light at a

sample containing a fluorophore (excitation) and the detection
of emitted photons from the excited fluorophores (emission).
Thus, understanding fluorescence microscopy involves under-
standing how and where light travels through the microscope
and through your sample. Key features of the microscope
include the light source, objective, excitation and emission
filters, dichroic mirrors, and eyepiece/detector. In epifluores-
cence microscopy, multispectral light, which is generated by
the light source, is first passed through an excitation filter. This
ensures that only light within a defined range of wavelengths
(including the wavelength that optimally excites the fluoro-
phore) reaches your sample [8]. The filtered light is then
reflected off a dichroic mirror and through the microscope
objective, to be focused on the sample. When appropriately
configured, the photons will push the electrons of the fluoro-
phores in your specimen to an excited state. As the electrons
rapidly fall back to the ground state, they emit light of a
specified wavelength that can be gathered by the objective
and passed through the dichroic mirror [8]. Light from the
objective is subsequently filtered by the emission filter (to block
any residual excitation light) and arrives at the eye piece or
photodetector. In most microscope setups, the excitation and
emission filters along with the dichroic mirror are packaged
into what is known as a filter cube. You will want to be sure that
the excitation/emission spectra of your selected fluorophore
are compatible with the filter cubes that are available on the
microscope that you will be using for imaging. If your experi-
mental plan necessitates long-term live cell imaging, you will
need access to stage-top microscope chambers that allow for
control of the gas, temperature, and humidity of your sample.
2. An ideal cell line for this protocol’s live imaging includes the
following criteria: can be easily transduced or dye-loaded, is
adherent to chamber slides, grows to confluency and remains
viable in two-dimensional monolayers, and is susceptible and
permissive to the virus you will be using.
3. For best image quality, choosing the appropriate slide is crucial.
There are several glass and optical grade plastic options, and it is
best to test which chamber slides will work best for your
intended cell line. For MA104 cells, we suggest the use of
ibidi Treat μ-slide 8-well chambers (Ibidi). Most objectives
are designed with optical corrections for aberrations that arise
from glass of a specific width. Thus, you must ensure that the
width of the slide aligns with the specifications of the objective.
 Live-Cell Fluorescence Imaging 45

4. The following reference is provided to introduce fluorescent

dyes [9] into cells. This needs to be completed prior to splitting
cells for seeding in the imaging slide and rotavirus inoculation.
5. Alternative methods for lentivirus titration include qRT-PCR
quantitation of lentiviral genome copies or p24 ELISAs. Both
methods can be completed with commercially available kits.
6. To calculate lentivirus multiplicity of infection (MOI), factor
the number of cells in each of your slide wells and the lentivirus
titer into the following equation: [(#cells/well) × (MOI)]-
÷ [Concentration of lentivirus stock (TU/mL)]. For transduc-
tion, do not scale up the volumes for multiple wells. If you will
be transducing more than one well of cells, make up separate
800 μL aliquots of inoculum.
7. If cell viability is low following the first round of antibiotic
selection, the transduced but non-selected wells can be trans-
duced a second time with new lentivirus inoculum.
8. The final concentration of ADP in each well after addition
should be 10 nM but can vary depending on the cell line
being used. Because the agonist will be added on top of the
medium that is already in each slide well, the working stock
should be more concentrated than 10 nM. We usually work
from 100 nM ADP stocks, but for optimization, you can vary
the concentration of stock and the volume that you will spike in
to each well (e.g., place each slide well into 150 μL of Fluoro-
Brite+ and add in 50 μL of 40 nM ADP stock).
9. Our laboratory uses a recombinant simian rotavirus strain
(SA11) that has been engineered to express the fluorescent
protein, mRuby, downstream of the rotavirus protein, NSP3.
This allows us to simultaneously measure calcium signaling
dynamics and viral protein expression.
10. To calculate multiplicity of infection (MOI), factor the number
of cells in each of your slide wells and the virus titer into the
following equation:[(#cells/well) × (MOI)] ÷ [Concentration of
virus stock (PFU/mL)]. Note that the above equation will give
you the volume of virus (in mL) per well. It is often helpful to
scale your volumes up by the number of wells that need to be
infected. The MOI should be optimized for the nature of the
signal studied. For resolution of rotavirus-induced intercellular
signals, we typically use an MOI of 0.005. This results in about
1–3 infected cells in a given field of view at 20×, minimizing the
overlap of neighboring zones of interest.
11. To minimize photobleaching and phototoxicity, we use bright-
field illumination to find the focal plane when setting up an
experiment. Continuous application of the excitation light
should be avoided. For most of our experiments, we image
with a 20× Plan Apo (NA 0.75) objective.
46 Francesca J. Scribano et al.
References
1. Sanderson MJ, Smith I, Parker I, Bootman MD
(2014) Fluorescence microscopy. Cold Spring
Harb Protoc 2014(10):pdb top071795
2. Toseland CP (2013) Fluorescent labeling and
modification of proteins. J Chem Biol 6:85–95
3. Deo C, Lavis LD (2018) Synthetic and geneti-
cally encoded fluorescent neural activity indica-
tors. Curr Opin Neurobiol 50:101–108
4. Chang-Graham AL, Perry JL, Strtak AC et al
(2019) Rotavirus calcium dysregulation mani-
fests as dynamic calcium signaling in the cyto-
plasm and endoplasmic reticulum. Sci Rep 9:
10822
5. Chang-Graham AL, Perry JL, Engevik MA
et al (2020) Rotavirus induces intercellular cal-
cium waves through ADP signaling. Science
370:eabc3621
6. Chen T-W, Wardill TJ, Sun Y et al (2013)
Ultrasensitive fluorescent proteins for imaging
neuronal activity. Nature 499:295–300
7. Perry JL, Ramachandran NK, Utama B, Hyser
JM (2015) Use of genetically-encoded calcium
indicators for live cell calcium imaging and
localization in virus-infected cells. Methods
90:28–38
8. Spring KR, Davidson MW (2008) Introduc-
tion to fluorescence microscopy. Nikon Micro-
scopyU. https://www.microscopyu.com/
techniques/fluorescence/introduction-to-fluo
rescence-microscopy
9. Bootman MD, Rietdorf K, Collins T et al
(2013) Loading fluorescent Ca2+ indicators
into living cells. Cold Spring Harb Protoc
2013:122–125
10. Ettinger A, Wittmann T (2014) Fluorescence
live cell imaging. Methods Cell Biol 123:77–94
11. Lambert TJ (2019) FPbase: a community-
editable fluorescent protein database. Nat
Methods 16:277–278
12. Cichon J, Magrane J, Shtridler E et al (2020)
Imaging neuronal activity in the central and
peripheral nervous systems using new Thy1.2-
GCaMP6 transgenic mouse lines. J Neurosci
Methods 334:108535
13. Dao L, Lucotte B, Glancy B et al (2014) Use of
independent component analysis to improve
signal-to-noise ratio in multi-probe fluores-
cence microscopy. J Microsc 256:133–144
14. Ladouceur AM, Brown CM (2021) Correc-
tion: fluorescence microscopy light source
review. Curr Protoc 1:e304
15. Ghauharali RI, Brakenhoff GJ (2000) Fluores-
cence photobleaching-based image standardi-
zation for fluorescence microscopy. J Microsc
198:88–100
 Chapter 4

Construction of a Mycoviral Infectious Clone for Reverse

Genetics in Botrytis cinerea
Laura Córdoba, Ana Ruiz-Padilla, Javier Pardo-Medina,
Julio L. Rodrı́guez-Romero, and Marı́a A. Ayllón

Abstract
The most important advances in our understanding of the viral life cycle, such as genome replication,
packaging, transmission, and host interactions, have been made via the development of viral infectious full-
length clones. Here, we describe the detailed protocols for the construction of an infectious clone derived
from Botrytis virus F (BVF), a mycoflexivirus infecting the plant pathogenic fungus Botrytis cinerea, the
determination of the complete sequence of the cloned mycovirus, the preparation of fungal protoplasts, and
the transfection of protoplasts using transcripts derived from the BVF infectious clone.

Key words Mycovirus, Virus, Synthetic virus, Viral infectious clone, Reverse genetics, Fungus,
Botrytis cinerea

1 Introduction

Infectious clones have been constructed for many plant and animal
viruses to gain insight into the different viral life cycle steps. To
date, hundreds of mycoviruses have been identified and character-
ized; however, mycoviral infectious clones have been constructed
only for several RNA and DNA mycoviruses. For RNA mycov-
iruses, there are available infectious clones of Cryphonectria hypo-
virus (CHV) [1–4], Diaporthe RNA virus 1 (DaRV) [5],
Saccharomyces 23S RNA narnavirus (23S RNA virus) [6], Saccharo-
myces 20S RNA narnavirus (20S RNA virus) [7], Sclerotinia scler-
otiorum hypovirus 2 Lactuca (SsHV2L) [8], yado-kari virus
1 (YkV1) and yado-nushi virus 1 (YnV1) [9], Sclerotinia sclero-
tiorum ourmia-like virus 4 (SsOLV4) [10], and BVF [11]; and
for DNA mycoviruses, there are infectious clones of Fusarium
graminearum gemytripvirus 1 (FgGMTV1) [12] and soybean-
leaf associated gemycircularvirus 1 (SlaGemV-1) [13]. For the
analysis of synthetic mycoviruses, it is essential to have the proper

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_4,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

47
48 Laura Córdoba et al.

methods for transformation and transfection of fungal protoplasts

using either DNA, complementary DNA (cDNA) infectious
clones, or in vitro transcribed RNA transcripts. Synthetic RNA
mycoviruses are mainly based on the cloning of the full-length
cDNA copy of a mycovirus inside a vector containing a bacterio-
phage promoter such as T7. These recombinant vectors are used to
synthesize mycoviral RNA in vitro for protoplasts transfection and
to deliver the mycoviral transcript inside the fungal cytoplasm for
the early translation of the proteins involved in replication.
B. cinerea is a major plant pathogenic fungus that causes gray
mold disease in more than 200 crops, inducing enormous eco-
nomic losses in field and in postharvest [14]. More than a hundred
mycoviruses have been identified in B. cinerea, and some of them
induce hypovirulence in the infected fungal host [15–26]. Among
the fully characterized mycoviruses is BVF. This virus belongs to
the genus Mycoflexivirus, inside the family Gammaflexiviridae.
BVF contains a genome of positive single-stranded RNA of
6.8 kb, excluding the poly-A tail, with two open reading frames
coding for a polyprotein, with the conserved motifs of methyltrans-
ferase, helicase, and RNA-directed RNA polymerase, and for the
coat protein [27]. Three different variants of BVF infecting
B. cinerea from different countries have been characterized
[20, 24, 27, 28]. Based on the BVF identified in a Spanish strain
of B. cinerea, an infectious clone has been developed [11]. The
authors demonstrated that BVF has no effect on the growth of
B. cinerea in in vitro conditions, indicating that it could be an
excellent candidate for the development of a viral expression vector
or a virus-inducing gene silencing vector. Moreover, it was shown
that BVF had no effect on the virulence of B. cinerea but induces
hypovirulence when the fungus is in mixed infections with other
mycoviruses, indicating that, under certain circumstances, BVF
could also be used for biocontrol strategies of the fungus in the
field. In this chapter, we detail the procedure to obtain and charac-
terize the full-length infectious clone of BVF published by Córdoba
and coworkers [11] and summarized in Fig. 1.

2 Materials

Prepare all solutions using nuclease-free water and analytical grade

reagents. Prepare and store all reagents at room temperature (RT),
unless otherwise indicated. Sterilize all media and material, unless
specified, in an autoclave at 120 °C for 20 min.

2.1 Cultivation 1. B. cinerea B05 model wild type strain obtained from
of B. cinerea grapevine [29].
 Synthetic Mycovirus Construction 49

Fig. 1 Experimental design of the generation of the BVF infectious clone

2. B. cinerea V448, a strain obtained from Spanish grapevine

fields, infected with BVF [20].
3. Potato dextrose agar (PDA) plates: dissolve 39 g of premixed
PDA in 1 L of distilled water or mix Potato Dextrose Broth
with 2% agar and add 1 L of distilled water. Alternatively, mix
15 g of bacteriological agar, 20 g of dextrose, and 4 g of potato
starch in 1 L of distilled water. Sterilize by autoclaving at 121 °
C for 15 min. Pour 20 mL of media in 90 mm diameter plates
at no more than 60 °C.
4. Potato dextrose broth (PDB): dissolve 26.5 g of premixed
Potato Dextrose Broth in 1 L of distilled water. Alternatively,
mix 20 g of dextrose and 6.5 g of infusion from potatoes in 1 L
of distilled water. Sterilize by autoclaving at 121 °C for 15 min.
5. 2% Water agar: dissolve 4 g of American or European Bacterio-
logical Agar in 200 mL of distilled water. Sterilize by autoclav-
ing at 121 °C for 15 min. Pour 20 mL of media in 90 mm
diameter plates at no more than 60 °C (see Note 1).
6. Drigalski spatula.
50 Laura Córdoba et al.

7. Sterile distilled water.

8. Alcohol lighter.
9. Sterile tips.
10. Neubauer camera.
11. 20% glycerol.

2.2 RNA Extraction 1. Sterile Miracloth paper or cheesecloth paper.

and Detection by 2. Filter paper (see Note 2).
Conventional RT-PCR
3. Spatula.
4. Liquid nitrogen.
5. 15 mL conical tubes.
6. Mortar and pestle.
7. A phenol-based solution.
8. Chloroform.
9. Cold isopropanol.
10. 75% cold ethanol.
11. Nuclease-free water.
12. Agarose Low EEO.
13. Gel loading dye purple (6×).
14. DNA molecular weight marker ladder.
15. DEPC water: dissolve 1 mL of diethyl pyrocarbonate (DEPC)
in 1 L of ultrapure water. Agitate at RT on a chemical extrac-
tion hood overnight (ON) (see Note 3).
16. TAE buffer 50×: dissolve 24.2 g Tris Base, 10 mL of 0.5 M
EDTA, 5.71 mL of glacial acetic acid (100%) in 700 mL of
DEPC water. Adjust pH to 8.2–8.4. Adjust the volume to 1 L
with DEPC water and autoclave. Store at RT.
17. First-Strand cDNA Synthesis Kit (see Note 4).
18. RNase H.
19. High-fidelity DNA polymerase.
20. Specific primers for detection of the viral genome of BVF. For
coat protein detection: BVF_FwQ1 and BVF_RvQ2. For RNA
polymerase detection: BVF_XbaIT7 Fw and New BVF738_Rv
(Table 1).
21. Nuclease-free tips.

2.3 RNA Genome 1. Reverse primer BVF_NotIEcoRIRev (NotI and EcoRI restric-
Amplification by PCR tion sites are underlined in the sequence, Table 1) and forward
and Cloning in pUC19 primer BVF_XbaIT7 Fw (XbaI restriction site is underlined,
Vector and the T7 RNA polymerase promoter is in italics in the
sequence, Table 1).
 Synthetic Mycovirus Construction 51

Table 1
Primers

Name Sequence (5′–3′)

1 BVF_FwQ1 GGCATGGTTGGAACAACCAG
2 BVF_RvQ2 TCATTCAAGTCGATGCAC
3 BVF_XbaIT7 Fw CTAGCTTCTCTAGATAATACGACTCACTATAGGGGA
TTAAATTCACATCCAACA
4 New BVF738_Rv CAGGCTCTTCATGGTCATCCAT
5 BVF_NotIEcoRI Rev TTGAACGGGAATTCGCGGCCGC
TTTTTTTTTTTTTTTTTTGCCTCGTGTGCAACGAAG
6 BVF_XbaIT7 CTAGCTTCTCTAGATAATACGACTCACTATAGGGGATTAAA
TTCACATCCAACA
7 BVF738_FW ATGGATGACTATGAAGAGCCTG
8 NEW BVF738_RV CAGGCTCTTCATGGTCATCCAT
9 BVF 1550_FW CCCGATATGCACTTAAAGCTG
10 NEWBVF 1550_RV CAGCTTTAAGTGCGTATCGGG
11 NEWBVF 2348_FW TCATCCATGACACTGGCAAG
12 NEWBVF 2348_RV CTTGCCAGTGTCATGGATGA
13 BVF 3149_FW CCAGCGCAGAAGCTGAACAAC
14 BVF3628_FW TATGCCCATGAGTACCGCCGCGTTAGTGAC
15 BVF 3628_RV GCTGGCGATGGCTTCAGTGG
16 NEW_BVF 3932_FW GAACCCTCCGCCTTGTCTAT
17 NEW_BVF 3932_RV ATAGACAAGGCGGAGGGTTC
18 NEW_BVF 4755_FW GCATCTCACAAGTAAACCGC
19 NEW_BVF 4755_RV GCGGTTTACTTGTGAGATGC
20 BVF 5279_RV GGTCCAAACCTCGCCAGAGA
21 NEW_BVF 6374_FW TTGAATCAGCGCACAAAGTCC
22 NEW_BVF 6374_RV GGACTTTGTGCGCTGATTCAA
23 NEW_QPCR- TTCACCTCACATTGAACCTT
INTERGENIC-
BVF_FOR
24 M13_REV GCGGATAACAATTTCACACAGG
25 M13_FOR GTAAAACGACGGCCAGT

2. SuperScript® IV First-Strand cDNA Synthesis Reaction (Invi-

trogen Life Technologies), or a similar Retrotranscriptase, and
high-fidelity polymerase.
52 Laura Córdoba et al.

3. XbaI and EcoRI restriction endonucleases and buffers.

4. NucleoSpin Gel and PCR Clean-up.
5. pUC19 or analog vector and ligase.
6. T4 DNA ligase.
7. E. coli strain DH5α.
8. 100 mg/mL ampicillin: dissolve in water, filter sterilize, and
store at 4 °C.
9. 90 mm Petri dishes containing Luria-Bertani (LB) broth agar
supplemented with 100 μg/mL ampicillin.
10. Luria-Bertani (LB) medium: dissolve 10 g Bacto-tryptone, 5 g
yeast extract, and 5 g NaCl in 1 L of distilled water. Adjust to
pH 6.8–7.2. Dispense in 0.5 L bottles and autoclave.
11. Miniprep kit.

2.4 Sequencing 1. Sequencing primers: BVF738_FW, NEW BVF738_RV, BVF

of the pUC19-BVF 1550_FW, NEWBVF 1550_RV, NEWBVF 2348_FW,
Infectious Clone NEWBVF 2348_RV, BVF 3149_FW, BVF3628_FW, BVF
3628_RV, NEW_BVF 3932_FW, NEW_BVF 3932_RV,
NEW_BVF 4755_FW, NEW_BVF 4755_RV, BVF 5279_RV,
NEW_BVF 6374_FW, NEW_BVF 6374_RV, NEW_QPCR-
INTERGENIC-BVF_FOR, M13_REV, and M13_FOR
(sequences included in Table 1).
2. Primer3Plus version: 3.2.4 [30].
3. Tracy program [31].
4. Sanger trace alignment.
5. ApE-A plasmid editor software [32].
6. Clustal Omega-Multiple Sequence Alignment [33].

2.5 Transfection 1. PCR Clean-up and Gel extraction kit.

of B. cinerea Using 2. NotI restriction enzyme and buffer.
the BVF
3. MEGAscript™ T7 Transcription Kit (Invitrogen) or transcrip-
Infectious Clone
tion with T7 RNA polymerase.
4. KC buffer: 0.6 M KCl, 50 mM CaCl2, pH 6. Dissolve 8.95 g of
KCl and 1.48 g of CaCl2 2H2O in 180 mL of H2O bidistilled
water and adjust to pH 6 with KOH. Fill up to 200 mL and
sterilize by filtering. Store at 4 °C.
5. Sterile 100 mL Erlenmeyer flask.
6. Osmostabilized SH agar: 0.6 M sucrose, 5 mM HEPESpH 5.3,
1 mM (NH4)2HPO4, 1.2% agar. Add 1.2 g of HEPES to
400 mL of ultrapure H2O. Adjust to pH 5.3. Then add 12 g
of agar. Add 500 mL of distilled water. Autoclave. Keep at 60 °
C. Mix with 500 mL of 1.6 M sucrose.
 Synthetic Mycovirus Construction 53

7. Sucrose 1.6 M: Add 273.84 g of sucrose to a final volume of

500 mL of ultrapure H2O. Sterilize by filtering or autoclaving
at 110 °C.
8. Vinotaste® Pro (Novozymes).
9. Sterile 50 mL conical tubes.
10. Pasteur pipette.
11. Syringe and 0.45 μm syringe-driven filters.
12. Centrifuge equipped with a rotor for 50 mL tubes or
equivalent.
13. Cell counting chamber.
14. 25% PEG solution: 25% PEG-3350, 50 mM CaCl2, 10 mM
Tris-HCl pH 7.5. Add 2.5 g of PEG-3350, either 0.5 mL of
1 M CaCl2 or 0.04 g of CaCl2 2H2O, and 0.1 mL of 1 M Tris-
HCl pH 7.5 to a final volume of 10 mL. Sterilize by filtering.
Keep at RT.
15. Spermidine.
16. m7G(5′)ppp(5′)G RNA Cap Structure Analog.

2.6 General 1. NanoDrop spectrophotometer or UV spectrophotometer.

Equipment 2. Horizontal electrophoresis system and power supply.
3. Vortex.
4. Thermal cycler.
5. Refrigerated centrifuge.
6. UV transilluminator.
7. Rotary shaker for Erlenmeyer flasks.
8. Microscope.

3 Methods

Conduct all procedures at RT unless otherwise specified.

3.1 Detection of BVF Perform all fungal inoculation and cultivation steps in sterility,
in Field Isolates either under a laminar flow hood or under the flame.
3.1.1 Cultivation of B. 1. Culture and maintain the fungus on PDA plates at 24 °C for
cinerea 5–6 days. Store isolates on plates at 4 °C and/or in 20%
glycerol, at -80 °C, for longer periods of time.
2. Add 2 mL of sterile water to a 5–6 day culture and spread it well
by all the surface using a previously sterilized Drigalski spatula.
3. Collect all biomass including hyphae, spores, and sclerotia (see
Note 5).
54 Laura Córdoba et al.

4. Use a 100–1000 μL pipette to transfer half of the biomass to a

new PDA plate and the other half to a plate containing 20 mL
of PDB (see Note 6).
5. Sterilize Drigalski spatula in alcohol lighter and chill.
6. Use the sterilized Drigalski spatula to spread biomass by all the
surface of the PDA plate.
7. Wiggle PDB plates carefully to disperse biomass in the liquid.

3.1.2 RNA Total The first step involving the cultivation of the fungus should be
Extraction performed under laminar hood to keep sterility.
1. Scratch the 7-day V448 fungal isolate cultured in Potato Dex-
trose Agar (PDA) plates with a yellow sterile tip in various parts
of the plate ensuring mycelia and/or spores are being infected
by the mycovirus, and suspend it in Potato Dextrose Broth
(PDB) (see Note 7).
2. Collect a 7-day liquid culture with a spatula, place it on Mira-
cloth, and dry with filter paper. Freeze mycelia immediately in
liquid nitrogen and maintain at -80 °C until total RNA extrac-
tion (see Note 8). Follow next steps of the protocol under
chemical extraction hood (see Note 9).
3. Collect approximately 1 g of frozen mycelia of B. cinerea
infected with BVF (see Note 10). Put fungal tissue into clean
mortar and add liquid N2 to cover the tissue and freeze
completely. Grind the tissue with a pestle while frozen into a
well pulverized fine powder.
4. Transfer the powder to a 15 mL conical tube. Add 10 mL of
phenol-based solution to the tube before the fungal sample
begins to thaw. Mix in a vortex at maximum speed for 20 to
30 s (see Note 11).
5. Incubate for 5 min at RT.
6. Add 2 mL of chloroform and shake vigorously by hand or
vortex for 15 sec. Incubate the sample for 3 min at RT and
centrifuge it at 12,000 ×g for 15 min at 4 °C (see Note 11).
7. Following centrifugation, the RNA remains exclusively in the
upper aqueous layer, whereas proteins remain in the organic
(phenol-chloroform) phase. Transfer the aqueous phase (top
layer) to a new 15 mL conical tube either with a Pasteur pipette
or with a 100–1000 μL pipette (see Note 12).
8. Optionally, repeat steps 6 and 7 until white layer at interface is
no longer present to assure the purity of the RNA.
9. Add 5 mL of cold isopropanol and mix carefully by inversion
2–3 times.
10. Incubate sample for 15 min at -20 °C (see Note 13).
 Synthetic Mycovirus Construction 55

11. Centrifuge at 12,000 ×g for 10 min at 4 °C and discard the

supernatant.
12. Add 5 mL of 75% cold ethanol to wash the sample and mix
briefly.
13. Centrifuge at 12,000 ×g for 5 min at 4 °C and discard the
supernatant.
14. Air dry the pellet for 5–10 min (see Note 14).
15. Resuspend pellet in RNase-free water or DEPC-treated water
by pipetting the solution up and down.
16. Incubate for 10 min at 55–60 °C if necessary (see Note 15).
17. Store RNA at -80 °C (see Note 16).
18. Measure RNA concentration and quality using the UV spec-
trophotometer or NanoDrop (see Note 17).
19. Make a 1% agarose gel using TAE 1× in DEPC water. Add
ethidium bromide or SYBR Safe. Fill the electrophoresis
cuvette with TAE 1× buffer (see Note 18).
20. Prepare at least 200 ng of RNA aliquots and add gel loading
dye to a final concentration of 1×. Load samples on the gel and
electrophorese for 1 h at 75 V.
21. Visualize RNA bands with a UV transilluminator (see
Note 19).

3.1.3 Viral Detection Prepare the reactions on ice.

by Complementary DNA
1. Use approximately 2 μg of total RNA to synthesize cDNA with
(cDNA) Synthesis Followed
random primers by First-Strand cDNA Synthesis Kit in a total
by Conventional PCR
reaction volume of 10 μL. Add the following reaction compo-
(See Notes 20 and 21)
nents into a sterile, nuclease-free microcentrifuge tube for each
sample: 5 μL 2× master mix, 1 μL of Enzyme Mix, 2 μg of RNA
and Nuclease-free H2O until a total volume of 10 μL (see Notes
22 and 23).
2. Mix gently and incubate at 25 °C for 10 min.
3. Incubate at 50 °C for 30 min.
4. Inactivate the reaction by heating at 85 °C for 5 min, and then
chill on ice.
5. Add 1 μL of RNase H and incubate at 37 °C for 20 min (see
Note 24).
6. Store at -20 °C until required.
7. Perform a PCR using high-fidelity Taq DNA polymerase with a
final concentration of master mix buffer 1×, 2 mM of MgCl2,
0.25 μM of forward and reverse primers, 0.4 μM of dNTPs
mix, 1 μL of a dilution 1/5 of previously prepared cDNA,
56 Laura Córdoba et al.

0.5 U of high-fidelity Taq polymerase, and nuclease-free water

to a final volume of 25 μL.
8. Place samples in thermal cycler and use following conditions.
Preincubation: 1 cycle of 95 °C for 5 min. Amplification:
35 cycles [94 °C for 30 s, 55 °C (or the annealing temperature
for the primers used) for 30 s, and 72 °C for 30 s]. Final
elongation: 1 cycle of 72 °C for 7 min. Cooling: 4 °C.
9. Prepare an agarose gel using an appropriate concentration
according to the amplicon size.
10. Load 10 μL of the PCR reaction as a final concentration of
loading buffer 1×, run the electrophoresis, and visualize the
product.

3.2 Construction 1. Repeat the RNA extraction as previously stated.

of the BVF 2. Set up the annealing reaction to prime cDNA synthesis of the
Infectious Clone viral RNA using SuperScript® IV First-Strand cDNA Synthesis
3.2.1 Obtention of Full- Reaction (Invitrogen Life Technologies) by pipetting to a
Length cDNA Derived from nuclease-free thin-wall PCR tube: 1 μL of 2 μM gene-specific
BVF Genomic RNA
reverse primer (BVF_NotIEcoRI Rev) complementary to the 3′
end of the viral sequence and which incorporates the restriction
enzyme sites NotI and EcoRI, both absent in the viral sequence,
and poly (A)18 tail (see Note 25); 1 μL of 10 mM dNTP mix
(10 mM each); 2 μL of 0.5 mg/mL of viral RNA; and 9 μL of
nuclease-free water. Mix gently. In case of using a different
retrotranscriptase, follow manufacturer’s instructions.
3. Heat the RNA-primer mix at 65 °C for 5 min, and then
incubate on ice for at least 1 min.
4. After 1 min on ice, pulse spin the tubes and add the following
components to the reaction: 4 μL of SuperScript® IV Reverse
Transcriptase Buffer; 1 μL of 100 mM DTT; 1 μL of RNase
Inhibitor; and 1 μL of SuperScript® IV Reverse Transcriptase
(200 U/μL). Mix components by gently pipetting up and
down, and incubate reaction at 50 °C for 30 min.
5. Inactivate the reaction by incubating it at 80 °C for 10 min.
6. Use the resulting cDNA immediately for PCR amplification or
store it at -20 °C.
7. Set up the PCR reaction with the HIFI PCR mix (Takara)
according to the manufacturer’s instructions (see Note 26).
Pipette the following reagents to a thin-walled PCR tube:
12.5 μL of HiFi PCR Premix; 1 μL of each forward
(BVF_XbaIFw; see Note 25) and reverse (BVF_NotIEcoRI
Rev) primers (10 μM); 5 μL of the cDNA solution; and
5.5 μL of sterilized distilled water. Mix by tapping the bottom
of the tube, then centrifuge briefly.
 Synthetic Mycovirus Construction 57

8. Program your thermal cycler with the following cycling condi-

tions: an initial 2 min denaturation at 98 °C; 35 cycles com-
prising a 98 °C denaturation of 15 s, an annealing period of
30 s at 55 °C, and an elongation period of 10 min at 72 °C; and
a final elongation at 68 °C of 10 min.
9. At the end of the thermal cycling, pulse spin the PCR tubes and
purify the obtained product. First, perform ethidium bromide
(0.5 μg/mL) agarose gel (0.8%) electrophoresis with 1× TAE
buffer. Visualize and excise the DNA band using a UV transil-
luminator and purify it with NucleoSpin Gel and a PCR Clean-
up kit following manufacturer’s instructions.

3.2.2 Cloning of 1. Set up the digestion of the purified PCR product in 0.5 mL
Amplified Fragments microcentrifuge tube. Prepare the restriction reaction using
into pUC19 Vector 5 μg of purified PCR product, 1.5 μL of XbaI enzyme,
(See Note 27) 1.5 μL of EcoRI enzyme, and 5 μL of 10× restriction buffer,
and fill up to 50 μL of bidistilled water. Mix and incubate at
37 °C for 1 h. Gel-purify the product with Gel and PCR Clean-
up kit.
2. Digest 5 μg of plasmid pUC19 with 1.5 μL of XbaI enzyme,
1.5 μL of EcoRI enzyme, and 5 μL of 10× restriction buffer, and
fill up to 50 μL of bidistilled water. Mix and incubate at 37 °C
for 1 h. Gel-purify the product with Gel and PCR Clean-up kit.
3. Set up a 20 μL reaction in a 0.5 mL microcentrifuge tube to
ligate the inserts to the vector. Mix 50 ng of digested pUC19
vector, 500 ng of digested insert fragment, 2 μL of 10× DNA
Ligase buffer, and 1 μL of DNA Ligase (1Weiss U), and fill up
with sterile ultrapure water up to 20 μL. Gently pipette up and
down. Incubate the ligation at 22 °C for 30 min and then ON
at 4 °C.
4. Mix 5 μL of the ligation reaction into 50 μL of E. coli DH5α
(Invitrogen; see Note 28) chemically competent cell suspen-
sion. Incubate the cells with DNA on ice for 30 min and then
heat shock the cells at 42 °C for 45 sec. Incubate reaction 1 min
on ice and then add 750 μL of LB medium without antibiotics,
and incubate the bacterial suspension at 37 °C for 1 h with
agitation at 200 rpm. Plate the bacterial suspension onto LB
medium-agar suplemented with 100 μg/mL ampicillin, and
grow the bacteria ON at 37 °C with agitation.
5. To screen the correct clones, perform mini-scale plasmid
extractions using a plasmid miniprep kit (see Note 29). To
confirm that the clones contain the desired insert, perform a
digestion reaction using the same enzymes used for the cloning
procedure (XbaI and EcoRI), and confirm correct clone size by
electrophoresis and Sanger sequencing. The resultant plasmid
58 Laura Córdoba et al.

Fig. 2 Schematic representation of the pUC19-BVF clone. The entire viral

genome (6.8 kb) was amplified using the primers BVF-XbaIT7 Fw and
BVF_NotI/EcoRI Rev and ligated into pUC19 between XbaI and EcoRI restriction
sites

followed to construct the full-length cDNA clone of BVF is

shown in Fig. 2.

3.2.3 Sequencing The cloned cDNA of B. cinerea virus F gRNA (BVF-V448) was
of the pUC19-BVF sequenced by standard Sanger sequencing. The complete sequence
Infectious Clone of full-length BVF-V448 was determined by primer walking (Gen-
Bank accession number OM928008). The sequence of BVF-V448
was 6827 nt in length and showed identity values of 92%, 87%, and
84% to BVF strains published by Donaire and Ayllón (2017)
(LN827953) [20], Howitt and coworkers (2001) (AF238884)
[27], and Svanella–Dumas and coworkers (MH338171) [28],
respectively.
1. Start sequencing the ends of the cloned fragment using primers
M13_Rev and M13_For that bind to the plasmid pUC19-BVF
(see Note 30).
2. Analyze the chromatogram files using an appropriate program
like ApE. Only a good quality 3′ sequence must be used for the
next step.
3. Use Pimer3Plus to design new primers using the recent
obtained sequences. BVF738_Fw and New_BVF 6374_Rv
(see Note 31).
4. New Sanger sequencing round using primers designed in step
3.
 Synthetic Mycovirus Construction 59

5. Repeat steps 3 to 5 to complete the entire sequence. BVF is

6827 bp, at least 10 rounds will be needed to obtain the full-
length sequence.
6. Finally, all sequences are aligned and visualized using the San-
ger trace alignment software and Tracy.
7. Only good-quality base calls are used to get a full sequence.
Generate the assembled sequences using Tracy.
8. This new BVF sequence will be compared with the BVF
sequences published by Clustal Omega and uploaded to Gen-
Bank https://www.ncbi.nlm.nih.gov/WebSub/.

3.3 Transfection As a starting material for the in vitro transcription reaction, we used
of the BVF the linearized pUC19-BVF described previously (see Note 32).
Infectious Clone
1. Inoculate E. coli DH5α transformed with pUC19-BVF in
3.3.1 Preparation of BVF ampicillin containing LB medium and incubate ON.
Template 2. Perform a DNA extraction of plasmid pUC19-BVF using a
commercial kit, according to manufacturer’s instructions.
3. Prepare a restriction reaction using 5 μg of pUC19-BVF,
1.5 μL of NotI enzyme, and 2 μL of 10× restriction buffer,
and fill up to 20 μL of bidistilled water.
4. Incubate the reaction for 1–2 h or ON at 37 °C.
5. Prepare a 1% agarose gel as previously stated and load 0.5 μL of
the reaction and 0.5 μL of the circular plasmid as a control,
mixed with DNA loading buffer.
6. Run the electrophoresis at 100 V for 1 h.
7. Visualize the result. If all the plasmid is linearized, purify the
reaction using a Gel and PCR Clean-up kit according to man-
ufacturer instructions. If not, add 0.5 μL of NotI, incubate for
another hour, and repeat the previous steps (see Note 33).
8. Resuspend the DNA sample in nuclease free H2O and quantify
it (see Note 34).

3.3.2 Preparation of BVF The transcripts for transfection were prepared according to manu-
Transcripts facturer instructions using the MEGAscript™ T7 Transcription Kit
(Invitrogen™) (see Notes 9 and 35).
1. Prepare the in vitro transcription reaction in 20 μL. Add 2 μL of
10× reaction buffer, 2 μL of ATP solution, 2 μL of CTP
solution, 2 μL of UTP solution, and 2 μL of a 1:5 dilution of
the GTP solution (see Note 36). In case of using a different kit,
follow manufacturer’s instructions.
2. Add 1 μL of 40 mM m7G(5′)ppp(5′)G RNA Cap Structure
Analog (see Note 37).
60 Laura Córdoba et al.

Fig. 3 In vitro transcription of the full-length infectious clone of BVF. kB

molecular weight marker; Lanes 1 and 3: Linearized pUC19; Lane 2:
Successful in vitro transcription. BVF transcript highlighted with an arrow.
Lane 4: Failed in vitro transcription

3. Add 1 μg of the linearized template DNA, in this case, pUC19-

BVF (see Note 38).
4. Add 2 μL of T7 enzyme and mix thoroughly with the pipette.
5. Complete the reaction with up to 20 μL of nuclease free
bidistilled water.
6. Incubate the reaction for 1–2 h at 37 °C and then ON at 12 °C
(see Notes 39 and 40).
7. The day after, prepare a 1% agarose gel using nuclease free
bidistilled water. Mix 0.5 μL of the transcription reaction with
RNA loading buffer and load them on the gel. Load 0.5 μL of
the template DNA for each different transcription reaction to
compare the sizes (see Note 18).
8. Run the electrophoresis at 75 V for at least 1 h.
9. While the electrophoresis is running, add 1 μL of DNase, and
incubate for 15 min at 37 °C.
10. If the transcript quality is sufficient, take out 2.5 μLof the
reaction to use them as a positive control for the transfection
verification, and use the rest to transfect B. cinerea protoplasts
(Fig. 3).

3.3.3 Transfection The transfection protocol is based on two protocols for transfection
of B. cinerea Protoplasts and transformation previously described [11, 34].
 Synthetic Mycovirus Construction 61

1. Collect conidia from sporulating cultures of B. cinerea and

inoculate in PDB (105 conidia/mL). Alternatively, inoculate
some PDB media with Botrytis biomass in an Erlenmeyer flask.
2. Incubate the cultures in a rotary shaker at 120 rpm at 24 °C for
2–3 days.
3. Harvest the mycelium by filtration with Miracloth and wash it
twice in sterile water and once in KC buffer (see Note 41).
4. Add 25 mL of a filter sterilized solution containing 200 mg of
Vinotaste® Pro (Novozymes) in 25 mL of KC-buffer per gram
of fresh weight Botrytis mycelium.
5. Incubate the suspension for 2–3 h at 30 °C in a shaker at
100 rpm (see Note 42).
6. Remove the digested mycelium debris by collecting in a 50 mL
conical tube the protoplast-containing flow through using
Miracloth. Wet the filter with cold KC buffer before adding
the protoplasts solution (see Note 43).
7. Fill the conical tube till 50 mL with cold KC buffer. Pellet the
protoplasts by centrifugation at 2000 ×g for 10 min.
8. Discard the supernatant and resuspend the protoplasts in cold
KC buffer. Centrifuge again at 2000 ×g for 10 min.
9. Discard the supernatant and resuspend the protoplasts in cold
KC-buffer to a final concentration of 108 protoplasts per mL
using a Pasteur pipette (see Note 44).
10. Transfer two portions of 100 μL to sterile microcentrifuge
tubes, one to be used as a negative control and the other to
be transfected, and maintain them on ice for 5 min (see
Note 45).
11. Add gently, 100 μL of 25% PEG solution first and then the
15 μL of RNA in 25 μL of RNAse-free bidistilled water mixed
with 5 μL of 50 mM spermidine to the protoplasts.
12. Keep the mixture on ice for 20 min.
13. Add 500 μL of 25% PEG solution, mix gently, and incubate for
10 min at RT.
14. Adjust the volume to 1 mL with cold KC-buffer.
15. Mix the protoplasts with 50 mL of SH agar medium at 50–55 °
C and incubate them at 24 °C (see Note 46).
16. After 7 days of incubation at 24 °C, the mycelia will cover the
transfection plate and the virus will have replicated (see
Note 47).
17. Transfer the mycelia as previously stated using sterile water and
a Drigalski spatula to new solid media to continue purifying
your transfected strains and to liquid media to harvest the
62 Laura Córdoba et al.

cultures, extract RNA, and detect the viral RNA as previously

described to see if the transfection protocol has been successful.
Once the virus of interest has been detected in the transfected
protoplasts, proceed with the purification of the fungus (see
Note 48).

3.3.4 Generation of 1. Add 1–2 mL of sterile water or PDB to a PDA plate and spread
Fungal Single-Spore it with a Drigalski spatula.
Infected Isolates 2. Collect all biomass and filter it through Miracloth to discard
rests of mycelia.
3. Count spores using a counter camera and prepare a dilution of
103 spores/mL.
4. Place 0.1 mL of this suspension on Petri dishes with water agar
(2%) medium and incubate at 24 °C for 16 h (see Note 49).
5. After incubation, select individual germinated spores with a
10 μL tip and transfer them onto individual Petri dishes with
PDA medium (see Note 50).
6. Incubate plates at 24 ° C for 6 days and confirm the presence of
BVF.

4 Notes

1. Media needs to be poured homogeneously in all plates, avoid-

ing irregularities on the surface, so that individual single-spore
colonies can be picked up.
2. Sterilize paper in autoclave in a dry cycle or by disinfect paper at
80 °C for at least 6 h.
3. Non-diluted DEPC reactive is toxic. Wear gloves and avoid
touching your skin or inhaling it. Perform the whole process
under an extraction hood.
4. Alternatively, other retrotranscriptase enzymes such as M-MLV
(New England Biolabs) may be used with specific primers.
5. Normally, agar absorbs part of the liquid. If necessary, add
more water.
6. In case of need of storage in glycerol at -80 °C, transfer part of
the biomass to a tube containing 1 mL of 20% sterile glycerol.
7. In case the mycovirus is not well-dispersed in the plate, scratch
in as many different parts of the plate and take mycelia, spores,
and sclerotia, if possible, simultaneously. Try to use a fresh
B. cinerea culture for RNA extraction.
8. Mycelia can be frozen directly at -80 °C without passing by
liquid nitrogen. However, rapid freezing improves mycelia
conservation.
 Synthetic Mycovirus Construction 63

9. All manipulations that involve RNA extraction using phenol-

derived chemicals should be performed in a fume hood. For
steps involving RNA, always use certified nuclease-free pipette
tips and tubes, and wear gloves. As an extra precaution to
reduce the risk of RNA degradation, clean your material with
a 10% SDS-containing solution and rinse thoroughly with
distilled water.
10. Alternatively, a lower amount of fungal biomass can be used as
input for the RNA extraction. Quality will not be affected, but
the viral concentration in the sample will be lower. The proto-
col can be adapted then to work with smaller volumes: 2 mL
safe lock microcentrifuge tubes, 1 mL of Nzyol, 200 μL of
chloroform, etc. would be used in that case.
11. Refrigerate the centrifuge at 4 °C before introducing samples
to maintain RNA integrity.
12. The interphase contains cellular debris, proteins, and DNA
that can affect the purity and quality of RNA, so it is very
important not to disturb it and not pipette any of it to your
sample. It is better to leave some aqueous layer on the tube
than to remove some debris and continue the precipitation.
13. Precipitation at -20 °C can be extended ON if needed.
14. Drying large pellets may take more than 10 min, so it is
recommended to do it under a chemical extraction hood or
even incubating tubes at 37 °C, for no more than 1 min, to
facilitate ethanol evaporation but avoiding RNA degradation.
15. In case of very dense pellets, consider adding more DEPC
water to dissolve the pellet easily.
16. To avoid freezing and defrosting cycles, aliquot total RNA in
smaller volumes.
17. An A260/A280 ratio of ~2.1 means high pure RNA. In case of
ratios higher than 1.8, purity can be considered acceptable. A
ratio of <1.8 indicates potential DNA or protein
contamination.
18. To ensure deactivation of RNases, electrophoresis equipment
(cubette, gel tray, and comb) used for RNA analysis should be
thoroughly cleaned with detergent, treated during 30 min with
a 0.5 M NaOH solution, washed with ultrapure water, and
dried well.
19. Good quality, non-degraded RNA will be seen on agarose gel
electrophoresis as two clear bands of ribosomal RNA. A par-
tially degraded RNA will show smear and an accumulation of
smaller fragments.
20. Specific reverse primers can be added to the master mix with a
final concentration of 2 μM.
64 Laura Córdoba et al.

21. Instead of First-Strand cDNA Synthesis Kit, SuperScript IV

retrotranscriptase can be used by applying 2.5 μg of RNA as
input in a total reaction volume of total volume of 10 μL
following manufacturer’s instructions.
22. You can use filter tips to avoid contamination or degradation of
the RNA.
23. Prepare complementary DNA reactions immediately prior to
its incubation.
24. Addition of RNase H will remove RNA bound to cDNA. It is
recommended when using cDNA in PCR amplification to
increase the sensitivity of the PCR step.
25. RT-PCR primers were designed based on the BYMV-CS
genome (Accession n°: OM928008). Reverse primer
(BVF_NotIEcoRI Rev.; 5′-TTGAACGGGAATTCGCGG
CCGCTTTTTTTTTTTTTTTTTTGCCTCGTGTGCAACGA
AG-3′) complementary to the 3′ end of the BVF viral sequence
incorporates the restriction enzyme sites NotI and EcoRI
(underlined), both absent in the viral sequence for linearization
and cloning porpoises. Reverse primer also introduces a poly
(A) 18 tail. An extra eight bases are added to the 5′ end of the
primer to allow efficient cutting of the amplification product by
XbaI and cloning in pUC19 vector. Forward primer
(BVF_XbaIFw; 5′-CTAGCTTCTCTAGATAATACGACTC
ACTATAGGGGATTAAATTCACATCCAACA -3′) contains
the XbaI restriction site (underlined) and the T7 RNA poly-
merase promoter sequence (in italics). An additional seven
bases are added to the 5′ end of the primer to allow efficient
cutting of the amplification product by XbaI and cloning in the
pUC19 vector. The choice of the restriction enzyme is critical
for the successful generation of the infectious clone. The
restriction sites introduced by the primers for linearization
and cloning purposes should be unique (present neither in
the viral genome nor in the vector sequence).
26. We have used CloneAmp HIFI PCR Premix, a master mix
containing a proof-reading DNA polymerase that in our
hands was critical for an accurate and efficient amplification of
the BVF genome. This enzyme generates blunt-endproducts
which allow for subcloning of PCR product into any commer-
cial linearized plasmid with blunt ends.
27. If you find difficulties to ligate the digested PCR products
directly into pUC19 vector, perform a subcloning step using
a commercial linearized plasmid with blunt ends such as
pJET1.2/blunt which offers a high cloning efficiency of
blunt PCR products and accepts inserts from 6 bp to 10 kb.
 Synthetic Mycovirus Construction 65

Transform chemically competent DH5 α E. coli strain and

perform mini-scale plasmid extractions. Gel-purify the product
with NucleoSpin Gel and PCR Clean-up. Follow steps 2–5 in
Subheading 3.2.2.
28. You can use commercial or lab-made competent cells; although
the efficiency of the commercial cells is much higher than the
lab-made ones, their cost is also considerable.
29. An alternative protocol using lab-made solutions can also be
performed; you can use one similar as is included in [35].
30. To achieve complete coverage of the sequence, and obtain a
correct sequence, we must do sequencing of both DNA strands
by using forward and reverse primers.
31. At this point, the full length sequence should be obtained by
canonical primer walking sequencing.
32. Alternatively, the DNA template can be obtained from a PCR
reaction, but it would also have to be cleaned up with a com-
mercial kit and resuspended in water.
33. If the restriction reaction is not very efficient, many factors can
be affecting it, but one of the main ones is the quality of the
starting material; if the plasmid is contaminated with ethanol or
other compounds, it is better to do a new miniprep and start
again.
34. To increase the linearized plasmid yield, heat the resuspension
water to 60 °C and, after the final centrifugation, pipette the
DNA suspension and place it on the same column. Centrifuge
again.
35. Wear gloves during RNA manipulation to avoid degradation.
36. In vitro transcription reactions that are described here are
prepared in 20 μL, but it can be done in a smaller volume.
Nevertheless, they would have to be tested to check if the
transfection is successful.
37. BVF transcripts are naturally capped. Thus, the addition of a
synthetic cap analogue is necessary, but could be avoided for
other viruses.
38. Keep in mind that for 20 μL, a maximum of 7 μL of linearized
template DNA could be added. It would be wise to check the
concentration using a NanoDrop spectrophotometer prior to
the transcription and concentrate the samples if needed.
39. The in vitro transcription, reaction can be performed for 2–4 h
at 37 °C, but in our experience, the yield and the quality of the
obtained transcripts is much higher if the incubation is done
ON. Nevertheless, an optimization protocol can be performed
using a time-course experiment with different times of
incubation.
66 Laura Córdoba et al.

40. The in vitro transcription reaction can be performed in a water

bath, in a thermocycler, or in a thermoblock.
41. Protoplasts are characteristically round fungal cells due to the
loss of their cell wall, so all buffers used during transfection
must be osmostabilized.
42. Check periodically the formation of protoplasts during the cell
wall degradation process to both assess the appearance of pro-
toplasts and their physical qualities. Take 10 μL aliquots under
microscope. Protoplasts should start appearing after
30–60 min of incubation.
43. An excess of incubation time might also be detrimental to the
protoplasts viability or competence, so it is advisable to filter
them after 2–3 h maximum after they start appearing.
44. After filtering and washing the protoplasts, keep them on ice to
avoid regeneration of the cell wall.
45. When manipulating protoplasts, avoid using standard pipet
tips. Instead use a Pasteur pipette with a bigger diameter for
protoplasts resuspension steps or cut pipette tips along during
the rest of the protocol to avoid the burst of your protoplasts.
46. Be careful with the temperature of the SH agar, it could be
positive for the protoplast viability to keep the SH-agar 2× at
55 °C, and mix it with RT 1.6 M sucrose right before adding
the protoplasts so that the temperature is not so high. Spread
the protoplasts immediately after to avoid solidification of the
medium.
47. If the fungal growth after transfection is too slow, the SH
medium can be supplemented with yeast extract at 0.01%.
48. It is more appropriated to obtain a single spore isolate from the
transfected isolate to ensure a higher concentration of the
virus.
49. Optionally, different higher or less concentrated dilutions may
be cultured in case of low or high number of expected germi-
nated spores.
50. Germinated spores are like little “white spots” or “spiders” that
can be seen by candling of plates.

Acknowledgments

L.C. and A.R.-P. were supported with the European Union’s Hori-
zon 2020 Research and Innovation Program (Grant Agreement
no. 773567), and L.C. was also supported with a postdoctoral
fellow by the “Severo Ochoa Programme for Centers of Excellence
in R&D” (2017–2021) from the Agencia Estatal de Investigación
of Spain (Grant SEV-2016-0672 to CBGP). J.P.-M. is currently
 Synthetic Mycovirus Construction 67

supported with a postdoctoral fellowship Margarita SalasMSALAS-

2022-20257. This study was financially supported by VIRO-
PLANT, a project that received funding from the European
Union’s Horizon 2020 Research and Innovation Program (grant
agreement number 773567). M. A. Ayllón and J.L.R-R research is
currently funded by the Project I + D + i PID2020-120106RB-I00
supported by MCIN/AEI/10.13039/501100011033/.

References
1. Choi GH, Nuss DL (1992) Hypovirulence of
chestnut blight fungus conferred by an infec-
tious viral cDNA. Science 257:800–803
2. Chen B, Choi GH, Nuss DL (1994) Attenua-
tion of fungal virulence by synthetic infectious
hypovirus transcripts. Science 264:1762–1764
3. Lin H, Lan X, Liao H et al (2007) Genome
sequence, full-length infectious cDNA clone,
and mapping of viral double-stranded RNA
accumulation determinant of hypovirus
CHV1-EP721. J Virol 81:1813–1820
4. Chen B, Nuss DL (1999) Infectious cDNA
clone of hypovirus CHV1-Euro7: a compara-
tive virology approach to investigate virus-
mediated hypovirulence of the chestnut blight
fungus Cryphonectria parasitica. J Virol 73:
985–992
5. Moleleki N, van Heerden SW, Wingfield MJ
et al (2003) Transfection of Diaporthe per-
juncta with Diaporthe RNA virus. Appl Envi-
ron Microbiol 69:3952–3956
6. Esteban R, Fujimura T (2003) Launching the
yeast 23S RNA Narnavirus shows 5′ and 3′
cis-acting signals for replication. Proc Natl
Acad Sci U S A 100:2568–2573
7. Esteban R, Vega L, Fujimura T (2005)
Launching of the yeast 20 S RNA narnavirus
by expressing the genomic or antigenomic viral
RNA in vivo. J Biol Chem 280:33725–33734
8. Marzano S-YL, Hobbs HA, Nelson BD et al
(2015) Transfection of Sclerotinia sclerotiorum
with in vitro transcripts of a naturally occurring
interspecific recombinant of Sclerotinia sclero-
tiorum hypovirus 2 significantly reduces viru-
lence of the fungus. J Virol 89:5060–5071
9. Zhang R, Hisano S, Tani A et al (2016) A
capsidless ssRNA virus hosted by an unrelated
dsRNA virus. Nat Microbiol 1:15001
10. Wang Q, Mu F, Xie J et al (2020) A single
ssRNA segment encoding RdRp is sufficient
for replication, infection, and transmission of
ourmia-like virus in fungi. Front Microbiol 11:
379
11. Córdoba L, Ruiz-Padilla A, Rodrı́guez-
Romero J, Ayllón MA (2022) Construction
and characterization of a Botrytis virus F infec-
tious clone. J Fungi 8:459
12. Li P, Wang S, Zhang L et al (2020) A tripartite
ssDNA mycovirus from a plant pathogenic fun-
gus is infectious as cloned DNA and purified
virions. Sci Adv 6:eaay9634
13. Feng C, Feng J, Wang Z et al (2021) Identifi-
cation of the viral determinant of hypoviru-
lence and host range in Sclerotiniaceae of a
Genomovirus reconstructed from the plant
metagenome. J Virol 95:e0026421
14. Dean R, Van Kan JAL, Pretorius ZA et al
(2012) The top 10 fungal pathogens in molec-
ular plant pathology. Mol Plant Pathol 13:414–
430
15. Howitt RLJ, Beever RE, Pearson MN, Forster
RLS (2006) Genome characterization of a flex-
uous rod-shaped mycovirus, Botrytis virus X,
reveals high amino acid identity to genes from
plant ‘potex-like’ viruses. Arch Virol 151:563–
579
16. Rodrı́guez-Garcı́a C, Medina V, Alonso A, Ayl-
lón MA (2014) Mycoviruses of Botrytis cinerea
isolates from different hosts. Ann Appl Biol
164:46–61
17. Hao F, Wu M, Li G (2018) Molecular charac-
terization and geographic distribution of a
Mymonavirus in the population of Botrytis
cinerea. Viruses 10:432
18. Hao F, Ding T, Wu M et al (2018) Two novel
hypovirulence-associated Mycoviruses in the
phytopathogenic fungus Botrytis cinerea:
molecular characterization and suppression of
infection cushion formation. Viruses 10:254
19. Donaire L, Pagán I, Ayllón MA (2016) Char-
acterization of Botrytis cinerea negative-
stranded RNA virus 1, a new mycovirus related
to plant viruses, and a reconstruction of host
pattern evolution in negative-sense ssRNA
viruses. Virology 499:212–218
20. Donaire L, Ayllón MA (2017) Deep sequenc-
ing of mycovirus-derived small RNAs from
Botrytis species. Mol Plant Pathol 18:1127–
1137
68 Laura Córdoba et al.
21. Donaire L, Rozas J, Ayllón MA (2016) Molec-
ular characterization of Botrytis ourmia-like
virus, a mycovirus close to the plant pathogenic
genus Ourmiavirus. Virology 489:158–164
22. Wang Q, Zou Q, Dai Z et al (2022) Four novel
Mycoviruses from the hypovirulent Botrytis
cinerea SZ-2-3y isolate from Paris polyphylla:
molecular characterisation and mitoviral
sequence transboundary entry into plants.
Viruses 14:151
23. Khalifa ME, MacDiarmid RM (2021) A
mechanically transmitted DNA Mycovirus is
targeted by the defence machinery of its host,
Botrytis cinerea. Viruses 13:1315
24. Ruiz-Padilla A, Rodrı́guez-Romero J, Gómez-
Cid I et al (2021) Novel Mycoviruses discov-
ered in the mycovirome of a necrotrophic fun-
gus. MBio 12:e03705–e03720
25. Hao F, Wu M, Li G (2021) Characterization of
a novel genomovirus in the phytopathogenic
fungus Botrytis cinerea. Virology 553:111–116
26. Cottet L, Potgieter CA, Castro ME, Castillo A
(2019) Molecular characterization of a new
botybirnavirus that infects Botrytis cinerea.
Arch Virol 164:1479–1483
27. Howitt RLJ, Beever RE, Pearson MN, Forster
RLS (2001) Genome characterization of Botry-
tis virus F, a flexuous rod-shaped mycovirus
resembling plant ‘potex-like’ viruses. J Gen
Virol 82:67–78
28. Svanella-Dumas L, Marais A, Faure C et al
(2018) Genome characterization of a divergent
isolate of the mycovirus Botrytis virus F from a
grapevine metagenome. Arch Virol 163:3181–
3183
29. Buttner P, Koch F, Voigt K et al (1994) Varia-
tions in ploidy among isolates of Botrytis
cinerea: implications for genetic and molecular
analyses. Curr Genet 25:445–450
30. Untergasser A, Cutcutache I, Koressaar T et al
(2012) Primer3-new capabilities and inter-
faces. Nucleic Acids Res 40:e115
31. Rausch T, Fritz MH-Y, Untergasser A, Benes V
(2020) Tracy: basecalling, alignment, assembly
and deconvolution of sanger chromatogram
trace files. BMC Genomics 21:230
32. Davis MW, Jorgensen EM (2022) ApE, a plas-
mid editor: a freely available DNA manipula-
tion and visualization program. Front
Bioinforma 2:818619
33. Sievers F, Wilm A, Dineen D et al (2011) Fast,
scalable generation of high-quality protein
multiple sequence alignments using Clustal
Omega. Mol Syst Biol 7:539
34. van Kan JAL, van ’t Klooster JW, Wagemakers
CAM et al (1997) Cutinase A of Botrytis
cinerea is expressed, but not essential, during
penetration of gerbera and tomato. Mol Plant-
Microbe Interact 10:30–38
35. Green MR, Sambrook J (2016) Preparation of
plasmid DNA by alkaline lysis with sodium
dodecyl sulfate: minipreps. Cold Spring Har-
bor Laboratory Press, Cold Spring Harbor
 Part III

Plant-Pathogens Interactions
 Chapter 5

Exopolysaccharide Production and Precipitation Method

as a Tool to Study Virulence Factors
Natalia Mielnichuk, Constanza M. Joya, Marı́a A. Monachesi,
and Romina P. Bertani

Abstract
Acidovorax avenae subsp. avenae (Aaa) is the causal agent of red stripe in sugarcane, a disease characterized
by two forms: leaf stripe and top rot. Despite the importance of this disease, little is known about Aaa
virulence factors (VFs) and their function in the infection process. Among the different array of VFs exerted
by phytopathogenic bacteria, exopolysaccharides (EPSs) often confer a survival advantage by protecting the
cell against abiotic and biotic stresses, including host defensive factors. They are also main components of
the extracellular matrix involved in cell–cell recognition, surface adhesion, and biofilm formation. EPS
composition and properties have been well studied for some plant pathogenic bacteria; nevertheless, there is
no knowledge about Aaa-EPS. In this work, we describe a simple and reliable method for EPS production,
precipitation, and quantification based on cold precipitation after ethanol addition, which will allow to
study EPS characteristics of different Aaa strains and to evaluate the association among EPS (e.g., amount,
composition, viscosity) and Aaa pathogenicity.

Key words Exopolysaccharide, Precipitation, Saccharum spp., Acidovorax avenae subsp. avenae, Red
stripe disease, Virulence factor

1 Introduction

Bacterial exopolysaccharides (EPSs) are extracellular polymeric sub-

stances with high molecular weight, composed of carbohydrates
and non-carbohydrate substituents such as acetate, glycerol, pyru-
vate, sulfate, carboxylate, succinate, and phosphate groups
[1]. EPSs are involved in a variety of biological processes, including
bacterial growth as a biofilm, cell recognition, protection against
stresses and hostile environments, antibiotic resistance, and phago-
cytosis; having a role in cell adhesion and aggregation; cohesion of
biofilm, water retention, nutrient and energy source, protective
barrier, sorption of organic compounds and inorganic ions, and
binding of cell components [2].

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_5,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

71
72 Natalia Mielnichuk et al.

Most EPSs are synthesized intracellularly and exported to the

extracellular environment as macromolecules. Bacteria can produce
a wide range of EPSs according to the monosaccharide composi-
tion, chemical structure (e.g., a backbone with a side chain deco-
rated by non-glycosidic substituents), molecular ratio, molecular
weight, and linkage bonds [1, 2]. EPS properties such as size,
flexibility, charge, and composition can influence their biological
function. For example, the result of intra- and intermolecular inter-
actions may affect which residues are exposed and hence determine
the interaction with other molecules [3–6].
EPSs yield, rheological properties, strand length, and quantity
of substituents may differ between strains of same species. In addi-
tion, these characteristics may also vary for one strain depending on
pH, temperature, incubation time, and medium composition used
to produce the EPS [2, 3], all these making the study of EPS not a
simple task.
In bacterial plant diseases, the ability of the pathogen to infect a
susceptible host is the result of the combined action of different
virulence factors (VFs). In this sense, VFs enable a phytopathogen
to colonize, proliferate, and cause tissue damage or systemic infec-
tion in its host [7]. Diverse VFs like extracellular degradative
enzymes, cell motilities, EPS, cell adhesion, and biofilm formation
have been studied during disease development [8, 9]. In particular,
EPSs have been described as key VF during disease progress being
deeply investigated for some phytopathogens that affect economi-
cally important crops [7]. For example, xanthan produced by the
Xanthomonas genus [6, 8, 10], alginate and a Psl-like EPS pro-
duced by Pseudomonas syringae [11, 12], the EPS amylovoran
produced by Erwinia amylovora [13], and the one produced by
Ralstonia solanacearum [14] have essentials functions related with
the bacterial survival (resistance to biotic and abiotic stresses),
biofilm development, and host colonization during plant infection.
Our group is interested in the study of Acidovorax avenae
subsp. avenae (Aaa), the causal agent of red stripe in sugarcane
(Saccharum spp.). The disease, observed in more than 50 sugarcane
growing countries, is characterized by the presence of two types of
symptoms: leaf stripe and top rot [15], which may occur either
separately or simultaneously under field conditions. It was consid-
ered a minor disease until the last decade, when a significant
increase in the prevalence and intensity of red stripe was noticed
in many world-widely sugarcane-producing regions, particularly on
many recommended varieties and in areas affected by climate
change [15]. The fact that the disease has not economic impact
until recently is reflected on how little is still known about Aaa-VFs
and its infection mechanism. Indeed, there are only few studies on
the genus Acidovorax, mainly in Acidovorax avenae subsp. oryzae
and Acidovorax avenae subsp. citrulli [16–18], regarding the role
of EPS in the disease progress. Moreover, to our knowledge, there
 Exopolysaccharide Precipitation to Study Virulence Factors 73

are no investigations concerning Aaa-EPS during the development

of red stripe disease. This is why we first decided to optimize the
conditions for Aaa-EPS extraction that would allow further inves-
tigations on EPS production, composition, and role in
pathogenesis.
In this sense, different methodologies have been described for
the production and precipitation of EPS synthesized by several
microorganisms since many conditions need to be set up in order
to get a reproducible method [3]. Usually, culture media and
incubation time vary between bacteria to produce EPS, and these
conditions have to be optimized in each case. After growing the
microorganism, cells are separated from the supernatant (EPS frac-
tion). At this point, precipitation methods may differ; the most
used ones are based on ethanol, isopropanol, or acetone addition,
since organic solvents permit EPS separation from the supernatant
by lowering its solubility in aqueous solutions [3]. Sometimes,
organic solvents are combined with salt (tipically 1% w/v KCl) to
increase EPS yield [19]. In any case, the volume of the solvent
needed for EPS precipitation is variable (generally from 1 to
4 volumes). On the other hand, during EPS extraction, proteins
and salts from the medium can precipitate. This is why some
preparation methods may include more elaborate steps like the
use of trichloroacetic acid for protein sedimentation or dialysis for
final EPS purification from sugars or other medium components
[20, 21]. Size exclusion chromatography can also be used to get
pure EPS fractions; however, EPS viscosity may be an impediment
for this method [20, 21]. All these generate many combined pos-
sibilities to test when one is studying EPS production of a certain
microorganism. To make things even more complicated and time
consuming, it is usually found, under experimental conditions, that
EPS production and precipitation can be erratic and variable
between replicates. All this brings up the necessity to establish the
best conditions for each bacterium under study to increase EPS
yield and to reduce variability between replicates.
In this scenario, in an effort to characterize the Aaa-EPS
biological role, we first optimized a protocol for EPS production
and precipitation that is simple and repetitive, using different Aaa
strains that differ in pathogenicity degree [22]. This method based
on ethanol addition and cold centrifugation and precipitation will
allow in the future the analysis of chemical composition, the pres-
ence of substituents and rheological properties of the EPS pro-
duced by Aaa, as well as to understand its role in pathogenicity.
74 Natalia Mielnichuk et al.

2 Materials

2.1 Aaa Strains TUC05-22.CR.14(106), TUCCP77-42.LQ.14(30), TUCCP77

-42.LQ.12(2), TUCCO77-42.LQ.14(33), TUCCP77-42.RC.13
(13), TUC05-21.CR.14(99), TUC05-4.CR.14(46), LCP85-384.
LZ.14(35), TUCCP77-42.LQ.12(7), TUCCP77-42.LQ.12(4),
TUCCP77-42.LQ.14(34), LCP85-384.CR.14(39), TUC05-21.
CR.14(97), and TUC05-22.CR.14(110) [22].

2.2 Bacterial Media 1. Nutrient Agar (NA) and Nutrient Broth (NB).
2. Luria Bertani liquid medium supplemented with 2% (wt/vol)
glucose (LBglu): 10 g/L tryptone, 5 g/L yeast extract, 7.5 g/
L NaCl, and 20 g/L glucose (see Notes 1 and 2).

2.3 Chemicals and 1. Ethanol for analysis.

Laboratory Equipment 2. Culture tubes, 250 mL Erlenmeyer flasks, 1 L beakers, centrif-
ugal bottles, spatula, lab spoon, aluminum foil.
3. Vortex.
4. Ultracentrifuge.
5. Incubator.
6. Analytical balance.

3 Methods

3.1 Bacterial Growth 1. Cultivate bacteria from -80 °C stock on NA for 72 h at 37 °C

(one plate per strain).
2. Collect bacterial biomass from each plate using a bacteriologi-
cal loop and inoculate 10 mL of NB as a starter culture per
strain. Mix gently in vortex to homogenize the inoculum (see
Note 3). Incubate overnight (ON) at 37 °C and 200 rpm.
3. Dilute Aaa culture into 50 mL of LBglu, adjusting initial
OD600 to 0.1–0.15 (see Note 4).
4. Incubate at 37 °C and 200 rpm for 48 h.

3.2 EPS Precipitation 1. Measure final OD600 of each test culture.

2. Centrifuge at 10,500 ×g and 4 °C for 30 min to separate
bacterial cells (Fig. 1) (see Note 5).
3. Collect supernatant in a beaker and add 3 volumes of ethanol
(Fig. 2) (see Notes 6 and 7).
4. Place the supernatant + ethanol at 4 °C ON.
5. Centrifuge at 12,850 ×g and 4 °C for 20 min (see Notes 8 and
9).
 Exopolysaccharide Precipitation to Study Virulence Factors 75

Fig. 1 Separation of Acidovorax avenae subsp. avenae cells from the supernatant containing the
exopolysaccharide. P: cell pellet; CFS: cell-free supernatant

Fig. 2 Precipitation of exopolysaccharide produced by Acidovorax avenae subsp. avenae, after the addition of
three ethanol volumes. Arrowhead shows EPS threads. Solid scale bars: 1 cm; dotted scale bars: 2 cm

3.3 Weight and 1. Collect the pellet (precipitated EPS from the liquid culture
Calculations medium) with a lab spoon and place it on a previously weight
aluminum foil (initial weight) (Fig. 3a, b) (see Notes 10 and
11).
2. Dry in an incubator at 37 °C for at least 48 h (Fig. 3c, d).
3. Measure final weight (aluminum foil + dried EPS).
4. Calculations.
76 Natalia Mielnichuk et al.

Fig. 3 Recovery of the exopolysaccharide produced by Acidovorax avenae subsp. avenae, after ethanol
precipitation, cold incubation, and centrifugation (a and b) and an additional drying for 48 h (c and d).
Scale bar: 0.5 cm

Fig. 4 Scheme of exopolysaccharide (EPS) production by Acidovorax avenae subsp. avenae. ON: over night

EPS weight relative to cell growth

= ðFinal weight–Initial weightÞ=Final OD600
A workflow of the EPS production and extraction protocol is
represented in Fig. 4.
 Exopolysaccharide Precipitation to Study Virulence Factors 77

4 Notes

1. Intermediate salt strength is used for LB preparation according

to lab experience.
2. We tested different culture conditions: both NB and LB with
1% (wt/vol) glucose as well as with no glucose addition and
various culture incubation times (24 h, 48 h, and 64 h). The
proposed conditions in the protocol got the best bacterial
growing.
3. Keep a 1:5 liquid-air relation for all cultures.
4. Measure OD600 with a spectrophotometer after diluting the
bacterial culture 1:10 in LBglu.
5. In case your centrifugal bottles hold up to 50 mL, you can do
serial centrifugations using the same bottle, collecting each
round of supernatant.
6. The use of ethanol for EPS precipitation instead of isopropanol
is more economical and available for researchers. Moreover, it is
less risky than working with acetone.
7. When you add ethanol to the supernatant without bacterial
cells, do it quickly in one step; EPS should begin to precipitate
after ethanol addition (like a white cloud; see Fig. 2). We tried
EPS precipitation with no cold incubation and with longer cold
incubation times for the supernatant + ethanol step (up to
72 h). Finally, different centrifugation times after ethanol addi-
tion were also evaluated (ranging from 10 min to 1 h). In any
case, the conditions presented in this protocol rendered the
best conditions for EPS production and precipitation.
8. Both cold centrifugation and cold ethanol precipitation
increased EPS yield.
9. Some precipitation protocols add KCl 1% (wt/vol) for increas-
ing EPS yield. Here we tested the addition of KCl 1% (wt/vol)
and two volumes of ethanol, but we obtained the best results
when we add only ethanol for that purpose. Since there is no
salt addition, the obtained EPS could be used for further
studies such as Atomic Force Microscopy (AFM), Scanning
Electron Microscopy (SEM), chemical composition by estab-
lishing the neutral monosaccharide molar percentage using
techniques such as gas liquid chromatography (GLC) and
mass spectrometry (MS), determination of the presence of
uronic acid residues, or non-glycosidic substituents as for
other EPS [23].
10. Eventually, EPS may not appear as a precipitated when the
ethanol is added to the supernatant, but becomes visible after
ON cold incubation.
78 Natalia Mielnichuk et al.
11. The amount of EPS can be variable between replicates; it is
suggested to perform at least three independent repetitions.
Acknowledgements
This work was supported by ANPCyT (PICT 2016-1586).
References
1. Sun X, Zhang J (2021) Bacterial exopolysac-
charides: chemical structures, gene clusters and
genetic engineering. Int J Biol Macromol 173:
481–490
2. Angelin J, Kavitha M (2020) Exopolysacchar-
ides from probiotic bacteria and their health
potential. Int J Biol Macromol 162:853
3. Kumar AS, Mody K, Jha B (2007) Bacterial
exopolysaccharides – a perception. J Basic
Microbiol 47:103–117
4. Ikeda S, Gohtani S, Nishinari K, Zhong Q
(2012) Single molecules and networks of
xanthan gum probed by atomic force micros-
copy. Food Sci Technol Res 18:741–745
5. Tielen P, Strathmann M, Jaeger KE et al (2005)
Alginate acetylation influences initial surface
colonization by mucoid Pseudomonas aerugi-
nosa. Microbiol Res 160:165–176
6. Bianco MI, Toum L, Yaryura PM et al (2016)
Xanthan pyruvilation is essential for the viru-
lence of Xanthomonas campestris pv. campestris.
Mol Plant-Microbe Interact 29:688–699
7. Pfeilmeier S, Caly DL, Malone JG (2016) Bac-
terial pathogenesis of plants: future challenges
from a microbial perspective: challenges in bac-
terial molecular plant pathology. Mol Plant
Pathol 17:1298–1313
8. An SQ, Potnis N, Dow M et al (2019) Mecha-
nistic insights into host adaptation, virulence
and epidemiology of the phytopathogen
Xanthomonas. FEMS Microbiol Rev 44:1–32
9. Pontes JGDM, Fernandes LS, Dos Santos RV
et al (2020) Virulence factors in the
phytopathogen-host interactions: an overview.
J Agric Food Chem 68:7555–7570
10. Büttner D, Bonas U (2010) Regulation and
secretion of Xanthomonas virulence factors.
FEMS Microbiol Rev 34:107–133
11. Keith RC, Keith LMW, Hernández-Guzmán G
et al (2003) Alginate gene expression by Pseu-
domonas syringae pv. tomato DC3000 in host
and non-host plants. Microbiology 149:1127–
1138
12. Heredia-Ponce Z, Gutiérrez-Barranquero JA,
Purtschert-Montenegro G et al (2020)
Biological role of EPS from Pseudomonas syr-
ingaepv. syringae UMAF0158 extracellular
matrix, focusing on a Psl-like polysaccharide.
NPJ Biofilms Microbiomes 6:37
13. Piqué N, Miñana-Galbis D, Merino S, Tomás
JM (2015) Virulence factors of Erwinia amy-
lovora: a review. Int J Mol Sci 16:12836–12854
14. Milling A, Babujee L, Allen C (2011) Ralsto-
nia solanacearum extracellular polysaccharide
is a specific elicitor of defense responses in
wilt-resistant tomato plants. PLoS One 6:
e15853
15. Yonzone R, Soniya Devi M (2018) Red stripe/
top rot disease of sugarcane: a review. Int J
Curr Microbiol Appl Sci 7:1469–1478
16. Zhang Y, Zhang F, Li B et al (2017) Charac-
terization and functional analysis of clpB gene
from Acidovorax avenae subsp. avenae RS-1.
Plant Pathol 66:1369–1379
17. Ogunyemi SO, Fang Y, Qiu W et al (2019)
Role of type IV secretion system genes in viru-
lence of rice bacterial brown stripe pathogen
Acidovorax oryzae strain RS-2. Microb Pathog
126:343–350
18. Fan J, Qian G, Chen T et al (2011) The acyl-
homoserine lactone (AHL)-type quorum sens-
ing system affects growth rate, swimming
motility and virulence in Acidovorax avenae
subsp. citrulli. World J Microbiol Biotechnol
27:1155–1166
19. Vojnov AA, Zorreguieta A, Dow JM et al
(1998) Evidence for a role for the gumB and
gumC gene products in the formation of
xanthan from its pentasaccharide repeating
unit by Xanthomonas campestris. Microbiology
144:1487–1493
20. Bajpai VK, Majumder R, Rather IA, Kim K
(2016) Extraction, isolation and purification
of exopolysaccharide from lactic acid bacteria
using ethanol precipitation method.
Bangladesh J Pharmacol 11:573–576
21. Ziadi M, Bouzaiene T, M’Hir S et al (2018)
Evaluation of the efficiency of ethanol precipi-
tation and ultrafiltration on the purification
and characteristics of exopolysaccharides
 Exopolysaccharide Precipitation to Study Virulence Factors 79

produced by three lactic acid bacteria. Biomed
Res Int 2018:1896240
22. Bertani RP, Perera MF, Joya CM et al (2021)
Genetic diversity and population structure of
Acidovorax avenae subsp. avenae isolated from
sugarcane in Argentina. Plant Pathol 70:1719–
1732
23. Mielnichuk N, Bianco MI, Yaryura PM et al
(2021) Virulence factors analysis of native iso-
lates of Xanthomonas albilineans and Xantho-
monas sacchari from Tucumán, Argentina,
reveals differences in pathogenic strategies.
Plant Pathol 70:1072–1084
 Chapter 6

Virulence-Related Assays for Investigation

of the Acidovorax citrulli-Cucurbitaceae Pathosystem
Francisco Pérez-Montaño, Irene Jiménez-Guerrero, Dafna Tamir-Ariel,
and Saul Burdman

Abstract
Acidovorax citrulli is one of the most important pathogens of cucurbit crops, mainly melon and water-
melon. Although A. citrulli is able to infect all aerial parts of the plant, fruits are highly sensitive to the
bacterium. Therefore, the disease is known as bacterial fruit blotch (BFB). The unavailability of effective
tools for managing BFB, including the lack of resistant varieties, exacerbates the threat this disease poses to
the cucurbit industry. However, despite the economic importance of BFB, still little is known about basic
aspects of A. citrulli-plant interactions. Here, we present diverse techniques that have recently been
developed for investigation of basic aspects of BFB, including identification of virulence determinants of
the pathogen.

Key words Acidovorax citrulli, Bacterial fruit blotch, Cucurbit, Melon, Watermelon

1 Introduction

Bacterial fruit blotch (BFB) of cucurbits is a devastating disease

caused by the Gram-negative bacterium Acidovorax citrulli. Global
outbreaks of BFB have been reported in many countries, in water-
melon, melon, squash, pumpkin, and cucumber [1, 2], and the
disease is considered as a serious threat mainly to the watermelon
and melon industry. On the basis of genetic and biochemical fea-
tures, A. citrulli strains are divided into two main groups that also
differ in terms of host preference: group I strains have been gener-
ally isolated from non-watermelon cucurbits, and mainly melon,
whereas group II strains have been mainly isolated from water-
melon and are more virulent and better adapted to this host than
to other cucurbits [2–4].

Francisco Pérez-Montaño and Irene Jiménez-Guerrero contributed equally with all other contributors.

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_6,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

81
82 Francisco Pérez-Montaño et al.

Type IV pili (T4P) and polar flagella, which mediate twitching

and swimming motilities, respectively, have been demonstrated as
important virulence determinants of A. citrulli [5–7]. T4P were
also shown to be important for biofilm formation by A. citrulli cells
[5, 6]. As many Gram-negative pathogenic bacteria, A. citrulli
depends on a functional type III secretion system (T3SS) to cause
disease [8]. This secretion system injects protein effectors to the
host cell, where they interfere with its metabolism and suppress
defense responses [9, 10]. Interestingly, group I and II strains of A.
citrulli can be distinguished based on the arsenal and sequences of
type III-secreted effectors (T3Es), suggesting that some T3Es may
play a role in determination of host preferential association of
A. citrulli towards different cucurbit crops [11, 12].
Although A. citrulli is one of the richest bacterial pathogens in
terms of T3E arsenal size, and some newly identified T3Es of
A. citrulli seem to be uniquely shared by plant-pathogenic Acid-
ovorax spp. [12], only few studies have characterized to some extent
the role of these T3Es in A. citrulli-plant interactions. In
A. citrulli, T3Es are termed Aop, for Acidovorax outer proteins.
AopW1, which shares similarity with P. syringae HopW1, was
shown to contribute to the virulence of A. citrulli [13]. As similar
as HopW1, AopW1 is able to interact with and disrupt the actin
cytoskeleton of the host cells [14]. AopP was shown to suppress
generation of reactive oxygen species and accumulation of salicylic
acid in host cells, significantly contributing to the virulence of a
group II strain in watermelon [15]. Zhang et al. [16] showed that
AopN induces a programmed cell death response in Nicotiana
benthamiana. Recently, Fujiwara et al. [17] reported that an
A. citrulli T3E homologous of RipAY from Ralstonia solana-
cearum decreases host cellular glutathione content. Despite these
recent advances, much work is needed to elucidate the contribution
of most A. citrulli T3Esto virulence and preferential host
association.
Based on (i) the relatively large size of the A. citrulli T3E
arsenal, including the occurrence of several T3E genes belonging
to the same family; (ii) the vast knowledge accumulated for other
Gram-negative plant-pathogenic bacteria, which show subtle or
undetected phenotypes for individual T3Es; and (iii) preliminary
characterization of various A. citrulli mutants defected in single
T3E genes, we hypothesize that most mutants impaired in single
T3E genes will not render detectable phenotypes in terms of viru-
lence and determination of host preference. In other words, to get
insights into the role played by T3Es in A. citrulli-plant interaction,
generation of polymutants of the bacterium defected in several T3E
genes is needed. This can be facilitated by a methodology that
allows generation of marker-free mutants.
 Virulence-Related Methods for Acidovorax citrulli 83

Fig. 1 Experimental scheme of techniques described in this chapter for investigation of the A. citrulli-
Cucurbitaceae pathosystem

In this chapter, we describe several techniques that were

adapted for investigation of the A. citrulli-Cucurbitaceae pathosys-
tem, with emphasis on methods involving (i) construction of
marker-free mutagenesis for deletion of specific genes,
(ii) inoculation assays for assessment of virulence of A. citrulli
strains, and (iii) quantitative measurements of twitching motility
and biofilm formation (Fig. 1).

2 Materials

The following protocols require standard equipment in microbiol-

ogy, molecular biology, as well as facilities for plant growth. These
include autoclave, biological hood, incubators, shakers, refrigera-
tors, -80 °C and -20 °C freezers, gel electrophoresis devices,
spectrophotometer, NanoDrop, centrifuges, thermocyclers, UV
transilluminator, plate reader, growth chamber and/or
temperature-controlled greenhouse, etc. In addition, routine
microbiology and molecular materials and devices are needed,
including pipettors, plastic tips, tubes, flask and bottles, Petri
dishes, media components, molecular biology enzymes and kits,
sterile ultrafiltrated water, etc.
84 Francisco Pérez-Montaño et al.

2.1 Bacterial Strains, 1. Bacterial strains: Escherichia coli DH5α for routine cloning and
Vectors, and Media plasmid maintenance, E. coli S17-λpir [18] as donor in
bi-parental mating, pK18mobsacB vector, and Acidovorax
citrulli strains.
2. Luria-Bertani (LB) medium: 10 g/L Bacto-tryptone, 5 g/L
yeast extract, and 5 g/L NaCl. pH 6.8–7.2. Add 15 g/L of
agar for LB solid media (LBA).
3. Luria-Bertani sucrose medium (LBS) without NaCl: 10 g/L
Bacto-tryptone, 5 g/L yeast extract, and 15% sucrose.
pH 6.8–7.2. Add 15 g/L of agar for solid media.
4. Nutrient Broth (NB) medium: 1 g/L beef extract, 2 g/L yeast
extract,5 g/L peptone, and 5 g/L NaCl. pH 6.8–7.2. Add
15 g/L of agar for solid media (Nutrient Agar, NA).
5. Nutrient Sucrose Agar (NSA) medium: 1 g/L beef extract,
2 g/L yeast extract, 5 g/L peptone, 5 g/L NaCl, and 10 g/
L sucrose. Add 15 g/L of agar for solid media.
6. Amended M9 minimal medium (for 1 L): 200 mL M9 salts,
20 mL 20% glucose, 2 mL 1 M MgSO4, 100 μL1 M CaCl2, and
sodium citrate and casamino acids at a final concentration of
0.75% each .pH 6.8–7.2.
7. M9 salts: 64 g/L Na2HPO4·7H2O, 15 g/L KH2PO4, 2.5 g/L
NaCl, and 5.0 g/L NH4Cl.
8. Antibiotics: when required, ampicillin (Amp), carbenicillin
(Cb), kanamycin (Km), and nalidixic acid (Nal) are added to
the media at appropriate final concentrations (see Note 1).

2.2 Enzymes, 1. Bacterial genomic DNA purification kit.

Compounds, and Kits 2. Plasmid mini extraction kit.
for Molecular Biology
3. Gel extraction and PCR cleanup kit.
4. Taq and proofreading DNA polymerase kits.
5. Appropriate oligonucleotide primers (see Note 2).
6. Some restriction enzymes contained in pK18mobsacB multiple
cloning site (ApoI, EcoRI, SacI, KpnI, XmaI, SmaI, BamHI,
XbaI, SalI, PstI, SphI, and/or HindIII).
7. Ultrapure agarose.
8. DNA ladder.
9. Tris borate EDTA (TBE): 109 g/L Tris base, 55 g/L boric
acid, and 4.65 g/LEDTA. Adjust the pH to 8.3 with NaOH.
10. Loading dye: Dissolve 25 mg of bromophenol blue and 4 g of
sucrose in 10 mL distilled water.
11. Ethidium bromide staining solution: Add 15 μL of 10 mg/mL
ethidiumbromide solution to 300 mL of water and store at
4 °C.
 Virulence-Related Methods for Acidovorax citrulli 85

12. DNA gel extraction kit.

13. T4 DNA ligase kit.
14. E. coli DH5α and S17-λ pir competent cells.
15. X-Gal (5-bromo-4-chloro-3-indolyl-D-galactoside) stock
solution (40 mg/mL in dimethylformamide).

2.3 Plant Inoculation 1. Melon or watermelon seeds.

2. 600 mLpots.
3. 150 mL pots.
4. Sand.
5. Peat-based commercial soil mixture.
6. Plant growth chamber or greenhouse.
7. 25-gauge needles.
8. 10 mM MgCl2 solution.
9. Mortar and pestle.
10. Vacuum chamber.
11. 2 mL syringes.
12. Plastic conical tubes.

2.4 Assessment of 1. 96-well plates.

Virulence 2. 95% ethanol.
Determinants
3. 0.1% crystal violet.
4. Multimode plate reader or spectrophotometer.
5. Light microscope equipped with image acquisition system.

3 Methods

Prepare solutions using distilled water or analytical grade reagents

and use sterilized materials. Most manipulations must be done
under aseptic conditions, with the employment of a laminar flow
cabinet being strongly recommended. Carefully follow waste dis-
posal regulations for disposal of waste materials.

3.1 Marker-Free 1. Extract the A. citrulli genomic DNA that will be used as PCR
Gene Deletion Using template using a bacterial genomic DNA purification kit.
the sacB-Containing 2. Isolate plasmid pK18mobsacB (suicidal plasmid in A. citrulli)
Plasmid pK18mobsacB [19] (Fig. 2a) using a plasmid extraction kit.
3. Conduct two PCR reactions using bacterial DNA as template
to amplify about 500 to 600 bp of the upstream and down-
stream regions of the open reading frame of the target gene
(the gene to be deleted), using the 1/2 and 3/4 pair of
86 Francisco Pérez-Montaño et al.

Fig. 2 Strategy for generation of A. citrulli mutants by marker-free gene deletion. (a) Schematic representation
of the suicide vector pK18mobsacB. (b) Scheme of deletion mutagenesis by overlapping PCR. Homology
between primers and template DNA is indicated by the same color

primers, respectively. Fuse both fragments by overlap extension

PCR using the1/4 pair of primers (Fig. 2b) (see Note 3) [20]
and a proofreading DNA polymerase kit for PCR reactions.
Make sure to include appropriate restriction sites at the 5′- and
3′-ends of the fusion product.
4. Clean the resulting PCR product from an agarose gel using a
gel extraction kit.
5. Cut plasmid pK18mobsacB and the PCR product with appro-
priate restriction enzymes, following manufacturer’s
instructions.
6. Apply a second DNA purification step to remove enzymes,
salts, and uncut DNA that were left from the restriction reac-
tion (see Note 4).
7. Ligate the insert (digested fusion product) into the cut
pK18mobsacB in a proportion of 3:1 (sticky-ends) or 1:1
(blunt-ends) using T4 DNA ligaseat16 °C overnight (see
Note 5).
8. Use the ligated plasmid to transform competent E. coli DH5α
cells [21] following an appropriate protocol, e.g., heat-shock
and electroporation. Plate the transformation on LBA supple-
mented with 30 mg/L Km and 40 mg/L X-gal. Incubate
overnight at 37 °C.
 Virulence-Related Methods for Acidovorax citrulli 87

9. Pick 2–3 white colonies from the medium and transfer them to
liquid LB medium supplemented with 30 mg/L Km. Incubate
at 37 °C with continuous shaking overnight.
10. Extract plasmid using a plasmid mini-prep kit and confirm the
insert presence by restriction profiling and sequencing using
appropriate primers (see Note 2).
11. Use the purified plasmid to transform E. coliS17-λ pir cells
following an appropriate protocol. Plate transformation on
LB agar supplemented with 30 mg/L Km and incubate over-
night at 37 °C (see Note 6).
12. Inoculate E. coli S17-λ pir harboring the plasmid (donor) and
Acidovorax citrulli (recipient) separately, in 5 mL LB broth
with the appropriate antibiotics, and incubate them for 24 h at
37 °C and 30 °C, respectively, with continuous shaking.
13. Dilute overnight cultures with fresh medium in a 1:10 ratio,
and allow it to reach the exponential growth phase [optical
density at 600 nm (OD600) of 0.3 to 0.6]. Then wash 1 mL of
each culture twice with sterile ultrafiltered water to eliminate
any antibiotic residues.
14. Mix samples of the two cultures in a 4:1 recipient/donor
proportion (e.g., 100 μL of A. citrulli and 25 μL of E. coli).
Place them as one large spot on a nonselective NA plate, let it
dry, and incubate at 30 °C for 48 h. Alternatively, dip a Q-tip in
one of the cultures and streak a line across a nonselective NA
plate, and repeat with the second culture, streaking a perpen-
dicular line on the same plate, and incubate at 30 °C for 48 h.
15. Transfer biomass from the NA plate to 1 mL NB medium,
dilute the cell suspension, and spread on NA selective plates
with 40 mg/L X-gal, 50 mg/L Cb, and 50 mg/L Km. Incu-
bate for 48–72 h at 30 °C. Plate negative controls on selective
plates containing only the recipient strain and only the donor
strain (see Note 6).
16. Pick single colonies on fresh selective NA plates and incubate
for 48 h at 30 °C.
17. Transfer single colonies from the selective NA plates to LBS
without NaCl plates to verify that they are unable to grow in
the presence of sucrose.
18. Prepare colony lysates of candidate clones to test plasmid inte-
gration. For that, take a single colony from the selective plate,
suspend in 50 μL sterile water, and boil for 5 min. Use this
lysate as DNA template for PCR reactions using appropriate
primers and following instructions of Taq DNA polymerase kit
(see Notes 2 and 6).
19. Pick single recombinant clones on fresh LBS without NaCl and
incubate for 72 h at 30 °C with continuous shaking.
88 Francisco Pérez-Montaño et al.

20. A second reciprocal recombination event is selected on LBS

without NaCl (see Note 7). Dilute the cell culture and spread
on LBS without NaCl-selective plates with 100 mg/L Amp.
Incubate for 48–72 h at 30 °C. Plate a negative control on a
selective plate containing only the single recombinant strain.
21. Pick single colonies on both selective LBS without NaCl and
NA with 50 mg/L Km plates, and incubate for 48 h at 30 °C.
22. For verification of gene deletion by double recombination,
prepare colony lysates by taking a single colony from the NSA
selective plate. Suspend it in 50 μL sterile water and boil for
5 min. Use this lysate as DNA template for PCR reactions
using appropriate primers and following instructions of Taq
DNA polymerase kit (see Notes 2 and 7).
23. Streak out the mutant strain with the in-frame deletion on an
NA agar plate with100 mg/L Amp, and incubate for 48 h at
30 °C.
24. Collect bacterial cells from the NA plates into 50% glycerol and
store at -80 °C until use.

3.2 Plant Inoculation 1. Take a frozen aliquot of A. citrulli and plate into NA plate with
Assays corresponding antibiotics. Incubate the plate for 48 h at 30 °C.
3.2.1 Preparation of 2. Collect isolated colonies and transfer them to new NA plates by
Bacterial Inoculum spreading the cells thorough the medium. Incubate the plate
for 24 h at 30 °C.
3. Collect the bacteria from the plates with 10 mM MgCl2, and
adjust OD600 to 0.2, which corresponds to approximately 108
colony forming units (CFU)/mL (see Note 8). If lower con-
centrations are needed, dilute the above suspension as needed
using 10 mM MgCl2.

3.2.2 Seed-to-Seedling 1. Plate fresh A. citrulli cells into NA medium with

Transmission Assay corresponding antibiotics. Incubate A. citrulli in NA for 24 h
at 30 °C.
2. Adjust the bacterial concentration to about 107 CFU/mL (see
Note 8).
3. Place 25 melon or watermelon seeds inside 50 mL conical
tubes containing 10 mL of the bacterial suspension. Incubate
them at room temperature for 2 h with gentle agitation.
4. Pass seeds through a strainer, wash briefly with sterile distilled
water, and dry under a laminar flow hood.
5. Sow inoculated seeds in 600 mL pots containing sand (4 or
5 seeds per pot and at least four pots per treatment). Place pots
in a greenhouse or in a growth chamber at 27–28 °C for
10–12 days. Peat-based commercial soil can be used instead
of sand, but a higher bacterial concentration (~108 CFU/mL)
is recommended (see Note 9).
 Virulence-Related Methods for Acidovorax citrulli 89

Fig. 3 Plant inoculation assays. (a) Seed transmission assays. Seeds are suspended in 107-CFU/mL bacterial
suspensions. Disease severity is quantified 10 to 12 days after inoculation (d.a.i.) using a 0 to 7 scale based on
shoot weight values of inoculated plants relative to the average shoot weight of non-inoculated controls. (b)
Stem Inoculation Assay. Six/seven-day-old seedlings are inoculated using fresh A. citrulli suspensions at
108 CFU/mL. (c) Foliage inoculation assays. Three-week-old plants are vacuum infiltrated with 102-CFU/mL
bacterial suspensions. For foliage inoculation without (W/O) vacuum, plants are immersed inside a 106 CFU/
mL bacterial. The bacterial concentration of the inoculum for leaf inoculation by spraying may change
according to the objective of the experiment

6. Disease severity of emerging seedlings is quantitatively

measured using a 0 to 7 scale based on shoot-weight values of
inoculated plants relative to the average shoot weight of
non-inoculated controls: 0, weight higher than 90% of average
control weight; 1 to 5, weight equal to 76–90%, 61–75%,
46–60%, 31–45%, and 16–30% of average control weight,
respectively; 6, weight equal to or lower than 15% of average
control weight; and 7, dead seedling (Fig. 3a).

3.2.3 Stem 1. Sow melon or watermelon seeds in small 150 mL pots contain-
Inoculation Assay ing pea-based commercial soil mixture (1 seed per pot, at least
10 seeds per treatment). Place pots in a greenhouse or a growth
chamber at 27 to 28 °C.
2. At 6–7 days after sowing, inoculate the plants using fresh A.
citrulli suspensions at 108 CFU/mL, prepared as described in
Subheading 3.2.1. Place a 5 μL droplet of the bacterial suspen-
sion at the base of the stem (~1 cm above the soil).
90 Francisco Pérez-Montaño et al.

3. Pass a 25-gauge needle through the droplet and the stem.

4. Remove the rest of the inoculum droplet immediately after
needle injection with a paper towel.
5. Keep the pots in the greenhouse or in the growth chamber for
additional 12–14 days, and evaluate every day the number of
symptomatic and dead seedlings.
6. To assess bacterial concentrations in stem tissue at different
time points, collect the seedlings, take 1 cm stem pieces around
the inoculation site, and homogenize them in 10 mM MgCl2
suspensions (see Note 10).
7. Serially dilute the suspension and plate on NA plates with
100 mg/L Amp and additional antibiotics depending on the
strain. Incubate for 48–72 h at 30 °C and determine CFU/cm
stem (Fig. 3b).

3.2.4 Foliage 1. Sow melon or watermelon seeds in 600 mL pots containing a

Inoculation Assay peat-based commercial soil mixture (one seed per pot). Place
the pots in a greenhouse or in a growth chamber at 27 to 28 °C
until full development of three true leaves (about 3 weeks after
sowing).
2. For vacuum infiltration, immerse the plants inside a 102 CFU/
mL bacterial suspension, placed over a plastic container inside a
vacuum chamber (see Note 8). Apply pressure at 600 mbar for
50 s. For foliage inoculation without vacuum, immerse the
plants inside a 106CFU/mL bacterial suspension for 3 min
(see Note 8). Alternatively, inoculate the plant leaves with the
bacterial suspension by spraying them until run-off. The bacte-
rial concentration of the inoculum may change according to
the objective of the experiment and the use of different combi-
nations of bacterial strains and plant varieties (Fig. 3c-left).
3. Place the plants in the greenhouse or in the growth chamber.
Take samples of 5 leaf discs (7 mm in diameter each) from the
two youngest fully developed leaves (see Note 10). These
samples are taken for assessment of bacterial concentration
inside the leaf tissue at time zero (see step 5 below).
4. If plants were inoculated without vacuum, cover the plants for
24 h with plastic bags for generation of high relative humidity
to promote infection.
5. To assess bacterial concentrations in leaves at different time
points, collect 5 leaf discs (7 mm in diameter each) from the
two youngest fully developed leaves at the inoculation time and
homogenize them in a 1.5 mL microcentrifuge tube contain-
ing 1 mL of 10 mM MgCl2 suspensions (see Note 10)
(Fig. 3c).
 Virulence-Related Methods for Acidovorax citrulli 91

6. Serially dilute the suspension and plate different dilutions on

NA selective plates with 100 mg/L Amp and other antibiotics
depending on the bacterial strain. Incubate for 48–72 h at
30 °C.
7. Determine CFU/leaf cm2.
8. Disease severity at different times after inoculation can be
quantitatively assessed by taking pictures of inoculated leaves
and assessing the percentage symptomatic area using ImageJ
(Fig. 3c).

3.3 Assessment of
Twitching Motility
1. Plate single, fresh colonies of A. citrulli into NA medium for
72 h at 30 °C.
2. Twitching motility is qualitatively assessed by the naked eye or
by light microscopy (Fig. 4a) and quantitatively by measuring
the length of the twitching haloes around the bacterial colonies
(see Note 11).

3.4 Biofilm 1. Incubate A. citrulli in M9 medium for 48 h at 30 °C with

Formation Assay continuous shaking.
2. Adjust the OD600 of the cultures to 0.2.

Fig. 4 Twitching and biofilm formation assays. (a) Strains are plated on nutrient agar plates and twitching
haloes were measured 72 h after plating. (b) Images of biofilm formed in polystyrene culture multi-well plates
characterized by stained crystal violet fringes around the well
92 Francisco Pérez-Montaño et al.

3. Add 200 μL of the cell suspension to a polystyrene 96-well

plate and incubate for 48 h without shaking (see Note 12).
4. Discard the growth medium from the multi-wells plate.
5. Wash the wells twice, each with 1 mL of water, and pipette out
slowly.
6. Air-dry for 30 min.
7. Fix biofilm by incubating the multi-wells plate at 80 °C for
20 min (see Note 13).
8. Add 1 mL of 0.1% (v/v) crystal violet solution to each well and
incubate for 30 min at room temperature.
9. Pour out the excess dye and wash three times with water and
tap the plate on paper towels to get all the water out.
10. Air-dry for 30 min.
11. Add 1 mL of 95% (v/v) ethanol to dissolve crystal violet and
incubate for 2 h at room temperature (Fig. 4b).
12. Measure OD590in a multi-plate reader or in a
spectrophotometer.

4 Notes

1. Antibiotics are added to the media when required at the fol-

lowing final concentrations: 50 mg/LCb, 100 mg/mL Amp,
10 mg/mL Nal, and 50 mg/mL Km.
2. The two sets of primers for amplification of upstream and
downstream regions of the target gene are designed to generate
DNA fragments having overlapping ends. These fragments are
combined in a subsequent “fusion” PCR reaction in which the
overlapping ends anneal, allowing the 3′ overlap of each strand
to serve as a primer for the 3′ extension of the complementary
strand. Thus, PCR results in a mutant (deletion) fusion ampli-
con. Primers hybridizing outside the cloned flanking sequences
are used to confirm the deletion event.
3. Deletion fragment is always 3× bp to ensure in-frame mutation.
Do not delete the Shine-Dalgarno sequence. Do not delete
start/stop codon of surrounding genes. Do not delete part of
another gene, when genes overlap in an operon.
4. Cloning vector needs to be purified by a gel extraction kit in
order to remove the uncut vector molecules.
5. DNA concentration is determined after the second DNA puri-
fication step using NanoDrop spectrophotometer or similar
apparatus.
 Virulence-Related Methods for Acidovorax citrulli 93

6. E. coli S17-λ pir colonies are per se blue in media supplemented

with X-gal. Vector pK18mobsacB is a mobilizable suicidal plas-
mid of several Gram-negative bacteria, including A. citrulli.
Km resistance acquisition of recipient strain is obtained
through integrating the whole plasmid via a single recombina-
tion event in one of the homologous 500 pb regions flanking
the target gene. Using external primers, the presence of two
amplicons (deleted and wild-type versions) is required for con-
firmation of plasmid integration.
7. Only colonies with a second reciprocal recombination event
grow on LBS without NaCl, since sacB expression is lethal to
A. citrulli in the presence of 15% sucrose. Kanamycin-sensible
but sucrose-resistant clones have withdrawn the plasmid in a
second recombination event. Only one version (deleted or
wild-type) of target region remains in the A. citrulli genome.
8. Fresh A. citrulli suspensions in 10 mM MgCl2 having an
OD600 of 0.2 contain approximately 108 CFU/mL.
9. Disease severity in seed-to-seedling transmission assays carried
out in peat-based commercial soil is substantially more moder-
ate than similar experiments carried out in sand. Therefore,
inocula with higher concentrations of bacteria are generally
used in these cases.
10. At each time, five or six replicates are collected from each
treatment.
11. Colonies exhibiting twitching motility are characterized by the
formation of a thin, light halo around the bulk colony.
12. To avoid culture evaporation, incubate the 96-well plate in a
wet chamber.
13. Biofilm fixation can also be achieved adding 1 mL of 100%
methanol per well for fixation and incubate at 37 °C for
15 min.

Acknowledgments

This work was supported by research grants IS-5023-17C from the

United States-Israel Binational Agriculture Research and Develop-
ment (BARD) Fund and PID2020-118279RA-I00from the Span-
ish Ministry of Science and Innovation.

References
1. Burdman S, Walcott R (2012) Acidovorax
citrulli: generating basic and applied knowl-
edge to tackle a global threat to the cucurbit
industry. Mol Plant Pathol 13:805–815
2. Zhao M, Walcott R (2018) Acidovorax citrulli:
history, epidemiology, and management of
bacterial fruit blotch of cucurbits. In:
Burdman S, Walcott R (eds) Plant-pathogenic
94 Francisco Pérez-Montaño et al.
Acidovorax species. American Phytopathologi-
cal Society, Saint Paul, pp 39–57
3. Burdman S, Kots N, Kritzman G et al (2005)
Molecular, physiological, and host-range char-
acterization of Acidovorax avenae subsp.
citrulli isolates from watermelon and melon
in Israel. Plant Dis 89:1339–1347
4. Walcott RR, Fessehaie A, Castro AC (2004)
Differences in pathogenicity between two
genetically distinct groups of Acidovorax ave-
nae subsp. citrulli on cucurbit hosts. J Phyto-
pathol 152:277–285
5. Bahar O, Goffer T, Burdman S (2009) Type IV
pili are required for virulence, twitching motil-
ity, and biofilm formation of Acidovorax avenae
subsp. citrulli. Mol Plant Microbe Interact 22:
909–920
6. Bahar O, Levi N, Burdman S (2011) The
cucurbit pathogenic bacterium Acidovorax
citrulli requires a polar flagellum for full viru-
lence before and after host-tissue penetration.
Mol Plant Microbe Interact 24:1040–1050
7. Rosenberg T, Jiménez-Guerrero I, Tamir-Ariel
D et al (2022) The GDSL-lipolytic enzyme
Lip1 is required for full virulence of the cucur-
bit pathogenic bacterium Acidovorax citrulli.
Microorganisms 10:1016
8. Bahar O, Burdman S (2010) Bacterial fruit
blotch: a threat to the cucurbit industry. Isr J
Plant Sci 58:19–31
9. Feng F, Zhou JM (2012) Plant-bacterial path-
ogen interactions mediated by type III effec-
tors. Curr Opin Plant Biol 15:469–476
10. Macho AP, Zipfel C (2015) Targeting of plant
pattern recognition receptor triggered immu-
nity by bacterial type-III secretion system effec-
tors. Curr Opin Microbiol 23:14–22
11. Eckshtain-Levi N, Munitz T, Zivanovic M et al
(2014) Comparative analysis of type III
secreted effector genes reflects divergence of
Acidovorax citrulli strains into three distinct
lineages. Phytopathology 104:1152–1162
12. Jiménez-Guerrero I, Pérez-Montaño F, Da
Silva GM et al (2020) Show me your secret
(ed) weapons: a multifaceted approach reveals
a wide arsenal of type III-secreted effectors in
the cucurbit pathogenic bacterium Acidovorax
citrulli and novel effectors in the Acidovorax
genus. Mol Plant Pathol 21:17–37
13. Traore SM, Eckshtain-Levi N, Miao J et al
(2019) Nicotiana species as surrogate host for
studying the pathogenicity of Acidovorax
citrulli, the causal agent of bacterial fruit
blotch of cucurbits. Mol Plant Pathol 20:800–
814
14. Jiménez-Guerrero I, Sonawane M, Eckshtain-
Levi N et al (2023) Natural variation in a short
region of the Acidovorax citrulli type III-
secreted effector AopW1 is associated with dif-
ferences in cytotoxicity and host adaptation.
Plant J https://doi.org/10.1111/tpj.16507
15. Zhang X, Yang Y, Zhao M et al (2020) Acid-
ovorax citrulli type III effector AopP sup-
presses plant immunity by targeting the
watermelon transcription factor WRKY6.
Front Plant Sci 11:1723
16. Zhang X, Zhao M, Jiang J et al (2020) Identi-
fication and functional analysis of AopN, an
Acidovorax citrulli effector that induces pro-
grammed cell death in plants. Int J Mol Sci 21:
6050
17. Fujiwara S, Toshio M, Nakayama E et al (2022)
Host specific activation of a pathogen effector
Aave_4606 from Acidovorax citrulli, the causal
agent for bacterial fruit blotch. Biochem Bio-
phys Res Commun 616:41–48
18. Simon R, Priefer U, Puhler A (1983) A broad
host range mobilization system for in vivo
genetic engineering: transposon mutagenesis
in gram negative bacteria. Biotechnology 1:
784–791
19. Sch€afer A, Tauch A, J€ager W et al (1994) Small
mobilizable multi-purpose cloning vectors
derived from the Escherichia coli plasmids
pK18 and pK19: selection of defined deletions
in the chromosome of Corynebacterium gluta-
micum. Gene 145:69–73
20. Ho SN, Hunt HD, Horton RM et al (1989)
Site-directed mutagenesis by overlap extension
using the polymerase chain reaction. Gene 77:
51–59
21. Sambrook J, Fritsch EF, Maniatis T (1989)
Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor
 Chapter 7

Dual-Fluorescence Chromosome-Located Labeling System

for Accurate In Vivo Single-Cell Gene Expression Analysis
in Pseudomonas syringae
Nieves López-Pagán, José S. Rufián, Javier Ruiz-Albert,
and Carmen R. Beuzón

Abstract
Epigenetic regulation as a means for bacterial adaptation is receiving increasing interest in the last decade.
Significant efforts have been directed towards understanding the mechanisms giving raise to phenotypic
heterogeneity within bacterial populations and its adaptive relevance. Phenotypic heterogeneity mostly
refers to phenotypic variation not linked to genetic differences nor to environmental stimuli. Recent
findings on the relevance of phenotypic heterogeneity on some bacterial complex traits are causing a shift
from traditional assays where bacterial phenotypes are defined by averaging population-level data, to single-
cell analysis that focus on bacterial individual behavior within the population. Fluorescent labeling is a key
asset for single-cell gene expression analysis using flow cytometry, fluorescence microscopy, and/or
microfluidics.
We previously described the generation of chromosome-located transcriptional gene fusions to fluores-
cent reporter genes using the model bacterial plant pathogen Pseudomonas syringae. These fusions allow
researchers to follow variation in expression of the gene(s) of interest, without affecting gene function. In
this report, we improve the analytic power of the method by combining such transcriptional fusions with
constitutively expressed compatible fluorescent reporter genes integrated in a second, neutral locus of the
bacterial chromosome. Constitutively expressed fluorescent reporters allow for the detection of all bacteria
comprising a heterogeneous population, regardless of the level of expression of the concurrently monitored
gene of interest, thus avoiding the traditional use of stains often incompatible with samples from complex
contexts such as the leaf.

Key words Phenotypic heterogeneity, Gene expression, Fluorescent reporter genes, Single-cell meth-
ods, Fluorescence microscopy, Non-genetic variation, Flow cytometry

1 Introduction

Multiple virulence factors are needed to suppress host defenses and

to allow bacterial pathogens to multiply and cause disease. Type III
secretion systems (T3SS) are key to bacterial establishment within
the host and for disease development. T3SS enable bacteria to

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_7,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

95
96 Nieves López-Pagán et al.

deliver effector proteins inside the host cell, where they can inter-
fere with cellular processes in order to promote bacterial survival,
multiplication, and spread [1]. Pseudomonas syringae is a model
plant pathogen of academic relevance [2] and an increasing eco-
nomic impact in agriculture, with emerging new diseases and
re-emerging old ones [3, 4]. P. syringae is a foliar pathogen strongly
linked to the water cycle, which typically reach the leaf surface
through rainfall [5]. Once on the leaf surface, it uses natural open-
ings or wounds [6] to reach the intercellular space of the leaf
parenchyma, the apoplast, where it engages in molecular interac-
tion with the plant. If the outcome of this interaction is defense
suppression, the pathogen then replicates reaching high population
levels. Pathogen success during the interaction depends heavily on
the ability of its T3SS effectors to suppress plant immunity, without
eliciting resistance [7–9]. Therefore, the ability to monitor when
and where bacterial effectors are being expressed during the inter-
action is key to understand the dynamics of the host-pathogen
interaction. Moreover, P. syringae T3SS genes display phenotypic
heterogeneity in their expression, differentiating into T3SSON and
T3SSOFF bacteria during plant colonization [10]. Such phenomena
has been proposed to allow for complex multicellular-like bacterial
behaviors [11], relevant for the ability to cause disease of several
animal pathogens (e.g., Salmonella enterica [12–15], Vibrio cho-
lerae [16], or Yersinia pseudotuberculosis [17]). Populations of
P. syringae pv. phaseolicola display heterogeneous expression of
T3SS genes within the homogeneous environment of nutrient-
limited culture medium, as well as in the plant apoplast [10]. In
summary, these studies have raised the interest in using single-cell
analytic methods to understand bacterial behavior. Fluorescence
reporters are very useful for single-cell gene expression analysis, as
it can be easily combined with techniques such as flow cytometry,
fluorescence microscopy, and/or microfluidics.
In this chapter, we describe the use of constitutively expressed
chromosome-located fluorescent reporter genes in combination
with chromosomal transcriptional gene fusions to compatible fluo-
rescent reporters, designed to follow variation in expression of the
gene(s) of interest. The design of the transcriptional gene fusions
and the validation of their use for following gene expression at the
single-cell level have been previously reported [10, 18]. The addi-
tional development described here represents an improvement in
the analytic power of the method by allowing detection of an entire
bacterial population displaying heterogeneous expression of the
gene of interest, regardless of the level of expression of the gene
of interest, easily allowing detection of OFF bacteria even within
complex contexts such as the interior of the leaf apoplast, where the
use of light microscopy or cellular staining can be limited. Hereby,
we detail the steps involved in applying this approach to the model
bacterial plant pathogen P. syringae, with particular focus in the
 Dual Fluorescence Labelling in Pseudomonas Syringae 97

generation of strains simultaneously carrying (i) a chromosome-

located cassette for constitutive expression of a given fluorophore
(i.e., the enhanced cyan eCFP or Discosoma sp. red dsRED fluor-
ophores) and (ii) a transcriptional fusion of a GFP to a gene of
interest (i.e., hrpL, the gene encoding the transcriptional activator
of the T3SS genes in P. syringae). The cassettes for constitutive
fluorophore expression are inserted into a neutral locus within the
bacterial chromosome, minimizing their potential impacts on bac-
terial fitness. In addition, transcriptional fusions of fluorescent
reporter genes to each gene of interest allow for the transcription
of both reporter and target genes from the native promoter of the
target, as a single bicistronic operon with two independently trans-
lated ORFs, thus preserving the integrity and functionality of the
target gene, as previously reported [10, 18]. The resulting strains,
combining compatible fluorophores, enable the tracking of
P. syringae individual bacteria during colonization of the plant,
while simultaneously monitoring the expression levels of the gene
of interest, either by microscopy or flow cytometry.

2 Materials

2.1 Bacterial Growth 1. Bacterial strains (Table 1).

2. Lennox Broth (LB) [19]: Weigh 10 g of Tryptone, 5 g of Yeast
Extract, and 5 g of NaCl and add to 800 mL of dH2O. Using a
measuring cylinder, fill up to 1 L with dH2O. Add 10 g of
bacteriological agar and autoclave at 121 °C for 20 min. Once

Table 1
Strains

Strain Relevant features Reference

1448A Pseudomonas syringae pv. phaseolicola wild-type strain [25]
DH5α Escherichia coli F-endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 ΔlacU189 f80 [26]
Δ-lacZDM15
SM10λpir Escherichia coli thi thr leu tonA lacy supE recA::RP4–2-Tc::Mu KmR λpir [27]
R - +
HB101 Escherichia coli K-12/B. hybrid; Sm recA thi pro leu hsdR M [28]
R
JRP10 Pseudomonas syringae pv. phaseolicola 1448A derivative Tn7-dsRED, Gm [6]
JRP11 Pseudomonas syringae pv. phaseolicola 1448A derivative Tn7-eCFP, GmR [6]
DCN01 Pseudomonas syringae pv. phaseolicola 1448A derivative Tn7-dsRED and hrpL:: This work
GFP3. GmR, KmR
DCN02 Pseudomonas syringae pv. phaseolicola 1448A derivative Tn7-eCFP and hrpL:: This work
GFP3. GmR, KmR
98 Nieves López-Pagán et al.

the temperature has got down to about 50 °C, add the appro-
priate antibiotic, and pour about 20 mL per 10 cm Petri dish.
This is a modified version of lysogeny broth [20] with NaCl
concentration halved.
3. Antibiotic stock solutions: 100 mg/mL ampicillin (Amp),
50 mg/mL kanamycin (Km), 50 mg/mL gentamicin (Gm),
and 40 mg/mL nitrofurantoin (Nf). LB was supplemented
with either Amp (100 μg/mL for E. coli, 500 μg/mL for
P. syringae strains), Km (50 μg/mL for E. coli, 15 μg/mL for
P. syringae strains), Gm (50 μg/mL for E. coli, 10 μg/mL for
P. syringae strains), or Nf (40 μg/mL).
4. Hrp-inducing medium (HIM): A phosphate buffer 1X must be
previously prepared using 8.5 mMK2HPO4 and 91.6 mM
KH2PO4. Add the following reagents to the phosphate buffer
at the indicated concentrations: 7.6 mM (NH4)2SO4, 1.7 mM
NaCl, 1.7 mM MgCl2, and 10 mM fructose. Adjust the pH to
7 with NaOH. Filter-sterilize using 0.22 μm filters.

2.2 Tetraparental 1. Plasmids (Table 2).

Mating 2. Centrifuge.
3. 1.5 mL microcentrifuge tubes.
4. 15 mL conical tubes.
5. 0.9% NaCl: dissolve0.9 g NaCl in 100 mL of double-distilled
water. Sterilize by autoclaving.
6. 0.22 μm Durapore membrane filters.
7. Tweezers.

Table 2
Plasmids

Plasmid Description Reference

pUXBF13 Helper expressing Tn7 transposase, AmpR [29]
R
RK600 Conjugation helper, Cm ColE1 oriV RP4 oriT [30]
R R
pBK-miniTn7(Gm)PA1/ dsRED, Amp , Gm [22]
04/03-DsRed-express-a

pBK-miniTn7(Gm)PA1/ eCFP, AmpR, GmR [22]

04/03-ecfp-a

pDLM8 pGemT (AmpR) containing the A + B fragment of hrpL [10]

truncated by the promoterless ORF of GFP3 and the
FRT-nptII-FRT cassette flanked by EcoRI sites (KmR)
pFLP2 Contains a flipase gene [31]
pKD4 pANTS derivative containing an FRT-flanked kanamycin [32]
resistance gene
 Dual Fluorescence Labelling in Pseudomonas Syringae 99

2.3 P. syringae 1. 300 mM sucrose stock solution.

Transformation 2. Refrigerated microcentrifuge.
3. Electroporation cuvettes (2 mm).
4. Electroporator.
5. A suicide plasmid containing a module including the promo-
terless GFP3 open reading frame (ORF) with its own
ribosomal-binding site (RBS) and followed by a nptII-expres-
sing cassette constitutively conferring kanamycin resistance,
flanked by the last 500 bps of the ORF of the gene of interest
(in this case hrpL) including the STOP codon and the 500 bps
immediately downstream the STOP codon, in our example
plasmid pDLM8 (Table 2).

2.4 Southern Blot 1. One Kb Plus ladder.

Analysis 2. 0.25 N HCl.
3. Denaturing solution: 1.5 M NaCl, 0.5 M NaOH.
4. Neutralizing solution:3 M NaCl, 0.5 M Tris-HCl pH 7.
5. 20× SSC: 3 M NaCl, 300 mMNa-citrate.
6. Nylon membrane.
7. Blocking reagent.
8. DIG Labeling Mix.
9. Anti-digoxigenin antibody.
10. CSPD ready to use (disodium 3-(4-methoxyspiro {1,2-dioxe-
tane-3,2′-(5′-chloro)tricyclo [3.3.1.1]decan}-4-yl)phenyl
phosphate.

2.5 Single-Cell 1. Flow cytometer.

Analysis 2. Kaluza software (Beckman Coulter, Life Sciences).
3. Confocal microscope.

3 Methods

To illustrate the method, we show the construction of P. syringae

strains constitutively expressing either the enhanced cyan (eCFP)
or Discosoma sp. red (dsRED) fluorescent proteins, in combination
with a transcriptional fusion of the enhanced green (GFP3, also
known as eGFP) fluorescent protein to hrpL, encoding the main
regulator of the T3SS system. We combine methods previously
applied by our laboratory to generate fluorescently labeled
P. syringae strains constitutively expressing fluorophores [21] and
to generate transcriptional fusions to monitor specific gene expres-
sion by fluorescence [18]. Although here we generate reporter
100 Nieves López-Pagán et al.

strains of the model strain Pseudomonas syringae pv. phaseolicola

1448A as an example, the method can be easily applied to strains
from other pathovars (we have successfully tested Pseudomonas
syringae pv. tomato DC3000) or adapted to other pseudomonads.
We begin the procedure by generating the strains constitutively
expressing either eCFP or dsRED strain (see Subheading 3.1) and
then proceed to introduce the transcriptional fusion of the gene of
interest to GFP3 (see Subheading 3.2) and to confirm chromosomal
integrations in the reporter strains by Southern blot (see Subhead-
ing 3.3). While we use as reporters the three abovementioned
fluorophores, we have constructs available to customize the plas-
mids to the use of several other fluorophore-expressing genes
[18, 21].
The first step of the procedure (see Subheading 3.1) relies on
the use of tetraparental mating to simultaneously deliver two sui-
cide plasmids into P. syringae: (i) one carrying a defective Tn7
transposon with a fluorophore-expressing cassette (either eCFP or
dsRED) and (ii) a second expressing the Tn7 transposase-encoding
gene (Fig. 1) [22], while a third plasmid carrying the tra region
from the F plasmid provides conjugative functions to the other two
plasmids which carry mob sequences. Once the first two plasmids
are delivered into the recipient strain, complementation in trans of

Fig. 1 Schematic representation of the tetraparental mating used in the method. Auxiliary 2 bacteria, carrying
plasmid pRK600 containing the tra genes, transfers pRK600 to Auxiliary 1 and to Donor bacteria. Conjugative
functions encoded by the tra genes allow conjugative transfer of plasmids carrying a mob site: plasmid
pUX-BF13 containing the transposase gene and plasmid pBK-miniTn7-FP carrying the miniTn7 transposon.
When recipient bacteria receive both plasmids through conjugation, the transposon can be integrated into the
genome. Both pBK-miniTn7-FP and pUX-BF13 plasmids are lost upon bacterial replication since they cannot
replicate in our recipient strain
 Dual Fluorescence Labelling in Pseudomonas Syringae 101

Tn7 transposition taking place before plasmid loss results in the

stable integration of a single copy of theTn7-bound fluorophore-
expressing cassette in an intergenic region downstream the GlmS-
encoding gene [22]. The chromosome-located cassette expresses
the fluorophore under the transcriptional control of the constitu-
tive E. coli lac-promoter derivative PA1/04/03 [21].
The second step (see Subheading 3.2) relies on the use of
transformation to deliver, into the fluorescently labeled P. syringae
strains obtained, a suicide plasmid designed for allelic exchange and
carrying a fluorescent reporter module that will be integrated into
the desired chromosome allocation by bacterial-dependent homol-
ogous recombination, as previously described in detail [18]. This
module includes the promoterless GFP3 open reading frame (ORF)
preceded by its own ribosomal-binding site (RBS) and followed by
a nptII-expressing cassette constitutively conferring kanamycin
resistance, the latter flanked by FRT sequences. All these features
can be precisely integrated into the 3′-UTR region of the selected
gene (hrpL in our example) by means of homologous recombina-
tion, since they are flanked upstream by the last 500 bps of the hrpL
coding sequence including the STOP codon and downstream by
the 500 bps immediately downstream the hrpL ORF STOP codon.
Here, we will not detail the construction of the allelic exchange
plasmid, which has already been described previously [18].

3.1 Generating a 1. Prepare overnight cultures of the recipient (R) P. syringae strain
Labeled Strain (1448A) by inoculating biomass grown on LB plates into a
Constitutively 500 mL flask containing 100 mL of liquid LB medium. Incu-
Expressing bate overnight with aeration at 28 °C.
Fluorescent Proteins 2. Prepare overnight cultures of E. coli strains acting as donor (D,
by Tetraparental DH5α carrying pBK-mini-Tn7(Gm)PA1/04/03-ecfp/dsRed),
Mating auxiliary 1 (A1, SM10λpir carrying pUX-BF13, which includes
the Tn7 transposase gene), and auxiliary 2 (A2, HB101 carry-
3.1.1 Bacterial Cultures
ing pRK600 which contains the tra region), by inoculating
biomass grown on LB plates into three independent 100 mL
flasks each containing 25 mL of liquid LB medium supplemen-
ted with either 50 μg/mL Gm (D), 100 μg/mL Amp (A1), or
6 μg/mL Cm (A2), and incubate overnight with aeration at
37 °C.

3.1.2 Tetraparental The mixture for tetraparental mating should be prepared using the
Mating Preparation previously grown strain cultures, strictly keeping the proportion
3 (R): 1 (D): 1 (A1): 1 (A2). In parallel, two separate negative
controls must be prepared using the same overnight cultures,
keeping the volumes and relative ratios used for the
tetraparental mix: the first negative control using only the Pseudo-
monas recipient (R) strain and the second using a mix of all E. coli
strains with a 1 (D): 1 (A1): 1 (A2) ratio.
102 Nieves López-Pagán et al.

1. Measure the OD600 of each overnight culture and adjust to a

final OD600 of 4 (see Note 1). From these OD-adjusted cul-
tures, we will use an 8 mL sample of the recipient strain (4 mL
for the tetraparental mixture and 4 mL for the first negative
control) and 2 mL samples of each of the three E. coli strains
(1 mL for the tetraparental mixture and 1 mL for the second
negative control).
2. Centrifuge the abovementioned samples at 4500 ×g for 5 min,
discard the supernatants, and resuspend each bacterial pellet
within 1 mL of 0.9% NaCl by gentle vortexing. This washing
step should be repeated 3 consecutive times (see Note 2).
3. To concentrate the bacterial samples before the preparation of
the tetraparental and control mixes, a key step for the success of
the procedure, the bacterial pellets resulting from the last
washing step should be resuspended by gentle pipetting into
40 μL of 0.9% NaCl for the Pseudomonas culture (R) and 20 μL
of 0.9% NaCl for the E. coli cultures (D, A1, A2).
4. Once thus concentrated, the samples are ready to use in the
tetraparental and control mixes. The tetraparental mix, with a
final volume of 100 μL, is prepared by mixing in a single
microcentrifuge tube 40 μL (D) + 20 μL (D) + 20 μL
(A1) + 20 μL (A2) of the concentrated samples. The negative
control mixture with only the E. coli strains, and a final volume
of 60 μL, is prepared by mixing in a single microcentrifuge tube
20 μL (D) + 20 μL (A1) + 20 μL (A2) of the concentrated
E. coli samples. The receptor negative control will consist in the
remaining 40 μL (R) of the recipient strain.
5. The tetraparental mix (Fig. 2) and the two controls should be
each placed separately onto a 0.22 μm filter sitting on a well-
dried LB plate without antibiotics (see Note 3).
6. Keep the plates horizontal to prevent bacterial samples from
spilling out of the filters, and incubate the plates at 28 °C
overnight.

3.1.3 Recovering and 1. Each of the filters, carrying either the tetraparental mix or each
Selection of Strains of the two controls, should be collected from the plate surface
using sterile tweezers and each placed into a separate 15 mL
sterile tube containing 1 mL of 0.9% NaCl. Then bacterial
biomass should be removed from the filters and resuspended
into the NaCl solution by vortexing.
2. Resulting samples must be concentrated prior to plating. To do
so, transfer each cell suspension to a 1.5 mL microcentrifuge
tube and centrifuge at 10,000 ×g for 2 min, and discard the
supernatants. Resuspend the pellet obtained from the tetrapar-
ental mix into 1 mL of 0.9% NaCl and each of the pellets
corresponding to the control samples into 100 μL of the
same solution.
 Dual Fluorescence Labelling in Pseudomonas Syringae 103

Fig. 2 Schematic representation of the preparation of a tetraparental mix. Tubes

containing the desired volume of each strain are centrifuged and the resulting
pellets washed and resuspended in 0.9% NaCl. The tetraparental mix is
prepared by mixing 40 μL of the Donor strain with 20 μL of each of the other
strains (A1, A2, R). The mix is placed on top of a 0.22 μm filter sitting on an LB
plate without antibiotics and incubated (lid side up) overnight at 28 °C

3. Plate samples onto selective media, i.e., LB supplemented with

40 μg/mL Nf (for direct selection of Pseudomonas recipient
bacteria and against E. coli strains) plus 10 μg/mL Gm (see
Note 4). Plate two plates using the sample corresponding to
the tetraparental mix: one with 100 μL and the second with the
rest of the sample (after an additional centrifugation step and
the subsequent removal of all but 100 μL of the supernatant,
where the pellet must be resuspended prior to plating), to allow
for differences in mating efficiency. Each control sample should
be plated onto a single selective media plate.
4. Incubate at 28 °C for 2–3 days.
5. Colonies grown from the tetraparental mix on the plates con-
taining Nf and Gm should correspond to P. syringae carrying
the fluorophore-carrying mini-Tn7 integrated into the chro-
mosome and must therefore be fluorescently labeled (Fig. 3).
6. To confirm the expected loss of the suicide delivery plasmids,
replicas of these colonies should be assayed in LB plates sup-
plemented with either 500 μg/mL Amp (marking the
unwanted presence of pBK-miniTn7 or pUXBF13) or 6 μg/
mL Cm (marking the unwanted presence of RK600). Replicas
104 Nieves López-Pagán et al.

Fig. 3 P. syringae colonies constitutively expressing either eCFP or dsRED.

Strains were grown on LB plates supplemented with 10 μg/mL gentamicin.
Images were taken with a Leica MZ FL III Fluorescence Stereomicroscope

should not grow on these selective media. Further confirma-

tion of the genomic integration can be done by PCR (see Note
5).

3.2 Generating P. syringae competent cells should be prepared immediately before

Transcriptional transformation since storage at -80 °C drastically reduces transfor-
Fusions to Target mation efficiency.
Genes by Introducing a 1. Refresh the selected P. syringae recipient strain from the -80 °
Promoterless C stock by plating onto LB without antibiotics, and incubate
Fluorescent Reporter for 2 days at 28 °C.
Gene into Selected
2. Recover biomass from the freshly grown LB plate (see Note 6),
Sites of the
and resuspend it by gentle vortexing in 1 mL of chilled
Chromosome by Allelic
300 mM sucrose. Do not use bacterial biomass from plates
Exchange
stored at 4 °C since that will reduce transformation efficiency.
3.2.1 P. syringae From here onwards, bacterial samples must be kept on ice (see
Electrocompetent Cell Note 7).
Preparation 3. Perform three consecutive washing steps, each time centrifu-
ging the sample for 2 min at 12,500 ×g at 4 °C, discarding the
supernatant and resuspending the pellet into 1 mL of chilled
300 mM sucrose.
4. To concentrate bacteria, after the third washing step resuspend
the bacterial pellet into 100 μL of chilled 300 mM sucrose.
Bacteria are now ready for electroporation.

3.2.2 P. syringae 1. Add up to 2 μL (50–100 ng) of high-purity allelic exchange

Transformation by plasmid DNA for the selected target gene (hrpL in this exam-
Electroporation ple) to 100 μL of electrocompetent cells, and mix by gentle
pipetting.
2. Pipette the mix into the chamber of a 2 mm electroporation
cuvette kept on ice, avoiding the formation of bubbles.
 Dual Fluorescence Labelling in Pseudomonas Syringae 105

3. Apply a pulse of 25 kV/cm in the electroporator, return the

cuvette to the ice bucket, and immediately resuspend the mix
with 1 mL of LB without antibiotics by gentle pipetting.
4. Transfer the sample to a 1.5 mL microcentrifuge tube and
incubate for 1 h at 28 °C to allow for bacterial cell recovery.
5. Centrifuge the sample for 2 min at 12,500 ×g, resuspend the
pellet into 100 μL of LB, and plate onto selective LB medium
supplemented with the corresponding antibiotics (15 μg/mL
Km, be mindful of the different concentration used for Pseudo-
monas versus E. coli). Incubate at 28 °C for 48 h.

3.2.3 Selection of Clones Kanamycin resistance of clones selected in Subheading 3.2.2 could
Carrying Transcriptional have been obtained by allelic exchange, via two independent
Fusions Without recombination events between the chromosome and each of the
Chromosomal Plasmid homologous 500 bp regions (A and B) flanking the Km resistance
Integration cassette, thus generating bacterial clones carrying the desired, sta-
ble chromosomal transcriptional fusions of the target gene (hrpL)
to GFP3 (Fig. 4). However, some Km resistant clones could have

Fig. 4 Schematic representation of the process used to introduce and select for the allelic exchange into the
chromosome of a transcriptional fusion of the gene hrpL to GFP3 (hrpL::GFP3). A plasmid containing the GFP3-
Km cassette flanked by two 500 nucleotide regions, respectively corresponding to the 500 bp upstream and
downstream the STOP codon of hrpL, was transformed into P. syringae. Selection of transformed clones is
carried out using Km, to select for the integration of the hrpL::GFP3 allele. Integration of the plasmid renders
bacteria Amp and Km resistant, whereas a double recombination event integrating the GFP3-Km cassette
downstream hrpL by allelic exchange, generating the transcriptional fusion hrpL::GFP3, would render
Km-resistant, Amp-sensitive bacteria. Thus, replica plating into LB + Km, LB + Amp, and LB allows
identification of double recombinants carrying the fusion, and to discard those carrying the full plasmid
integration
106 Nieves López-Pagán et al.

been obtained via a single recombination event in either one of the

homologous 500 bp regions flanking the cassette (A or B), thus
generating unwanted bacterial clones carrying the whole plasmid
unstably integrated into the chromosome (merodiploids). Only the
latter clones, with the whole plasmid integrated would be resistant
to ampicillin, while the desired clones would be sensitive to the
antibiotic.
The procedure to select the appropriate clones is as follows:
1. Replicas of at least 50 Km resistant colonies should be assayed
in independent LB plates supplemented with either 15 μg/mL
Km (marking all integration events, including the desired inte-
gration of the nptII cassette by allelic exchange) or 500 μg/
mL Amp (marking the unwanted integration of the entire
allelic exchange plasmid), plus a control plate without antibio-
tics (see Note 8). Incubate overnight at 28 °C. The desired
clones are those growing on LB supplemented with Km, but
not on LB supplemented with Amp (Fig. 4).
2. An additional control step can be carried out inoculating the
desired clones (sensitive to Amp) into liquid LB medium sup-
plemented with 500 μg/mL Amp and incubating overnight at
28 °C with aeration. We have observed that sometimes Amp
resistant clones, in particular when allelic exchange of resident
plasmid-located loci are involved, may appear as false negatives
in LB plates with 500 μg/mL Amp but display slow growth in
liquid LB supplemented with Amp. Carrying out this step helps
to improve the efficiency of the process since such clones can
thus be discarded prior to the Southern blot analysis.
3. Select colonies displaying the appropriate antibiotic resistance
pattern from the LB control plate, and inoculate into liquid LB
medium supplemented with 15 μg/mL kanamycin. Incubate
overnight at 28 °C with aeration and store the selected clones
in 25% (v/v) glycerol at -80 °C. The correct integration of the
nptII cassette should be confirmed by Southern blot analysis, as
described in Subheading 3.3.

3.3 Validating The chromosomal integration of a single copy of the mini-Tn7-

Chromosomal carried constitutive expression cassette downstream the GlmS-
Integrations by coding gene, and the subsequent integration by allelic-exchange
Southern Blot Analysis of a single copy of the transcriptional fusion module into the
selected position in the 3′-UTR region of the target gene, can
both be validated by Southern blot analysis.
1. Prepare a 5 mL inoculum in LB medium of the selected bacte-
rial clone and incubate overnight at 28 °C with aeration. Con-
centrate bacteria by centrifugation at 12,000 ×g for 5 min, and
perform a genomic DNA extraction and purification using any
dedicated commercial kit, following the instructions of the
 Dual Fluorescence Labelling in Pseudomonas Syringae 107

manufacturer. Quantify the yield and assess the integrity of the

extracted DNA.
2. Prepare two independent digestions, each with 2 μg of geno-
mic DNA, one using a restriction enzyme that cuts within the
probe and another with a restriction enzyme which does not,
making sure that fragments generated are not larger than 5 Kb.
3. Load the product of the restriction reactions into a 0.7% aga-
rose gel and separate by electrophoresis for 1–2 h at 100 V
(while typical conditions are suggested, agarose percentage and
conditions should be adapted to the expected size of the
fragments).
4. Immerse the gel into a 0.25 N HCl solution for 15 min at room
temperature with gentle shaking, to depurinate DNA.
5. Perform three consecutive washing steps by rinsing the gel into
double-distilled water.
6. Immerse the gel into denaturing solution for 30 min at room
temperature with gentle shaking.
7. Transfer the gel to neutralizing solution and incubate for
30 min at room temperature with gentle shaking.
8. Transfer DNA onto a nylon membrane by upward capillarity
transfer or by means of a semi-dry transfer blotter, and stabilize
the interaction by crosslinking, irradiating the DNA-bound
side of the membrane with UV light (0.120 J/cm2).
9. Carry out prehybridization and hybridization steps at 65 °C,
using a digoxigenin (DIG)-labeled DNA fragment containing
either the FRT-nptII-FRT sequence (to validate the integra-
tion of the transcriptional fusion) or the ORF of gene aacC1
(coding for the GmR carried by the mini-Tn7) as a probe (see
Note 9).
10. Detect the chemiluminescent signal obtained after treatment
with the anti-DIG antibody and CSPD following instructions
of the manufacturers, by exposure to an X-ray film or an
imaging system.

3.4 Single-Cell To examine gene expression of T3SS-related genes in controlled

Analysis of T3SS Gene laboratory conditions, we use the nutrient-limited Hrp-inducing
Expression in medium (HIM) [23]. Growth in HIM activates the expression of
Pseudomonas T3SS genes.
syringae
3.4.1 P. syringae 1. Prepare 5 mL cultures of the P. syringae strains to be analyzed,
Cultures in HIM as well as a negative control (wild type strain not carrying any of
the fluorescence reporters), in LB. Incubate overnight at 28 °C
with aeration.
2. Transfer 1 mL of the culture into a sterile microcentrifuge tube
and centrifuge at 10,000 ×g for 2 min.
108 Nieves López-Pagán et al.

3. Discard the supernatant and resuspend the pellets into

1 mL 10 mM MgCl2 to wash the cells. Repeat twice.
4. Measure OD600 and prepare 5 mL HIM at OD600 = 0.13.
5. Incubate at 28 °C with aeration and analyze the samples at the
desired timing.

3.4.2 Flow Cytometry
Analysis of the Strains
1. Take an aliquot of 300 μL of each of the HIM cultures to be
analyzed (see Note 10) by flow cytometry.
2. To detect GFP fluorescence, use a 488 nm laser with a voltage
of 560 using the FITC filter. For CFP fluorescence, use a
405 nm laser with a voltage of 480 using the AmCyan filter.
And for dsRED fluorescence, use a 561 nm laser with a voltage
of 480 using the PE filter of a flow cytometer.
3. Analyze data obtained using Kaluza software.

3.4.3 Visualization by
Confocal Microscopy of the
Strains
1. Prepare agar pads with 1.5% agarose as described in [24].
2. Take 1 mL of each of the HIM cultures and centrifuge at
10,000 ×g for 2 min. Pour out the supernatant and resuspend
the cells in the remaining liquid.
3. Set 2 μL of each of the resuspended samples on a cover slip.
4. Cut 1 cm2 of agar pad and use them to cover each drop.
5. Visualize samples using a confocal microscope with the follow-
ing variable AOTF per fluorophore (excitation/emission):
eCFP (405 nm/450 to 500 nm), GFP3 (488 nm/500 to
533 nm), and dsRED (561 nm/600 to 650 nm).

3.5 Analysis Once a strain carrying both a constitutively expressed fluorescent

of the Strains gene and a transcriptional fusion to a gene of interest in the chro-
mosome has been confirmed by Southern blot analysis, it can be
used for microscopy and/or flow cytometry analyses. To validate
the use of the strain hereby described as an example, we followed
expression of the hrpL::GFP3 (Fig. 4) in combination with the
eCFP or the dsRED reporter (Fig. 3) in bacteria growing in
Hrp-inducing medium (HIM), where HrpL expression is activated
[10]. Confocal microscopy shows all bacteria within the culture
expressing eCFP to similar levels after overnight growth in HIM
with aeration (Fig. 5), leading to a narrow unimodal distribution of
fluorescence intensity when flow cytometry analyses are applied. In
contrast, expression of hrpL::GFP3 transcriptional fusion is very
heterogeneous in these conditions, with some bacteria showing
no GFP expression (thus are only visible in the eCFP channel or
the bright field) versus some expressing GFP to very different levels,
leading to a wide bimodal distribution of GFP fluorescence inten-
sity (Fig. 5), in keeping with previous reports [10].
 Dual Fluorescence Labelling in Pseudomonas Syringae 109

Fig. 5 Strain carrying dual fluorescent labeling, i.e., constitutively expressed eCFP reporter gene and hrpL::
GFP3 transcriptional fusion, displays homogeneous unimodal distribution of eCFP expression and heteroge-
neous bimodal distribution of GFP expression across bacterial samples. (a) Confocal microscopic images of
hrpL::GFP3 eCFP bacteria previously grown in HIM. GFP panels show the fluorescence of GFP as reporter of
the hrpL gene expressions. Scale bars correspond to 2 μm. Images were taken using the Zeiss LSM880
confocal microscope (Zeiss, Germany). The following settings were used for visualization (excitation/emission
in nm): GFP3 (488/500–550), eCFP (440/450–500). Image processing was performed using ZEN blue
software. (b) Flow cytometry analysis of the hrpL::GFP3 eCFP HIM culture used in (a). Event counts versus
GFP fluorescence intensity. Data was collected for 100,000 events per sample. The non-fluorescent panel
shows the autofluorescence of the WT strain not carrying any of the fluorescent reporter genes. (a) and
(b) figures show typical results

Similarly, HIM cultures of the strain carrying hrpL::GFP3 and

constitutively expressing dsRED displayed homogeneous expres-
sion of dsRED(Fig. 6), while showing heterogeneous expression of
hrpL::GFP3, leading to a wide bimodal distribution of GFP fluores-
cence intensity (Fig. 6) (see Note 11). Constitutive expression of
dsRED is somehow slightly noisier (perceived as a slightly wider
distribution of fluorescence intensity by flow cytometry and by
some differences in fluorescence intensity under the microscope)
than expression of eCFP (Figs. 5 and 6).
To illustrate the usefulness of this dual labeling in complex
samples, we used confocal microscopy to follow the expression of
a transcriptional fusion to another T3SS gene, the effector-
encoding hopAB1::GFP3, in a strain constitutively expressing
eCFP, on the leaf surface (Fig. 7). The gene encoding hopAB1
110 Nieves López-Pagán et al.

Fig. 6 Strain carrying dual fluorescent labeling, i.e., constitutively expressed dsRED reporter gene and hrpL::
GFP3 transcriptional fusion, displays homogeneous unimodal distribution of dsRED expression and heteroge-
neous bimodal distribution of GFP expression across bacterial samples. (a) Confocal microscopic images of
hrpL::GFP3 dsRED bacteria previously grown in HIM. GFP panels show the fluorescence of GFP as reporter of
the hrpL gene expression. Scale bars correspond to 2 μm. Images were taken using the Zeiss LSM880
confocal microscope (Zeiss, Germany). The following settings were used for visualization (excitation/emission
in nm): GFP3 (488/500–550), dsRED (558/570–630). Image processing was performed using ZEN blue
software. (b) Flow cytometry analysis of the hrpL::GFP3 dsRED HIM culture used in (a). Event counts versus
GFP fluorescence intensity. Data were collected for 100,000 events per sample. The non-fluorescent panel
shows the autofluorescence of the WT strain not carrying any of the fluorescent reporter genes. (a) and
(b) figures show typical results

displays stronger expression than the regulator gene hrpL, so its

expression can be easily detected on the leaf surface, and it also
displays heterogeneous expression [10]. Bean leaves dip-inoculated
with 5 × 108 cfu/mL of the strain carrying these markers were
observed under the confocal microscope as previously described
[6]. Bacteria displaying eCFP but no GFP can be detected along-
side others expressing both fluorophores (Fig. 7). In this setting,
HopAB1OFF bacteria can only be detected, thanks to the use of the
constitutively expressed eCFP reporter, since the bright field does
not allow the identification of the individual bacteria on the leaf
surface, further supporting the advantages of the approach for the
analysis of host-pathogen interactions or similarly complex samples.
 Dual Fluorescence Labelling in Pseudomonas Syringae 111

Fig. 7 Strain carrying dual fluorescent labeling, i.e., constitutively expressed eCFP reporter gene and hopAB1::
GFP3 transcriptional fusion, growing on the leaf surface following dip-inoculation with 5 × 108 CFU/mL,
displays homogeneous distribution of eCFP expression and heterogeneous distribution of GFP expression
across bacterial samples. Scale bars correspond to 2μm. In this case, bacteria cannot be detected under
bright light, thus hopAB1::GFPOFF bacteria can only be detected by eCFP fluorescence. Images were taken
using the Zeiss LSM880 confocal microscope (Zeiss, Germany). The following settings were used for
visualization (excitation/emission in nm): GFP3 (488/500–550), eCFP (440/450–500). Image processing
was performed using ZEN blue software

4 Notes

1. If the OD600 of the overnight culture is above 4, dilute the

culture with LB broth. If the OD600 is below 4, concentrate the
bacteria by centrifugation.
2. Three consecutive washes with 0.9% NaCl are required to
eliminate any rest of antibiotic used for plasmid selection in
the overnight culture.
3. Bacterial suspensions should be carefully placed onto the filters
to avoid spill outs, which will lead to a reduce recovery of the
conjugation mix and thus decrease the efficiency of the
procedure.
112 Nieves López-Pagán et al.

Table 3
Primers

Name Sequence
Tn7-GlmS AATCTGGCCAAGTCGGTGAC
Tn7R109 CAGCATAACTGGACTGATTTCAG
aacC1-F AAGGTACCCATGTTACGCAGCAGC
aacC1-R AAGGTACCTTAGGTGGCGGTACTTGG
P1 EcoRI TCAGAATTCGTGTAGGCTGGA
P2 EcoRI TCAGAATTCCATATGAATATCCTCCTTAG

4. Note the lower Gm selective concentration use for direct selec-

tion of the fluorophore-carrying mini-Tn7 (present in a single
chromosomal copy) versus the concentration used when select-
ing for multicopy plasmid borne-mini-Tn7.
5. The integration of a single copy of the mini-Tn7-carried con-
stitutive expression cassette into the desired site of the bacterial
chromosome downstream the GlmS-coding gene can be easily
confirmed by performing a Polymerase Chain Reaction (PCR)
analysis on colony crude extracts using primers Tn7-GlmS and
Tn7R109 [22] (Table 3).
6. For successful transformation, recover the equivalent of a rice
grain of biomass.
7. P. syringae competent cells can also be prepared at room tem-
perature, but transformation efficiency decreases.
8. Residual growth of P. syringae in LB plates supplemented with
ampicillin might appear. To minimize it, perform the replicates
in the indicated order (Km – Amp – LB).
9. Probes were generated using chemiluminescent digoxigenin-
dNTPs and DIG Labeling Mix. For the aacC1 probe, primers
aacC1-F and aacC1-R and the template pBK-miniTn7(-
Gm) were used. For the nptII probe, use primers P1 and P2
and pKD4 as the DNA template.
10. If the number of events is higher than 3000 events/second,
dilute the culture using HIM.
11. Very low levels of autofluorescence may give rise to bars appear-
ing near the Y axis as in the example of the non-fluorescent
strain and dsRED fluorescence. This issue could be fixed by
raising the voltage used.
 Dual Fluorescence Labelling in Pseudomonas Syringae 113

Acknowledgments

This work was supported by Grants RTI2018-095069-B-I00 and

PID2021-127245OB-100 funded by MCIN/AEI/10.13039/
501100011033/ and by “ERDF A way of making Europe” and
PY18-2398 funded by Plan Andaluz de Investigación, Desarrollo
e Innovación (PAIDI 2020). JSR was funded by Plan Andaluz de
Investigación, Desarrollo e Innovación (PAIDI 2020,
DOC_00276).

References
1. Hueck CJ (1998) Type III protein secretion
systems in bacterial pathogens of animals and
plants. Microbiol Mol Biol Rev 62:379–433
2. Mansfield J, Genin S, Magori S et al (2012)
Top 10 plant pathogenic bacteria in molecular
plant pathology. Mol Plant Pathol 13:614–629
3. Green S, Studholme DJ, Laue BE et al (2010)
Comparative genome analysis provides insights
into the evolution and adaptation of Pseudomo-
nas syringae pv. aesculi on Aesculus hippocasta-
num. PLoS One 5:e10224
4. Shenge KC, Mabagala RB, Mortensen CN et al
(2007) First report of bacterial speck of tomato
caused by Pseudomonas syringae pv. tomato in
Tanzania. Plant Dis 91:462
5. Morris CE, Sands DC, Vinatzer BA et al
(2008) The life history of the plant pathogen
Pseudomonas syringae is linked to the water
cycle. ISME J 2:321–334
6. Rufián JS, Macho AP, Corry DS et al (2017)
Confocal microscopy reveals in planta dynamic
interactions between pathogenic, avirulent and
non-pathogenic Pseudomonas syringae strains.
Mol Plant Pathol 19:537–551
7. Rohmer L, Guttman DS, Dangl JL (2004)
Diverse evolutionary mechanisms shape the
type III effector virulence factor repertoire in
the plant pathogen Pseudomonas syringae.
Genetics 167:1341–1360
8. Alfano JR, Collmer A (1997) The type III
(Hrp) secretion pathway of plant pathogenic
bacteria: trafficking harpins, Avr proteins, and
death. J Bacteriol 179:5655–5662
9. Macho AP, Zipfel C (2015) Targeting of plant
pattern recognition receptor-triggered immu-
nity by bacterial type-III secretion system effec-
tors. Curr Opin Microbiol 23:14–22
10. Rufián JS, Sánchez-Romero MA, López-Már-
quez D et al (2016) Pseudomonas syringae dif-
ferentiates into phenotypically distinct
subpopulations during colonization of a plant
host. Environ Microbiol 18:3593–3605
11. van Vliet S, Ackermann M (2015) Bacterial
ventures into multicellularity: collectivism
through individuality. PLoS Biol 13:e1002162
12. Stecher B, Hapfelmeier S, Muller C et al
(2004) Flagella and chemotaxis are required
for efficient induction of Salmonella enterica
serovar Typhimurium colitis in streptomycin-
pretreated mice. Infect Immun 72:4138–4150
13. Saini S, Koirala S, Floess E et al (2010) FliZ
induces a kinetic switch in flagellar gene expres-
sion. J Bacteriol 192:6477–6481
14. Stewart MK, Cookson BT (2012) Non-genetic
diversity shapes infectious capacity and host
resistance. Trends Microbiol 20:461–466
15. B€aumler AJ, Winter SE, Thiennimitr P, Casa-
desús J (2011) Intestinal and chronic infec-
tions: Salmonella lifestyles in hostile
environments. Environ Microbiol Rep 3:508–
517
16. Nielsen AT, Dolganov NA, Rasmussen T et al
(2010) A bistable switch and anatomical site
control Vibrio cholerae virulence gene expres-
sion in the intestine. PLoS Pathog 6:e1001102
17. Davis KM, Mohammadi S, Isberg RR (2015)
Community behavior and spatial regulation
within a bacterial microcolony in deep tissue
sites serves to protect against host attack. Cell
Host Microbe 17:21–31
18. Rufián JS, López-Márquez D, López-Pagán N
et al (2018) Generating chromosome-located
transcriptional fusions to fluorescent proteins
for single-cell gene expression analysis in Pseu-
domonas syringae. In: Medina C, Lopez-Baena
FJ (eds) Methods in molecular biology, vol
1734. Humana Press, Springer, New York, pp
183–199
19. Lennox ES (1955) Transduction of linked
genetic characters of the host by bacteriophage
P1. Virology 1:190–206
20. Bertani G (1951) Studies on lysogenesis. I The
mode of phage liberation by lysogenic Escher-
ichia coli. J Bacteriol 62:293–300
114 Nieves López-Pagán et al.
21. Rufián JS, Ruiz-Albert J, Beuzón CR (2022)
Fluorescently labeled Pseudomonas syringae
DC3000 and 1449b wild-type strains constitu-
tively expressing either eGFP, eCFP, or dsRED.
MicroPubl Biol. https://doi.org/10.17912/
micropub.biology.000595
22. Lambertsen L, Sternberg C, Molin S (2004)
Mini-Tn7 transposons for site-specific tagging
of bacteria with fluorescent proteins. Environ
Microbiol 6:726–732
23. Huynh TV, Dahlbeck D, Staskawicz BJ (1989)
Bacterial blight of soybean: regulation of a
pathogen gene determining host cultivar speci-
ficity. Science 245:1374–1377
24. Rufián JS, López-Pagán N, Ruiz-Albert J, Beu-
zón CR (2022) Single-cell analysis of the
expression of Pseudomonas syringae genes
within the plant tissue. J Vis Exp. https://doi.
org/10.3791/64614
25. Teverson DM (1991) Genetics of pathogenic-
ity and resistance in the halo-blight disease of
beans in Africa. PhD thesis, University of Bir-
mingham, Birmingham, UK
26. Hanahan D (1983) Studies of transformation
of Escherichia coli with plasmids. J Mol Biol
166:557–580
27. Simon R, Priefer U, Pühler A (1983) A broad
host range mobilization system for in vivo
genetic engineering: transposon mutagenesis
in gram-negative bacteria. Meth Enzymol
118:640–659
28. Boyer HW, Roulland-Dussoix D (1969) A
complementation analysis of the restriction
and modification of DNA in Escherichia coli. J
Mol Biol 41:459–472
29. Bao Y, Lies DP, Fu H, Roberts GP (1991) An
improved Tn7-based system for the single-
copy insertion of cloned genes into chromo-
somes of gram-negative bacteria. Gene 109:
167–168
30. Kessler B, de Lorenzo V, Timmis KN (1992) A
general system to integrate lacZ fusions into
the chromosomes of gram-negative eubacteria:
regulation of the Pm promoter of the TOL
plasmid studied with all controlling elements
in monocopy. Mol Gen Genet 233:293–301
31. Hoang TT, Karkhoff-Schweizer RR, Kutchma
AJ, Schweizer HP (1998) A broad-host-range
Flp-FRT recombination system for site-specific
excision of chromosomally-located DNA
sequences: application for isolation of
unmarked Pseudomonas aeruginosa mutants.
Gene 212:77–86
32. Datsenko KA, Wanner BL (2000) One-step
inactivation of chromosomal genes in Escheri-
chia coli K-12 using PCR products. Proc Natl
Acad Sci U S A 97:6640–6645
 Chapter 8

A Robust Method to Perform In Vitro and In Planta

Interbacterial Competition Assays: Killing Plant Pathogens
by a Potent Biocontrol Agent
Cristina Civantos, Adrián Ruiz, and Patricia Bernal

Abstract
Interbacterial competition assays have become an essential tool for understanding the interactions between
bacteria and their ability to outcompete one another in natural environments. This is especially relevant
when studying the type VI secretion system (T6SS), a contact-dependent bacterial weapon that can be used
to kill or inhibit the growth of other competing bacteria. Some beneficial environmental microorganisms
such as Pseudomonas putida rely on the T6SS as their primary biocontrol mechanism to eliminate resilient
plant pathogens. Competition assays are an essential methodology in this field that allows us to understand
the efficacy of this bacterial nanoweapon. This chapter outlines the methodology for conducting in vitro
and in planta competition assays between P. putida, a well-known biocontrol agent, and phytopathogenic
bacterial species of economic and scientific interest.

Key words Competition assays, Type VI secretion system, Pseudomonas putida, Biocontrol, Plant
protection, Phytopathogens

1 Introduction

A critical aspect of studying microbial interactions is understanding

the dynamics and mechanisms underlying interbacterial competi-
tion that allow certain bacteria to outcompete others in natural
environments. The type VI secretion system (T6SS), a contact-
dependent bacterial weapon capable of killing or inhibiting the
growth of rival bacteria, contributes significantly to this process.
Beneficial environmental microorganisms such as Pseudomonas
putida rely on the T6SS as a biocontrol mechanism to combat plant
pathogens. P. putida is a well-established biocontrol agent com-
monly found in soil and crop plant roots and plays a vital role in

Supplementary Information The online version contains supplementary material available at https://doi.org/
10.1007/978-1-0716-3617-6_8.

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_8,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

115
116 Cristina Civantos et al.

protecting crops against plant pathogens that significantly reduce

crop yields and cause economic losses. Recent research has high-
lighted the T6SS as its main biocontrol mechanism for combating
resilient phytopathogens. P. putida employs three T6SS, namely
K1, K2 and K3, to deliver more than 11 toxins. Notably, the
K1-T6SS of P. putida demonstrates exceptional efficacy in
controlling various phytopathogens, including Agrobacterium
tumefaciens, Pseudomonas syringae, Pseudomonas savastanoi, Pecto-
bacterium caratovorum, and Xanthomonas campestris [1, 2]. These
pathogens are on the list of the “Top 10” bacterial plant pathogens
based on scientific and economic importance [3] as they are respon-
sible for severe crop losses with a substantial impact on the global
economy. Among the crops affected by these phytopathogens are
brassica crops including broccoli, cauliflower, cabbage, turnips, and
mustard (X. campestris); coffee, kiwi, tomato, rice, beans, cherry,
plum, horse chestnut, and loquat (P. syringae); carrot, potato, leafy
greens, squash, onion, and peppers (P. carotovorum); walnuts,
grapevines, stone fruits, nut trees, sugar beets, horseradish, and
rhubarb (A. tumefaciens); and olive trees, oleander, and ash trees
(P. savastanoi); the main causal agents are indicated in brackets
immediately after the affected crops. The magnitude of economic
losses and the increasing number of restrictions on the use of
classical (chemical) pesticides illustrate the importance of biocon-
trolling plant pathogens.
To assess the effectiveness of this bacterial nanoweapon in
biocontrol, competition assays have become an indispensable
methodology in the field. Competition assays performed to test
the ability of the biocontrol agent P. putida to outcompete plant
pathogens involve the coculture of the two strains, the attacker
(P. putida), and the prey strain (phytopathogen) in a variety of
settings. In vitro competition assays involve the coculture of the
strains on the surface of well-dried solid agar plates of nutrient-rich
or limiting media, whereas in planta competition assays involve the
infiltration of tissues such as leaves of model plants. These assays
allow us to quantitatively measure bacterial growth and survival and
detect inhibitory interactions between strains.
This chapter provides a detailed description of the methodol-
ogy for conducting in vitro and in planta competition assays,
focusing on the interactions between the biocontrol agent P. putida
and bacteria of the Top 10 phytopathogenic bacterial species
reported in the molecular plant pathology literature [3].

2 Materials

The basic microbiology instrumentation that will be needed

includes Erlenmeyer glass flasks, glass bottles, plastic 94 mm diam-
eter Petri dishes, 120 mm square Petri dishes, plastic 96-well plates,
pipette tips, cork-borer set, motorized tissue grinder, 1 mL sterile
 Interbacterial Competition Assays 117

plastic syringes (10 mL), sterile syringe filters, a micropipette set,

multichannel micropipettes, spectrophotometer, bench-top centri-
fuge, vortex/mixer, thermocycler, plastic inoculating loops
(10 μL), shaker incubator, incubator, electroporation system
(BioRad MicroPulser), plant chamber, and laboratory refrigerators
and freezers.

2.1 General 1. Antibiotics: prepare 20 mg/mL stocks of rifampicin and gen-

Reagents and tamicin. Prepare gentamicin in water and sterilize by filtration.
Culture Media Prepare rifampicin in methanol/ethanol, without the need for
sterilization.
2. LB (Lysogenic Broth) Lennox: 10 g/L tryptone, 5 g/L yeast
extract, 5 g/L NaCl.
3. LB Lennox-Agar: LB Lennox supplemented with 1.5% agar.
Dry the plates for 1.5–2 h in a safety cabinet.
4. Sucrose: prepare 0.3 M sucrose in water and sterilize by filtra-
tion. Keep at RT.
5. PBS: phosphate buffered saline in tablets. Dissolve 1 tablet in
200 mL of water. The pH will be in the range between 7.2 and
7.6. Autoclave for 15 min at 120 °C to sterilize and keep at RT.

2.2 Vectors 1. pRL662: a pBBR1-MCS2 derivative where a gentamicin-

resistance marker has replaced the kanamycin resistance gene
and the mob region [4].
2. pRL662-gfp2: a pRL662 derivative expressing GFP2 constitu-
tively from the multicloning site. The plasmid is from the
laboratory collection of Prof. Erh-Min Lai.

2.3 Bacterial Strains 1. The prey strain harbored the plasmid pRL662or pRL662-gfp2,
which confer resistance to gentamicin and are used for antibi-
otic selection.
2. P. putida KT2440R strains (T6SS+ [wild type] and the isogenic
mutant T6SS- [ΔtssA1M2M3]) are naturally resistant to rifam-
picin [1, 2].

2.4 Plants 1. Nicotiana benthamiana plants.

2.5 Molecular 1. Conventional easy PCR reagents (see Note 1).

Biology Reagents 2. Primers to confirm the presence of the pRL662 or pRL662-
gfp2plasmids:
Primer forward (PB0632): 5′- TGCTTCCGGCTCGTATGT
TG-3′.
Primer reverse (PB0635): 5′- TGTGCTGCAAGGCGAT
TAAG-3′.

The expected size of the PCR product for pRL662 is 335 bps
and for pRL662-gfp2 is around 1 kb.
118 Cristina Civantos et al.

3 Methods

3.1 Preparation of After interbacterial competition, prey (phytopathogen) and

Antibiotic Resistance attacker (P. putida) cells will be selected with antibiotics specific
Strains for each strain. Thus, these strains should be resistant to different
antibiotics. The P. putida KT2440R is naturally resistant to rifam-
picin, which can be used for selection if the prey cell is sensitive to
this antibiotic. If the prey strain (phytopathogen) is not naturally
resistant to any antibiotic, a plasmid conferring resistance to genta-
micin (pRL662 or pRL662-gfp2) will be electroporated before the
competition assay (see Note 2). Prepare aliquots of electrocompe-
tent cells using a modified version of the Choi et al. [5] protocol as
follows:
1. Prepare a starter in a rich medium such as LB Lennox and
incubate for 16 h at the appropriate temperature (28 °C) and
180 rpm (see Note 3).
2. Harvest 1.5 mL of culture by centrifugation at 16,000 ×g for
1 min and discard the supernatant. From this step, do every-
thing on ice.
3. Wash cell pellets with 1 mL 0.3 M sucrose.
4. Centrifuge at 16,000 ×g for 1 min and discard the supernatant.
5. Wash cell pellets with 1 mL 0.3 M sucrose.
6. Centrifuge at 16,000 ×g for 1 min and discard the supernatant.
7. Resuspend in 50 μL of 0.3 M cold sucrose and add 150–200 ng
of plasmid (keep on ice for 5 min).
8. Electroporate the 50 μL of the competent cells with the plas-
mid using 2 mm gap electroporation cuvettes and the Ec2
program (V = 2.5 kV) of the BioRad MicroPulser Electropo-
ration Apparatus (see Note 4).
9. Add 1 mL of LB Lennox to the electroporation cuvette and
recover transformed cells incubating for 1 h at 28 °C and
180 rpm.
10. Then, plate aliquots from each of the reactions onto LB
Lennox-Agar supplemented with 20 μg/mL gentamicin to
select for cells harboring the plasmid. From the 1 mL sample,
plate three different dilutions: 890 μL (spin down, discard
supernatant, and resuspended in 100 μL to spread), 100 μL
directly into the LBA plate, and 10 μL of sample resuspended
in 90 μL of LB to spread properly.
11. Incubate plates at 28 °C for 24 h until the visualization of
gentamicin-resistant colonies.
 Interbacterial Competition Assays 119

12. Set up a PCR reaction using forward and reverse primers

described in Subheading 2.5 to confirm the presence of the
plasmid in gentamicin-resistant cells.

3.2 Preparation Prepare starters of the attacker (T6SS+ and T6SS-) and the prey
of Samples for cells (phytopathogen harboring the plasmid with gentamicin-
Interbacterial resistance cassette).
Competition 1. Use a 100 mL conical flask with 10 mL LB Lennox supple-
mented with 10 μL Rif20 and inoculate P. putida KT2240 and
its isogenic T6SS mutant. Incubate at 28 °C in an orbital shaker
at 180 rpm for 16 h.
2. Prepare a 100 mL conical flask with 10 mL LB Lennox supple-
mented with 10 μL Gm20 and inoculate the phytopathogen.
Incubate at 28 °C in an orbital shaker at 180 rpm for 16 h (see
Note 5).
3. Measure the OD600 nm and calculate the volume to obtain a
total OD of 1 for the P. putida strains and ODtotal = 2 for the
phytopathogen (i.e., if the OD600 = 1, collect 1 ml to obtain a
ODtotal = 1).
4. Centrifuge at 16,000 ×g for 1 min and discard the supernatant.
5. Wash cell pellets with 1 mL of sterile PBS.
6. Centrifuge at 16,000 ×g for 1 min and discard the supernatant.

3.3 Interbacterial Concept definition:

Competition
INPUT samples: samples used in the assay just before the inter-
bacterial competition (time = 0 h).
OUTPUT samples: samples used in the assay after interbacterial
competition (time = 24 h).

3.3.1 In Vitro Competition
Assay
1. Resuspend the samples of P. putida (T6SS+ and T6SS-) in
100 μL of sterile PBS and the phytopathogen sample in
200 μL. The ODtotal of all samples will be 10 in all cases, but
the volume of the prey cells will be double to be mixed with the
two samples of the biocontrol agent (T6SS+ and T6SS-)
(Fig. 1).
2. Prepare the INPUT samples as combinations of attacker and
prey cells in 2 tubes of 1.5 mL, i.e., 1:1 ratio as detailed in steps
3 and 4 (see Note 6).
3. Mix 100 μL of the phytopathogen preparation with 100 μL of
T6SS+ samples prepared in step 1.
4. Mix 100 μL of the phytopathogen preparation with 100 μL of
T6SS- samples prepared in step 1.
Fig. 1 Set-up of an in vitro interbacterial competition assay. The biocontrol agent
is represented in green (dark green for the T6SS+ strain and light green for the
T6SS- strain). The phytopathogen is represented in red. For clarity, only one
drop is recovered with the inoculating loop as an example
 Interbacterial Competition Assays 121

IMPORTANT: continue immediately to Subheading 3.4

“Quantification and Analysis of Data.”
5. Plate the following samples in a 2-h dried LB Lennox-Agar
plate (see Note 7): 20 μL of each mix and 10 μL of the attacker
(T6SS+ and T6SS-) and the phytopathogen samples, separately
(Fig. 1).
6. Let it dry for 10 min and incubate the plate for 24 h at 28 °C
(see Note 8).
7. After the incubation period, collect the OUTPUT samples
using an inoculating loop (10 μL) and resuspend them in
1 mL of sterile PBS in a 1.5 mL tube.
8. Homogenize the sample in a ThermoMixer at 2000 rpm and
28 °C (see Note 9).

3.3.2 In Planta 1. Resuspend the P. putida (T6SS+ and T6SS-) samples in 1 mL

Competition Assay of sterile PBS and the phytopathogen sample in 2 mL. The
ODtotal of all the samples will be 1 in all cases, but the volume of
the prey cells will be doubled, to be mixed with the two samples
of the biocontrol agent (T6SS+ and T6SS-).
2. Prepare the INPUT samples as combinations of attacker and
prey cells in 2 tubes of 1.5 mL, i.e., 1:1 ratio as detailed in steps
3 and 4 (see Note 6).
3. Mix 500 μL of the phytopathogen preparation with 500 μL of
T6SS+ samples prepared in step 1.
4. Mix 500 μL of the phytopathogen preparation with 500 μL of
T6SS- samples prepared in step 1.
IMPORTANT: continue immediately to Subheading 3.4
“Quantification and Analysis of Data.”
5. Infiltrate the following samples into the reverse of 1-month-old
Nicotiana benthamiana plant leaves using a 1 mL sterile plastic
syringe without a needle (Fig. 2 and Electronic Supplementary
Video 1): 100 μL of each bacterial mix and 100 μL of the
attacker (T6SS+ and T6SS-) and phytopathogen samples,
separately.
Perform at least two technical replicates on different leaves.
Mark the infiltration area with a marker (see Note 10).
6. Incubate for 24 h in a plant chamber at 23 °C and 16 h of light
exposure (see Note 11).
7. After the incubation period, collect the OUTPUT samples by
cutting a circular section of 6 mm in diameter from the infiltra-
tion area of the leaf using a cork-borer set and resuspending
them in 1 mL of sterile PBS in a 1.5 mL tube.
8. Homogenize the sample using a motorized tissue grinder (see
Note 12).
Fig. 2 Set-up of an in planta interbacterial competition assay. The biocontrol
agent is represented in green (dark green for the T6SS+ strain and light green for
the T6SS- strain). The phytopathogen is represented in red. For clarity, only one
leaf is cut as an example
 Interbacterial Competition Assays 123

3.4 Quantification The interbacterial competition assay is quantified by counting

and Analysis of Data colony-forming units (CFUs) of INPUT and OUTPUT samples
after selection on plates supplemented with appropriate antibiotics,
as described in Subheading 3.1.

IMPORTANT
*INPUT samples will be serially diluted and plated immediately
after their preparation, described in steps 1 to 4 of Subhead-
ings 3.3.1 and 3.3.2 “in vitro and in planta interbacterial
competition assays.”
*OUTPUT samples will be serially diluted and plated immediately
after their preparation, described in steps 7 and 8 of Subhead-
ings 3.3.1 and 3.3.2 “in vitro and in planta interbacterial
competition assays.”
The following steps need to be performed in sterile conditions.

1. Prepare a 96-well plate for serial dilutions. The dilutions will be

set in the rows of 96-well plates (A–H) as shown in Fig. 3:
Row A: Leave row A for the samples.
Row B–H: Add 270 μL of sterile PBS in rows B–H using a
multichannel pipette. *Only in the necessary columns (see
step 2).
2. Follow these general steps to prepare serial dilutions in 96-well
plates of the INPUT and OUTPUT samples of the in vitro and
in planta competition assays. Each sample will be in a different
column of the plate (1–12). For in planta competition assays,
at least two technical repeats of each sample will be serially
diluted and plated. The following shows an example of the
preparation of the INPUT samples of an in vitro competition
assay (Fig. 3):
Column 1: T6SS+.
Column 2: T6SS-.
Column 3: Phytopathogen.
Column 4: Mix of T6SS+ and phytopathogen.
Column 5: Mix of T6SS- and phytopathogen.
3. Add 100 μL of the samples in row A.
4. Using a multichannel pipette, take 30 μL of samples in row A
and deposit them in row B.
5. Change tips, mix and take 30 μL of samples in row B, and
deposit them in row C.
124 Cristina Civantos et al.

Fig. 3 Serial dilutions using a 96-well plate and a multichannel pipette. Column 12 illustrates the first step
where rows B–H are filled with 270 μL of sterile PBS and row one with 100 μL of sample (in orange). The
 Interbacterial Competition Assays 125

6. Repeat step 5, taking the last row with samples and adding to
the next row with sterile PBS until reaching row H.
7. Manually or using a multichannel pipette that allows separation
of the tips, plate 20 μL of each dilution on square LB Lennox-
Agar plates supplemented with appropriate antibiotics (rifam-
picin and gentamicin) as shown in Fig. 3. Plate at least two
technical replicates. All samples are plated on both antibiotics.
8. Let the drops dry for 10 min and incubate for 24 h at 28 °C (see
Note 8).
IMPORTANT: samples from columns 1 and 2, i.e., attacker
strains should only grow in LB Lennox-Agar plate supple-
mented with rifampicin and should be fully sensitive to the
concentration of gentamicin used in this assay (Fig. 4a, b,
e, f). Sample from column 3, prey strain, should only grow
on LB Lennox-Agar plate supplemented with gentamicin
and should be fully sensitive to the concentration of rifam-
picin used in this assay (Fig. 4a, b, e, f). At time 0, the
number of attacker and prey cells is expected to be similar
since a 1:1 ratio has been used (Fig. 4c, d). The number of
T6SS+ and T6SS+ cells should be the same at time 0 h
(INPUT) and 24 h (OUTPUT) (Fig. 4d, h). When this is
the case, it is possible to exclusively represent the survival of
the attacker strain (Fig. 4g). Otherwise, to consider these
differences, the result of the competition assay should be
represented as a competitive index that includes the input
and output of the attacker and prey cells.
9. Count colony-forming units in the 20 μL drop and calculate
the number of CFU/mL in your sample. Calculate the average
of the technical replicates (see Note 13).

3.5 Competitive 1. The value of the competitive index is calculated using the
Index Calculation following formula:

competitive index ðCIÞ

= ðoutput attacker=output preyÞ=ðinput attacker=input preyÞ:

Example
Killing of the phytopathogen by a T6SS+ biocontrol agent:

CI = 108 =105 = 107 =107 = 103 =1 = 1000:

Fig. 3 (continued) samples of the biocontrol agent are represented in green (dark green for the T6SS+ strain
and light green for the T6SS- strain). The sample of the phytopathogen is represented in red. Every dilution of
every column is plated in duplicate in LB Lennox-Agar plates supplemented independently with rifampicin and
gentamicin. For clarity, only the plating of column 1 is represented in the figure
Fig. 4 Quantification of the INPUT and OUTPUT samples by serial dilution and counting CFU. Control and
interbacterial competition samples are plated on LB Lennox-Agar supplemented with gentamicin and
rifampicin independently at time 0 h (INPUT samples) and time 24 h (OUTPUT samples)
 Interbacterial Competition Assays 127

Fig. 5 Representation from data of an interbacterial competition assay

Killing of the phytopathogen by a T6SS- biocontrol agent:

CI = 108 =108 = 107 =107 = 1=1 = 1:

2. The statistical analysis of the experimental data can be per-

formed using GraphPad PRISM or similar software. Perform
unpaired T-tests following the instructions of the selected
program.
3. Plot the data as the Log10 of the competitive index, in the
previous example (Fig. 5):
Killing of the phytopathogen by a T6SS+ biocontrol agent:

Log10 ðCIÞ = > Log10 ð1000Þ = 3:

Killing of the phytopathogen by a T6SS- biocontrol agent:

Log10 ðCIÞ = > Log10 ð1Þ = 0:

4 Notes

1. Any PCR reagents could be used to run the PCR to confirm the
presence of the plasmid. However, we recommend GoTaq
Green Master Mix (Promega).
2. Any stable plasmid conferring resistance to an appropriate anti-
biotic could be used.
128 Cristina Civantos et al.

3. The growth medium, temperature, and rpm should be opti-

mized for the bacterial culture. We have used standard condi-
tions for plant and soil microorganisms.
4. The pre-programmed Ec2 program of the BioRadMicroPul-
serTM electroporation apparatus has been used. Similar condi-
tions in other electroporation systems could be utilized. As a
note, the 0.1 and 0.2 cm gap cuvettes are the most often used
for electroporation of microorganisms. Electroporation is gen-
erally carried out at a voltage of 1.8 kV (E = 18 kV/cm) when
electroporating cells in 0.1 cm cuvettes and at a voltage of
2.5 kV (E = 12.5 kV/cm) when electroporating cells in
0.2 cm cuvettes. The other default parameters are 200 Ω and
25 μF.
5. Adjust the incubation time as needed for different plant
pathogens.
6. The ratio between the attacker and the prey cell can be mod-
ified to identify the appropriate ratio that optimizes T6SS
killing.
7. The media used for the competition assay should allow the
growth of attacker and prey cells. A standard rich medium has
been used here, but it could be adjusted depending on the
phytopathogen being tested.
8. The incubation time could be adjusted as needed to improve
killing efficiency.
9. Any instrument that allows mixing and heating of the samples
at the appropriate speed and temperature for the microorgan-
isms could be used. We have used the Eppendorf
ThermoMixer.
10. The plants should be approximately 1 month old. For a more
detailed description of the infiltration protocol, please refer
to [6].
11. Adjust as necessary if using a different plant model.
12. In the absence of the motorized tissue grinder, the sample can
be homogenized using the grinder tips manually or by gener-
ous pipetting and vortexing.
13. At least four biologically independent experiments need to be
performed.

Acknowledgments

Micropipette-multi, petri-dish-top-yellow, microtube-closed-

translucent, cell-culture-equipment-1, syringe and incubator icons
used in the figures were retrieved from Bioicons.com. According to
its instructions. They are acknowledged as Icons by Servier https://
 Interbacterial Competition Assays 129

smart.servier.com/ is licensed under CC-BY 3.0 Unported

https://creativecommons.org/licenses/by/3.0/
Work in the P.B. laboratory is funded by two Research Grants from
the State Subprogram for Knowledge Generation from the Spanish
Minister of Science and Innovation (MCIN), the Spanish State
Research Agency (AEI) and the European Union (UE) with refer-
ence PID2021-123000OB-I00 (MCIN/AEI/10.13039/
501100011033/FEDER, UE) and TED2021-130357B-I00
(MCIN/AEI/10.13039/501100011033/“NextGeneratio-
nEU”/PRTR [The Spanish Recovery, Transformation and Resil-
ience Plan]). P.B. is also supported through a Ramon y Cajal
RYC2019-026551-I fellowship (AEI/10.13039/
501100011033) and a Grant (Excellence Grant 2021) from the
Andalusian Knowledge Agency (AAC), Andalusian government
with reference ProyExcel_00450.

References

1. Bernal P, Allsopp LP, Filloux A, Llamas MA
(2017) The Pseudomonas putida T6SS is a
plant warden against phytopathogens. ISME J
11:972–987
2. Bernal P, Furniss RCD, Fecht S et al (2021) A
novel stabilization mechanism for the type VI
secretion system sheath. Proc Natl Acad Sci U
S A 118:e2008500118
3. Mansfield J, Genin S, Magori S et al (2012) Top
10 plant pathogenic bacteria in molecular plant
pathology. Mol Plant Pathol 13:614–629
4. Vergunst AC, Schrammeijer B et al (2000)
VirB/D4-dependent protein translocation
from Agrobacterium into plant cells. Science
290:979–982
5. Choi KH, Kumar A, Schweizer HP (2006) A
10-min method for preparation of highly elec-
trocompetent Pseudomonas aeruginosa cells:
application for DNA fragment transfer between
chromosomes and plasmid transformation. J
Microbiol Methods 64:391–397
6. Ma LS, Hachani A, Lin JS et al (2014) Agrobac-
terium tumefaciens deploys a superfamily of type
VI secretion DNase effectors as weapons for
interbacterial competition in planta. Cell Host
Microbe 16:94–104
 Part IV

Molecular Methods for Plant-Interacting Bacteria

 Chapter 9

Quantification of Mixed-Linkage β-Glucan (MLG) in Bacteria

Juan Antonio Marchante, Lucı́a Ruiz-Sáez, Socorro Muñoz, Juan Sanjuán,
and Daniel Pérez-Mendoza

Abstract
Prokaryotes are known to produce and secrete a broad range of biopolymers with a high functional and
structural heterogeneity, often with critical duties in the bacterial physiology and ecology. Among these,
exopolysaccharides (EPS) play relevant roles in the interaction of bacteria with eukaryotic hosts. EPS can
help to colonize the host and assist in bacterial survival, making this interaction more robust by facilitating
the formation of structured biofilms. In addition, they are often key molecules in the specific recognition
mechanisms involved in both beneficial and pathogenic bacteria-host interactions. A novel EPS known as
MLG (Mixed-Linkage β-Glucan) was recently discovered in rhizobia, where it participates in bacterial
aggregation and biofilm formation and is required for efficient attachment to the roots of their legume host
plants. MLG is the first and, so far, the only reported linear Mixed-Linkage β-glucan in bacteria, containing
a perfect alternation of β (1 → 3) and β (1 → 4) bonds. A phylogenetic study of MLG biosynthetic genes
suggests that far from being exclusive of rhizobia, different soil and plant-associated bacteria likely produce
MLG, adding this novel polymer to the plethora of surface polysaccharides that help bacteria thrive in the
changing environment and to establish successful interactions with their hosts.
In this work, a quantification method for MLG is proposed. It relays on the hydrolysis of MLG by a
specific enzyme (lichenase), and the subsequent quantification of the released disaccharide (laminaribiose)
by the phenol-sulfuric acid method. The protocol has been set up and optimized for its use in 96-well plates,
which makes it suitable for high-throughput screening (HTS) approaches. This method stands out by its
fast processing, technical simplicity, and capability to handle multiple samples and biological replicates at
a time.

Key words MLG, Exopolysaccharides, β-Glucans, Biopolymers, Biofilm formation

1 Introduction

Most bacteria are capable of synthesizing and secrete to the cell

exterior biopolymers with different compositions, functions, and
physical-chemical characteristics. These extracellular substances can
be chemically diverse, such as carbohydrates, lipids, proteins, or

Juan Antonio Marchante and Lucı́a Ruiz-Sáez contributed equally with all other contributors.

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_9,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

133
134 Juan Antonio Marchante et al.

nucleic acids [1]. Some of the multiple functions of these bacterial

products are the adherence to surfaces, formation of biofilms, cell-
cell interactions, water retention, or defense against abiotic and
biotic stresses.
Biofilm formation is an ancient and integral component of the
microbial life cycle, being common to a diverse range of microor-
ganisms. Although many studies on bacterial biofilm formation are
assayed over abiotic materials, it is important to note that most
bacteria in the natural environment grow aggregated on biotic
surfaces. This protected mode of growth is crucial during many
host-microbe interactions [2]. Biofilms are responsible for a variety
of chronic bacterial infections that rarely can be resolved by host
defense mechanisms [3]. There are several important disorders
associated including onset of cancer, dental plaque, infectious of
lungs, and kidney stones [4]. One of the best studied examples is
Pseudomonas aeruginosa, and the chronic lung infections it causes
in most patients with the recessive genetic disease cystic fibrosis
(CF). Chronic infection occurs in over 60% of adults with CF,
where the ability of Pseudomonas to overproduce polymeric sub-
stances is crucial to its adaptation and persistence within the CF
airway [5]. Biopolymers secreted by plant-associated bacteria are
also key determinants in both pathogenic and beneficial relation-
ships. Direct observations of bacteria adhered to plant surfaces have
revealed multicellular assemblies and the majority of natural isolates
with the ability to form biofilms [6]. P. putida, P. fluorescens,
P. syringe, and related pseudomonads are common plant-associated
bacteria found on leaves and roots forming associated communities
[7–10]. As nitrogen-fixing symbionts of legumes, rhizobia are
economically important root colonizers. Colonization of the rhi-
zosphere and nodulation require attachment to plant roots. Rhizo-
bium and Sinorhizobium, among other Rhizobiaceae members, can
form biofilms on legume roots. In this kind of processes, the
secretion of different biopolymers also plays a crucial role [11–14].
Biopolymers formed by carbohydrates and excreted into the
extracellular medium are commonly known as exopolysaccharides
(EPS). These EPS can be present firmly attached to the cell surface
forming sheaths, capsules, or slimes, or can be released into the
medium as either a soluble or insoluble material, thereby contribut-
ing to the biofilm matrix, protection, or signaling functions in host-
microbe interactions. Furthermore, EPS currently have a great
impact in the industrial sector, being an ideal substitute for differ-
ent chemical polymers due to its biodegradable and non-toxic
nature. EPS are also involved on innumerable applications in the
environmental sector, highlighting the treatment of wastewater,
the elimination of toxic organic compounds, or the treatment of
leachate in landfills, among others. Some examples of these biotech
recognized EPS are xanthan gum, hyaluronic acid, gellan, or algi-
nate [1]. Other remarkable EPS are β-glucans: naturally occurring
 Mixed-Linkage β-Glucan Exopolysaccharide 135

homopolysaccharides made up of D-glucose monomers linked

through β-glycosidic bonds. The best studied is bacterial cellulose
with its countless industrial applications, but also reported as an
important EPS in host-microbe interactions [15, 16]. However,
other less studied β-glucans are increasingly attracting the interest
of various biotechnological, pharmaceutical, and industrial sectors
due to their numerous functions [17, 18]. Furthermore, the ability
of these β-glucans to interact with protein receptors of micro- and
macro-organisms and triggering biological responses point to a
novel role as immunomodulators in different animal and plant
host defense systems [19, 20]. The study of how these polymers
interact with PRRs (pattern recognition receptors) present on the
surface of various immune cells such as monocytes, macrophages,
or NK (Natural Killer) cells is imperative in understanding host
defense mechanisms against pathogens producing these EPS. On
that sense, several β-glucans are presented as good alternatives for
vaccines and treatments against cancer [18, 19]. Moreover,
β-glucans can regulate the intestinal microbiota, and their use as
ingredient of the feedstock destined for animal husbandry is
increasing [21, 22]. In addition, its physicochemical properties of
gelation, solubility, and viscosity are becoming important today,
having a high potential as thickening and gelling agent in the food
and cosmetic industry [18].
Among β-glucans, there is a specific type formed by mixed β
(1 → 4) and β (1 → 3) linkages, the so-called Mixed-Linkage
β-Glucans. These Mixed-Linked β-Glucans have been described in
fungi, lichens, and higher plants [23, 24]. Eukaryotic Mixed-
Linkage β-Glucans consist of unbranched linear molecules contain-
ing distinctive ratios of cello-oligosaccharides of 3, 4, or higher
degrees of polymerization bounded by mixed β (1 → 4) and β
(1 → 3) linkages. In bacteria, a Mixed-Linkage β-Glucan (MLG)
was first described in the 8530 strain of Sinorhizobium meliloti
(Sme) [13], although later studies demonstrated that it is also
produced by other rhizobia [12]. MLG biosynthetic genes are
also present in phylogenetically distant bacteria that also establish
interaction with eukaryotic hosts. MLG in Sme participates in
different processes of bacterial aggregation, biofilm formation,
and attachment to host plant roots, resembling the function of
cellulose in other bacteria [13]. Unlike eukaryotic organisms, bac-
terial MLG exhibits a perfect alternation of β (1 → 3) and β (1 → 4)
bounds, which makes it interesting for the study of its biological
role in the interaction with the host and for biotech applications
[13, 25]. MLG was discovered when intracellular levels of the
bacterial second messenger cyclic diguanylate (c-di-GMP) were
artificially increased in Sme [13]. This universal bacterial second
messenger allosterically activates the MLG synthase upon binding
to its cytoplasmic C-terminal domain [26]. Cyclic-di-GMP is also
able to activate the production of other linear β-glucans in bacteria,
136 Juan Antonio Marchante et al.

including cellulose β(1 → 4) and curdlan β(1 → 3) [27, 28]. Several

quantification methods based on different dyes and hydrolytic
enzymes have been reported for bacterial cellulose and curdlan
[29–34]. However, no MLG quantification method has been
described to date.
In this work, we describe a reliable and reproducible method to
quantify the production of MLG in a 96-well microplate format.
MLG is indirectly quantified through the use of a commercially
available lichenase enzyme and the subsequent quantification of the
released sugars to the supernatant by the phenol-sulfuric acid
method [35, 36]. Lichenase is a specific glucan endohydrolase
whose target sites are all β (1 → 4) bonds immediately following
β (1 → 3). Thus, it cannot hydrolyze other β-glucans (i.e., curdlan
or cellulose) and would be specific for MLG in bacteria. Phenol, in
the presence of sulfuric acid, can be used for the colorimetric
microdetermination of sugars including monosaccharides, oligo-
saccharides, polysaccharides, and their methyl derivatives, and their
quantification on a given solution requires only a standard curve for
the respective sugar [35]. In this case, the coloration obtained will
indicate the amount of laminaribiose [β-D-Glcp-(1 → 3)-β-D-Glcp],
the disaccharide released from MLG by the lichenase enzyme, and
therefore, indirectly, the amount of MLG produced by the bacterial
strains under certain conditions. The method can be useful to
screen for different bacterial strains potentially producing this inter-
esting biopolymer, as well as for testing multiple physiological and
environmental conditions of production. The advantages of this
inexpensive quantification protocol lay on its technical simplicity
and capability of reproducing different biological replicas in the
same experiment, thanks to its microplate format and its potential
automation avoiding the excessive handling and materials
utilization.
As a proof of concept, we use the commercially available
Mixed-Linkage β-Glucans: lichenan and barley β-Glucan [with
(1 → 3)/(1 → 4) β-bonds], and the model bacterium Sme over-
producing MLG under high c-di-GMP condition [13]. In order to
assay the specificity of the approach, Sme MLG- biosynthetic
mutant and commercial pure β-glucans such as cellulose [β
(1 → 4) bonds] and curdlan [β (1 → 3) bonds] are included as
negative controls.

2 Materials

2.1 Culture Media 1. Minimal medium (MM) broth [37](for 1 L): 0.3 g K2HPO4,
and Bacterial Strains 0.3 g KH2PO4, 0.15 g MgSO4·7H2O, 0.05 g NaCl, 1.1 g
sodium glutamate, 10 g mannitol, 0.06 g FeCl3, and 0.05 g
Cl2Ca ·2H2O (pH 6.8). Final pH was adjusted to 6.8 prior to
autoclaving. The solution was sterilized in an autoclave 20 min
 Mixed-Linkage β-Glucan Exopolysaccharide 137

at 120 °C. The MM was supplemented with vitamins solution

(1000×) and required antibiotics.
2. Strains used in this study have been previously described in
Pérez-Mendoza et al. (2015) [13]:
Sinorhizobium meliloti 8530 pJBpleD*: 8530 strain is 1021
expR+ derivative, Smr [38], containing pJBpleD* plasmid:
Apr, Tcr, pJB3Tc19 derivate bearing a 1423 bp XbaI/
EcoRI fragment containing pleD* [11].
S. meliloti 8530 SMb20391::Nm pJBpleD*: It is a S. meliloti
8530 pJBpleD* derivative mutant in the bgsA gene
(SMb20391), encoding the glycosyltransferase required
for the synthesis of MLG.

2.2 Plate Format The protocol is described to be carried out in 2 mL 96-deep-well

and Equipment plates (DWP), which are sealed with a breathable foil that allows the
bacterial growth and prevents cross-contamination. The enzyme
digestions are also performed in 2 mL 96-deep-well plates. The
phenol-sulfuric acid method, including the calibration curve, is
carried out in a regular 96-well microplate and quantified in a
microplate reader.
1. 2 mL 96-deep-well plates (DWP).
2. Breathable foil.
3. 96-well plates.
4. Microplate reader.
5. Incubator.
6. PCR thermal cycler.
7. Plate shaker.
8. Centrifuge with microplate adapters.

2.3 Buffers, 1. Vitamin solution (1000×): 0.2 g biotin, 0.1 g thiamine chlor-
Solutions, Reagents, hydrate, 0.1 g sodium pantothenate, fill up to 1 L with d-
and Enzymes H2O. The solution was sterilized by filtration with 0.22 μm
pore size cellulose acetate filters.
2. 10 mg/mL tetracycline: Dissolve 0.1 g tetracycline in 10 mL
methanol.
3. 100 mM sodium phosphate buffered saline (PBS) pH 6.4:
Dissolve 10.5 g H2NaPO4 and 10.6 g HNa2PO4 in 1 L dH2O.
4. Glucose solutions: 1.8 mg/mL, 0.9 mg/mL, 0.45 mg/mL,
0.23 mg/mL, 0.11 mg/mL, 0.06 mg/mL, 0.03 mg/mL,
0.01 mg/mL. A stock solution (1.8 mg/mL) of glucose was
prepared: 18 mg glucose in 10 mL deionized water. The rest of
the glucose solutions were prepared as ½ dilutions of the
original stock solution.
138 Juan Antonio Marchante et al.

5. 97% sulfuric acid.

6. 5% phenol: Mix 55.56 ml of aqueous solution 90% phenol in
947.9 mL of deionized water.
7. Lichenase (1000 U/mL). This enzyme is capable of hydrolyz-
ing glucose polymers with β(1 → 4) linkage followed by
β(1 → 3).

3 Methods

This protocol is described following a standard 96-well microplate

format and is designed to be performed manually with multichan-
nel pipettes or could also be automatized with liquid handling
workstations. A schematic summary of the protocol is described
in Fig. 1.

3.1 Bacterial Growth 1. Thaw glycerol stocks (made of stationary phase cultures) on ice
Conditions and inoculate 5 μL of each strain to be assayed in a DWP with
1 mL of MM supplemented with tetracycline (10 μg/mL) (see
Note 1).
2. Incubate 72 h at 28 °C and 600 rpm (see Note 1).
3. Centrifuge 1 h at 3220 ×g.
4. Discard the supernatant and let the plate upside-down on towel
paper to ensure all supernatants are drained off (see Note 2).
5. Wash the pellet by adding 1 mL of 100 mM PBS in each well,
mix them by pipetting up and down 3 times, and centrifuge for
20 min at 3220 ×g.
6. Repeat steps 4 and 5 twice to avoid any residual sugars from
the culture broth.
7. Discard the supernatant and let the plate upside-down on towel
paper to ensure all supernatants are drained off (see Note 2).

3.2 Lichenase 1. Add 6 μL of lichenase (6 Units) dissolved in 1 mL of 100 mM

Digestion PBS into each well (see Note 3).
2. Resuspend pellets by pipetting up and down 3 times.
3. Incubate 30 min at 40 °C in an orbital microplate shaker at
600 rpm.
4. Centrifuge 30 min at 3220 ×g.
5. Transfer 250 μL of the supernatant to a 96-well plate (see
Note 4).
As it is indicated above, a single bacterial strain can produce and
secrete more than one EPS at the same time. Thus, specificity is
crucial for the quantification of MLG over any other bacterial EPS
that could be produced simultaneously. For this, the specificity of
 Mixed-Linkage β-Glucan Exopolysaccharide 139

Fig. 1 Diagram of the MLG quantification protocol

140 Juan Antonio Marchante et al.

lichenase enzyme is the key. As a proof of concept, different control

assays were carried out with different commercially available EPS in
digestions with the lichenase enzyme (Fig. 2a).

3.3 MLG MLG production is expressed as glucose equivalents. Thus, an

Quantification appropriate linear glucose calibration curve should be included in
the microplate for every quantification (see Note 5).
1. Transfer 50 μL of the supernatant fraction of each digestion in a
new 96-well plate.
2. Transfer 50 μL of each glucose dilutions to the 96-well plate for
the calibration curve (see Note 5).
3. Add 150 μL of concentrated sulfuric acid and mix well.
4. Add 30 μL of the 5% phenol solution and mix well (see Note 6).
5. Incubate 5 min at 90 °C (see Note 7).
6. Measure the optical density at 490 nm in a microplate reader
(see Note 8).
7. Construct the calibration curve and use its equation to estimate
the glucose equivalents of MLG in every culture.
As a proof of concept, in Fig. 2b is shown the MLG quantifica-
tion of the model bacterium Sme under high c-di-GMP condition
and a parallel experiment with a Sme MLG- biosynthetic mutant,
as a negative control.

4 Notes

1. Suitable media (including antibiotics concentration) and

growth conditions, particularly temperature, should be chosen
depending on the assayed bacterial strains.
2. The removal of the supernatants can be done either by pipet-
ting off or by directly inverting the plate, depending on how
strong the cell pellets remain attached onto the well bottom
surface. This step is crucial to remove any traces of sugars from
the culture broth.
3. The conditions of incubation with lichenase (amount of
enzyme, temperature, and time) may require optimization for
different bacterial strains. The optimal temperature for enzyme
activity, according to the manufacture instructions, is 60 °C.
However, it is crucial to avoid cell lysis to prevent the release of
intracellular sugars. Our experience indicates that it is desirable
to apply more units of lichenase, rather than higher tempera-
tures or longer incubation times.
4. The protocol could be stopped at this point and the microplate
with supernatants stored at -20 °C for further quantifications.
 Mixed-Linkage β-Glucan Exopolysaccharide 141

Fig. 2 MLG quantification. (a) Enzymatic digestion with lichenase of different commercial β-glucans used as
controls. Five mg of each commercial EPS were suspended in 1 mL of PBS and digested with 10 units of
lichenase (2 h at 40 °C in agitation). Supernatant fractions were quantified with the phenol-sulfuric acid
method. (b) MLG quantification of the model bacterium Sme under high c-di-GMP condition and a parallel
experiment with a Sme MLG- biosynthetic mutant. Columns show the mean of seven biological replicas of
each sample and the bars show ± SD
142 Juan Antonio Marchante et al.

5. A calibration curve with appropriate glucose concentrations

should be included. This would depend on the dynamic
range of the plate reader and the expected amount of MLG in
bacterial samples. A 10 μM glucose stock solution and ½ serial
dilutions (25 μL of deionized water with 25 μL of the previous
dilution: 90, 45, 22.5, 11.25, 5.63, 2.81, 1.41 μg of glucose)
per well in triplicates are suitable amounts.
6. The addition of 5% phenol solution after the sulfuric acid
should be done as fast as possible. Accurate volumes of these
reactive are very important for the colorimetric reaction.
7. The plate was incubated in a PCR thermal cycler with heating
lid to avoid condensation.
8. During the measurements, it is common to achieve saturated
signals if the MLG production is high. In these cases, it is
desirable to make a 1/10 dilution of the supernatants in
another microplate before the sulfuric acid and phenol
addition.

References
1. More TT, Yadav JSS, Yan S et al (2014) Extra-
cellular polymeric substances of bacteria and
their potential environmental applications. J
Environ Manag 144:1–25
2. Parsek MR, Fuqua C (2004) Biofilms 2003:
emerging themes and challenges in studies of
surface-associated microbial life. J Bacteriol
186:4427–4440
3. Costerton JW, Stewart PS, Greenberg EP
(1999) Bacterial biofilms: a common cause of
persistent infections. Science 284:1318–1322
4. Sharma S, Sharma S, Tiwari V (2022) Role of
biofilm in host-pathogen interaction. In: Roy
D (ed) A complete guidebook on biofilm study.
Academic/Elsevier, London, p 227
5. Lund-Palau H, Turnbull AR, Bush A et al
(2016) Pseudomonas aeruginosa infection in
cystic fibrosis: pathophysiological mechanisms
and therapeutic approaches. Expert Rev Respir
Med 10:685–697
6. Ramey BE, Koutsoudis M, von Bodman SB,
Fuqua C (2004) Biofilm formation in plant-
microbe associations. Curr Opin Microbiol 7:
602–609
7. Collins AJ, Smith TJ, Sondermann H, O’Toole
GA (2020) From input to output: the Lap/c-
di-GMP biofilm regulatory circuit. Annu Rev
Microbiol 74:607–631
8. Ude S, Arnold DL, Moon CD et al (2006)
Biofilm formation and cellulose expression
among diverse environmental Pseudomonas
isolates. Environ Microbiol 8:1997–2011
9. Aragón IM, Pérez-Mendoza D, Gallegos MT,
Ramos C (2014) The c-di-GMP phosphodies-
terase BifA is involved in the virulence of bac-
teria from the Pseudomonas syringae complex.
Mol Plant Pathol 16:604–615
10. Perez-Mendoza D, Felipe A, Ferreiro MD et al
(2019) AmrZ and FleQ co-regulate cellulose
production in Pseudomonas syringae pv. tomato
DC3000. Front Microbiol 10:746
11. Pérez-Mendoza D, Aragón IM, Prada-Ramı́rez
HA et al (2014) Responses to elevated c-di-
GMP levels in mutualistic and pathogenic
plant-interacting bacteria. PLoS One 9:e91645
12. Pérez-Mendoza D, Romero-Jiménez L, Rodrı́-
guez-Carvajal MA et al (2022) The role of two
linear β-glucans activated by c-di-GMP in Rhi-
zobium etli CFN42. Biology 11:1364
13. Pérez-Mendoza D, Rodrı́guez-Carvajal MA,
Romero-Jiménez L et al (2015) Novel mixed-
linkage beta-glucan activated by c-di-GMP in
Sinorhizobium meliloti. Proc Natl Acad Sci U S
A 112:E757–E765
14. Fujishige NA, Kapadia NN, De Hoff PL,
Hirsch AM (2006) Investigations of Rhizo-
bium biofilm formation. FEMS Microbiol
Ecol 56:195–206
15. Augimeri RV, Varley AJ, Strap JL (2015)
Establishing a role for bacterial cellulose in
environmental interactions: lessons learned
from diverse biofilm-producing. Front Micro-
biol 6:1282
 Mixed-Linkage β-Glucan Exopolysaccharide
16. Navya PV, Gayathri V, Samanta D, Sampath S
(2022) Bacterial cellulose: a promising bio-
polymer with interesting properties and appli-
cations. Int J Biol Macromol 220:435–461
17. Xu L, Zhang J (2016) Bacterial glucans: pro-
duction, properties, and applications. Appl
Microbiol Biotechnol 100:9023–9036
18. Caseiro C, Dias JNR, de Andrade Fontes
CMG, Bule P (2022) From cancer therapy to
winemaking: the molecular structure and appli-
cations of β-glucans and β-1,3-glucanases. Int J
Mol Sci 23:3156
19. Goodridge HS, Wolf AJ, Underhill DM (2009)
β-glucan recognition by the innate immune
system. Immunol Rev 230:38–50
20. Rebaque D, Del Hierro I, Lopez G et al (2021)
Cell wall-derived mixed-linked β1,3/1,4-glu-
cans trigger immune responses and disease
resistance in plants. Plant J 106:601–615
21. Anwar MI, Muhammad F, Awais MM, Akhtar
M (2017) A review of β-glucans as a growth
promoter and antibiotic alternative against
enteric pathogens in poultry. World Poult Sci
J 73:651–661
22. Vetvicka V, Vannucci L, Sima P (2014) The
effects of β-glucan on pig growth and immu-
nity. Open Biochem J 8:89–93
23. Clavaud C, Aimanianda V, Latge J-P (2009)
Organization of fungal, oomycete and lichen
(1,3)-β-glucans. In: Bacic A, Fincher GB,
Stone BA (eds) Chemistry, biochemistry, and
biology of 1–3 beta glucans and related poly-
saccharides. Academic, San Diego, p 387
24. Henrion M, Francey C, Lê K-A, Lamothe L
(2019) Cereal β-glucans: the impact of proces-
sing and how it affects physiological responses.
Nutrients 11:1729
25. Pérez-Mendoza D, Sanjuán J (2016) Exploit-
ing the commons: cyclic diguanylate regulation
of bacterial exopolysaccharide production.
Curr Opin Microbiol 30:36–43
26. Pérez-Mendoza D, Bertinetti D, Lorenz R et al
(2017) A novel c-di-GMP binding domain in
glycosyltransferase BgsA is responsible for the
synthesis of a mixed-linkage β-glucan. Sci Rep
7:8997
27. Morgan JL, McNamara JT, Zimmer J (2014)
Mechanism of activation of bacterial cellulose
synthase by cyclic di-GMP. Nat Struct Mol Biol
21:489–496
143
28. Ruffing AM, Chen RR (2012) Transcriptome
profiling of a curdlan-producing Agrobacter-
ium reveals conserved regulatory mechanisms
of exopolysaccharide biosynthesis. Microbe
Cell Fact 11:17
29. Lynd LR, Weimer PJ, van Zyl WH, Pretorius IS
(2002) Microbial cellulose utilization: funda-
mentals and biotechnology. Microbiol Mol
Biol Rev 66:506–577
30. Wood PJ, Fulcher RG (1984) Specific interac-
tion of aniline blue with (1→3)-β-D-glucan.
Carbohydr Polym 4:49–72
31. Evans NA, Hoyne PA, Stone BA (1984) Char-
acteristics and specificity of the interaction of a
fluorochrome from aniline blue (sirofluor) with
polysaccharides. Carbohydr Polym 4:215–230
32. Nakanishi I, Kimura K, Suzuki T et al (1976)
Demonstration of curdlan-type polysaccharide
and some other β-1,3-glucan in microorgan-
isms with aniline blue. J Gen Appl Microbiol
22:1–11
33. Reichhardt C, McCrate OA, Zhou X et al
(2016) Influence of the amyloid dye Congo
red on curli, cellulose, and the extracellular
matrix in E. coli during growth and matrix
purification. Anal Bioanal Chem 408:7709–
7717
34. Zevenhuizen LP, Bertocchi C, van Neerven AR
(1986) Congo red absorption and cellulose
synthesis by Rhizobiaceae. Antonie Van Leeu-
wenhoek 52:381–386
35. DuBois M, Gilles KA, Hamilton JK et al
(1956) Colorimetric method for determina-
tion of sugars and related substances. Anal
Chem 28:350–356
36. Masuko T, Minami A, Iwasaki N et al (2005)
Carbohydrate analysis by a phenol-sulfuric acid
method in microplate format. Anal Biochem
339:69–72
37. Robertsen BK, Aman P, Darvill AG et al
(1981) The structure of acidic extracellular
polysaccharides secreted by Rhizobium legumi-
nosarum and Rhizobium trifolii. Plant Physiol
67:389–400
38. Glazebrook J, Walker GC (1989) A novel exo-
polysaccharide can function in place of the
calcofluor-binding exopolysaccharide in nodu-
lation of alfalfa by Rhizobium meliloti. Cell 56:
661–672
 Chapter 10

Surface Plasmon Resonance as a Tool to Elucidate

the Molecular Determinants of Key Transcriptional
Regulators Controlling Rhizobial Lifestyles
Laura Tomás-Gallardo, Juan J. Cabrera, and Socorro Mesa

Abstract
Bacteria must be provided with a battery of tools integrated into regulatory networks, in order to respond
and, consequently, adapt their physiology to changing environments. Within these networks, transcription
factors finely orchestrate the expression of genes in response to a variety of signals, by recognizing specific
DNA sequences at their promoter regions. Rhizobia are host-interacting soil bacteria that face severe
changes to adapt their physiology from free-living conditions to the nitrogen-fixing endosymbiotic state
inside root nodules associated with leguminous plants. One of these cues is the low partial pressure of
oxygen within root nodules.
Surface plasmon resonance (SPR) constitutes a technique that allows to measure molecular interactions
dynamics at real time by detecting changes in the refractive index of a surface. Here, we implemented the
SPR methodology to analyze the discriminatory determinants of transcription factors for specific interac-
tion with their target genes. We focused on FixK2, a CRP/FNR-type protein with a central role in the
complex oxygen-responsive regulatory network in the soybean endosymbiont Bradyrhizobium diazoeffi-
ciens. Our study unveiled relevant residues for protein-DNA interaction as well as allowed us to monitor
kinetics and stability protein-DNA complex. We believe that this approach can be employed for the
characterization of other relevant transcription factors which can assist to the better understanding of the
adaptation of bacteria with agronomic or human interest to their different modes of life.

Key words CRP/FNR-type proteins, Microoxia, Nitrogen-fixing symbiosis, Promoter, Protein-

DNA interaction, Rhizobia, SPR, Transcription factors

1 Introduction

The biological nitrogen fixation (BNF) process is the main contrib-

utor of biological accessible nitrogen species to ecosystems and,
consequently, to the nitrogen cycle [1–3]. BNF is primarily per-
formed by nitrogen-fixing organisms, the diazotrophs. Among
them, a large group of both α- and β-proteobacteria, collectively
called as “the rhizobia,” are able to establish symbiotic relationships
with leguminous plants [4], eliciting the formation of plant root

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_10,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

145
146 Laura Tomás-Gallardo et al.

(and occasionally stem) nodules where nitrogen fixation occurs

[5, 6]. As BNF is of great relevance for both agronomy and the
environment, since it diminishes the need for chemical fertilizers in
agriculture, there is a demanding interest to further understand the
regulatory mechanisms involved in rhizobia-legumes interaction
control.
Rhizobia are challenged to respond to a battery of signals in
order to adjust their physiology from free-living conditions in the
soil to the symbiotic state, so-called bacteroids, inside of the highly
specialized milieu of a plant cell. One of these cues is the low partial
pressure of free oxygen within the nodules (microoxia) which
triggers the expression of specific genes [6, 7]. Microoxia is abso-
lutely required for the expression and functioning of nitrogenase,
the enzyme that converts molecular nitrogen to ammonium, and
also for the cbb3-type high-affinity terminal oxidase, essential for
bacteroid respiration inside the nodules [5–9].
Bradyrhizobium species are the most extended used diazo-
trophs as inoculants for soybean crops [10]. In particular,
B. diazoefficiens USDA 110 [11] is considered as a model rhizobial
species due to its capacity to establish symbiosis with soybean and
other host plants such as mung bean, cowpea, and siratro [4]. In
this bacterium, a sophisticated regulatory network comprising two
interlinked oxygen-responsive cascades (FixLJ-FixK2-NnrR and
RegSR-NifA) controls the expression of genes needed for free-
living and symbiotic lifestyles [12, 13]. Within this network, the
FixK2 protein plays a key role since (i) it provides the connection
with the RegSR-NifA cascade and (ii) it acts as central distributor of
the microoxic signal sensed at the level of the hierarchically super-
imposed FixLJ two-component regulatory system, thus activating
hundreds of genes [14], including the fixNOQP operon coding for
the cbb3-type high-affinity terminal oxidase.
FixK2 belongs to the cyclic AMP receptor protein (CRP)/
fumarate-nitrate reductase regulator (FNR) family of bacterial tran-
scription factors that respond (directly or indirectly) to a broad
spectrum of metabolic and environmental signals [15–17]. This
class of proteins are involved in the control of processes such as
virulence, photosynthesis, nitrogen fixation, carbon source utiliza-
tion, and various modes of respiratory electron transport. Although
the sequence similarity within the members of CRP/FNR family is
fairly low, they usually interact as homodimers with a preserved
DNA sequence present at different locations at the promoter region
of regulated genes via a C-terminal helix-turn-helix (HTH) motif.
Particularly for FixK2, the consensus DNA binding site is an imper-
fect 14-base pairs palindromic sequence (TTGA/C-N6-T/GCAA,
FixK2 box) [18, 19]. Furthermore, consistent with the FixK2-DNA
complex structure [18], the first solved of an oxygen-responsive
CRP/FNR-type protein, amino acids L195, E196, and R200
within the HTH interact with positions 1, 12, and 3 and 11, respec-
tively, of the FixK2 box at the fixNOQP operon promoter.
 Protein-DNA Interaction Dynamics Determined by SPR 147

Surface plasmon resonance (SPR) is a tool to measure real-time

molecular interactions by detecting changes in the refractive index
of a surface. It is based on the phenomenon which occurs when a
polarized light beam is projected through a prism onto a thin metal
film called the sensor surface [20]. In the Biacore system (the main
supplier of automated SPR), the sensor surface is formed by a small
flow cell through which an aqueous solution, named running
buffer, passes under a continuous flow (1–100 μL/min). For an
interaction assay, one molecule (named ligand) is immobilized on
the sensor surface, and its putative binding partner (named analyte)
is injected in an aqueous solution (running buffer) through the
flow cell under a continuous flow. If there is an interaction between
analyte and ligand, the formation of a complex on the sensor
surface will result in an increase in the refractive index, which can
be translated into a change in response units (RU). Subsequent to
the analyte injection, buffer flow will pass over the surface and
dissociation of the analyte will be monitored, resulting in a decrease
in RU. This technology has been widely used to measure protein-
protein and protein-ligand interactions due to the low quantity of
material needed for an assay (picomolar-to-nanomolar range) and
the easy way of calculating kinetic and affinity constants. However,
the use of SPR in the characterization of DNA-protein interactions
is not so common probably due to (i) the very slow dissociation rate
that used to be out of Biacore measurable range and (ii) the limited
time for the association reaction due to volume limitation in the
injection system [21].
Due to the crucial role of the FixK2 protein in the microoxic-
responsive regulatory network in B. diazoefficiens, we were inter-
ested to further investigate the discriminatory determinants and
dynamics of interaction of this protein with its target genes
[19]. Therefore, we here implemented the SPR methodology
using Biacore with several improvements that avoid the classical
limitations described previously, to analyze real-time protein-DNA
interaction. Thus, we employed a battery of purified FixK2 protein
derivatives and a series of fixNOQP promoter variants harboring
specific mutations within the FixK2 box. We believe that similar
tools can be applied to identify the molecular distinctive features of
other transcription factors involved in the adaptation to the suite of
lifestyles that bacteria must face.

2 Materials

2.1 General 1. Sterile bench.

Equipment and 2. Glassware.
Materials
3. Pipette and tips.
4. Microcentrifuge 1.5 mL tubes.
148 Laura Tomás-Gallardo et al.

5. Centrifuge tubes.
6. Incubators at 16 °C, 30 °C, and 37 °C.
7. French press.
8. Cooling centrifuge.
9. Microcentrifuge.
10. Vortex mixer.
11. Nanodrop.
12. Spectrophotometer and cuvettes.
13. Thermoblock.
14. Protein electrophoresis equipment.
15. pH meter.

2.2 Protein 1. Plasmids pRJ0051, pMB1209, and pMB1211 [19] (see Notes
Expression 1 and 2).
2. Escherichia coli ER2566 competent cells [22, 23] (see Notes 3
and 4).
3. Luria-Bertani medium (LB): dissolve 10 g tryptone, 5 g yeast
extract, and 5 g NaCl (pH 7.0) in 1 L of distilled water. Add
15 g agar for solid medium. Sterilize by autoclaving for 20 min
at 121 °C.
4. 100× Ampicillin (Ap) stock solution: 20 mg/mL in ultrapure
water. Sterilize by filtration.
5. 840 mM isopropyl β-D-1-thiogalactopyranoside (IPTG):
200 mg/mL in ultrapure water. Sterilize by filtration. Keep at
-20 °C.

2.3 Protein 1. Disposable chromatography columns, 10 mL.

Purification 2. Chitin resin: 50% chitin beads in ethanol (New England
Biolabs).
3. Column buffer: 20 mM HEPES pH 8.5, 500 mM NaCl, and
1 mM EDTA.
4. DNase, stock solution: 2 mg/ml in ultrapure water.
5. Cleavage buffer: column buffer supplemented with 50 mM
dithiothreitol (DTT).
6. PD-10 desalting columns (Cytiva).
7. Modified in vitro transcription (mIVT) buffer: 40 mM Tris-
HCl pH 7.0, 150 mM KCl, and 0.1 mM EDTA.
8. Stripping solution: 0.3 N NaOH.
9. 20% ethanol.
 Protein-DNA Interaction Dynamics Determined by SPR 149

2.4 Protein Quality 1. SDS-PAGE stacking minigel (4%): 375 μL of 500 mM Tris-
and Quantity HCl pH 6.8, 910 μL H2O, 200 μL of 30% Acrylamide:Bis-
Determination acrylamide (37.5:1), 15 μL of 10% sodium dodecyl sulfate
(SDS), 30 μL of 10% ammonium persulfate (APS, freshly
prepared, dissolve 100 mg in 1 mL H2O), 1.25 μL of 6.6 M
N,N,N′,N′-tetramethylethylenediamine (TEMED).
2. SDS-PAGE resolving minigel (14%): 1.25 mL of 1.5 M Tris-
HCl pH 8.8, 1.31 mL H2O, 2.34 mL of 30% Acrylamide:Bis-
acrylamide (37.5:1), 50 μL of 10% SDS, 31.25 μL of 10% APS
(freshly prepared), and 2.5 μL of 6.6 M TEMED.
3. SDS-PAGE running buffer: dissolve 3.03 g Tris, 14.41 g gly-
cine, and 1 g SDS in 1 L of distilled water.
4. 2× SDS sample buffer: 0.25 mL 0.5 M Tris-HCl pH 6.8,
0.55 mL H2O, 0.2 mL glycerol, 40 mg SDS, and 15 mg DTT.
5. Protein ladder.
6. Coomassie staining solution: 1 g Coomassie blue R250,
400 mL methanol, 100 mL acetic acid, and 500 mL H2O.
7. Coomassie destaining solution: 250 mL methanol, 100 mL
acetic acid, and 600 mL H2O.
8. Bio-Rad 5× protein quantification reagent.
9. Bovine serum albumin (BSA) stock solution: 2 mg/mL in
ultrapure water.

2.5 Generation of (see Note 5)

Biotinylated Double-
1. fixNOQP parental promoter (the FixK2 box is underlined; Btn,
Stranded Promoter
biotine):
Regions
fixN3-for: 5′-CCACCTATCTTGATTTCAATCAATTCCCC
G-3′,
fixN3-rev-biot: 5′-[Btn]CGGGGAATTGATTGAAATCAA-
GATAGGTGG-3′,
2. fixNOQP mutant promoters (the FixK2 box is underlined,
boldfaced letters correspond to mutated positions; Btn,
biotine):
fixN24-for: 5′-CCACCTATCTTGTTTTCAAACAATTCCCCG-3′,
fixN24-rev-biot: 5′-[Btn]CGGGGAATTGTTTGAAAACAA
GATAGGTGG-3′,
fixN29-for: 5′-CCACCTATCTTGTTTTCAAACAATT
CCCCG-3′,
fixN29-rev-biot: 5′-[Btn]CGGGGAATTGTTTGAAAACAA-
GATAGGTGG-3′,
fixN25-for: 5′-CCACCTATCAACTATTCATAGTTTT
CCCCG-3′,
150 Laura Tomás-Gallardo et al.
2.6 Surface Plasmon
Resonance with
Biacore Technology
(SPR)
3 Methods
3.1 Expression of
Intein-Chitin-Tagged
Proteins
3.1.1 Transformation of
Expression Plasmids into E.
coli ER2566
fixN25-rev-biot: 5′-[Btn]CGGGGAAAACTATGAATAGTT-
GATAGGTGG-3′.
3. Immobilization buffer: 10 mM Tris-HCl pH 7.5, 50 mM
NaCl, and 1 mM EDTA.
The SPR workflow comprises a series of materials and instruments
as shown in Fig. 1:
1. Biotinylated double-stranded promoter regions ( fixNOQP
parental promoter and fixNOQP mutant promoters).
2. Immobilization buffer: 10 mM Tris-HCl pH 7.5, 50 mM
NaCl, and 1 mM EDTA.
3. Sensor chip SA (Cytiva).
4. Pure recombinant proteins C183S FixK2, L195A C183S
FixK2, and R200A C183S FixK2.
5. Biacore X100 equipment (Cytiva).
6. Biacore Evaluation Software (Cytiva).
7. Running buffer: 40 mM Tris-HCl pH 7.0, 150 mM KCl,
0.1 mM EDTA, and 0.005% Tween 20. Filtered and degassed.
8. Conditioning buffer: 1 M NaCl and 50 mM NaOH.
9. Extra wash buffer: 1 M NaCl, 50 mM NaOH, and 50%
isopropanol.
10. Regeneration buffer: 0.2% SDS. Filtered and degassed.
Expression and purification (see Subheading 3.2) of FixK2 protein
variants were performed by the IMPACT™ (Intein-Mediated Puri-
fication with an Affinity Chitin-binding Tag) system. This method-
ology is based on the inducible self-cleavage activity of protein
splicing elements, termed inteins, to separate the target protein
from the affinity tag. As a result of this methodology, non-tagged
proteins without extra vector-encoded amino acids can be
obtained. This methodology comprises fresh transformation of
individual expression plasmids into E. coli ER2566 competent
cells and the optimization of expression settings and protein solu-
bility prior protein purification.
Microbiological methods are performed under aseptic condi-
tions with autoclaved materials at the sterile bench.
1. E. coli ER2566 competent cells were individually transformed
with 10 to 25 ng of plasmids pRJ0051, pMB1209, or
pMB1211 according to a standard procedure [24].
 Protein-DNA Interaction Dynamics Determined by SPR 151

Fig. 1 Surface plasmon resonance assay. (a) Flowchart of protein-DNA interaction assays with the materials
and equipment needed. (b) Classic sensorgram of a binding assay measured with SPR. The assay starts
measuring the response units (RU) of the baseline, i.e., the signal obtained when the ligand and the running
buffer are in contact (1). Then, the analyte is injected and the association rate can be measured (2). If the
equilibrium is reached, we can observe a plateau in the association curve, indicating the saturation of the
ligand (3). When the injection of the analyte ends, the analyte starts to dissociate (4) and the dissociation
constant can be calculated. At the end of the dissociation part, the sensor surface must be regenerated to
eliminate all the analyte that could stay bound to the ligand (5). At the end of the regeneration step, the
baseline must be reached again (6). Loss of signal in the baseline could mean loss of ligand during the
interaction assay

2. 20 μL of each transformation were plated on a LB agar supple-

mented with Ap (200 μg/mL). In parallel, 100 mL Erlenmeyer
flasks containing 20 mL of LB supplemented with Ap were
inoculated with 30 μL of each transformation.
3. Plates and liquid cultures are incubated at 37 °C overnight.
152 Laura Tomás-Gallardo et al.

4. Measure the optical density at 600 nm (OD600) of a 1/10

dilution of the 20 mL overnight cultures.
5. Transfer the cultures to a 50 mL centrifuge tube. Perform four
cycles of washing the cell pellets with LB medium without
antibiotics. Then, resuspend the individual pellets in 2.5 mL
of LB and add 2.5 mL of glycerol.
6. Mix well and distribute the cell suspensions into aliquots for
inoculating 20 and 500 mL cultures of LB at an initial OD600
of 0.02. Preserve the aliquots at -20 °C.

3.1.2 Optimization of (see Note 6).

Conditions for Maximum Within the IMPACT system we employed in our assays, we
Expression and Solubility analyzed the influence of the concentration of IPTG, temperature
of incubation during induction and time of induction on the
expression, and solubility of three FixK2 protein variants: C183S
FixK2, L195A C183S FixK2, and R200A C183S FixK2. Here, we
describe a protocol for optimization of protein expression with two
concentrations of IPTG and two incubation temperatures that can
be extended to a wider spectrum of factors and variables.
1. For each protein variant to analyze, inoculate four cultures of
20 mL in 100 mL Erlenmeyer flasks at an initial OD600 of 0.02.
2. The cultures are incubated at 37 °C until reaching an OD600 of
approximately 0.3. Then, incubate at 30 °C for 60 min until
reaching an OD600 of 0.6–0.8.
3. At that point, take 1 mL aliquots of the individual cultures
before induction of protein expression with IPTG. Centrifuge
the aliquots (13,000 rpm, 2 min in a table top centrifuge) and
keep the pellets on ice.
4. Split the cultures in two series of two: add 0.1 mM IPTG to
one of the series and 1 mM IPTG to the other.
5. Incubate one culture of each condition (0.1 and 1 mM IPTG)
at 30 °C and at 16 °C. Take aliquots of 1 mL of the cultures
incubated at 30 °C at 1, 2, and 4 h. Aliquots of cultures at 16 °
C are taken after 16 h of incubation. All samples are centrifuged
(13,000 rpm, 2 min in a table top centrifuge), and the pellets
are kept on ice.
6. To perform a solubility test, centrifuge the rest of the cultures
(about 16 mL) for 7 min at 5500 ×g. The cell pellets are washed
with column buffer and resuspended in 2 mL of the same
buffer. Cell lysis is performed using a constant pressure of
120 MPa with a French press. Repeat the process 3 times.
Centrifuge for 10 min at 8000 ×g, 4 °C, and keep the soluble
fractions and pellets on ice.
7. Finally, aliquots taken at points 3, 5, and 6 are analyzed on an
SDS-PAGE gel (see Note 7). Expression and solubility of each

3.2 Purification of
Intein-Chitin-Tagged
Proteins
3.2.1 Cells Production for
Protein Overexpression
3.2.2 Protein Purification
Protein-DNA Interaction Dynamics Determined by SPR 153
protein derivative are visualized on the gel after staining with
Coomassie blue. These procedures are performed according to
standard protocols.
Once the optimal conditions for maximal expression of recombi-
nant FixK2 protein derivatives are settled according to Subheading
3.1.2, next steps cover protein-overexpressing cells production,
protein purification, protein quality and quantity determination,
and buffer exchange of protein solutions.
1. Inoculate 500 mL of LB medium in a 2 L flask with E. coli
ER2566 cells containing either of the expression plasmids
pRJ0051, pMB1209, or pMB1211 at an initial OD600 of
0.02. The individual cultures are then incubated at 37 °C,
170 rpm until an OD600 of 0.3 is reached, when they are
further incubated at 30 °C for about 1 h.
2. When the OD600 is about 0.6 to 0.8, protein expression is
induced by adding 0.1 mM IPTG. The cultures are incubated
overnight at 16 °C.
3. Take an aliquot of 1 mL for analysis of protein overexpression
prior protein purification (see Subheading 3.2.2) in Coomassie-
stained SDS-PAGE gels as described in step 7 of
Subheading 3.1.2.
4. Cultures are centrifuged for 7 min at 5500 ×g, and the pellets
are washed with column buffer and subsequently stored at
-20 °C or proceed to purification once protein overexpression
has been verified (see step 3 of this section).
1. Resuspend the cell pellet from 500 mL cultures in 5 mL of
column buffer containing DNase (20 μg/mL).
2. Cell lysis is performed by applying a constant pressure of
120 MPa using a French press. Repeat this process three times.
3. Centrifuge at 8000 ×g for 10 min at 4 °C to eliminate unbro-
ken cells. Then, centrifuge the resulting supernatant again
under the same conditions for 60 min.
4. Dilute the supernatant to a final volume of 50 mL with column
buffer.
5. Prepare the column according to the following procedure,
prior to sample loading: Add 10 mL of 50% chitin resin in
ethanol to an empty chromatography column. The column is
left with a volume of 5 mL of resin. Wash the column with five
column volumes (CV) of H2O, and equilibrate with another
five CV of column buffer.
6. Load the diluted supernatant onto the column at a flow rate of
0.5–1 mL/min.
154 Laura Tomás-Gallardo et al.

7. Wash the column with 20 CV of column buffer.

8. Induce the cleavage of the intein by adding three CV of cleav-
age buffer and allow it to flow until 1 mL of the mixture
remains above the resin. At this point, stop the flow, cap the
column, and incubate at room temperature for 16 h (see
Note 8).
9. After incubation, open the column and elute the protein with
two CV of column buffer, in 1 mL aliquots (11 to 12 aliquots in
total).
10. Chitin columns can be reused for the same protein four to five
times. Therefore, it must be regenerated after each purification
(see Note 9).
11. Monitor shortly protein concentration of each aliquot after
protein elution using a standard protein quantification method
(see Note 10).
12. Analyze the protein fractions of each purification step as well as
the most concentrated elution fractions in Coomassie-stained
SDS-PAGE gels as described in step 7 of Subheading 3.1.2.
13. Combine protein aliquots with highest purity and concentra-
tion for buffer exchange with mIVT buffer using a PD-10
desalting column (see Note 11). Equilibrate the column with
approximately 25 mL of mIVT buffer. Add up to 2.5 mL of
sample and allow it to elute completely through the column.
Add 6 mL of mIVT buffer and collect 12 fractions of 0.5 mL.
14. Monitor shortly the protein elution profile as described in step
11 of this section. Select and combine the most concentrated
fractions and determine protein concentration of the pool.
Measure the absorbance at 595 nm using a spectrophotometer.
Integrate the absorbance values to a calibration curve per-
formed with BSA.
15. Distribute the protein solution in aliquots of 50 to100 μL for a
further use, and store them at -80 °C shortly after flash
freezing in liquid nitrogen.

3.3 Generation of This procedure allows us to generate the double-stranded DNA

Biotinylated Double- probes ready to be immobilized on the sensor chip SA. The sensor
Stranded DNA Probes chip is coated with a thin layer of streptavidin so a biotinylated
molecule can be fixed on it (see Note 5). The protocol is described
in Cabrera et al. [19], and it is essentially as follows:
1. Resuspend primers in the immobilization buffer at a final con-
centration of 100 μM (see Note 12).
2. Mix primers in a ratio 10/1 forward:reverse-biot, leaving the
biotinylated primer at 10 μM.
 Protein-DNA Interaction Dynamics Determined by SPR 155

3. Heat the sample at 100 °C for 10 min in a thermoblock and

allow to cool slowly until 25 °C.
4. Store the probe at -20 °C until use.

3.4 Biotinylated DNA immobilization on the sensor chip is based on biotin-

Promoter streptavidin affinity. The ligand immobilization level depends on
Immobilization the purpose of the binding assay. For a kinetics assay, the maximal
response (Rmax) level must not be higher than 100–500 response
units (RU) (see Note 13). In our experience, a 5 nM dilution of a
30 pb DNA probe in immobilization buffer is optimal. The immo-
bilization was performed in a Biacore X100 equipment at 25 °C
running a custom method described as follows:
1. Wash both flow cells with immobilization buffer during 6 min.
2. Activate both flow cells with 3 consecutive 60 sec injections at
10 μL/min of conditioning buffer.
3. Inject the ligand in the flow cell 2 until calculated Rligand is
reached (see Note 14).
4. Apply an extra wash to both flow cells with extra wash buffer.

3.5 DNA-Protein Once the DNA is bound on the sensor chip, the interaction analysis
Binding Assay can be run. Serial dilutions of the protein are tested in a random
order to obtain kinetic parameters. Prepare serial half dilutions of
the purified protein in the running buffer. Try to test a broad range
of protein concentrations to ensure saturation of the ligand. Test
5–7 protein concentrations plus a zero concentration at the begin-
ning and at the end of the assay.
Run a kinetic/affinity custom wizard with a prime step at the
beginning and at least 7 cycles with the following steps:
1. Inject sample through both cells at 40 μL/min with a contact
time long enough to reach steady state at higher concentra-
tions. For example, start using an association time of 180 s.
2. Stop injection and pass running buffer to measure the dissoci-
ation rate. Start using 300 s of dissociation time and change it if
the dissociation rate cannot be calculated.
3. Regenerate both flow cells with 0.2% SDS during 15 s at
30 μL/min (see Note 15).
Run each cycle with different protein concentration in a ran-
dom order, with at least one duplicate of a low concentration
analyte after a higher concentration.

3.6 Data Analyses Interaction data are analyzed using the Biacore X100 Evaluation
Software (Cytiva). Kinetics constants (Ka, Kd, KD) are calculated,
when possible, by fitting into a 1:1 Langmuir model using double
subtraction, selecting the protein concentration range with an
156 Laura Tomás-Gallardo et al.

accepted fitting to the model (see Note 16). If there is a cycle with
disturbances or a strong deviation from the model, delete it before
kinetic constants calculation.
Parameters including association rate constant (Ka), dissocia-
tion rate constant (Kd), maximum response (Rmax), and mass trans-
fer constants (tc) were fitted globally. A quality control of every
fitted dataset must be done. For that, the following parameters
must be evaluated:
– Check that mass transfer (tc) is higher than 108.
– Closeness of the fit was assessed by chi-square (χ 2). This value
must be lower than 5% of the Rmax value.
– The uniqueness of the calculated rate constants and Rmax is
evaluated by the U-value and it must be lower than 25.
– Analyze the residual’s curve and check that there are no values
higher than 25% of the Rmax.
When kinetic data cannot be assessed as described, the equilib-
rium dissociation constant (KD) is calculated from steady-state
sections of the curves 5 s before analyte injection stops, by using
the affinity wizard tool. For this, the binding reaction must reach
equilibrium. The KD value must be near the half of the analyte
concentration range tested.
The SPR assay and associated methods have been implemented
to characterize the discriminatory determinants of the FixK2 regu-
latory protein of B. diazoefficiens, basically as described by Cabrera
and co-workers [19]. Our protocol allows the study of real-time
protein-DNA interaction affinity and kinetics focused on both
partners, protein variants (Fig. 2) and promoter derivatives (Fig. 3).
The parental FixK2 protein effectively interacted with the FixK2
box at the genuine fixNOQP promoter with an affinity constant
(KD) of 4.4 × 10-9 M and association (Ka) and dissociation (Kd)
constants of 4.9 × 106 M-1 s-1 and 2.1 × 10-2 s-1, respectively
(Fig. 2a; see Note 17), fitting with a kinetics 1:1 binding model
(protein dimer:dsDNA). Alanine replacement of residue L195
resulted in an increase of affinity by two orders of magnitude (KD
of 8.7 × 10-11 M) and a decrease of the Kd (2.1 × 10-3 s-1), leading
to a higher DNA-protein complex stability (Fig. 2b). However, this
protein-specific behavior caused an inhibitory effect on FixK2-
mediated in vitro transcription activation at concentration over
1.25 μM [19], probably due to RNA polymerase blocking
[25]. When R200 in FixK2 was exchanged by alanine, protein-
DNA interaction was severely impaired (Fig. 2c), thus neither
affinity nor kinetics constants could be calculated for this protein
variant. Consequently, this protein derivative turned out to be
inactive both in vitro and in vivo [19].
Fig. 2 Typical assay for FixK2-DNA interaction. (a) Parental FixK2 protein. (b) Effect of mutation L195A or (c)
R200A FixK2 in the interaction with its genuine FixK2 box at the fixNOQP promoter. Sensorgrams showing the
relative response units (RU) of the interaction of the three protein derivatives at different concentrations with
the FixK2 box at the fixNOQP operon promoter. The experiments were repeated at least three times with each
protein variant
158 Laura Tomás-Gallardo et al.

Fig. 3 Mutations at specific positions of the FixK2 box at the fixNOQP promoter
altered FixK2-DNA interaction. (a) Comparison of the interaction of the FixK2
parental protein with the genuine promoter (Pwt), the promoter derivative with
transversion T to A at position 11 (PN24), and the promoter derivative with
transversions T to A and vice versa in positions 4 and 11 (PN29). Promoter N25
with transversions T to A and G to C and vice versa was used as negative control.
Shown are the sensorgrams with the relative response units (RU) of the
interaction at 62.5 μM of protein. (b) Sequence alignment of FixK2 boxes
present at the promoters tested in (a). Specific mutations are depicted in gray.
Data of the PN29 and PN25 promoter variants did not allow us to calculate any
kinetic/affinity parameters. The association and dissociation rates of the PN24
could not be calculated due to being out of range

We also applied SPR to analyze how specific nucleotide posi-

tions within the FixK2 box influence FixK2-DNA interaction
(Fig. 3). A transversion T to A at position 11 (PN24) decreased
protein affinity to bind DNA with a KD of 7.7 × 10-8 M instead of
that of the parental promoter. Also, this mutation provoked an
increase in the dissociation rate as can be deduced through the
fast decay of the RU signal in the dissociation part of the sensor-
gram (the Kd could not be calculated because it was out of the
Biacore range). When a second substitution (transversion A to T at
position 4, PN29) was introduced, no protein-DNA interaction
could be detected, similar to that observed for FixK2 box derivative
harboring nucleotide exchanges at positions 1 to 5 and 10 to
14 (PN25), which was used as negative control in our assays
(Fig. 3).
Taken together, the SPR methodology that we have implemen-
ted for FixK2 can be used as reference for the characterization of
 Protein-DNA Interaction Dynamics Determined by SPR 159

other relevant bacterial transcription factors responding to environ-

mental or intracellular signals, and therefore, this knowledge can be
applied for biotechnological purposes.

4 Notes

1. Plasmids are based on the pTXB1 vector which expresses

recombinant proteins fused in frame to a C-terminal thiol-
cleavable Mycobacterium xenopi (Mxe) GyrA-intein-chitin-
binding domain (CBD) under T7 promoter control (NEB).
Plasmid pRJ0051 encodes a C183S FixK2-intein-CBD deriva-
tive (parental protein). This protein is insensitive to oxidation
and even more active than the genuine FixK2 protein
[26]. Thus, it has been employed as the parental protein and
named as “FixK2.” Plasmid pMB1209 encodes a L195A
C183S FixK2-intein-CBD protein variant with impaired
FixK2 activity in vitro [19]. Plasmid pMB1211 codes for a
R200A C183S FixK2-intein-CBD protein variant which is inac-
tive in vitro [19].
2. FixK2-encoding fragments were obtained by PCR with geneti-
cally engineered NdeI/BcuI restriction sites. The reverse oligo-
nucleotide also contains the coding sequence of the intein
fused in frame with the stop codon-less C-terminal sequence
of the fixK2 gene. This is an alternative strategy to the one
proposed by NEB to produce recombinant proteins without
extra vector-derived amino acids, in which the target gene is
cloned into the NdeI and SapI restriction sites. In order to
improve the yield of the desired plasmid construct, the ligation
reaction is restricted with NheI. During the cloning procedure,
this restriction site is removed from the original pTXB1 vector
and, therefore, absent in the final expression plasmid. Depend-
ing on the insert sequence, it is also possible or not to use other
enzymes such as EcoRI, XhoI, or NotI for the same purpose.
3. The E. coli ER2566 strain is recommended as host strain for the
expression of target genes cloned into IMPACT vectors,
pTXB1 among them. It derives from E. coli BL21 (DE3), a
strain usually employed in the expression of recombinant pro-
teins under the IPTG-inducible T7 promoter. There are certain
differences between the genome of the E. coli ER2566 strain
and of that of the E. coli BL21 (DE3) strain [22, 23] that result
in an increased resistance to stresses and improved character-
istics for a better yield of soluble recombinant proteins at low
temperature induction in the case of the former.
4. Chemically competent E. coli ER2566 cells were prepared
using the rubidium chloride methodology [27].
160 Laura Tomás-Gallardo et al.

5. Complementary primers comprising a 30 nucleotides region

containing the transcription factor binding site in the centre
must be designed. One of the primers must have a biotin in the
5′ end. In our experiments, we used the promoter of the
fixNOQP operon encoding the high-affinity cbb3 terminal oxi-
dase required for bacterial respiration inside root nodules. This
promoter contains the FixK2 box considered as a prototype to
study FixK2-DNA interaction [19]. The FixK2-DNA complex
crystal structure [18] in combination with previous studies
[19] allowed us to select specific nucleotide residues within
the FixK2 box at the fixNOQP promoter for a functional analy-
sis and their influence in protein-DNA interaction. In particu-
lar, we introduced the following mutation: (i) a transversion T
to A in position 11, one of the nucleotides that interact with
R200 in FixK2 (promoter N24); (ii) transversion T to A and
vice versa in positions 4 and 11, to analyze the influence of
palindromy (promoter N29); and (iii) transversions T to A and
G to C and vice versa in positions 1 to 5 and 10 to 14 of the
FixK2 box (promoter N25), employed as negative control in
the assays [19].
6. Optimal production of recombinant proteins in terms of yield
and solubility depends on a series of parameters that have to be
analyzed for each protein derivative before defining a specific
protocol for cell culturing for protein purification. For proteins
that tend to form inclusion bodies, it is recommended to slow
down the expression process by reducing the culture tempera-
ture. To achieve this, before adding the IPTG inducer, the
cultures should be cooled to 16 °C. Once cooled, add the
inducer and let the culture grow overnight. On the contrary,
for unstable proteins, it is recommended to speed up the
expression process by performing it completely at 37 °C and
not delaying induction for more than 1 h.
7. For the analysis of protein expression in SDS-PAGE gels, cell
pellets are resuspended in 1X SDS sample buffer (100 μL per
mL of a culture of OD600 of 1). After protein fractionation,
soluble lysates are mixed with an equal volume of 2X SDS
sample buffer. Small aliquots of the insoluble lysates are resus-
pended in 100 μL of 1X SDS sample buffer. Samples are boiled
at 98 °C for 5 min and centrifuged (13,000 rpm, 2 min in a
table top centrifuge) prior loading onto an SDS-PAGE gel. The
remaining volume of samples can be stored at -20 °C for
further analyses, if necessary.
8. The conditions of the DTT-induced cleavage of the intein
domain depend on the target residue and the incubation tem-
perature. It is recommended to consult the resin instruction
manual to achieve optimal purification results.
 Protein-DNA Interaction Dynamics Determined by SPR 161

9. To regenerate chitin columns, wash them with 15 mL of strip-

ping solution. Let the column be soaked in stripping solution
for 30 min and finally rinsed with 100 mL of H2O. Columns
are stored at 4 °C in 20% ethanol for future use. This process is
important to maintain the column performance and avoid
contamination between protein purifications.
10. It is very important to check that the buffer used in protein
purification is compatible with the method selected for the
quantification of the protein concentration. We suggest the
Bio-Rad protein assay that is an easy colorimetric test for
measuring total protein concentration. It is based on the Brad-
ford dye-binding method [28], in which the color of Coomas-
sie brilliant blue G-250 dye changes in function of protein
concentration (the dye binds to essentially basic and aromatic
amino acid residues).
11. Each assay has specific buffer conditions in order to achieve an
optimal activity. In the case of SPR experiments, we employed
mIVT buffer, which has been successfully used for protein-
DNA complex formation in crystallization trials [18]. There-
fore, the buffer of proteins after protein purification is
exchanged to mIVT buffer by using PD-10 columns that
contain Sephadex G-25 M according to the manufacturer
instructions.
12. All the buffers and reagents used must be filtered through at
least 0.45 μm pore diameter.
13. Immobilization of too much ligand can lead to mass transfer
limitation and non-Langmuir kinetics due to steric hindrance.
According to the Rmax level, the amount of ligand to immobi-
lize (Rligand) can be calculated with the following formula
(Mr is the molecular mass in Da): Rligand = (Mrli-
gand × Rmax)/(Mranalyte × Valencyligand). In a 1:1 Langmuir
model, the valency of the ligand is 1.
14. For the Rmax calculation, if your analyte forms an oligomer, the
Mranalyte must be the mass of the oligomer.
15. The regeneration must be harsh enough to wash the remaining
analyte but soft enough to not damage the ligand. In a
DNA-protein interaction, SDS 0.2% is recommended as the
regeneration buffer in most of the cases.
16. Before fitting to a specific binding model, it is necessary to have
an idea about the binding model of your biological system.
Biacore data does not answer which type of interaction fits with
your biological system; the biological system is supported by
the Biacore data. Real life is complex and does not always fit a
simple model.
162 Laura Tomás-Gallardo et al.

17. Similar affinity and kinetics profiles of FixK2-DNA interaction

were observed for the protein derivative with a C-terminal
histidine tag, which was employed for FixK2 crystallization in
complex with the fixNOQP promoter [18].

Acknowledgments

This work was financially supported by grants AGL2015-63651-P

and PID2020-114330GB-100 funded by MCIN/AEI/
10.13039/501100011033 and by “ERDF A way of making Eur-
ope.” Grant P18-RT-1401 (PAIDI2020) and continuous support
to group BIO-275 (Junta de Andalucı́a, Spain) are also
acknowledged.

References

1. Galloway JN, Townsend AR, Erisman JW et al
(2008) Transformation of the nitrogencycle:
recent trends, questions, and potential solu-
tions. Science 320:889–892
2. Galloway JN, Leach AM, Bleeker A, Erisman
JW (2013) A chronology of human under-
standing of the nitrogen cycle. Philos Trans R
Soc Lond Ser B Biol Sci 368:20130120
3. Martı́nez-Espinosa RM, Cole JA, Richardson
DJ, Watmough NJ (2011) Enzymology and
ecology of the nitrogen cycle. Biochem Soc
Trans 39:175–178
4. Sprent JI, Ardley J, James EK (2017) Biogeog-
raphy of nodulated legumes and their
nitrogen-fixing symbionts. New Phytol 215:
40–56
5. Dixon R, Kahn D (2004) Genetic regulation of
biological nitrogen fixation. Nat Rev Microbiol
2:621–631
6. Terpolilli JJ, Hood GA, Poole PS (2012) What
determines the efficiency of N2-fixing Rhizo-
bium-legume symbioses? Adv Microb Physiol
60:325–389
7. Poole P, Ramachandran V, Terpolilli J (2018)
Rhizobia: from saprophytes to endosymbionts.
Nat Rev Microbiol 16:291–303
8. Torres MJ, Simon J, Rowley G et al (2016)
Nitrous oxide metabolism in nitrate-reducing
bacteria: physiology and regulatory mechan-
isms. Adv Microb Physiol 68:353–432
9. Rutten PJ, Poole PS (2019) Oxygen regulatory
mechanisms of nitrogen fixation in rhizobia.
Adv Microb Physiol 75:325–389
10. Santos MS, Nogueira MA, Hungria M (2019)
Microbial inoculants: reviewing the past, dis-
cussing the present and previewing an
outstanding future for the use of beneficial
bacteria in agriculture. AMB Express 9:205
11. Delamuta JRM, Ribeiro RA, Ormeño-Orrillo
E et al (2013) Polyphasic evidence supporting
the reclassification of Bradyrhizobium japoni-
cum group Ia strains as Bradyrhizobium dia-
zoefficiens sp. nov. Int J Syst Evol Microbiol
63:3342–3351
12. Sciotti M-A, Chanfon A, Hennecke H, Fischer
H-M (2003) Disparate oxygen responsiveness
of two regulatory cascades that control expres-
sion of symbiotic genes in Bradyrhizobium
japonicum. J Bacteriol 185:5639–5642
13. Fernández N, Cabrera JJ, Salazar S et al (2016)
Molecular determinants of negative regulation
of the Bradyrhizobium diazoefficiens transcrip-
tion factor FixK2. In: González-Andrés F,
James E (eds) Biological nitrogen fixation and
beneficial plant-microbe interaction. Springer,
Cham, pp 57–72
14. Mesa S, Hauser F, Friberg M et al (2008)
Comprehensive assessment of the regulons
controlled by the FixLJ-FixK2-FixK1 cascade
in Bradyrhizobium japonicum. J Bacteriol
190:6568–6579
15. Körner H, Sofia HJ, Zumft WG (2003) Phy-
logeny of the bacterial superfamily of Crp-Fnr
transcription regulators: exploiting the meta-
bolic spectrum by controlling alternative gene
programs. FEMS Microbiol Rev 27:559–592
16. Dufour YS, Kiley PJ, Donohue TJ (2010)
Reconstruction of the core and extended reg-
ulons of global transcription factors. PLoS
Genet 6:e1001027
17. Matsui M, Tomita M, Kanai A (2013) Com-
prehensive computational analysis of bacterial
CRP/FNR superfamily and its target motifs
 Protein-DNA Interaction Dynamics Determined by SPR
reveals stepwise evolution of transcriptional
networks. Genome Biol Evol 5:267–282
18. Bonnet M, Kurz M, Mesa S et al (2013) The
structure of Bradyrhizobium japonicum tran-
scription factor FixK2 unveils sites of DNA
binding and oxidation. J Biol Chem 288:
14238–14246
19. Cabrera JJ, Jiménez-Leiva A, Tomás-Gallardo
L et al (2021) Dissection of FixK2protein-
DNA interaction unveils new insights into Bra-
dyrhizobium diazoefficiens lifestyles control.
Environ Microbiol 23:6194–6209
20. Majka J, Speck C (2007) Analysis of protein-
DNA interactions using surface plasmon reso-
nance. Adv Biochem Eng Biotechnol 104:13–
36
21. Wang S, Poon GMK, Wilson WD (2015)
Quantitative investigation of protein-nucleic
acid interactions by biosensor surface plasmon
resonance. Methods Mol Biol 1334:313–332
22. Zhou L, Yu H, Wang K et al (2020) Genome
re-sequencing and reannotation of the Escher-
ichia coli ER2566 strain and transcriptome
sequencing under overexpression conditions.
BMC Genomics 21:407
163
23. Zhou L, Ma Y, Wang K et al (2023) Omics-
guided bacterial engineering of Escherichia coli
ER2566 for recombinant protein expression.
Appl Microbiol Biotechnol 107:853–865
24. Rodrı́guez RL, Tait RC (1983) Recombinant
DNA techniques: An introduction. Addison-
Wesley, Reading, MA
25. Jensen D, Manzano AR, Rammohan J et al
(2019) CarD and RbpA modify the kinetics of
initial transcription and slow promoter escape
of the Mycobacterium tuberculosis RNA poly-
merase. Nucleic Acids Res 47:6685–6698
26. Parejo S, Cabrera JJ, Jiménez-Leiva A et al
(2022) Fine-tuning modulation of oxidation-
mediated posttranslational control of Bradyrhi-
zobium diazoefficiens FixK2 transcription factor.
Int J Mol Sci 23:5117
27. Hanahan D (1983) Studies on transformation
of Escherichia coli with plasmids. J Mol Biol
166:557–580
28. Bradford MM (1976) A rapid and sensitive
method for the quantitation of microgram
quantities of protein utilizing the principle of
protein-dye binding. Anal Biochem 72:248–
254
 Chapter 11

Microscope Subcellular Localization of Plant-Interacting

Bacterial Effectors in Animal Cell Cultures
Irene Jiménez-Guerrero, Francisco Javier López-Baena,
and Carlos Medina

Abstract
Eukaryote-interacting bacteria have developed along the evolution of an arsenal of tools to interact with
potential hosts and to evade their defensive responses. Among these tools, the effector proteins are gaining
a special importance due to the high diversity of molecular actions that they play in the host cell, with the
final aim of taking the control over the cell. Bacteria inject these effectors into the cytosol of the host cells
through distinct ways, as the type III secretion system. The study of the effectors’ molecular roles inside the
host cell is challenging, due in part to the lack of traceability of such proteins once they are delivered by the
bacteria. Here, we describe in depth a methodology that combines the increase of the bacterial effector
concentration by protein expression systems with the use of heterologous hosts to facilitate the visualization
of the subcellular targeting of the effector inside the host cell by fluorescence microscopy.

Key words Type III secretion system, Type III-secreted effector, Bacterial effector, Heterologous
expression system, Effectors’ transfection, Bacterial lysis, Fluorescence microscopy, Salmonella,
Salicylate

1 Introduction

From the emergence of the eukaryotic life forms, bacteria have

evolved numerous tools to interact with them in different ways,
behaving as commensals, pathogens, or symbionts later in the
evolution. These interactions were first epibiotic, becoming to
endobiotic when the bacteria found the way to penetrate the sur-
face of such eukaryotes. As an evolutionary race, the eukaryotes
hosts have developed defenses against bacterial invaders that, in
turn, were raising strategies to counterattack their possible hosts.
In this sense, the protein effectors are considered one of the most
important weapons of eukaryote-interacting bacteria [1, 2]. Bacte-
rial effectors are proteins delivered by bacteria directly to the cyto-
sol of the host cells via type III, IV, or VI secretion systems, which

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_11,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

165
166 Irene Jiménez-Guerrero et al.

are collectively known as injectosomes, because their structure and

function are reminiscent of a syringe injecting proteins through
external barriers [2–5]. Thus, once inside the eukaryotic cytosol,
bacterial effectors can induce their transport to specific subcellular
compartments to manipulate different cell targets, interfering many
cellular processes and hampering the defensive responses of the
host, what finally can lead to a bacterial invasion. The molecular
role of the effectors is, therefore, not easy to describe, since the low
and local concentration at which they act inside the host cell usually
hinders their study. In addition, the absence of information about
the subcellular targeting of unknown effectors makes even more
difficult their characterization.
Several microscopic approaches have been developed to dem-
onstrate translocation and localization of bacterial effectors within
single host cells [6]. Even though that host-interacting bacteria
have developed effectors adapted to their natural hosts, the use of
easy-to-handle heterologous hosts has proven to be an excellent
tool to contribute to the study of the molecular functioning of the
effectors. In the specific case of plant-soil interacting bacteria,
agroinfiltration mediated by Agrobacterium tumefaciens in tobacco
leaves has been broadly used to achieve transient expression of
heterologous proteins in plant hosts [7]. Nevertheless, animal
cells have also been tested as heterologous hosts for plant-
interacting bacteria due to the striking parallels between their
in-host lifestyles with animal-interacting bacteria [8, 9].
Our research group have recently described the use of Salmo-
nella infecting HeLa cells to complement the study of the subcel-
lular localization of a rhizobial effector [10]. One of the reasons of
choosing this heterologous system is the possibility of using protein
overexpression systems to cope with the low concentration of
effectors inside the host cells. Therefore, we have harnessed the
potential of the salicylate-inducible protein expression system,
which our group has previously published for different applications
[11–18]. This system combines regulatory elements from Pseudo-
monas putida that respond to variable concentrations of salicylate,
which, working in cascade, magnifies the concentration of a protein
encoding gene (i.e., an effector). Briefly, the system consists on a
regulatory module (integrated in the chromosome of Salmonella)
composed by two divergent promoters, Pnah and Psal, which
control the expression of two regulators NahR and XylS2, respec-
tively. NahR, constitutively expressed, binds salicylate promoting
both, its own expression from Pnah and XylS2 transcription from
Psal, which also binds salicylate and triggers transcription from a
third promoter named Pm. The system is completed with an
expression module harbored in a plasmid that contains a gene of
interest (i.e., coding for the production of an effector) cloned
downstream of the Pm promoter. The system, upon salicylate
addition, induces a cascade of regulators that concludes in the
 Subcellular Localization of Bacterial Effectors 167

production of a high amount of protein (the effector in this case)

due to the synergic actuation of regulators (Fig. 1a) [18, 19].
In parallel, we have designed an anhydrotetracycline (AHT)-
inducible lysis system, based on lambda phage lysis mechanism to
release the content of Salmonella, in free living condition or in the
cytosol of a Salmonella-infected eukaryotic cell [16, 20]. This sys-
tem combines the AHT-inducible tet promoter, with the lambda
lysis gene cluster SRRz, whose expression derives in the degrada-
tion of the peptidoglycan and the disruption of the bacterial mem-
brane (Fig. 1a) [21, 22]. Following internalization of host cell,
Salmonella replicates inside a vacuole, known as Salmonella-con-
taining vacuole (SCV), a structure whose integrity is maintained by
the action of the SifA protein. Therefore, bacteria carrying a muta-
tion in this gene are released into the host cell cytosol several hours
after internalization [23]. This feature, in combination with the
lysis system (triggered by AHT) and with the salicylate-induced
expression system, allows the massive production of an effector
and its delivery directly into the eukaryotic cytosol from the “Sal-
monella factory” (Fig.1b). With this complex system, we have used
the Salmonella factory to overproduce the rhizobial effector NopL
tagged with the HA epitope (NopL-HA) and release it into the
cytosol of HeLa cells. Finally, we have used immunodetection to
visualize its subcellular targeting by confocal fluorescence
microscopy.
Furthermore, we have complemented this methodology with a
conventional transient expression experiment in transfected HeLa
cells, mediated by inducible eukaryotic vectors, encoding the effec-
tors fused to a fluorescent protein. This technology has been previ-
ously used to analyze the role of a single pathogen effector on host
cells to avoid the masking of its effect when other effectors are
present in a conventional infection experiment [24]. Here we have
cloned NopL encoding gene to the C-terminus of the Venus green-
fluorescent protein [Venus-NopL] in a pcDNA 5/FRT/TO deriv-
ative. This vector bears a hybrid promoter composed by a fragment
from the Cytomegalovirus promoter (PCMV) fused to the tetracy-
cline operator (TetO2), which makes it responsive to AHT. Down-
stream this sequence, the vector includes a multiple cloning site to
clone the DNA coding sequence of a desired protein to express
(in this case the effector) in frame with Venus C-termini. In brief,
we have overproduced on transfected HeLa cells the Venus-NopL
construction directly from a eukaryotic promoter using AHT as
inducer and track its subcellular destiny by epifluorescence micros-
copy. Finally, we have analyzed the cell cycle of the cell population
to check if the expression of the effector exerted any effect on the
cell cycle progression.
In summary, here we describe in depth the methodology of two
complementary molecular techniques to find the subcellular loca-
tion of an effector in a eukaryotic cell.
168 Irene Jiménez-Guerrero et al.

Fig. 1 Protein production induced by salicylate in Salmonella. (a) Regulatory and expression modules induce a
high concentration of desired protein upon salicylate induction. Anhydrotetracycline triggers bacterial lysis
through the production of holin, endolysin, and spanin from the λ phage. (b) Protein release to the host cell
following bacterial lysis

2 Materials

Standard equipment in microbiology is required, including laminar

flow hoods, autoclave, pipets, microcentrifuge tubes, Petri plates,
shakers, static incubators, spectrophotometer, etc.. . . Additionally,
since protocols detailed below include the handling of eukaryotic
cells, other materials are required as a security flow hood, pipettors,
plastic disposable pipettes, multi-wells plates, CO2 incubator, vac-
uum pump connected to an Erlenmeyer flask, and other conven-
tional equipment used conventionally for cell biology.

2.1 Bacteria, Cell 1. Salmonella strains (i.e., Salmonella enterica serovartyphimur-

Handling, and iumMPO386 [14028ΔsifAΔtrg::(nahR/Psal–xylS2–nasR/
Infection Conditions Km); KmR[16]and tumoral cell lines (i.e., HeLa cells).
2. Plasmid vectors are listed in Table 1.
 Subcellular Localization of Bacterial Effectors 169

Table 1
Vectors used

Plasmid name Characteristics Reference

pMPO1617 Expression vector with rrnBT1T2-Pm-T7 SD sequence-MCSII- [10]
NopL-HA epitope encoding sequence, ColE1 replication
origin; ApR (salicylate inducible)
pMPO1631 pWSK29-derived plasmid with Pbla-tetR (no lysis plasmid); CmR [16]
(AHT inducible)
pMPO1632 pWSK29-derived plasmid with Pm-SRRz and PblatetR (lysis [16]
plasmid); CmR(AHT inducible)
pcDNA5/FRT/TO- pcDNA5/FRT/TO backbone with Venus YFP-3xFlag inserted via Addgene
Venus-Flag (865) BstXI-XhoI sites; ApR (AHT inducible)
pMPO1643 pcDNA5/FRT/TO with fusion Venus-NopL; ApR (AHT [10]
inducible)

3. Luria-Bertani (LB) medium: 10 g/L Bactotryptone, 5 g/L

yeast extract, and 5 g/L NaCl. Add 15 g/L of agar for solid
media.
4. Commercial Dulbecco’s Modified Eagle’s Medium (DMEM):
This medium must be supplemented with 10% fetal calf serum
(FCS; complement previously heat-inactivated), 2 mM L-glu-
tamine, and a commercial mixture of antibiotics penicillin and
streptomycin 100× (see Note 1).
5. Cells should be cultivated in a determined plate size that allows
the growth of the appropriate number of cells for each technic.
The relation between the number of cells and the surface of the
plate is detailed for each application in further sections.
6. Phosphate-saline buffer (PBS 1×): 8 g/L NaCl, 0.201 g/
LKCl, 1.42 g/L Na2HPO4, and 0.272 g/L KH2PO4. Adjust
pH to 7.4.
7. Earle’s balanced salt solution (EBSS commercial).
8. Gentamicin sulfate solutions: Dilute a commercial stock of
10 mg/mL in DMEM to prepare 100 μg/mL and 16 μg/mL
solutions.
9. Expression induction solution: 0.1 M sodium salicylate
(16.01 mg/mL in bi-distilled water) and sterilize by filtration.
Keep aliquots protected from light at 4 °C.
10. Anhydrotetracycline solution (AHT): Commercially acquired
at 2 mg/mL. Dilute to 20 μg/mL in ultrapure ethanol to
achieve a 100× stock.
11. Trypsin: Dilute commercial trypsin (2.5×) tenfold in PBS 1×
and store in 10 mL aliquots. In some applications, trypsin can
be supplemented with EDTA (20 μL EDTA 0.5 M in 10 mL
170 Irene Jiménez-Guerrero et al.

0.25× trypsin) to disaggregate efficiently cells clamps (see

Note 2).
12. Triton X-100.
13. Neubauer chamber or similar.

2.2 Protein 1. Formalin 3.7%: Dilute commercial formalin (usually at 37%)

Immunodetection 10× in PBS 1×.
2. PBT: 0.1% Triton X-100 in PBS 1×.
3. Blocking buffer: PBT complemented with 3–7% FCS (see
Note 3).
4. Anti-HA primary antibody. For antibodies use, follow manu-
facturers’ recommendations (see Note 4).
5. Fluorescent secondary antibody (see Note 5).
6. Nuclei staining solution: 1 mg/mL DAPI dye (4′,6-Diami-
dino-2-phenylindole) (or Hoechst bisbenzimida) in distilled
water and dilute 1:1000 directly into the sample for nuclei
staining.
7. Mounting media: 50% glycerol, 50% PBS 1×.
8. Round coverslips and slides (optional).
9. Epifluorescence or confocal microscope.

2.3 Cell Transfection 1. Opti-MEM-reduced serum medium.

2. Lipofectamine.
3. Anhydrotetracycline solution (AHT): Commercial stock
2 mg/mL (see Note 6).

2.4 Cell Cycle 1. Ethanol solution: 80% ethanol analytical grade in PBS 1×.
Analysis 2. PBS-BSA solution: 0.1% of bovine serum albumin into PBS 1×.
3. Extraction solution: Dissolve 0.21 g citric acid in 10 mL
H2O. Separately, dissolve 14.32 g Na2HPO4·12 H2O in
200 mL distilled water. To prepare properly, remove 8 mL of
Na2HPO4 solution and replace with 8 mL of citric acid solu-
tion and adjust pH to 7.8 (see Note 7).
4. Staining solution: 100 μg/mL RNAse, 0.1% Triton X-100,
0.1 mM EDTA pH 8, and 40 μg/mL dissolved in PBS 1X.
Protect from light and discard after use.
5. Trypsin 1X-EDTA (see step 2 in Subheading 2.1).
6. 70 μm nylon filters.
7. Flow cytometer and cytometer tubes.
 Subcellular Localization of Bacterial Effectors 171

3 Methods

The optimum growing temperature for Salmonella is 37 °C, and

they are usually cultivated aerobically at 180 rpm. HeLa cells are
also incubated at 37 °C in DMEM media at an atmosphere of 5%
CO2. Therefore, carry out all experiments under these conditions.

3.1 Detection of In this section, we detail a method employed for the subcellular
Effectors microscope localization of an effector in HeLa cells when the
Overproduced and effector is overproduced by intracellular bacteria (Salmonella) and
Released from released into the cell cytosol when the bacteria is lysed.
Salmonella in HeLa
Cells

3.1.1 Infection of HeLa
Cells and Effector Protein
Induction
1. To infect properly the HeLa cells, Salmonella must be added to
the culture at early stationary phase. The day before the infec-
tion, inoculate a 5 mL culture of Salmonella strains and grow
overnight in LB medium supplemented with antibiotics when
necessary.
2. The same day, detach previously cultured HeLa cells with
0.25× trypsin and count cells in a Neubauer chamber.
3. Prepare a suspension in fresh DMEM medium containing anti-
biotics adjusting the number of cells to 2 × 105 or 105 for wells
of 1 cm diameter (24 wells plates) in 1 or 2 mL to follow the
infection during 24 or 48 h, respectively. Cells must be plated
around 20 h before the infection to avoid cell division and
maintain its number constant until the infection. In different
applications, the density of the cell culture in the plate and the
duration of the experiment are variable.
4. On the day of the infection, dilute Salmonella culture (1:33) in
3 mL of LB medium, and incubate for 3 h and 30 min. The
eukaryotic cells must be washed twice with PBS and equili-
brated with EBSS buffer 30 min before the infection.
5. Add bacteria to the plate containing cells at a desired multiplic-
ity of infection (M.O.I.). In most applications, it is used a 100:
1 M.O.I., which can be increased to 250–500:1, or reduced to
50:1 depending on the experiment. A higher M.O.I. leads to a
greater number of infected cells, what is suitable in applications
where the expected effect of the protein produced is not easy to
detect (see Note 8).
6. Incubate cells with bacteria for 20 min to allow bacterial inva-
sion. Remove the medium by aspiration and wash twice with
PBS to eliminate extracellular bacteria (see Note 9).
7. Remove PBS, substitute it by DMEM containing 100 μg/mL
gentamicin to kill extracellular bacteria, and incubate for 1 h.
172 Irene Jiménez-Guerrero et al.
3.1.2 Controlled
Autolysis of Intracellular
Bacteria
3.1.3 Detection of The proteins released from the bacteria (effectors overproduced
Released Proteins by among them) can be detected in the cytosol or any other compart-
Immunofluorescence ment of eukaryotic cell by immunofluorescence (see Note 10).
Remove media by aspiration, wash twice with PBS, and add
DMEM containing 16 μg/mL gentamicin. The infected cul-
ture can be tracked the time necessary for the visualization or
accumulation of the effector; however, 24 or 48 h should be
enough to detect it.
8. Add expression induction solution (2 mM salicylate)per well
and incubate a minimum of 4 h to induce the cascade system
and the effector protein (NopL in our case). Salicylate must be
added to the cell culture once the infection is established
(usually at the same time when the amount of gentamicin is
reduced to 16 μg/mL).
9. If the effector is fused to a fluorescent reporter (optional), it
can be pre-visualized by fluorescence microscopy, and the sig-
nal should be inside the bacteria.
1. Allow the protein production as long as necessary, and subse-
quently induce bacterial lysis adding 0.2 μg/mL of AHT.
2. Incubate for a minimum of 10 h to ensure that most bacteria
are lysed.
3. If quantification of survivor intracellular bacteria (gentamicin-
protected) is needed, wash three times the eukaryotic cells with
PBS and gently lyse with 0.1% Triton X-100 for 10 min. Dif-
ferent dilution series (101–105) should be plated on LB agar
and count the number of colonies after 24 h incubation at 37 °
C.
4. Alternatively, cells can be treated for immunofluorescence (see
Subheading 3.1.3).
1. Wash cells with PBS and fix with formalin 3.7% for 30 min at
room temperature (R.T.) (see Note 11).
2. Permeabilize membranes washing 5 min with PBT and block
membrane receptors with blocking buffer 45 min at 37 °C.
3. Incubate the sample with primary antibody diluted in blocking
buffer (following the manufacturers’ recommendations) for
90 min at R.T.
4. Wash three times with PBT 10 min each time.
5. Add fluorescent secondary antibody diluted in PBS (following
manufacturers recommendations) and incubate 90 min at
R.T. in darkness.
6. Stain cellular nuclei and actin filaments with DAPI staining
solution (1 μg/mL final concentration) and rhodamine-labeled
 Subcellular Localization of Bacterial Effectors 173

Fig. 2 NopL production and release into HeLa cells cytosol and accumulated in
nucleus. HeLa cell cultures were infected with Salmonella sifA- mutants bearing
NopL fused to HA epitope (pMPO1617) expression and control (pMPO1631) or
lysis plasmid (pMPO1632). NopL was overproduced upon salicylate induction for
4 h, and the content of the bacteria was released (right panel) or not (left panel)
in HeLa cytosol following an AHT induction. HeLa cell nuclei were stained with
Hoechst (blue) and actin filaments (red) with rhodamine phalloidin. Anti-HA
epitope antibody was immunodetected (green). White bars are scaled to
10 μm. This figure is reproduced from Jimenez-Guerrero et al. (2023) [10]
with the permission of the publisher (MDPI)

phalloidin (1:100 diluted) respectively for 15 min at

R.T. keeping sample protected from the light (see Note 12).
7. Wash four times with PBT at R.T. and place the coverslip
(if used) upside-down in a slide containing mounting medium.
8. Use an inverted epifluorescence or a confocal microscope to
analyze if the fluorochrome-conjugated secondary antibody is
detected outside the bacteria, in the eukaryotic cytoplasm or
any subcellular compartment (Fig. 2).

3.2 Detection of In this section, we detail a method employed for the subcellular
Effectors in microscope localization of an effector in HeLa cells transfected with
Transfected HeLa Cells inducible eukaryotic vectors encoding effectors fused to fluorescent
proteins (Venus-Nop L in our case). Take into consideration that
some incubations in Opti-MEM medium will be carried out in this
section.

3.2.1 Transfection of 1. Seed cells into DMEM containing 5% FBS and 2 mM gluta-
HeLa Cells and Effector mine but without antibiotics. Seed 104 to 2.5 × 104 cells/cm2
Protein Induction such that cells are 70–90% confluent next day (see Notes 13 and
14).
2. Prepare transfection master mix as detailed in following steps
(see Note 15).
3. Prepare tube 1: 117 μL Opti-MEM medium +1–2 μg ADN
(control vector or with effector). Prepare tube 2: 117 μL Opti-
MEM medium +2.5–5 μL lipofectamine.
174 Irene Jiménez-Guerrero et al.

Fig. 3 Venus-NopL transient expression in HeLa cells. HeLa cells were transfected with pcDNA5/FRT/TO-
Venus-Flag (865) control plasmid (upper panels) or with pMPO1643 containing a Venus-NopL fusion (bottom
panels). The Venus reporter gene with or without NopL was expressed from pCMV-TetO2 promoter upon AHT
induction. After 24 h, the green fluorescence was concentrated in nuclear dots in Venus-NopL, while in the
control vector, it was spread throughout the whole cell. White arrows indicate nuclei borders, and yellow
arrowheads show the location of nucleolus. Columns correspond to GFP, phase contrast, and the merge. White
bars are scaled to 25 μm. This figure is reproduced from Jimenez-Guerrero et al. (2023) [10] with the
permission of the publisher (MDPI)

4. Incubate both tubes for 5 min at R.T.

5. Bind the content of both tubes in one (approx. volume 240 μL)
and incubate 30 min at R.T.
6. During the incubation of step 5, wash the cells twice with PBS
and add 930 μL Opti-MEM medium to each well.
7. Add the lipofectamine-DNA mix from step 5 after the 30 min
incubation, to the wells (approx. volume 1170 μL), and incu-
bate the cells at 37 °C from 6 h to overnight (see Note 16).
8. Rinse cells with PBS and add DMEM5% FBS without antibio-
tics supplemented with a final concentration of 20 ng/mL
anhydrotetracycline to induce the expression of the effector
protein.
9. Incubate cells at 37 °C for at least 4 h and check the fluores-
cence in an epifluorescence microscope.
10. The expression and subcellular location of the effector can be
tracked until 72 h after the induction (Fig. 3).

3.2.2 Cell Cycle Analysis If desired, the culture can be analyzed to check if the expression of
in Flow Cytometer the effector affects the progression of HeLa cell cycle.
1. Recover the DMEM medium with floating cells and transfer it
to a clean 10 mL tube (see Note 17).
 Subcellular Localization of Bacterial Effectors 175

2. Wash plates once with 500 μL of PBS, recover PBS, and mix it
with the medium recovered in step 1.
3. Add 500 μL of trypsin 1X-EDTA to harvest cells and incubate
4–5 min (see Note 18) at 37 °C.
4. Neutralize the reaction with the medium plus PBS mix previ-
ously recovered (see steps 1 and 2) and homogenize cells
pipetting carefully.
5. Centrifuge tubes at 0.5 ×g for 5 min aspirating supernatant
afterwards.
6. Carefully resuspend cells by flicking the tubes few times and
wash with cold PBS centrifuging as above.
7. Resuspend the pellet in 100 μL of cold PBS and fix with 900 μL
of cold ethanol solution drop by drop while shacking in vortex
at 1500 rpm. Keep at -20 °C at least 24 h before analyzing (see
Note 19).
8. Transfer the content of the tube to a clean 1.5 mL tube and use
a refrigerated microcentrifuge for the following steps (see
Note 20).
9. Centrifuge the cell suspension at 0.5 ×g for 5 min and remove
ethanol of the supernatant by aspiration (see Note 21).
10. Wash twice with 500 μL of cold PBS-BSA solution by centrifu-
gation and aspiration.
11. Incubate with 400 μL of extraction solution (see step 3 in
Subheading 2.4) for 5 min at R.T. (see Note 22).
12. Remove liquid by aspiration and incubate sample with 700 μL
of staining solution (see step 4 in Subheading 2.4) for 30 min at
37 °C protecting it from light.
13. Homogenize and filtrate sample trough a 70 μm nylon filter
directly over cytometer tubes.
14. Proceed to the flow cytometry keeping low the acquisition
velocity (200 events/s) (see Note 23).

4 Notes

1. During the infection process, penicillin-streptomycin must not

be used.
2. Commercial trypsin is supplied at 2.5× and when diluted ten-
fold, its final concentration is 0.25×. This diluted stock is
usually named as trypsin 1× in most laboratories.
3. The percentage of FCS included in the blocking buffer depends
on the cell line and the specificity of the antibody. For HeLa
cells, it is recommended to use at 3%.
176 Irene Jiménez-Guerrero et al.

4. As a general approach, primary antibodies are usually diluted

ranging from 1:50 to 1:1000 in the best case. They can be
recovered and frozen to be re-utilized up to 4–5 times. Sec-
ondary antibody should be diluted ranging from 1:300 to 1:
1000.
5. Choose a color for the secondary antibody that does not
overlap with the excitation/emission spectrum of any other
fluorescent label used. In our case we have used a green
antibody.
6. The final concentration of AHT for bacterial lysis is 0.2 μg/
mL, while for protein induction from pcDNA5/FRT/TO-
Venus-Flag (865) is 20 μg/mL.
7. We recommend preparing this way, since the experiments have
shown to be more repetitive. The extraction solution can be
conserved up to 1 week at 4 °C.
8. An elevated M.O.I. can induce early apoptosis itself, and there-
fore, it is important to adjust the M.O.I. for every application.
9. Every medium change involves two PBS washing steps as this
one, but to avoid being repetitive, we do not have to state it in
every step entailing such changes.
10. For coarse approaches, visualization can be done on an
inverted epifluorescence microscope. However, if users need
to use confocal microscopy, introduce sterilized coverslips into
the wells. To sterilize it, immerse it in 70% ethanol for 5 min
and rinse with abundant sterile water.
11. Formalin must be disposed as toxic waste following the recom-
mendations of your institution.
12. To save unnecessary spending of solutions, we recommend to
stain wells in 500 μL PBS containing 0.5 μL DAPI and 50 μL
rhodamine-labeled phalloidin.
13. For 6 wells plates, 35 mm diameter, seed 105 to 2.5 × 105
cells/well. Having a lower FBS concentration (normal is 10%),
the cells will replicate slowly.
14. Take in consideration that lipofectamine has a limited toxicity
in cells; the more confluent the cells, the less toxic the com-
pound. However, 5 × 105 cells per well are too confluent, and
the experiment cannot be followed due to medium depletion.
15. It is recommended to test different ratios DNA/lipofectamine
(μg/μL). We have tried ratios 1:1, 1:2, or 1:4 (respectively)
with distinct number of cells 105, 2.5 × 105, and 5 × 105 in the
plate. In our experience, the best combination for higher
transfection efficiency is 2.5 × 105 cells per well with a DNA/-
lipofectamine ratio of 1/4.
 Subcellular Localization of Bacterial Effectors 177

16. Optimem is a minimal medium, and therefore, the cells repli-

cate slowly. To reduce the toxicity of lipofectamine if it hap-
pens, we recommend reducing the incubation to 4–5 h.
17. The volumes of this protocol are adapted to 6-well plates. If
done in other plates, scale the volumes as necessary.
18. The duration of the trypsin-EDTA treatment depends on the
cell line. For some cell lines, 3 min could be enough to avoid
cell damage.
19. Keep in mind that ethanol and PBS should be chilled before
starting the protocol.
20. Points 1 to 7 are usually carried out in 10 mL plastic tubes, and
to facilitate further 4 °C washing steps, it is better to transfer
the content to a 1.5 mL tubes (points 8 to 13).
21. It is not recommended to aspirate all the ethanol to avoid
losing cells; subsequent washing steps will dilute it. From
5 × 105 to 6 × 105, cells should be stained, keeping frozen
the remaining sample. If a low number of cells are expected,
you can bind the content of several wells or use higher plates.
22. The original protocol indicates that this incubation should be
done on ice, but we have noticed that the extraction solution
crystalizes after this step hindering the aspiration.
23. The instrument’s setting depends on each cytometer. We pro-
pose the next settings to simplify the analysis of samples for
following detectors, respectively (FCS, SSC, FL2A, FL2W),
voltage (E-1, 295, not applicable, not applicable), and Amp-
Gain (4.48, 1, 1.09, 1.6). For further details, please refer
to [17].

Acknowledgments

This work was funded by the Spanish Ministry of Science and

Innovation, grant number PID2019-107634RB-I00, and sup-
ported by FEDER funds, grant number FEDER-US 1259948.

References

1. Jiménez-Guerrero I, Pérez-Montaño F, Da and their effectors. Environ Microbiol 19:

Silva GM et al (2020) Show me your secret
(ed) weapons: a multifaceted approach reveals
a wide arsenal of type III-secreted effectors in
the cucurbit pathogenic bacterium Acidovorax
citrulli and novel effectors in the Acidovorax
genus. Mol Plant Pathol 21:17–37
2. Hu Y, Huang H, Cheng X et al (2017) A global
survey of bacterial type III secretion systems
3879–3895
3. Rapisarda C, Fronzes R (2018) Secretion sys-
tems used by bacteria to subvert host func-
tions. Curr Issues Mol Biol 25:1–42
4. Alfano JR, Collmer A (2004) Type III secre-
tion system effector proteins: double agents in
bacterial disease and plant defense. Annu Rev
Phytopathol 42:385–414
178 Irene Jiménez-Guerrero et al.
5. Mansfield JW (2009) From bacterial avirulence
genes to effector functions via the hrp delivery
system: an overview of 25 years of progress in
our understanding of plant innate immunity.
Mol Plant Pathol 10:721–734
6. O’Boyle N, Connolly JPR, Roe AJ (2018)
Tracking elusive cargo: illuminating spatio-
temporal type 3 effector protein dynamics
using reporters. Cell Microbiol 20:e12797
7. Stephenson MJ, Reed J, BrouwerB OA (2018)
Transient expression in Nicotiana benthami-
ana leaves for triterpene production at a pre-
parative scale. J Vis Exp 16:58169
8. Marchetti M, Capela D, Poincloux R et al
(2013) Queuosine biosynthesis is required for
Sinorhizobium meliloti-induced cytoskeletal
modifications on HeLa cells and symbiosis
with Medicago truncatula. PLoS One 8:
e56043
9. LeVier K, Phillips RW, Grippe VK et al (2000)
Similar requirements of a plant symbiont and a
mammalian pathogen for prolonged intracellu-
lar survival. Science 287:2492–2493
10. Jiménez-Guerrero I, López-Baena FJ, Medina
C (2023) Multitask approach to localize rhizo-
bial type three secretion system effector pro-
teins inside eukaryotic cells. Plan Theory 12:
2133
11. Medina C, Camacho EM, Flores A et al (2011)
Improved expression systems for regulated
expression in Salmonella infecting eukaryotic
cells. PLoS One 6:e23055
12. Medina C, Santero E, Gómez-Skarmeta JL,
Royo JL (2012) Engineered Salmonella allows
real-time heterologous gene expression moni-
toring within infected zebrafish embryos. J
Biotechnol 157:413–416
13. Medina C, Royo JL (2013) Zebrafish as a
model organism to study host-pathogen inter-
actions. Methods 62:241–245
14. Mesa-Pereira B, Medina C, Camacho EM et al
(2013) Novel tools to analyze the function of
Salmonella effectors show that SvpB ectopic
expression induces cell cycle arrest in tumor
cells. PLoS One 8:e78458
15. Mesa-Pereira B, Medina C, Camacho EM et al
(2015) Improved cytotoxic effects of Salmo-
nella-producing cytosine deaminase in tumour
cells. Microb Biotechnol 8:169–176
16. Camacho EM, Mesa-Pereira B, Medina C et al
(2016) Engineering Salmonella as intracellular
factory for effective killing of tumour cells. Sci
Rep 6:30591
17. Medina C, Mesa-Pereira B, Camacho EM et al
(2018) Molecular methods to analyze the
effect of proteins expressed by Salmonella dur-
ing its intracellular stage. In: Medina C, Lopez-
Baena FJ (eds) Methods in molecular biology,
vol 1734. Humana Press/Springer, New York,
pp 55–70
18. Royo JL, Becker PD, Camacho EM et al
(2007) In vivo gene regulation in Salmonella
spp. by a salicylate-dependent control circuit.
Nat Methods 4:937–942
19. Cebolla A, Royo JL, De Lorenzo V et al (2002)
Improvement of recombinant protein yield by
a combination of transcriptional amplification
and stabilization of gene expression. Appl Envi-
ron Microbiol 68:5034–5041
20. Cárcel-Márquez J, Flores A, Martı́n-Cabello G
et al (2019) Development of an inducible lytic
system for functional metagenomic screening.
Sci Rep 9:3887
21. Degenkolb J, Takahashi M, Ellestad GA, Hillen
W (1991) Structural requirements of
tetracycline-Tet repressor interaction: determi-
nation of equilibrium binding constants for
tetracycline analogs with the Tet repressor.
Antimicrob Agents Chemother 35:1591–1595
22. Young R (1992) Bacteriophage lysis: mecha-
nism and regulation. Microbiol Rev 56:430–
481
23. Beuzon CR, Meresse S, Unsworth KE et al
(2000) Salmonella maintains the integrity of
its intracellular vacuole through the action of
SifA. EMBO J 19:3235–3249
24. Sontag RL, Mihai C, Orr G et al (2015) Elec-
troporation of functional bacterial effectors
into mammalian cells. J Vis Exp 19:52296
 Chapter 12

A Workflow for the Functional Characterization

of Noncoding RNAs in Legume Symbiotic Bacteria
Natalia I. Garcı́a-Tomsig, Sabina K. Guedes-Garcı́a,
and José I. Jiménez-Zurdo

Abstract
Computational comparative genomics and, later, high-throughput transcriptome profiling (RNAseq) have
uncovered a plethora of small noncoding RNA species (sRNAs) with potential regulatory roles in bacteria.
A large fraction of sRNAs are differentially regulated in response to different biotic and abiotic stimuli and
have the ability to fine-tune posttranscriptional reprogramming of gene expression through protein-assisted
antisense interactions with trans-encoded target mRNAs. However, this level of gene regulation is still
understudied in most non-model bacteria. Here, we compile experimental methods to detect expression,
determine 5′/3′-ends, assess transcriptional regulation, generate mutants, and validate candidate target
mRNAs of trans-acting sRNAs (trans-sRNAs) identified in the nitrogen-fixing α-rhizobium Sinorhizobium
meliloti. The workflow, molecular tools, and methods are suited to investigate the function of newly
identified base-pairing trans-sRNAs in phylogenetically related α–rhizobia.

Key words Sinorhizobium meliloti, Rhizobia, α-Proteobacteria, trans-sRNA, Riboregulation

1 Introduction

The development of next-generation high-throughput sequencing

technologies for transcriptome profiling (RNAseq) has uncovered
large and heterogeneous populations of small noncoding RNA
(sRNAs) with major regulatory roles in the adaptive responses of
bacteria that await functional characterization [1–3]. The symbiotic
interaction between rhizobia and legume plants is a remarkable
example of a continuous genetic reprogramming underwent by
bacteria to adapt their physiology during the transition from the
soil environment to the intracellular residence within root nodules
as morphologically differentiated nitrogen-fixing bacteroids [4–
7]. This reprogramming has been almost exclusively investigated
from the perspective of the transcriptional regulation assisted by
proteins. However, the post-transcriptional adjustment of gene

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_12,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

179
180 Natalia I. Garcı́a-Tomsig et al.

product levels by sRNAs is still scarcely studied [8]. Global

mapping of transcription start sites (TSS) by differential RNAseq
(dRNAseq) for sRNA annotation was performed in the nitrogen-
fixing α-rhizobium Sinorhizobium meliloti, but only a handful of
the hundreds of trans-acting RNAs identified by this method have
been studied in detail [8, 9]. These sRNAs are differentially tran-
scribed from independent promoters in response to environmental
cues and rely on limited base-pairing with trans-encoded target
mRNAs to post-transcriptionally control the translation and/or
stability of the messages.
Here, we describe core molecular tools and methods for deci-
phering the key functional features of S. meliloti trans-sRNAs, i.e.,
differential expression in response to environmental signals and
target mRNA regulation by base-pairing mechanisms. This work-
flow involves expression profiling, mapping of 5′- and 3′-ends,
identification of transcriptional regulators, gain- and loss-of-func-
tion phenotyping, and experimental validation of putative target
mRNAs and sRNA targeting motifs of the sRNAs (Fig. 1). The
whole methodology is suitable for the characterization of trans-
sRNAs in phylogenetically close α-proteobacteria interacting with
eukaryotic hosts such as Sinorhizobium, Rhizobium, Agrobacter-
ium, or Brucella species.

2 Materials

Standard equipment in molecular biology (e.g., incubators, gel

electrophoresis devices, refrigerated centrifuges) is required for
the following protocols. To avoid RNA degradation, special atten-
tion on glassware and equipment cleanness is required. Cleaning of
work surfaces and gloves (powder-free) with RNase-free agent or
decontamination solution (e.g., RNAZap™, Invitrogen) and the
use of pipettes only for RNA work is also recommended. Working
solutions are prepared in ultrafiltered sterile water, and commercial
RNase-free water and plasticware are used for the preparation of the
RNA-containing reactions. Moreover, commercial RNase-free and
sterile plastic tubes, pipette tips, and boxes should be directly used
to avoid contamination with DNA from autoclave water.

2.1 Culture, Harvest 1. Sinorhizobium meliloti strains Sm2B3001 [10] (Sm2011 deriv-
of Bacteria, and Cell ative expR+) and the derivative strain with a deletion of the
Lysis sRNA locus of interest. For sRNA overexpression, Sm2019
[11], which is a Sm2B3001 ΔsinRsinI-derivative.
2. Rubidium chloride competent Escherichia coli DH5α [12] and
S17.1 [13] cells for cloning and conjugation by biparental
mating, respectively.
 Characterization of Rhizobial sRNAs 181

Fig. 1 Overview of the workflow for molecular and functional characterization of S. meliloti sRNAs. PsRNA,
native promoter of the sRNA under study. Further details throughout the text

3. Luria-Bertani (LB) medium [14]: 5 g/L NaCl, 10 g/L tryp-

tone, and 5 g/L yeast extract.
4. Tryptone yeast (TY) medium [15]: 0.9 g/L CaCl2∙2H2O, 5 g/
L tryptone, and 3 g/L yeast extract.
5. Minimal medium (MM) [16]: 1.1 g/L potassium glutamate,
10 g/L mannitol, 0.3 g/L K2HPO4, 3 g/L KH2PO4, 0.15 g/
L MgSO4∙7H2O, 0.05 g/L CaCl2·2H2O, 0.05 g/L NaCl,
0.006 g/L FeCl3∙6H2O, 0.2 mg/L biotin, 0.1 mg/L calcium
pantothenate, and pH 6.8. Alternatively, glutamate is replaced
by glutamine (0.79 g/L) to avoid nitrogen stress. Glutamate
could be also replaced by NH4Cl at 0.5 mM (nitrogen-limiting
conditions) or 10 mM (nitrogen-excess conditions) to assess
shifts of sRNA expression in response to N status.
6. Antibiotics at the following final concentrations (μg/mL):
streptomycin (Sm) 480, erythromycin (Er) 100, tetracycline
182 Natalia I. Garcı́a-Tomsig et al.

(Tc) 10, ampicillin (Ap) 200, kanamycin (Km), and gentamicin

(Gm) 50 for E. coli and 180 for rhizobia.
7. Isopropyl β-D-1-thiogalactopyranoside (IPTG) stock solution
at an appropriate concentration to achieve by dilution 1 mM in
growing cultures.
8. 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal).
9. STOP solution: 90% ethanol, 10% phenol.
10. Sarcosyl solution: 0.1% (w/v) N-lauroylsarcosine sodium salt,
10 mM Tris-HCl pH 8, 1 mM ethylenediaminetetraacetic acid
(EDTA) pH 8, for washing cells before harvesting.
11. Lysis solution: 1.4% (w/v) sodium dodecyl sulfate (SDS),
4 mM EDTA pH 8, for total RNA extraction from bacterial
cultures.
12. NTES: 100 mM NaCl, 10 mM Tris-HCl pH 7.5, 1 mM
EDTA, 1% SDS, for RNA isolation from nodules.
13. β-Mercaptoethanol.
14. Proteinase K.
15. Complete Protease Inhibitor Cocktail (Roche).
16. RNase inhibitor.
17. Incubator.
18. Refrigerated centrifuge.
19. French Press or sonicator.

2.2 Total RNA 1. 5 M NaCl.

Extraction 2. Ethanol absolute.
3. Isopropanol.
4. Sodium acetate (NaAc) pH 5.2 and glycogen.
5. RNase-free DNase I.
6. Agarose.
7. 4X MOPS buffer: 80 mM 3-(N-morpholino)propanesulfonic
acid (MOPS), 20 mM sodium acetate, 4 mM EDTA, pH 7.
8. Formaldehyde: 1.875% (v/v) in agarose gel.
9. 6X DNA loading dye [50% glycerol (v/v), 10 mM EDTA
pH 8, 0.5% Orange G (w/v)] and 6X RNA loading dye
(0.15% Orange G, 7.5% glycerol, 10 mM EDTA).
10. Horizontal electrophoresis system for RNA electrophoresis.
11. Dyes for nucleic acids staining (e.g., GelRed).
12. Qubit3 fluorimeter (Thermo Fisher Scientific) and Qubit RNA
high sensitivity assay kit (Invitrogen) for RNA quantification.
13. RNeasy® Plus kit (Quiagen).
 Characterization of Rhizobial sRNAs 183

2.3 Northern Blot 1. [γ-32P]-dATP (PerkinElmer).

Hybridization 2. Polynucleotide kinase.
3. MicroSpin G-25 columns (Cytiva).
4. VWR® Acryl/Bis™ Solution (40%) 29:1 (electrophoresis
grade), urea, ammonium persulfate (APS) and tetramethy-
lethylendiamine (TEMED).
5. TBE: 89 mM Tris base, 89 mM boric acid, and 2 mM EDTA,
pH 8.
6. Loading buffer: 0.3% bromophenol blue, 0.3% xylene cyanol,
10 mM EDTA pH 7.5, and 97.5% formamide.
7. DNA size marker.
8. Nylon membranes, positively charged.
9. Whatman 3MM papers.
10. Pre-hybridization solution: 0.5 M sodium phosphate buffer,
pH 7.2, 7% SDS, and 10 mM EDTA.
11. 20X SSC solution: 3 M NaCl and 0.3 M sodium citrate.
12. Semi-dry blotter for electrotransfer (e.g., ECL Semi-dry blot-
ters; Amersham).
13. Phosphorimager and scanner (e.g., Personal molecular imager®
FX scanner equipped with Quantity One®).

2.4 Rapid 1. FirstChoice™ RLM-RACE Kit (Invitrogen) containing calf-

Amplification of the 5′/ intestinal alkaline phosphatase (CIP) and buffer, ammonium
3′-cDNA Ends (RACE) acetate solution, tobacco acid pyrophosphatase (TAP) and 10X
TAP buffer, and T4 RNA ligase and 10X ligase buffer (see Note
1).
2. Outer and inner primers to be designed according to the
sequences of the target transcript for nested PCR.
3. Phenol (pH 4.5)-chloroform-isoamyl alcohol solution (25:
24:1, v/v).
4. PrimeScript™ RT Master Mix (Takara) for reverse
transcription.
5. RNase H.
6. mi-Gel Extraction kit (Metabion).
7. High-fidelity Taq DNA polymerase (e.g., Phusion, Thermo-
Scientific) and buffer for amplification of DNA fragments
using outer and inner primers.
8. DNA Polymerase (e.g., OneTaq, New England Biolabs) for
adenylation of PCR product to be cloned in pGEM-T using
the pGEM-T easy kit (Promega) or similar and colony PCR.
9. T7 (TAATACGACTCACTATAGGGCGA) and SP6 (GTATT
CTATAGTGTCACCTAAATAGC) universal primers.
184 Natalia I. Garcı́a-Tomsig et al.

2.5 Evaluation of 1. pBB-egfp [17] and pABCa [18] vectors for promoter-reporter
Promoter Activity fusions.
2. Primers carrying the appropriate restriction enzyme sites
designed for amplification and cloning of the sRNA promoter.
SR_Fw (CTGATCGGCATCAGCGTCAC), GFP_Rv (GTTG
GCCATGGAACAGGTAG), pABC_Fw (CTGTTGTTTGTC
GGTGAACG ) and pABC_Rv (
GCCAGTTACCTCGGTTCAAA) universal primers.
3. High-fidelity and routine Taq polymerase.
4. Restriction enzymes. Choose among those contained in the
Multiple Cloning Site of plasmids pBB-egfp and pABCa.
5. T4 DNA ligase.
6. mi-PCR Extraction kit (Metabion).
7. Fluorimeter for measurement of GFP-derived fluorescence.
8. Bacteroid buffer: 40 mM MOPS, 20 mM KOH, 2 mM
MgSO4, and 300 mM sucrose, pH 6.5.
9. Microscope for GFP fluorescence detection.

2.6 Identification of 1. High-fidelity Taq polymerase.

Proteins Regulating 2. Primers designed for PCR amplification of the sRNA promoter
sRNA Transcription region, one of them must be biotinylated.
3. Phenol (pH 4.5)-chloroform-isoamyl alcohol solution (25:
24:1, v/v) and ethanol.
4. Streptavidin resin.
5. SigmaPrep spin column (Sigma).
6. Bovine serum albumin (BSA).
7. Protein Binding Buffer: 20 mM Tris-HCl buffer pH 8, 1 mM
EDTA, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfo-
nic acid (HEPES), 10% glycerol, 100 mM NaCl, and 0.05%
Triton X-100.
8. Wash Buffer: 20 mM Tris-HCl pH 8, 1 mM EDTA, and
150 mM NaCl.
9. Elution Buffer: 50 mM Tris-HCl pH 8 and 2 M NaCl.
10. 8 M Guanidine· HCl (pH 1.5).
11. Belly Dancer Shacker.

2.7 SDS-Page 1. Resolving gel: 1.5 M Tris-HCl buffer pH 8.8, 10–15% acryl-
amide/bisacrylamide solution 37.5:1, 0.1% (w/v) APS, 0.1%
(w/v) SDS, and 0.5 μL/mL TEMED; stacking gel: 1 M Tris-
HCl buffer pH 6.8, 5% acrylamide/bisacrylamide solution
37.5:1, 0.1% (w/v) APS, 0.1% (w/v) SDS, and 0.5 μL/mL
TEMED.
 Characterization of Rhizobial sRNAs 185

2. 10X SDS running buffer: 0.25 M Tris-HCl, 1.9 M glycine, and

1% (w/v) SDS.
3. Protein loading buffer: 0.01% (w/v) bromophenol blue, 12%
(w/v) SDS, 0.3 M Tris-HCl, pH 6.8, 60% (v/v) glycerol
supplemented with 2% (v/v) β-mercaptoethanol.
4. Protein size marker.
5. Vertical electrophoresis system.
6. Coomassie and silver staining solution (e.g., Silver Stain kit,
Biorad).

2.8 Construction of 1. pK18mobsacB [19] to construct pK18ΔsRNA. pSRKKm [20]

sRNA Mutants and to construct pSKi-sRNA for overexpression of the sRNA upon
Validation of mRNA IPTG-induction.
Targets 2. Plasmid pReGFP [21] and its derivative pR_FLAG.
3. High-fidelity and routine Taq polymerase.
4. Restriction enzymes. Choose among those contained in the
Multiple Cloning Site of plasmids pK18mobsacB and pSRKKm.
5. T4 DNA ligase.
6. Primers designed for cloning. PCR2 (TTAGCTCACTCAT-
TAGG), PCR1 (CGGGCCTCTTCGCTATT), pJBsecF
(CCTCTTCGCTATTACGCCAGC), and pJBsecR
(CGGCTCGTATGTTGTGTGGA) universal primers.
7. Fluorimeter for measurement of GFP-derived fluorescence.
8. Whatman 3MM paper.
9. Polyvinylidene difluoride membrane (PVDF).
10. Methanol.
11. Transfer buffer: 25 mM Tris pH 8.3, 0.19 M glycine, and 20%
methanol.
12. TBST20 buffer: 20 mM Tris-HCl pH 8.0, 0.18 M NaCl, and
0.1% Tween 20.
13. Blocking reagent.
14. Monoclonal anti-FLAG antibody and anti-mouse antibody
conjugated to horseradish peroxidase (1:100,000).
15. Blotting detection reagent (ECL) and imaging system (e.g.,
ChemiDoc, BioRad).

2.9 Bioinformatic 1. ClustalW implemented in BioEdit for promoter sequence

Tools alignments (https://bioedit.software.informer.com/7.2/).
MEME algorithm to search for conserved motifs (http://
meme-suite.org/index.html). The logo of motif consensus
sequences can be generated at http://weblogo.berkeley.edu/
logo.cgi.
186 Natalia I. Garcı́a-Tomsig et al.

2. CopraRNA (v 2.1.2; http://rna.informatik.uni-freiburg.de/

CopraRNA/Input.jsp) and IntaRNA (v 3.2.0;http://rna.
informatik.uni-freiburg.de/IntaRNA/Input.jsp) for predic-
tion sRNA-mRNA base-pairing interactions.
3. ImageJ software [22] for quantification of band intensity after
Northern-blot and Western-blot hybridization.

3 Methods

The following protocols have been used for the characterization of

the S. meliloti trans-sRNAs AbcR1, AbcR2, and NfeR1 [17, 21,
23]. Oligonucleotide sequences and methods can be adapted for
the primary characterization of any trans-sRNA in plant symbiotic
α-rhizobia.

3.1 Detection and 1. Grow rhizobial strains in TY or MM media at 30 °C and E. coli

Molecular cells in LB medium at 37 °C. Any stress condition can be
Characterization of mimicked by addition of the stressor (e.g., salt stress; NaCl
sRNAs 400 mM) to logarithmic cultures and incubation for 1 h.

3.1.1 Cell Growth and

2. Before cell harvesting, mix 5 mL of STOP solution with 25 mL
Isolation of Total RNA
of culture. Harvest bacterial cells by centrifugation for 10 min
at 3,500× g and 4 °C, and wash once with 20 mL of sarcosyl
solution. Then, pellets are frozen using liquid nitrogen prior to
storage at -80 °C to facilitate subsequent cell disruption.
3. Bacterial pellets containing cells equivalent to OD600 ~ 20–30
(e.g., 30 mL culture of OD600 0.8) are gently resuspended in
1 mL of pre-heated lysis solution and incubated for 10 min at
65 °C with mixing by vortex every 2 min. Use 2 mL of lysis
solution and incubate for 20 min at 65 °C when the rhizobial
strain is expR+ (i.e., high amounts of extracellular
polysaccharides).
4. Chill lysates on ice and add 500 μL of 5 M NaCl. Centrifuge
samples (15 min, 16,000 × g, 4 °C) after 10 min on ice.
5. Transfer the supernatant to a new tube with 4.5 mL of cold
100% ethanol. Mix tubes by inversion and store them at -80 °
C for at least 1 h. Then, centrifuge tubes at 16,000 × g and 4 °C
for 30 min.
6. Completely remove ethanol and resuspend pellets in 225 μL of
water. Then pool them together for treatment with 40 U of
DNAse I according to the manufacturer’s instructions supple-
mented with 40 U RNase inhibitor (final volume reaction
should be 250 μL).
7. After incubation, add 1X cold phenol-chloroform-isoamyl
alcohol (pH 4.5). Mix samples by vortex (15–20 s), and
 Characterization of Rhizobial sRNAs 187

separate the organic and aqueous phases by centrifugation

(15 min, 16,000 × g, 4 °C).
8. Transfer the aqueous (upper) phase to a new microtube con-
taining 14 μL of 3 M NaAc (pH: 5.2) and 4X ethanol (1 mL),
mix by inversion, and store at -80 °C for at least 1 h prior to
centrifugation (30 min, 16,000 × g, 4 °C). Glycogen (0.25 μg)
is added to ethanol when the expected amount of RNA is low.
9. Remove ethanol avoiding pipetting or vortex and wash the
RNA pellet with 200 μL of cold 70% ethanol. Precipitated
RNA is pelleted by centrifugation (10 min, 16,000 × g, 4 °
C), and the supernatant is carefully removed, avoiding pipet-
ting again.
10. Air-dry samples at room temperature with open lids for
10 min, or alternatively, they are dried using a vacuum concen-
trator. Then, resuspend RNA in 50 μL of RNase-free water and
store at -20 °C (or at -80 °C for long-term storage).
11. Separate 1 μL of purified RNA in 1.3% denaturing agarose gels
in MOPS buffer to assess RNA integrity. Add MOPS and
formaldehyde after agarose melting in ultrapure water, and
add GelRed to the RNA loading buffer and RNA samples.
Then, run the electrophoresis in MOPS buffer with voltage
typically set at 100 V. Non-degraded 23S, 16S, and 5S species
should be clearly visible.
12. Use an Invitrogen Qubit 3 fluorimeter to determine the RNA
concentration using the QubitRNA high sensitivity (HS) kit.
These RNA preparations are suited for analysis by Northern-
blot hybridization. For RT-qPCR protocols, RNA samples are
cleaned up with the RNeasy® Plus Kit following the manufac-
turer’s guidelines (see Note 2).

3.1.2 Isolation of Total Nodulation assays are carried out as previously described [21] using
RNA from Nodules the desired rhizobia-legume combination, e.g., S. meliloti-alfalfa
(Medicago sativa L. ‘Aragón’).
1. Nitrogen-fixing indeterminate mature root nodules are typi-
cally harvested 28 days after inoculation (1–2 g are recom-
mended) and frozen using liquid nitrogen prior to storage at
-80 °C.
2. Ground to powder in a mortar, nodules previously covered
with liquid nitrogen.
3. Add 4 mL of NTES supplemented with 100 mM
β-mercaptoethanol to nodules powder to lysate them, and
then, collect the lysate in a new tube. It is recommended to
first add 1–2 mL of NTES to easily lyse the nodules and then
complete the volume up to 4 mL.
188 Natalia I. Garcı́a-Tomsig et al.

4. Add 3 mL of cold phenol-chloroform-isoamyl alcohol

(pH 4.5). Mix samples by vortexing (15–20 s) and separate
the organic and aqueous phases by centrifugation (15 min,
3,500 × g, 4 °C).
5. Transfer the aqueous (upper) phase to a new microtube con-
taining 14 μL of 3 M NaAc (pH 5.2) and 5 mL of isopropanol,
mix by inversion, and store at -80 °C for at least 1 h prior to
centrifugation (20 min, 10,000 × g, 4 °C).
6. From here on, the steps are the same as in the above protocol
(from step 9). 26S (plant), 23S, 18S (plant), 16S, and 5S bands
should be clearly detected on gels as indicative of RNA
integrity.

3.1.3 Northern Blot Probing of total RNA on Northern blot membranes is a classical
Analysis of sRNA molecular method to assess expression of sRNAs previously identi-
Expression fied by comparative genomics or RNAseq. The use of DNA probes
is usually sufficient for transcript detection. These probes should be
25–30 nt-long. However, RNA probes (riboprobes) could improve
sRNA detection. The use of a DNA size marker allows rough
determination of transcripts size. The 5S rRNA probe
(TACTCTCCCGCGTCTTAAGACGAA) is a good control of the
amount of RNA loaded onto gels. Ensure RNA integrity prior to
sample loading. For preparation of the gel, clean glasses with soapy
water to remove acrylamide residues and, then, clean glasses with
ethanol and paper.
1. Use oligonucleotides labeled at their 5′-end with [γ-32P]-
dATP as probes. For that, independently label 50 pmol of the
oligonucleotide and a DNA size marker (e.g., 5 μg of pGEM
marker) with 10 U polynucleotide kinase in the presence of
1 μL of [γ-32P]-dATP by incubation for 2–3 h at 37 °C in
10 μL reaction mixtures.
2. Purify the labeling reactions in MicroSpin G-25 columns by
centrifugation (1,200 × g, 5 min) (see Note 3).
3. Resuspend RNA samples (10–20 μg; 30 μg for RNA from
nodules) in loading buffer and denature by incubation at 95 °
C for 5 min, followed by a rapid transfer to ice. One μL of
labeled DNA marker is also loaded. Samples are subjected to
vertical electrophoresis on 6% polyacrylamide/7 M urea dena-
turing gels, which are polymerized by addition of 1% (w/v)
APS, and 0.5 μL per mL TEMED, in TBE. Electrophoreses are
typically run at 450 V. Total RNA from nodules can be cleaned
up with the RNeasy® Plus kit to improve sRNA detection.
4. To transfer RNA to nylon membranes, six 3MM papers and
one nylon membrane are cut according to the gel size and
wetted in TBE. One of the 3MM papers is glued to the gel
avoiding the formation of bubbles (this 3MM paper should be
 Characterization of Rhizobial sRNAs 189

dried to complete adherence to the gel). With the help of this

paper, the gel is removed from the glass (see Note 4).
5. Wet the gel and 3MM paper in TBE buffer (use a 10 mL pipette
to roll it over the paper and eliminate bubbles). Then, place
two more wet 3MM papers on it.
6. Then, cover the free side of the gel with the wet membrane and
other three wet 3MM papers (ensure elimination of bubbles).
Then, place the cassette on a semi-dry blotter with an applied
current of 0.5–3 mA/cm2 membrane for 60 min. Fix the RNA
to the membrane by exposure to UV light (120 mJ/cm2).
Alternatively, RNA fixation also occurs in a vacuum heating at
80 °C for 1 h. Store the membrane between dried 3MM papers
in a dry place.
7. Pre-hybridize the membrane at 42 °C for 30 min with 20 mL
of pre-hybridization solution in a hybridization oven. Denature
the radiolabeled probe by heating at 95 °C for 5 min, and then
place on ice.
8. Add 50 pmol of radiolabeled probe to the solution for over-
night hybridization at 42 °C.
9. Remove the pre-hybridization solution containing the probe
and wash the membrane successively with 2X SSC/0.1% (w/v)
SDS for 1 min, 2X SSC/0.1% (w/v) SDS for 15 min, 1X
SSD/0.1% (w/v) SDS for 15 min, and 0.1X SSC0.1% (w/v)
SDS for 15 min at 42 °C. The third wash (high stringency)
could be ignored when probe efficiency is unknown. In con-
trast, this wash is recommended for 5S probe or probes with
high efficiency.
10. Then, cover the membrane with plastic wrap and expose over
to a phosphor imager screen for 16 h (2 h should be enough for
the 5S probe). The images are acquired with the appropriate
scanner and software (see Note 5).

3.1.4 5′/3′-RACE Once expression of a newly identified sRNA has been readily
detected by Northern hybridization in a given biological condition,
its 5′ and 3′ boundaries must be determined or confirmed
(if initially identified by RNAseq). This determination is essential
for the subsequent steps in the functional characterization (e.g.,
sRNA overexpression from plasmids, or bioinformatics prediction
of target mRNAs using the full-length sRNA sequence) (see Note
6). For that, RACE is the most common experimental approach of
choice. 5′-RACE discriminates between primary 5′-triphosphate
ends and monophosphate processing sites (5′-P) of bacterial tran-
scripts. Typically, 5′-RACE and 3′-RACE are carried out separately
for determining both sRNA ends as previously described
[24]. Here, we describe an alternative protocol based on
190 Natalia I. Garcı́a-Tomsig et al.

circularization of the transcripts before cDNA synthesis [21, 25],

which allows simultaneous determination of both sRNA ends
(Fig. 2).
1. Treat 10 μg of total bacterial RNA with 2 μL calf intestine
alkaline phosphatase in a 20 μL reaction for 1 h at 37 °C for
removing of 5′- and 3′-phosphates. This step removes free
5′-phosphates from molecules such as ribosomal RNA, frag-
mented mRNA, tRNA, and contaminating genomic DNA.
The cap structure found on intact 5′ ends of mRNA is not
affected by CIP.
2. Then add 50 μL ammonium acetate solution, 115 μL nuclease-
free water, and 150 μL acid phenol-chloroform. Vortex the
mixture thoroughly and centrifuge for 5 min at 10,000 × g at
room temperature.
3. Transfer the aqueous phase to a new tube containing 150 μL
isopropanol, vortex thoroughly, and chill on ice for 10 min.
Then, centrifuge samples for 20 min at 13,000 × g.
4. Remove ethanol avoiding pipetting or vortex and wash the
RNA pellet with 200 μL of cold 70% ethanol. Precipitated
RNA is pelleted by centrifugation (10 min, 16,000 × g, 4 °
C), and supernatant is carefully removed, avoiding pipetting
again.
5. Air-dry samples at room temperature with open lids, or alter-
natively, dry using a vacuum concentrator. Resuspend pellets in
11 μL of nuclease-free water. Keep 1 μL for a minus-TAP
control reaction.
6. Treat 5 μL of CIP-treated RNA (~5 μg of RNA) with 2 μL
tobacco acid pyrophospatase (TAP) in a 20 μL final volume
reaction to remove the cap structure from RNAs, leaving a
5′-monophosphate. Incubate reactions for 1 h at 37 °C.
7. Treat 2 μL of CIP/TAP-treated RNA (~0.5 μg) and the mock-
treated control (-TAP) with 5 U T4 RNA ligase to circularize
transcripts in a 20 μL reaction, which is incubated for 1 h at 37 °
C.
8. Synthesize cDNA with the Takara PrimeScript RT master mix
(perfect real time) using 0.1 μg of self-ligated RNA according
to the manufacturer’s instructions.
9. Treat reactions with 1 U RNase H for 20 min at 37 °C to
remove RNA-DNA hybrids (see Note 7).
10. Use 1 μL of reaction as template for PCR amplification with
Phusion high-fidelity DNA polymerase. Primer pairs are
designed to amplify fragments containing the junctions of
each sRNA. A further nested PCR is recommended using a
primer’s pair annealing in the inner region of first PCR
product.
Fig. 2 Workflow for 5′/3′-end determination of RNAs by RACE. CIP treatment to deplete degraded RNA and TAP
treatment for dephosphorylation of primary transcripts. RNAs are self-ligated and used as template for cDNA
synthesis. Nested PCR for generation of the PCR product containing both 5′- and 3′-ends, which is cloned in
pGEM-T vector for sequencing
192 Natalia I. Garcı́a-Tomsig et al.

11. Separate PCR products in TAE 2% agarose gels, excise frag-

ments of the expected size, and purify them with mi-Gel
Extraction Kit. If possible, the size of the PCR products should
be 100–300 bp. Alternatively, fragments shorter than 100 bp
can be separated in nondenaturing 10% polyacrylamide gels.
12. Adenylate purified PCR products with OneTaq DNA polymer-
ase in the presence of 0.3 mM dATP at 70 °C for 30 min.
13. Mix adenylated PCR products with the pGEM-T vector and
the ligase provided with the Promega kit, and incubate for 16 h
at 4 °C.
14. Use E. coli DH5α competent cells for transformation with the
ligation reaction, and plate in ampicillin-containing LB plates
supplemented with IPTG and X-gal for incubation for 16 h at
37 °C and further blue/white selection of transformants.
15. Analyze plasmid inserts by colony PCR using SP6 and T7 as
primers flanking the pGEM-T polylinker. Positive colonies are
not expected from the minus-TAP control.
16. Purify plasmid DNA from colonies showing different sizes and
sequence them with SP6 as primer. Sequencing results are
aligned with the sRNA sequence to identify the 5′/3′-ends
(see Note 8).

3.2 Transcriptional Intracellular sRNA levels are primarily adjusted by transcriptional

Regulation of sRNAs regulation exerted by proteins (i.e., transcription factors and/or
alternative RNA polymerase σ factors). The activity of the sRNA
3.2.1 Determination of
promoter can be first assessed using transcriptional fusions of the
Promoter Activity
wild-type or mutant variants of the promoter to the eGFP (Green
Fluorescence Protein) reporter. This analysis can be guided by the
identification of conserved motifs in alignments generated by Clus-
talW of the promoter regions of sRNA homologs from related
bacteria. Wild-type and mutant versions (e.g., in the conserved
motifs) of the promoter are transcriptionally fused to eGFP in the
mid-copy pBBR1MCS-2 derivative plasmid pBB-egfp [17].
1. The promoter region of the sRNA of interest, extending just to
its TSS, is amplified by PCR with the appropriate primer pair
and ligated to pBB-egfp to be inserted upstream the 5′-UTR
and CDS of eGFP.
2. Use E. coli DH5α competent cells for transformation with the
ligation reaction, and plate in kanamycin-containing LB plates
for incubation at 37 °C.
3. Successful integration of the insert is verified by colony PCR
using SR_Fw and GFP_Rv as primers flanking the insert in
pBB-egfp.
4. Purify plasmid DNA from colonies showing the correct size
and check by sequencing with GFP_Rv as primer.
 Characterization of Rhizobial sRNAs 193

5. Transform E. coli S17.1 cells with the correct constructs for

biparental mating with the desired rhizobial wild-type or
mutant (e.g., in the transcription factor of interest) strain.
6. Activity of the promoter-egfp fusions can be assessed in diverse
growth/environmental conditions. Changes in GFP accumu-
lation are poorly detectable upon pulse stress induction. There-
fore, we recommend measuring fluorescence of the reporter
strains at least 12 h after stress induction. Bacteria transformed
with the empty vector are used as negative controls in these
assays (see Note 9).
7. Select at least three transconjugants from each mating for fluo-
rescence determinations in a plate reader fluorimeter. Transfer
cultures of the reporter strains (100 μL) to a 96-well microtiter
plate for measurement of OD600 and fluorescence (excitation
485 nm, emission 520 nm) in a microplate reader. Fluorescence
and absorbance values emitted by each media are subtracted
from values emitted by reporter strains. This allows comparison
of the same reporter strains after growing in different media.
Then, the fluorescence values are normalized by OD600, but
cultures are also adjusted to comparable optical densities. Strains
harboring the empty vector are used to determine background
fluorescence/OD600 values in each culture condition.

3.2.2 Bacteroid Isolation 1. Harvest at least 10 nodules elicited by the GFP reporter strain
to Track sRNA of interest, suspend them in 200 μL bacteroid buffer, and crash
Transcription in Planta them with a crystal rod. Once nodules are lysed, add another
800 μL of bacteroid buffer and mix well.
2. Carefully transfer nodule lysates to a microcentrifuge tube with
a 1000 μL tip and centrifuge at 500 × g and 4 °C for 10 min to
eliminate the plant debris.
3. Centrifuge the supernatant again for 10 min at 2000 × g and 4 °
C to pull down the bacteroids. This new supernatant is dis-
carded, and the pellet is resuspended in 50 μL bacteroid buffer.
4. Plot 10 μL of bacteroid preparation on a microscope slide and
cover with a coverslip for visualization in an epifluorescence
microscopy using a Leica DMI6000B microscope equipped
with filter set ET GFP (excitation band pass 470/40 nm,
beam splitter 500 nm, emission band pass 525/50 nm).
Image acquisition and adjustment was carried out with Leica
Application Suite EZ 3.4.0 software (see Note 10).

3.2.3 Promoter For the primary identification of proteins that bind to and puta-
Pull-Down Assays tively regulate the sRNA promoter, we use a DNA-chromatography
pull-down assay [26] (Fig. 3). Bacteria are cultured in conditions
that promote differential accumulation of the sRNA. Use culture
conditions in which induction or repression of promoter activity
has been observed.
194 Natalia I. Garcı́a-Tomsig et al.

Fig. 3 DNA-affinity chromatography pull-down assay. Scheme of the sRNA promoter region amplified by PCR
with a biotinylated forward primer (Btn-PsRNA). The control bait DNA lacks the conserved motif(s). Lysates for
pull-down assays are obtained from cultures in the conditions indicated, i.e., TY, MM, and MM upon salt shock
(400 mM for 1 h). See text for details about the procedure
 Characterization of Rhizobial sRNAs 195

1. The DNA probe is generated by PCR amplification of genomic

DNA using specific primers, but the forward primer is biotiny-
lated. The use of DNA fragments at least of 200-bp extending
10–20 bp downstream the sRNA TSS is recommended to allow
binding of the RNA polymerase with the corresponding σ
factor. DNA fragments containing deletions of putative con-
served transcription factor binding motifs can be used as nega-
tive controls in the assays.
2. Concentrate DNA fragments and purify them by phenol-
chloroform-isoamyl alcohol [25:24:1 (v/v)] extraction as
described in Subheading 3.1.1. Resuspend the pellet in
100 μL of nuclease free water, and determine the DNA con-
centration in a NanoDrop ND-1000 spectrophotometer.
3. Harvest cells equivalent to 400 OD600 by centrifugation
10 min at 3500 × g and 4 °C. Wash then pelleted cells once
with sarcosyl solution and froze them in liquid nitrogen.
4. Resuspend cells in 4 mL Protein Binding Buffer supplemented
with Complete Protease Inhibitor Cocktail and lyse them by
three consecutive passes through a French’s Press (1,000 psi).
Precipitate cell debris by centrifugation at 12,000 × g and 4 °C
for 10 min and keep the supernatant for the next step.
5. Wash the streptavidin resin (200 μL) four times in wash buffer
by centrifugation at 8,200 × g for 15 s. Then, resuspend the
resin in 600 μL of wash buffer containing 40 μg of biotinylated
DNA in a 2 mL tube. Incubate this mixture at 4 °C for 1 h in a
Belly Dancer shaker. Then, centrifuge the mixture at 8200 × g
for 1 min, and wash the pellet in 500 μL of Protein Binding
Buffer three times. Add bacterial lysates and BSA (5 μg/mL) to
the streptavidin resin-DNA baits in 15 mL conical tubes, and
incubate at 4 °C for 16 h in a Belly Dancer shaker.
6. Centrifuge the mixture at 8,200 × g and 4 °C for 1 min and
remove the supernatant leaving 0.8–1 mL of buffer to resus-
pend the pellet. Load this mixture into a Sigma Prep spin
column previously washed twice with Protein Binding Buffer.
Then, wash the resin three times with Protein Binding Buffer
supplemented with Complete Protease Inhibitor Cocktail and
5 μg/mL BSA.
7. Incubate the resin with 120 μL of Elution Buffer for 10 min to
release proteins bound to DNA upon centrifugation at
8,200 × g for 2 min. The use of the Elution Buffer containing
increasing concentrations of NaCl releases proteins with differ-
ent DNA affinities (protein eluted at low NaCl concentration
has lower affinity for DNA binding). To monitor the presence
of DNA baits, DNA is released from the streptavidin resin by
addition to 60 μL of 8 M Guanidine-HCl (pH 1.5), centrifu-
gation, and stabilization with 60 μL of 1 M Tris-HCl (pH 8).
196 Natalia I. Garcı́a-Tomsig et al.

8. Load the eluted fractions into a conventional SDS-PAGE gel.

Visualize proteins and DNA probes by silver staining. DNA
fragments used as probes should be visualized in the
Guanidine-HCl eluted fraction.
9. Independently load eluted fractions from each culture condi-
tion in an SDS-PAGE gel and run samples at ~6 mA for 10 min
(until total sample volume enters the gel). Stain gels with
Coomassie solution and excise bands for LC/MS analysis.
Alternatively, samples are run for 1 h, and upon Coomassie
staining, the major protein bands are sliced out and analyzed
also by LC/MS (see Note 11).

3.3 sRNA Function Phenotyping of gain- and loss-of-function sRNA mutants is the
and Target Regulation first approach of choice to evaluate the impact of the sRNAs in
rhizobial physiology. Phenotypes that can be evaluated typically
3.3.1 Construction of S.
include growth kinetics in different media, survival to stress, root
meliloti sRNA Mutants
colonization efficiency, or nodulation competence. For phenotype
complementation, it is recommended to clone the sRNAs under
the control of their own promoters into the single-copy pABCa
vector (this is more appropriate because antibiotics are dispensable
to retain the plasmid).
The sRNA deletion can be achieved by double recombination
according to the method described for Gram-negative bacteria
using pK18mobsacB that confers Km resistance and sucrose sensi-
tivity. To assess effects of gain of function, the sRNA deletion
mutant is transformed with pSKi-sRNA, which combines the
IPTG-inducible native system of pSRKKm (or pSRKGm) and the
S. meliloti sinR-sinI genes involved in quorum sensing to achieve a
strong pulse overexpression of the sRNA upon IPTG addition to
cultures [11]. Induced sRNA expression overcomes problems with
pleiotropic effects or weak overexpression from constitutive pro-
moters [24]. If the targeting motifs of the sRNA are known or
predicted, overexpression of sRNA variants containing point muta-
tions at these motifs can be used to assess the phenotype related to
their regulatory activity [23].
1. For pK18Δ sRNA construction, 0.8–1 kb fragments flanking
the sRNA locus are PCR amplified using genomic DNA and
primers containing the most convenient restriction enzyme
sites for subsequent cloning in pK18mobsacB.
2. Transform E. coli DH5α competent cells with the ligation
reaction and then plate them on kanamycin-containing LB
plates for incubation at 37 °C. Blue/white selection of trans-
formants with IPTG and X-gal is possible.
3. Verify successful integration of the insert by colony PCR using
PCR2 and PCR1 as primers flanking the insert in
pK18mobsacB.
 Characterization of Rhizobial sRNAs 197

4. Purify plasmid DNA from colonies showing the correct size

and check by sequencing with PCR2 as primer.
5. Transform E. coli S17.1 cells with the correct constructs for
biparental mating with the desired rhizobial strain (e.g.,
Sm2B3001).
6. Select transconjugants carrying the plasmid insertion in the
genome by simultaneous plating on TY agar supplemented
with Km or 10% sucrose. To select double recombinants, colo-
nies showing sucrose sensitivity and Km resistance are cultured
in liquid TY medium to OD600 1. Dispense dilutions from this
culture on TY agar containing 10% sucrose. Replicate visible
colonies in TY medium with Km or sucrose to select colonies
showing Km sensitivity and sucrose resistance. Loss of the wild-
type gene in the selected colonies is subsequently confirmed by
PCR or whole genome sequencing.
7. To construct pSKi-sRNA, the region sinR-PsinI is PCR ampli-
fied using genomic DNA as the template with the primers
sinR_NdeIF (GCCACATATGGCTAATCAACAGGCTGTC)
and TSS3_28bp_b_sinIR (GTAGCGATGCTGTCAGGCTC).
The sRNA is PCR amplified independently from genomic
DNA using primers to generate a fragment overlapping the
one of the sinR-PsinI region. These two PCR fragments are
used as template for a second round of PCR. The resulting
PCR product is restricted with NdeI and another enzyme
(typically, XbaI) to be inserted into pSRKKm to yield pSKi-
sRNA.
8. To generate pSKi-sRNA expressing sRNA mutant variants,
specific nucleotides within the sRNA targeting motifs are
replaced by a two-step PCR strategy based on overlapping
fragments using pSKi-sRNA as template. The first round of
PCR amplifications is performed with PCR2 and PCR1 and
their respective primer pairs carrying the desired mutations,
generating complementary PCR products which are used as
the template in the second PCR with PCR2/PCR1 primers
pair. The resulting products are digested with NdeI and the
restriction site selected and ligated to pSRKKm.
9. Repeat steps 2–4.
10. Transform E. coli S17.1 cells with the correct constructs for
biparental mating with the rhizobial strain Sm2019ΔsRNA
(ΔsinRsinI).

3.3.2 Validation of Unrevealing the trans-sRNAs function further requires the identi-
Candidate Target mRNAs fication of mRNA targets and dissection of the base-pairing inter-
actions. For that, comparative genomics-based predictions of most
probable conserved sRNA-mRNA interactions (e.g., CopraRNA,
IntaRNA, Target RNA algorithms) are used. Besides this, the
198 Natalia I. Garcı́a-Tomsig et al.

Fig. 4 Reporter assay for the genetic dissection of regulatory sRNA-mRNA antisense interactions in S. meliloti.
The sRNA and a translational fusion of its putative target mRNA to eGFP or 3xFLAG epitope are co-expressed
from compatible plasmids in the same bacterial cell lacking the sRNA locus. GFP-derived fluorescence or
immunodetection of the FLAG-tagged protein is then scored quantitatively to assess sRNA-mediated post-
transcriptional regulation of the target mRNA. Psyn is a constitutive promoter with a consensus σ70 signature

affinity chromatography using an aptamer-tagged (e.g., MS2)

sRNA allows genome-wide scale characterization of the sRNA
interactome [23, 27]. However, sRNA interactions with candidate
target mRNAs require experimental validation. For that, one exper-
imental approach is a two-plasmid genetic reporter assay based on
the co-expression in the same cell of the sRNA of interest from
pSKi-sRNA and a translational fusion of the putative mRNA targets
to eGFP cloned in the pR_eGFP vector [24]. Fluorescence of the
reporter strains is related to sRNA-mediated translational repres-
sion or activation of the mRNAs (Fig. 4). Alternatively, proteins
encoded by the putative target mRNAs can be tagged at either their
N- or C-termini with three consecutive units of the FLAG epitope
 Characterization of Rhizobial sRNAs 199

(3xFLAG) using the pR_FLAG plasmid. Co-expression of relevant

sRNA and mRNA mutant variants in the assays enables the precise
mapping of the interacting motifs in both molecules. The use of
pSKi-sRNA for a short pulse (15 min–2 h) sRNA overexpression is
also recommended for evaluation of mRNA levels by RT-qPCR.
1. The 5′-region of the mRNA of interest, from its TSS to the first
12–15 codons, is PCR amplified from genomic DNA using
primers to generate a fragment carrying the BamHI site in its
5′-end and the NheI site in its 3′-end. This fragment is
restricted and inserted between those sites in pR_eGFP. The
fusion is expressed constitutively from this plasmid. Similarly,
the 5′-region of the mRNA of interest along with the full-
length coding sequence (devoid of the stop codon) is amplified
by PCR and cloned between the BamHI and SphI sites in
pR_FLAG to express a FLAG-tagged protein (see Note 12).
2. Use E. coli DH5α competent cells for transformation with the
ligation reaction, and plate them in tetracycline-containing LB
plates for incubation at 37 °C.
3. Verify successful integration of the insert by colony PCR using
PCR2 and eGFP-139 (GATGAACTTCAGGGTCAGCTTG)
as primers flanking the insert in pR_eGFP or pJBsecF and
pJBsecRas primers flanking the insert in pR_FLAG.
4. Purify plasmid DNA with the correct insert size from colonies
and check by sequencing with PCR2 or pJBsec as primers.
5. Transform E. coli S17.1 cells with the correct constructs for
biparental mating with the rhizobial strain Sm2019 carrying
pSKi-sRNA expressing wild-type sRNA or its mutant variants.
6. Grow three double transconjugants for 48 h to stationary
phase in TY medium. Inoculate aliquots of 5 μL of each
pre-culture in TY medium and grow cells to early exponential
phase (OD600 0.2–0.3). Then, divide cultures into untreated
and 0.5 mM IPTG-treated cultures, and incubate for 12–24 h
before fluorescence measurement or immunoblotting.
7. Follow step 7 in Subheading 3.2.1 for fluorescence measure-
ment. In this case, fluorescence/OD600 values from IPTG-
treated cultures are normalized with respect to untreated sam-
ples. For Western blot, aliquots of cultures containing
cells equivalent to 0.05 OD600 are denatured by heating at
95 °C for 5 min, resolved in a conventional 10% SDS-PAGE,
and blotted onto a PVDF membrane. The membrane is probed
with a monoclonal anti-FLAG antibody (Sigma F7425; 1:
5000) as described [28]. The intensity of lanes is quantified
using ImageJ software (see Note 13).
200 Natalia I. Garcı́a-Tomsig et al.

4 Notes

1. TAP could be replaced by RNA 5′ pyrophosphohydrolase

(RppH, M0356, New England Biolabs) using 10X Thermopol
Buffer (B9004S, New England Biolabs) to remove pyropho-
sphates from the 5′ end of triphosphate RNA [29, 30].
2. To improve retention of sRNAs, RNA samples are loaded onto
the columns mixed with 7 volumes of 100% ethanol. Moreover,
the first wash buffer is not used. RNeasy® Plus kit also contains
columns that optimize elimination of genomic DNA. Never-
theless, the absence of DNA should be checked by routine PCR
using primer pairs to amplify any genomic locus.
3. Ensure that the storage buffer of the columns is completely
removed by centrifugation before adding the probes. The
labeling reaction volume is raised up 25–50 μL before loaded
onto column.
4. If a DNA size marker is loaded, cut the corresponding lane first
(make sure to leave the flanking lane sample free). This lane is
dried in a vacuum system on 3MM paper, covered with plastic
wrap, and stored. The DNA marker is previously labeled with
[γ-32P]-dATP.
5. Digoxigenin (DIG)-labeled oligonucleotide probes for hybri-
dization can be considered as an alternative to the radiolabeled
probes [31, 32].
6. The sRNA full-length sequence can be predicted using bioin-
formatics tools as TransTermHP [33] for detection of
rho-independent transcription terminators and TS Spredator
(https://tsspredator20-rtd.readthedocs.io/en/latest/index.
html) for prediction of TSS from RNA-Seq. In addition, the
command-line suite, ANNOgesic [34], integrates diverse bio-
informatics tools to predict TSS, termination sites, or con-
served promoter regions from different RNAseq data sets.
7. Alternatively, M-MLV reverse transcriptase provided with the
FirstChoice™ RLM-RACE Kit can be used. In this case, RNase
H-treatment is unnecessary.
8. If sRNA boundaries have been successfully determined, the
intracellular level of the transcript in different conditions
could be evaluated by RT-qPCR. Typically, qPCR requires
amplification of 100–120 bp PCR fragments. In our labora-
tory, sRNAs of at least 110-nt are efficiently and specifically
amplified by RT-qPCR. The constitutively expressed gene
SMc01852 is an appropriate endogenous control to normalize
gene expression in S. meliloti [7].
 Characterization of Rhizobial sRNAs 201

9. Alternatively, the promoter-eGFP transcriptional fusions can be

mobilized to the single-copy vector pABCa. For that, the
promoter region is amplified by PCR using primers AvrIISRFw
(CAATCCTAGGCACCGCGGGGAAGTACGCCA) and
AvrIIGFPRv (CGGCCCTAGGTTAGCAGCCGGATCCTTT
GTATAG), restricted with AvrII, and ligated to these sites in
pABCa. In this case, transconjugants are gentamicin-resistant,
and successful integration of the insert is verified by colony
PCR using pABC_Fw and pABC_Rv. Because the fluorescence
levels from pABCa are generally lower than those from pBB--
egfp, this plasmid is recommended to analyze promoters with
strong transcriptional activity, which if cloned into mid-copy
vectors could provoke alterations of bacterial growth. Another
advantage of this vector is the possibility to test the transcrip-
tional fusion in a S. meliloti strain co-transformed with the
pSRKKm vector expressing the candidate transcription factor
controlled by an IPTG-dependent promoter.
10. GFP fluorescence of transcriptional fusions during bacterial
root hair colonization and infection thread formation can be
observed at 6 and 9 days post-inoculation, respectively. Use
bacteria transformed with an empty vector as negative control
and pBBPsyn::egfp as positive control, which carries a transcrip-
tional fusion to a constitutive promoter. Due to the autoflor-
escence of roots, analysis by laser scanning confocal microscopy
and prior DAPI treatment of the samples should improve the
quality of images.
11. The sRNA promoter activity can be evaluated in loss- and gain-
of-function mutants in the transcription factor of interest.
Point mutations in the putative binding site of the promoter
sequence should abolish the inducing or repressor capacity of
the candidate protein. The DNA-protein interaction can be
further assessed by electrophoretic mobility shift assay
(EMSA) (e.g., using radiolabeled DNA). For that, binding
reactions are incubated on ice for 30 min, and electrophoresis
is performed at 4 °C to increase reproducibility. Alternatively, a
Dot blot assay can be performed using a nitrocellulose mem-
brane on a nylon membrane to retain protein/bound DNA or
free-DNA, respectively.
12. 5′-RACE can be used to determine the TSS of the candidate
target mRNA if it is unknown. Alternatively, a fragment con-
taining the putative promoter of the mRNA can be amplified
and cloned between the HindIII and NheI sites in pR_eGFP or
pR_FLAG to express the translational fusion from its own
promoter.
13. The regulatory activity of the sRNA carrying point mutations
at known or predicted targeting motifs should be lower than
that of the wild-type sRNA. Specific nucleotides within the
202 Natalia I. Garcı́a-Tomsig et al.

predicted mRNA interaction region can be replaced to com-

plement point mutations of sRNA and restore the regulatory
activity [23]. For that, follow step 8 in Subheading 3.3.1, but
using PCR2 and eGFP-139 or pJBsecF and pJBsecR for the
first round of PCR.

Acknowledgments

Work at J.I.J.-Z. laboratory has been supported by grants

BFU2017-82645-P and PID2020-114782GB-I00 funded by
MCIN/AEI/10.13039/501100011033 and by “ERDF A way
of making Europe” (BFU2017-82645-P) and grant P20_00185
funded by Junta de Andalucı́a PAIDI/FEDER/EU, all awarded to
J.I.J.-Z. S.K.G-G is supported by an FPU fellowship (FPU21/
05195) from Ministerio de Universidades.

References
1. Waters LS, Storz G (2009) Regulatory RNAs
in bacteria. Cell 136:615–628
2. Dutta T, Srivastava S (2018) Small
RNA-mediated regulation in bacteria: a grow-
ing palette of diverse mechanisms. Gene 656:
60–72
3. Mahendran G, Jayasinghe OT, Thavakumaran
D et al (2022) Key players in regulatory RNA
realm of bacteria. Biochem Biophys Rep 30:
101276
4. Wheatley RM, Ford BL, Li L et al (2020)
Lifestyle adaptations of Rhizobium from rhizo-
sphere to symbiosis. Proc Natl Acad Sci U S A
117:23823–23834
5. Udvardi M, Poole PS (2013) Transport and
metabolism in legume-rhizobia symbioses.
Annu Rev Plant Biol 64:781–805
6. Patriarca EJ, Tatè R, Iaccarino M (2002) Key
role of bacterial NH4+metabolism in Rhizo-
bium-plant symbiosis. Microbiol Mol Biol Rev
66:203–222
7. Becker A, Bergès H, Krol E et al (2004) Global
changes in gene expression in Sinorhizobium
meliloti 1021 under microoxic and symbiotic
conditions. Mol Plant-Microbe Interact 17:
292–303
8. Robledo M, Garcı́a-Tomsig NI, Jiménez-
Zurdo JI (2020) Riboregulation in nitrogen-
fixing endosymbiotic bacteria. Microorganisms
8:384
9. Schlüter JP, Reinkensmeier J, Barnett MJ et al
(2013) Global mapping of transcription start
sites and promoter motifs in the symbiotic
alpha-proteobacterium Sinorhizobium meliloti
1021. BMC Genomics 14:156
10. Bahlawane C, Baumgarth B, Serrania J et al
(2008) Fine-tuning of galactoglucan biosyn-
thesis in Sinorhizobium meliloti by differential
WggR (ExpG)-, PhoB-, and MucR-dependent
regulation of two promoters. J Bacteriol 190:
3456–3466
11. Robledo M, Frage B, Wright PR, Becker A
(2015) A stress-induced small RNA modulates
alpha-rhizobial cell cycle progression. PLoS
Genet 11:e1005153
12. Grant SGN, Jessee J, Bloom FR, Hanahan D
(1990) Differential plasmid rescue from trans-
genic mouse DNAs into Escherichia coli
methylation-restriction mutants. Proc Natl
Acad Sci U S A 87:4645–4649
13. Simon R, Priefer U, Puhler A (1983) A broad
host range mobilization system for in vivo
genetic engineering: transposon mutagenesis
in gram negative bacteria. Nat Biotech 1:784–
791
14. Sambrook J, Fritsch EF, Maniatis T (1989)
Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor
15. Beringer JE (1974) R factor transfer in Rhizo-
bium leguminosarum. J Gen Microbiol 84:
188–198
16. Robertsen BK, Aman P, Darvill AG et al
(1981) Host-symbiont interactions: V. The
structure of acidic extracellular polysaccharides
secreted by Rhizobium leguminosarum and
Rhizobium trifolii. Plant Physiol 67:389–400

17. Robledo M, Peregrina A, Millán V et al (2017)
A conserved α-proteobacterial small RNA con-
tributes to osmoadaptation and symbiotic effi-
ciency of rhizobia on legume roots. Environ
Microbiol 19:2661–2680
18. Döhlemann J, Wagner M, Happel C et al
(2017) A family of single copy repABC-type
shuttle vectors stably maintained in the alpha-
proteobacterium Sinorhizobium meliloti. ACS
Synth Biol 6:968–984
19. Schafer A, Tauch A, Jager W et al (1994) Small
mobilizable multi-purpose cloning vectors
derived from the Escherichia coli plasmids
pK18 and pK19: selection of defined deletions
in the chromosome of Corynebacterium gluta-
micum. Gene 145:69–73
20. Khan SR, Gaines J, Roop RM, Farrand SK
(2008) Broad-host-range expression vectors
with tightly regulated promoters and their use
to examine the influence of TraR and TraM
expression on Ti plasmid quorum sensing.
Appl Environ Microbiol 74:5053–5062
21. Torres-Quesada O, Millán V, Nisa-Martı́nez R
et al (2013) Independent activity of the homol-
ogous small regulatory RNAs AbcR1 and
AbcR2 in the legume symbiont Sinorhizobium
meliloti. PLoS One 8:1080–1091
22. Schneider CA, Rasband WS, Eliceiri KW
(2012) NIH image to ImageJ: 25 years of
image analysis. Nat Methods 9:671–675
23. Garcı́a-Tomsig NI, Robledo M, Dicenzo GC
et al (2022) Pervasive RNA regulation of
metabolism enhances the root colonization
ability of nitrogen-fixing symbiotic alpha-
rhizobia. mBio 13:e0357621
24. Robledo M, Garcı́a-Tomsig NI, Jiménez-
Zurdo JI (2018) Primary characterization of
small RNAs in symbiotic nitrogen-fixing bacte-
ria. Methods Mol Biol 1734:277–295
25. Urban JH, Vogel J (2008) Two seemingly
homologous noncoding RNAs act hierarchi-
cally to activate glmS mRNA translation.
PLoS Biol 6:e64
Characterization of Rhizobial sRNAs 203
26. Garcı́a-Tomsig NI, Garcı́a-Rodriguez FM,
Guedes-Garcı́a SK et al (2023) A double-
negative feedback loop between NtrBC and a
small RNA rewires nitrogen metabolism in
legume symbionts. mBio 18:e0200323
27. Lalaouna D, Massé E (2015) Identification of
sRNA interacting with a transcript of interest
using MS2-affinity purification coupled with
RNA sequencing (MAPS) technology. Geno-
mics Data 5:136–138
28. Robledo M, Matia-González AM, Garcı́a-
Tomsig NI, Jiménez-Zurdo JI (2018) Identifi-
cation of small RNA–protein partners in plant
symbiotic bacteria. Methods Mol Biol 1737:
351–370
29. Hetzel J, Duttke SH, Benner C, Chory J
(2016) Nascent RNA sequencing reveals dis-
tinct features in plant transcription. Proc Natl
Acad Sci U S A 113:12316–12321
30. Neri F, Rapelli S, Krepelova A et al (2017)
Intragenic DNA methylation prevents spurious
transcription initiation. Nature 543:72–77
31. Beckmann BM, Grünweller A, Weber MHW,
Hartmann RK (2010) Northern blot detection
of endogenous small RNAs (~14 nt) in bacte-
rial total RNA extracts. Nucleic Acids Res 38:
2–11
32. Kawamoto H, Koide Y, Morita T, Aiba H
(2006) Base-pairing requirement for RNA
silencing by a bacterial small RNA and acceler-
ation of duplex formation by Hfq. Mol Micro-
biol 61:1013–1022
33. Kingsford CL, Ayanbule K, Salzberg SL
(2007) Rapid, accurate, computational discov-
ery of Rho-independent transcription termina-
tors illuminates their relationship to DNA
uptake. Genome Biol 8:R22
34. Yu SH, Vogel J, Förstner KU (2018) ANNO-
gesic: a Swiss army knife for the RNA-seq based
annotation of bacterial/archaeal genomes.
Gigascience 7:1–11
 Chapter 13

Methods for Studying Swimming and Surface Motilities

in Rhizobia
Francisco Fuentes-Romero, Cynthia Alı́as-Villegas, Pilar Navarro-Gómez,
Sebastián Acosta-Jurado, Lydia M. Bernabéu-Roda, Virginia Cuéllar,
Marı́a J. Soto, and José M. Vinardell

Abstract
Rhizobia are soil proteobacteria able to establish a nitrogen-fixing interaction with legumes. In this
interaction, rhizobia must colonize legume roots, infect them, and become hosted inside new organs
formed by the plants and called nodules. Rhizobial motility, not being essential for symbiosis, might affect
the degree of success of the interaction with legumes. Because of this, the study of rhizobial motility (either
swimming or surface motility) might be of interest for research teams working on rhizobial symbiotic
performance. In this chapter, we describe the protocols we use in our laboratories for studying the different
types of motilities exhibited by Sinorhizobium fredii and Sinorhizobium meliloti, as well as for analyzing the
presence of flagella in these bacteria. All these protocols might be used (or adapted) for studying bacterial
motility in rhizobia.

Key words Rhizobia, Swimming, Surface motility, Swarming, Sliding, Flagella, Transmission electron
microscopy (TEM)

1 Introduction

Rhizobia are soil proteobacteria able to establish a nitrogen-fixing

symbiosis with legumes. In this interaction, rhizobia are attracted
by plant exudates, colonize root surfaces, enter into the roots
(infection), and colonize intracellularly new organs, nodules, cre-
ated by the plant in response to the presence of compatible rhizobia
[1, 2]. Inside nodules, rhizobia differentiate into bacteroids able to
fix N2 into ammonia that is mostly transferred to the plant. This
relation, which is highly specific (each rhizobial strain interacts with
a definite set of legumes), relies in a complex molecular dialogue.
When compatible legumes and rhizobia meet, flavonoids exuded by
legume roots interact with the rhizobial NodD protein, a LysR
transcriptional regulator that binds to conserved promoter

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_13,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

205
206 Francisco Fuentes-Romero et al.

sequences called nod boxes and activates the expression of bacterial

nodulation (nod) genes [3]. Rhizobial nod genes are responsible for
the production of molecular signals called Nod factors (NF) that,
when perceived by compatible legumes, trigger the infection pro-
cess and the nodule developmental program. In some rhizobia,
flavonoids and NodD also induce the expression of ttsI, which
codes for the positive transcriptional regulator of a symbiotic type
III secretion system (T3SS) that delivers effector proteins that are
important for host specificity and, in some rhizobia-legume inter-
actions, may promote nodulation in the absence of Nod factors [4].
Rhizobia transit between two types of lifestyles: as saprophytic
organisms in soils and as legume endosymbionts [5]. Motility of
rhizobia might play important roles in the colonization of the
different habitats [6]. Like other motile bacteria, rhizobia can
swim in liquid media and translocate across surfaces [7–
14]. Concerning symbiosis, different studies have shown that,
although rhizobial motility is not essential for nodulation and
nitrogen fixation, it may be important not only for root coloniza-
tion but also for progression into the roots and the nodules during
the infection process, thus affecting traits such as nodulation effi-
ciency and competitiveness. Also, several works have highlighted
the influence of plant exuded compounds on rhizobial motility:
strigolactones (phytohormones) promote swarming motility in S.
meliloti GR4 and Rhizobium leguminosarum bv. viciae, whereas
nod-gene-inducing flavonoids stimulate surface motility in S. fredii
HH103 [13–16]. For all these reasons, the study of bacterial
motility may be of interest for laboratories that focus their research
on the rhizobia-legume symbiosis.
As mentioned above, rhizobia may exhibit both swimming and
surface motility. The first is an individual movement of bacteria
propelled by flagella that takes place in liquid media and can be
studied by inoculating media with low agar concentrations (usually
0.3%), in which bacteria can swim through water-filled channels
within the agar [16, 17]. After a period of incubation, this kind of
translocation can be visualized as a semi-transparent halo located
inside the medium. Surface motility can be mediated by flagella-
dependent and flagella-independent mechanisms, and both have
been described in rhizobia [7–16]. Whereas swarming is dependent
on flagellar action, sliding is a passive movement promoted by
bacterial growth and facilitated by surfactant molecules. Surface
motility is studied by inoculating bacteria onto plates of media
with gelling agent concentrations between 0.4% (in order to pre-
vent swimming motility) and 1% [16]. After a period of incubation,
surface motility, regardless of the mechanism used by the bacte-
rium, is visualized as a bacterial spreading on the surface of the
medium. It is important to remark that this methodology allows to
visualize surface motility, but it does not distinguish between the
 Studying Motility in Rhizobia 207

different mechanisms responsible for this motility (such as swarm-

ing or sliding).
In this chapter, we summarize the methodologies that we
usually employ for analyzing swimming and surface motilities of
Sinorhizobium fredii HH103, a broad-host range rhizobial strain
able to nodulate with the important crop soybean [18]. In contrast
to S. meliloti, HH103 does not exhibit surface motility when
grown on semisolid minimal medium. However, the presence of
either nod gene-inducing flavonoids or high concentrations of
mannitol (non-ionic osmotic stress) promotes surface motility in
this strain in a symbiotic T3SS-dependent manner
[15, 19]. HH103 flavonoid-induced surface motility involves
both flagella-dependent and flagella-independent mechanisms and
requires the participation of the transcriptional regulators NodD1
and TtsI, which suggests a relevant role of this motility in symbiosis
with legumes [15]. On the other hand, the mannitol-induced
surface motility is absolutely dependent on the presence of flagella
(swarming) [19]. The concentration of gelling agent (agarose) used
to study surface motility in HH103 is rather low (0.4%), which
contrasts with the conditions used for S. meliloti strains
(MM supplemented with agar concentrations ranging from 0.6%
to 1%) [20]. Thus, when studying for the first time surface motility
in a rhizobial strain, it is strongly recommended to test different
sources and concentrations of gelling agents in order to determine
the most appropriate conditions for that strain. The use of the
lowest gelling agent concentrations will favor surface spreading
but also may hide putative inducing effects of the compounds to
be tested. Regarding swimming, a concentration of agar 0.3% is
usually adequate for most strains. In addition to swimming and
surface motility assays, in this chapter we also provide the method-
ology we use for the preparation of samples aimed at the visualiza-
tion of flagella by transmission electron microscopy (TEM).

2 Materials

2.1 Preparation 1. Balance and microbalance.

of Media 2. Reagents.
3. Deionized water.
4. Glass or plastic flasks or beakers.
5. Graduated cylinders.
6. pH meter.
7. Glass bottles with screw cap.
8. Autoclave.
208 Francisco Fuentes-Romero et al.

9. Cell culture media: media, immediately after preparation, are

autoclaved at 121 °C for 20 min and stored at room tempera-
ture (unless indicated otherwise). For media preparation:
10. Tryptone yeast (TY) broth: Prepare a beaker with 900 mL
water and add 5 g tryptone, 3 g yeast extract, and 0.9 g
CaCl2·2H2O. Mix thoroughly, and fill up with water to reach
1 L, using a graduated cylinder. Distribute in different glass
bottles and sterilize in autoclave as described above.
11. Bromfield agar (0.3%) medium (BM): Prepare a beaker with
900 mL water and add 0.4 g tryptone, 0.1 g yeast extract, and
0.1 g CaCl2·2H2O. Mix thoroughly and add water to reach 1 L
using a graduated cylinder. Distribute 400 mL of medium into
500 mL glass bottles containing 1.2 g agar and sterilize in
autoclave.
12. Minimal medium (MM): Prepare Solution I by dissolving
22.64 g K2HPO4 and 30 g KH2PO4 in 1 L of water. Prepare
Solution II by dissolving 15 g MgSO4·7H2O in 1 L of water.
Prepare Solution III by dissolving 5 g CaCl2·2H2O, 0.6 g
FeCl3·6H2O, and 5 g NaCl in 1 L of water (see Note 1).
Prepare a beaker with 900 mL water and add 1.1 g L-glutamic
acid monosodium salt and 10 g mannitol. Add 10 mL of each
solution (I, II, and III) to the beaker. Mix thoroughly and fill
up with water to reach 1 L using a graduated cylinder (see Note
2). For semisolid MM (0.4% agarose D1, low EEO), distribute
liquid MM into glass bottles containing the required amount
of agarose to obtain 0.4% concentration (see Note 3), and
sterilize in autoclave. Many rhizobia (not S. fredii HH103)
require a supplement of the vitamins biotin, thiamine, and
calcium pantothenate for appropriate growth in MM. The
required amount of a filter-sterilized (1000X) stock solution
of vitamins (containing biotin 0.27 g/L, thiamine 0.1 g/L,
and calcium pantothenate 0.1 g/L) is added once MM has
been autoclaved. Further details about the preparation of this
(1000X) stock solution of vitamins are indicated in [16].

2.2 Motility Assays 1. Glass tubes.

2. Tryptone yeast (TY) broth, Bromfield agar (0.3%) medium,
and semisolid (0.4% agarose) minimal medium (see
Subheading 2.1).
3. Spectrophotometer with a tube holder accessory.
4. Plastic Petri dishes.
5. Sterile conical tubes.
6. Parafilm.
7. 1.5 mL plastic tubes.
8. Microcentrifuge.
 Studying Motility in Rhizobia 209

9. Laminar flow cabinet.

10. Orbital shaker.
11. Incubator.

2.3 Image 1. Scanner or digital camera.

Acquisition 2. Photography software.

2.4 Sample 1. Formvar/Carbon 200 Mesh Copper grids (FCF200-CU;

Preparation for TEM Sigma-Aldrich).
2. Deionized water.
3. Automatic pipette.
4. Tweezers.
5. Parafilm.
6. Filter paper.
7. 2% Uranyl acetate.
8. Plastic Petri dishes.
9. Fume cabinet.

3 Methods

3.1 Swimming All procedures before incubation of cultures are performed under
Motility Assays sterile conditions in a laminar flow cabinet. The procedure is sum-
marized in Fig. 1.
1. Inoculate tubes containing 5 mL of TY broth with the bacterial
strains to be analyzed (see Notes 4 and 5).
2. Grow cultures overnight at 28 °C in an incubator with shaking
(180 rpm).
3. Measure the optical density at 600 nm (OD600nm) using a
spectrophotometer with a tube holder accessory.
4. Freshly prepared and autoclaved 0.3% agar BM medium must
be cooled down before use (see Note 6).
5. Pour exactly 25 mL of 0.3% agar BM per plate with the help of
a sterile conical tube. At least, three plates per condition and
strain should be prepared (see Note 7).
6. Close the plates, take them out from the laminar flow cabinet,
and let them solidify on the bench at room temperature for
2–3 h (see Note 8). Although, once solidified, plates may be
stored at 4 °C until use, at least for S. fredii HH103 the best
results in swimming assays are obtained with plates freshly
prepared.
210 Francisco Fuentes-Romero et al.

Fig. 1 Swimming motility assays. The different steps of the protocol are indicated
 Studying Motility in Rhizobia 211

7. Place 3 μL of an overnight-grown culture at a OD600nm ≈ 1.0

into the 0.3% BM plates (see Note 9).
8. Seal the plates with parafilm and incubate upside up at 28 °C
for 24 h.
9. After 24 h, turn the plates over and incubate them upside down
at 28 °C for 2 more days.
10. Measure (in mm) the swimming diameter after 24, 48, and
72 h of incubation, and either scan the plates or take photos
(see Note 10).

3.2 Surface Motility All procedures before incubation of cultures are performed under
Assays sterile conditions in a laminar flow cabinet. The procedure is sum-
marized in Fig. 2.
1. Proceed as described for the swimming motility assay in Sub-
heading 3.1 (steps 1 to 3) in order to obtain a bacterial culture
with OD600nm ~ 1.0.
2. Transfer 1 mL of each culture into sterile 1.5 mL microcentri-
fuge tubes. Centrifuge these tubes at 12,000 × g for 3 min.
3. Wash the pellet twice with 1 mL of liquid MM, carefully discard
the whole supernatant, and gently resuspend the pellet in a final
volume of 100 μL of liquid MM with the help of a micropipette
(no vortex) (see Note 11).
4. Prepare freshly autoclaved semisolid 0.4% agarose MM.
5. For each condition and strain, prepare at least three plates (see
Note 12) by pouring 20 mL of medium in each plate with the
help of a sterile conical tube. Distribute the plates at the back of
the laminar flow cabinet (see Note 13).
6. Let the plates dry with the lids partially open for exactly 15 min
(see Note 14). Then, close the plates. If bacterial inoculants are
ready (i.e., Steps 2 and 3 have already been done), you can
proceed directly to step 7. If bacterial inoculants are to be
prepared, keep the plates out of the laminar flow cabinet to
prevent further drying until steps 2 and 3 have been
performed.
7. Place 2 μL of the previously prepared bacterial suspension (step
3) on the center of the corresponding plates.
8. Let the drops dry for 10 min in the same way as described in
Step 6, and then close the lids.
9. Seal the plates with parafilm and incubate them upside down at
28 °C for 3 days.
10. Measure (in mm) the movement zones after 24, 48, and 72 h
of incubation (see Note 15).
212 Francisco Fuentes-Romero et al.

Fig. 2 Surface motility assays. The different steps of the protocol are indicated
 Studying Motility in Rhizobia 213

11. After 72 h of incubation at 28 °C, store the plates at 4 °C for

2 days before acquisition of images (see Note 16). Images can
be obtained either scanning or taking photos.

3.3 Sample Although these samples can be prepared by using liquid cultures, in
Preparation for our experience the best results are obtained by using bacterial
Visualization of colonies grown on semisolid MM. In this case, the samples are
Bacterial Flagella by collected 24 h after incubation of the plates. All procedures to
TEM prepare the transmission electron microscopy grids should be per-
formed in a fume cabinet. The procedure is summarized in Fig. 3.
1. Twenty four hours after incubation, add 25 μL of deionized
water at the edge of the bacterial colony.
2. Place a grid downside with the formvar/carbon layer on top of
the droplet for 5 min. Meanwhile place two droplets of 25 μL
each one of deionized water on a parafilm slice.
3. After 5 min, place the grid on one of the water droplets and
leave it for 1 min.
4. Then, place the grid on the other water droplet and leave it for
1 min.
5. Take the grid and dry it with filter paper (see Note 17) without
touching the surface (see Note 18).
6. Place a droplet of 25 μL of 2% uranyl acetate on a parafilm slice.
7. Place the grid downside on top of the 2% uranyl acetate droplet
for 3 min.
8. Take the grid and dry it with filter paper (see Note 17) without
touching the surface (see Note 18). Uranyl acetate is toxic, so
the generated residues must be disposed of adequately.
9. Dry the grid placing it with the formvar layer upside on a
parafilm slice in a plastic Petri dish and leave it at least for 1 h
(better around 24 h) in the fume cabinet.
10. Then, samples are ready to be visualized using a transmission
electron microscope. Alternatively, samples can be stored sev-
eral days at room temperature (preferably, inside an incubator
maintaining an 11.5% humidity) before visualization.

4 Notes

1. None of these solutions need to be prepared in sterile condi-

tions. Once prepared, they can be kept at room temperature.
Solution III must be stored in the dark.
2. If necessary, adjust pH to 6.8 with KOH 2.5 N.
3. The appropriate agarose concentration for studying surface
motility in S. fredii HH103 is 0.4%, but you should test
214 Francisco Fuentes-Romero et al.

Fig. 3 Sample preparation for visualization of bacterial flagella by TEM. The different steps of the protocol are
indicated
 Studying Motility in Rhizobia 215

different agarose (or other gelling agents) concentrations

(ranging from 0.4% to 1.0%) when you study for the first
time this kind of motility in your strain.
4. We strongly recommend inoculating these tubes directly from a
-80 °C glycerol vial to decrease variability among different
assays. Because of this, it is advisable to have a collection of
glycerol vials with the different strains to be studied.
5. It is advisable preparing several tubes with different amounts of
inoculum per strain to maximize the chance of obtaining cul-
tures with OD600nm around 1.0 by the next morning.
6. You need to cool this medium before pouring into plates. You
can let the medium in the oven or water bath at 55 °C for
several hours.
7. In the case you are studying the effect of a specific compound
on motility, you should add it to the plates at this step. Note
that if the compound is dissolved into a solvent other than
water, you must also prepare control plates supplemented
with this solvent and without the compound. As an example,
flavonoids are dissolved in ethanol. So, if you are studying the
effect of flavonoids on motility, plates supplemented with an
equivalent amount of ethanol must be included as a control.
8. Plates should be solidified out of the laminar flow cabinet to
avoid excessive drying of the medium.
9. Inoculate the rhizobial strain into the medium by slightly
puncturing it with the sterile tip. Note that you can assay
different strains (no more than four) in the same plate, leaving
an appropriate separation between them.
10. Images might be acquired either by using a scanner or by
taking photos with an appropriate digital camera.
11. Steps 2 and 3 can be carried out while plates are solidifying
(step 6). Concentrated cultures can be kept at room tempera-
ture meanwhile plates are being prepared.
12. Since surface spreading might extend to the whole plate sur-
face, only one strain should be inoculated per plate; moreover,
because surface motility assays show high variability, it is highly
recommendable to perform at least three independent experi-
ments with at least three replicates (n ≥ 9 per strain and
condition).
13. If possible, in order to have a uniform drying of the media, all
the plates should be placed at the same distance from the back
surface of the cabinet (the origin of the laminar flow).
14. The degree of dryness of the medium has a high influence on
surface motility. Therefore, the optimal drying time must be
strictly adhered to. To achieve this purpose, the use of timers is
strongly recommended.
216 Francisco Fuentes-Romero et al.

15. We usually perform two measurements per plate: the maximum

length and the maximum width of the migration zone. The
borders of the migration zone might be difficult to detect. It is
usually easier when the plates are placed on a black surface. As
another option, the area of surface migration can be deter-
mined using the software ImageJ.
16. After 48 h of incubation at 4 °C, the borders of the migration
zone usually become sharper, which facilitates the acquisition
of clear images and accurate measurements.
17. The filter paper must be pre-cut into small triangles.
18. Dry the grid carefully by only bringing the paper close to the
edges of the grid.

Acknowledgments

This work was supported by grants PID2019-107634RB-I00 and

PID2021-123540NB-I00 funded by MCIN/AEI/ 10.13039/
501100011033 and “ERDF A way of making Europe,”
US-1250546 funded by FEDER/Universidad de Sevilla,and
grant P20_00225 from “Consejerı́a de Economı́a, Conocimiento,
Empresas y Universidad” (Junta de Andalucı́a, PAIDI 2020).

References

1. Roy S, Liu W, Nandety RS et al (2020) Cele-
brating 20 years of genetic discoveries in
legume nodulation and symbiotic nitrogen fix-
ation. Plant Cell 32:15–41
2. Yang J, Lan L, Jin Y et al (2022) Mechanisms
underlying legume-rhizobium symbioses. J
Integr Plant Biol 64:244–267
3. López-Baena FJ, Ruiz-Sainz JE, Rodrı́guez-
Carvajal MA, Vinardell JM (2016) Molecular
signals in the Sinorhizobium fredii soybean
symbiosis. Int J Mol Sci 17:E755
4. Jiménez-Guerrero I, Medina C, Vinardell JM
et al (2022) The rhizobial type 3 secretion sys-
tem: the Dr. Jekyll and Mr. Hyde in the Rhizo-
bium-legume symbiosis. Int J Mol Sci 23:
11089
5. Poole P, Ramachandran V, Terpolilli J (2018)
Rhizobia: From saprophytes to endosym-
bionts. Nat Rev Microbiol 16:291–303
6. Aroney STN, Poole PS, Sánchez-Cañizares C
(2021) Rhizobial chemotaxis and motility sys-
tems at work in the soil. Front Plant Sci 12:
725338
7. Wadhwa N, Berg HC (2022) Bacterial motil-
ity: machinery and mechanisms. Nat Rev
Microbiol 20:161–173
8. Soto MJ, Fernández-Pascual M, Sanjuán J, Oli-
vares J (2002) A fadD mutant of Sinorhizobium
meliloti shows multicellular swarming migra-
tion and is impaired in nodulation efficiency
on alfalfa roots. Mol Microbiol 43:371–382
9. Daniels R, Reynaert S, Hoekstra H et al (2006)
Quorum signal molecules as biosurfactants
affecting swarming in Rhizobium etli. Proc
Natl Acad Sci U S A 103:14965–14970
10. Tambalo DD, Yost CK, Hynes MF (2010)
Characterization of swarming motility in Rhi-
zobium leguminosarum bv. viciae. FEMS
Microbiol Lett 307:165–174
11. Nogales J, Bernabéu-Roda L, Cuéllar V, Soto
MJ (2012) ExpR is not required for swarming
but promotes sliding in Sinorhizobium meliloti.
J Bacteriol 194:2027–2035
12. Covelli JM, Althabegoiti MJ, López MF, Lode-
iro AR (2013) Swarming motility in Bradyrhi-
zobium japonicum. Res Microbiol 164:136–
144
13. Tambalo DD, Vanderlinde EM, Robinson S
et al (2014) Legume seed exudates and Physco-
mitrella patens extracts influence swarming
behaviour in Rhizobium leguminosarum. Can
J Microbiol 60:15–24

14. Peláez-Vico MA, Bernabéu L, Kohlen W et al
(2016) Strigolactones in the Rhizobium-
legume symbiosis: stimulatory effect on bacte-
rial surface motility and down-regulation of
their levels in nodulated plants. Plant Sci 246:
119–127
15. Alı́as-Villegas C, Fuentes-Romero F, Cuéllar V
et al (2022) Surface motility regulation of
Sinorhizobium fredii HH103 by plant flavo-
noids and the NodD1, TtsI, NolR, and
MucR1 symbiotic bacterial regulators. Int J
Mol Sci 23:7698
16. Bernabéu-Roda LM, López-Ráez JA, Soto MJ
(2021) Analyzing the effect of strigolactones
on the motility behavior of Rhizobia. In:
Prandi C, Cardinale F (eds) Strigolactones.
Methods in molecular biology, vol 2309.
Humana, New York, pp 91–103
Studying Motility in Rhizobia 217
17. Ames P, Schluederberg SA, Bergman K (1980)
Behavioral mutants of Rhizobium meliloti. J
Bacteriol 141:722–727
18. Margaret I, Becker A, Blom J et al (2011)
Symbiotic properties and first analyses of the
genomic sequence of the fast growing model
strain Sinorhizobium fredii HH103 nodulating
soybean. J Biotechnol 155:11–19
19. Fuentes-Romero F, Moyano-Bravo I, Ayala-
Garcı́a P et al (2023) Non-ionic osmotic stress
induces the biosynthesis of nodulation factors
and affects other symbiotic traits in Sinorhizo-
bium fredii HH103. Biology 12:148
20. Bernabéu-Roda L, Calatrava-Morales N,
Cuéllar V, Soto M (2015) Characterization of
surface motility in Sinorhizobium meliloti: reg-
ulation and role in symbiosis. Symbiosis 67:1–
12
 Chapter 14

Isolation, Quantification, and Visualization of Extracellular

Membrane Vesicles in Rhizobia Under Free-Living
Conditions
Paula Ayala-Garcı́a, Natalia Moreno-de Castro, Irene Jiménez-Guerrero,
Mathias Müsken, Alejandro Arce-Rodrı́guez, Francisco Pérez-Montaño,
and José Manuel Borrero-de Acuña

Abstract
Rhizobia are a group of soil proteobacteria that are able to establish a symbiotic interaction with legumes.
These bacteria are capable to fix atmospheric nitrogen into ammonia within specific plant root organs called
nodules. The rhizobia-legume interaction is established by a complex molecular dialogue that starts with
flavonoids exudated by the plant roots. In response, signaling molecules known as Nod factors (NFs) are
secreted by the bacteria. These factors are sensed by specific plant receptors that trigger a downstream
signaling cascade leading to rhizobium-specific intracellular colonization of the root hair via the formation
of infection threads and the eventual development of nodules on roots. In these organs, rhizobia can fix
nitrogen from the atmosphere for the plant in exchange for photosynthates and the appropriate environ-
ment for nitrogen fixation. Recently, it has been demonstrated that extracellular membrane vesicles (EMVs)
produced by some rhizobia carry NFs. EMVs are proteolipidic structures that are secreted to the milieu
from the bacterial membranes and are involved in several important biological processes, including
intercellular communication. Thus far, little is known about rhizobia vesicles, and further studies are needed
to understand their functions, including their role as transporting vessels of signaling molecules during the
process of symbiosis. Here, we present a detailed protocol to isolate high-purity EMVs from free-living
cultured rhizobia, test their integrity, and quantify their abundance.

Key words Rhizobium, Symbiosis, Flavonoids, Nodulation factors, Extracellular membrane vesicles

1 Introduction

Nitrogen is an essential macronutrient for plant growth and crop

yields, typically supplied to crops as fertilizers when phytoavailabil-
ity is low [1]. Despite of their relevance, the industrial synthesis of
N-fertilizers contributes to the production of greenhouse gases [2],

These two authors contributed equally to this work.

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_14,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

219
220 Paula Ayala-Garcı́a et al.

and its use in agriculture provokes eutrophication processes in

water [3]. Therefore, alternative means are needed to supply
crops with nitrogen, such as the use of rhizobia in symbiosis with
legume plants. Rhizobia are a group of soil proteobacteria that are
able to establish a symbiotic interaction with legumes, in order to
fix atmospheric nitrogen into ammonia inside specialized root
organs called nodules. By such means, rhizobia increase the nitro-
gen availability to the host plant and improve plant performance
[4], which makes the rhizobial biofertilization of legumes a highly
advantageous strategy for a sustainable and environment-friendly
agriculture.
The rhizobium-legume symbiotic interaction is established by a
complex molecular dialogue that starts with flavonoids exuded
from legume roots into the rhizosphere. Compatible flavonoids
are recognized by rhizobial NodD transcriptional regulators [5]
that in turn activates the expression of the bacterial nod genes
[6, 7]. These genes encode the Nod proteins that are involved in
the synthesis and export of specific lipo-chitooligosaccharides
molecules, also known as Nod factors (NFs) [8]. These NFs are
then recognized by specific plant LysM receptor-like kinases trig-
gering a downstream transduction cascade. This signaling process
leads to root hair tissue differentiation and reorganization, and
rhizobium-specific intracellular colonization usually through the
formation of infection threads, which culminates with the nodule
development [9]. Besides the initial molecular recognition
mediated by flavonoids and NFs, other types of bacterial molecules
are necessary for a successful nodulation process, such as surface
polysaccharides or proteins secreted through the type III secretion
system [10].
Although the nodulation process has been extensively studied,
additional players of the molecular crosstalk are still to be deter-
mined. In this context, several studies have highlighted the essential
role of extracellular membrane vesicles (EMVs) in bacterial-
bacterial communication and bacterial-host interactions [11]. The
EMVs are spherical, mono- or bilayer lipidic structures of nano-
metric size (typically from 20 to 400 nm) that are released into the
external milieu, playing a role in several biological processes. For
example, EMVs can be fused with membranes of other bacteria or
can be internalized into eukaryotic cells, releasing their content
and, thus, operating as transport vessels [12–15]. This interplay
has recently been proposed to add an additional layer in the molec-
ular dialogue of the holobiont [16]. In the case of the rhizobium-
legume symbiosis, during the infective process many physiological
changes take place, some of which might be mediated by these
membranous vehicles. Supporting these suggestions, recent studies
have discovered the presence of NFs inside of EMVs of Rhizobium
etli exclusively when grown in the presence of naringenin, a flavo-
noid that induce the expression of this bacterium nod genes
 Extracellular Membrane Vesicles Isolation from Rhizobia 221

[17]. This finding could be pointing out a new way of bacterium-

plant interaction wherein the NFs are being transported from the
rhizobium to the plant.
Here we describe a detailed protocol to isolate high-purity
rhizobial EMVs in free-living conditions. The model organism
used for developing this protocol is Rhizobium tropici CIAT899,
a broad host range rhizobial strain that nodulates some legumes,
including Lotus japonicus, Lotus burttii, and the economically rele-
vant crop Phaseolus vulgaris. This bacterium also presents high
tolerance to external stress – such as high levels of acidity or high
temperatures – and has a great diversity of Nod factors
[18]. Besides, this bacterium has the capacity to produce these
signaling molecules in acid and saline environments or in the
absence of molecular signals from the plant [19–22]. The method-
ology for EMVs isolation is a stepwise process of centrifugation,
filtration, ultrafiltration, and ultracentrifugation, in order to sepa-
rate the vesicles from the rest of the cellular and culture media
constituents and concentrate them. Following the isolation, we
apply different techniques to evaluate the vesicles integrity and
quantity.

2 Materials

The following protocol requires standard equipment found in

microbiology and molecular biology laboratories. These include
an autoclave, biological laminar flow hood, incubator, shaker,
refrigerator, -80 °C and -20 °C freezers, spectrophotometer,
centrifuges, plate reader, vacuum pump, pipettes, scale, etc. Special
equipment required in this protocol encompass ultracentrifuge, a
NanoSight and a transmission electron microscope (see below). In
addition, routine microbiology and molecular materials and devices
are needed, including pipettors, forceps, plastic tips, tubes with
different volumes, laboratory glass bottles, Erlenmeyer flasks,
Petri dishes, media components, sterile ultrafiltered water, syringe
filters, etc.

2.1 Bacterial Strains 1. Bacterial strains: Rhizobium tropici CIAT899.

and Culture Medium 2. Tryptone yeast (TY) medium: dissolve 3 g yeast extract, 5 g
tryptone, and 0.65 g CaCl22H2O in 1 L of distilled water. Add
agar 2% for TY agar plates. Autoclave at 121 °C for 20 min.
3. 3.7 mM apigenin: dissolve 1 mg apigenin in 1 mL of 100%
ethanol.
4. 0.5 M NaOH: dissolve 20 g sodium hydroxide in 1 L of
distilled water.
222 Paula Ayala-Garcı́a et al.

2.2 Centrifugation 1. Beckman Coulter Avanti J-E series centrifuge.

Process 2. JA-14 centrifuge rotor.
3. 200 mL centrifuge bottles.

2.3 Filtration 1. 150 mL bottle with a 0.2 μm polyether sulfone bottle top filter.
Process 2. Vacuum pump.
3. 50 mL syringe.
4. Syringe filter (0.2 μm pore size).

2.4 Ultrafiltration 1. Vivaflow 50R easy load ultrafiltration system.

Process 2. Vivaflow 50R 30,000 MWCO Hydrosart membrane.

2.5 1. Beckman Optima L-90K ultracentrifuge.

Ultracentrifugation 2. 45 Ti ultracentrifuge rotor.
Process
3. 70.1 Ti ultracentrifuge rotor.
4. 70 mL capacity ultracentrifuge tubes.
5. 8 mL capacity ultracentrifuge tubes.
6. 20 mMHEPES buffer: dissolve 238.3 g HEPES and 90 g NaCl
in 1 L distilled water. pH 7.0.

2.6 Integrity 1. Sputter coater with carbon evaporation function.

Evaluation and 2. Carbon coated-mica.
Quantification Assays
3. Uranyl acetate solution: dissolve 40 mg uranyl acetate in 1 mL
distilled water.
4. Transmission electron microscope (TEM).
5. 10X FM4-64 (N-(3-Triethylammoniumpropyl)-4-
(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibro-
mide) fluorescent membrane dye: dissolve 100 μg FM4-64 in
2 mL sterile distilled water (50 μg/mL). Store at 4 °C.
6. Hanks balanced salt solution (HBSS): dissolve 0.4 g KCl,
0.06 g KH2PO4, 8 g NaCl, 0.05 g Na2HPO4, and 1 g glucose
in 1 L of distilled water. Store at 4 °C.
7. 96-well microtiter plate.
8. Multiplate reader.
9. NanoSight NS300 Marvern Panalitycal nanoparticle analyzer
equipped with a 488 nm laser module.

3 Methods

Prepare the solutions using distilled water or analytical grade

reagents and use sterilized materials. Most manipulations must be
 Extracellular Membrane Vesicles Isolation from Rhizobia 223

done under aseptic conditions, with the employment of a laminar

flow cabinet being strongly recommended. Carefully follow the
waste disposal regulations of your institution/local government
for the management of waste materials.

3.1 EMVs Isolation 1. Inoculate a fresh colony of R. tropici CIAT899 in an Erlen-

meyer flask containing 10 mL of TY medium. Incubate for 72 h
at 28 °C with continuous shaking at 180 rpm.
2. Inoculate 3 mL of the saturated culture in a 1 L Erlenmeyer
flask containing 300 mL of TY medium. Supplement with
300 μL of apigenin (3.7 mM) or 300 μL of 100% ethanol as
negative control (see Note 1). Grow at 28 °C with continuous
shaking at 180 rpm.
3. Grow the culture to an optical density at 600 nm (OD600) of
0.7–0.8 (around 16 h).
4. Distribute the culture into 2 200 mL centrifuge bottles
(150 mL each). Centrifuge at 5000 × g for 30 min.
5. Pour the supernatants into new 200 mL centrifuge bottles
(discard the pellet). Centrifuge again at 7000 × g for 30 min.
6. Mix the supernatants in a clean 500 mL bottle. Filter the
supernatant with a standard vacuum filtration system, and use
bottles with a 0.2 μm polyethersulfone bottle top filter. Keep
the sterile eluent at 4 °C (see Note 2).
7. Concentrate the eluent from 300 to 50 mL with the Vivaflow
50R easy load ultrafiltration system using Vivaflow 50R 30,000
(kDa) MWCO Hydrosart membranes and following manufac-
turer instructions (see Notes 3 and 4).
8. Filter the concentrated supernatant using a 50 mL syringe and
a 0.2 μm filter.
9. Transfer the whole concentrated supernatant into 70 mL ultra-
centrifuge tubes. Use sterile TY and a precision scale to even
the weight of the tubes (see Note 5). Centrifuge at 100,000 g
and 4 °C for 2 h using 45 Ti ultracentrifuge rotor.
10. Remove completely the supernatant using a micropipette to
ensure that there is no liquid left, but take care to not disturb
the pellet. Carefully resuspend the pellet in 300 μL of ice-cold
HEPES buffer.
11. For proteomic purposes, heat at 65 °C for 5 min to avoid
flagellin contamination, scale up to 5 mL with ice-cold
HEPES buffer and ultracentrifuge again with the same condi-
tions using 8 mL ultracentrifuge tubes and 70.1 Ti ultracentri-
fuge rotor (see Note 6).
224 Paula Ayala-Garcı́a et al.

Fig. 1 Workflow described in this chapter for the rhizobial extracellular membrane vesicles (EMVs) isolation
cultured in free-living conditions

12. Carefully resuspend the pellet in 300 μL of ice-cold HEPES

buffer. Store the vesicle containing samples at 4 °C. Sample is
stable for months (Fig. 1).

3.2 Microscopy for For the negative staining of EMVs, use the grid-on drop method
EMVs Integrity with droplets of approx. 30–50 μL.
Evaluation
1. Prepare carbon-coated mica by vacuum evaporation on a
freshly cleaved mica beforehand (see Note 7).
2. Cut a piece of parafilm to allow the pipetting of 4 droplets in a
row next to each other, and plan the according number of rows
in dependence of your sample number (drop 1: sample, drop
2 + 3: distilled water, drop 4: 4% aqueous uranyl acetate).
3. Take a small piece of a carbon-coated mica and apply it to the
sample drop to float off the carbon support film.
4. After 30–60 s, overlay the carbon film with a cooper grid
(300 mesh) and lift it up together with adsorbed molecules.
5. Wash the grid on the two droplets of distilled water by dipping
it in and out.
6. Carefully take away the excessive liquid by a filter paper.
7. Put the grid on a drop with 4% (w/v) aqueous uranyl acetate.
 Extracellular Membrane Vesicles Isolation from Rhizobia 225

Fig. 2 Extracellular membrane vesicles (EMVs) integrity and quantification analyses described in this chapter.
(a) EMVs evaluation by Transmission Electron Microscopy analysis. (b) EMVs quantification using the FM4-64
lipid dye staining and (c) nanoparticle tracking analysis by means of the NanoSight system

8. Lift up the grid after 45 s and take away the excessive liquid
with a filter paper before heat-drying the grid by the heat of a
filament lamp (see Note 8).
9. Examine the samples at the TEM to evaluate the vesicles integ-
rity (Fig. 2a). We used a Zeiss Libra 120 Plus at an acceleration
voltage of 120 kV and at calibrated magnifications.

3.3 Lipid Dye for
EMVs Quantification
1. Prepare theFM4-64 dye 1X mixing 500 uL of FM4–6410X
and 4.5 mL of HBSS.
2. Mix 50 μL of each EMVs sample with 50 μL of FM4-64 dye
1X. As blank control, mix 50 μL of HEPES buffer with 50 μL
of FM4-64 dye 1X (see Note 9).
3. Add the individual samples into a 96-well microtiter plate and
introduce it in a multiplate reader.
4. Measure the fluorescence of the samples using an excitation/
emission wavelength range of 558 nm/734 nm (Fig. 2b).

3.4 Nanoparticle 1. Dilute the EMVs sample to a protein concentration of 0.1 μg/
Tracking Analysis for mL (see Note 10).
EMVs Quantification
226 Paula Ayala-Garcı́a et al.

2. Apply a monochromatic laser beam at 488 nm to the EMVs

sample using the NanoSight NS300 Marvern Panalitycal nano-
particle analyzer.
3. From each sample, take 90 s videos at 23 °C.
4. Analyze particle movement by nanoparticle tracking analysis
software with the minimal expected particle size, minimum
track length, and blur setting all set to automatic.
5. Analyze each video with the nanoparticle tracking analysis soft-
ware following manufacturer’s instructions to quantify and size
EMVs (Fig. 2c).

4 Notes

1. 100% ethanol is added to TY medium as a control, since

apigenin is dissolved in this organic solvent.
2. From this point on, all the steps must be carried out on ice or at
low temperatures (4 °C). Moreover, the use of gloves is highly
recommended.
3. Before using the ultrafiltration system, wash the container with
distilled water and subsequently with 100% ethanol. Between
samples, wash the container with distilled water, with 0.5 M
NaOH solution, and then again with distilled water. Before
storing the system, wash it with 0.5 M NaOH and distilled
water. Finally, add 10% ethanol into the filter and store it at 4 °
C. Wash all hoses with distilled water.
4. Once the desired volume is reached in the upper section of the
concentrator device, resuspend with a micropipette to make
sure all the vesicles are separated from the membrane.
5. The weight of the samples into the tubes must be equilibrated
to the milligram before carrying on with the
ultracentrifugation.
6. Skip this step if EMV samples are not subsequently analyzed by
proteomics.
7. Freshly cleaved mica should be prepared 1 day before use and
can be used for weeks.
8. Make sure that uranyl acetate waste (radioactive!) is properly
disposed.
9. Depending on total EMVs concentration, samples can require
a previous dilution to optimize lipid quantification.
10. Normalization of the total protein amount in each sample can
be determined using standard protein concentration assays,
such as Bradford, BCA assay, Nanodrop, or other method
compatible with your sample.
 Extracellular Membrane Vesicles Isolation from Rhizobia 227

Acknowledgments

This work was supported by research grants: EMERGIA20_00048

from the Junta de Andalucı́a, Consejerı́a de transformacióneconó-
mica, industria, conocimiento y universidades, the ProyEx-
cel_00450 from the Junta de Andalucı́a, Consejerı́a de
Universidad, Investigación e Innovación, the PID2021-
122395OA-I00 and the PID2020-118279RA-I00 from the Span-
ish Ministry of Science and Innovation. We thank Ina Schleicher for
EM sample preparation.

References

1. WhiteP J, Brown P (2010) Plant nutrition for
sustainable development and global health.
Ann Bot 105:1073–1080
2. Smith P, Martino D, Cai Z et al (2008) Green-
house gas mitigation in agriculture. Philos
Trans R Soc Lond B Biol Sci 363:789–813
3. ConleyD J, PaerlH W, Howarth RW et al
(2009) Controlling eutrophication: nitrogen
and phosphorus. Science 323:1014–1015
4. Oldroyd GE (2013) Speak, friend, and enter:
signalling systems that promote beneficial sym-
biotic associations in plants. Nat Rev Microbiol
11:252–263
5. Cooper JE (2007) Early interactions between
legumes and rhizobia: disclosing complexity in
a molecular dialogue. J Appl Microbiol 103:
1355–1365
6. Spaink HP, Kondorosi A, Hooykaas PJ (eds)
(2012) The Rhizobiaceae: molecular biology of
model plant-associated bacteria. Springer Sci-
ence & Business Media, Dordrecht, Boston:
Kluwer Academic
7. Peck MC, Fisher RF, Long SR (2006) Diverse
flavonoids stimulate NodD1 binding to nod
gene promoters in Sinorhizobium meliloti. J
Bacteriol Res 188:5417–5427
8. Dénarié J, Debellé F, Promé JC (1996) Rhizo-
bium lipo-chitooligosaccharide nodulation fac-
tors: signaling molecules mediating
recognition and morphogenesis. Annu Rev
Biochem 65:503–535
9. Radutoiu S, Madsen LH, Madsen EB et al
(2003) Plant recognition of symbiotic bacteria
requires two LysM receptor-like kinases.
Nature 425:585–592
10. López-Baena FJ, Ruiz-Sainz JE, Rodrı́guez-
Carvajal MA et al (2016) Bacterial molecular
signals in the Sinorhizobium fredii-soybean
symbiosis. Int J Mol Sci 17:755
11. Borrero de Acuña JM, Bernal P (2021) Plant
holobiont interactions mediated by the type VI
secretion system and the membrane vesicles:
promising tools for a greener agriculture. Envi-
ron Microbiol 23:1830–1836
12. Turnbull L, Toyofuku M, Hynen AL et al
(2016) Explosive cell lysis as a mechanism for
the biogenesis of bacterial membrane vesicles
and biofilms. Nat Commun 7:1–13
13. Orench-Rivera N, Kuehn MJ (2016) Environ-
mentally controlled bacterial vesicle-mediated
export. Cell Microbiol 18:1525–1536
14. Bitto NJ, Chapman R, Pidot S et al (2017)
Bacterial membrane vesicles transport their
DNA cargo into host cells. Sci Rep 7:1–11
15. Toyofuku M, Nomura N, Eberl L (2019)
Types and origins of bacterial membrane vesi-
cles. Nat Rev Microbiol 17:13–24
16. Middleton H, Yergeau É, Monard C et al
(2021) Rhizospheric plant–microbe interac-
tions: miRNAs as a key mediator. Trends
Plant Sci 26:132–141
17. Taboada H, Dunn MF, Meneses N et al (2019)
Qualitative changes in proteins contained in
extracellular membrane vesicles produced by
Rhizobium etli grown in the presence of the
nod gene inducer naringenin. Arch Microbiol
201:1173–1194
18. Martı́nez-Romero E, Segovia L, Mercante FM
et al (1991) Rhizobium tropici, a novel species
nodulating Phaseolus vulgaris L. beans and
Leucaena sp. trees. Int J Syst Evol Microbiol
41:417–426
19. del Cerro P, Rolla-Santos AAP, Gomes DF et al
(2015) Opening the “black box” of nodD3,
nodD4 and nodD5 genes of Rhizobium tropici
strain CIAT899. BMC Genomics 16:1–10
20. del Cerro P, Rolla-Santos AAP, Gomes DF et al
(2015) Regulatory nodD1 and nodD2 genes of
Rhizobium tropici strain CIAT899 and their
roles in the early stages of molecular signaling
and host-legume nodulation. BMC Genomics
16:1–13
228 Paula Ayala-Garcı́a et al.
21. del Cerro P, Pérez-Montaño F, Gil-Serrano A
et al (2017) The Rhizobium tropici CIAT899
NodD2 protein regulates the production of
Nod factors under salt stress in a flavonoid-
independent manner. Sci Rep 7:46712
22. Pérez-Montaño F, del Cerro P, Jiménez-Guer-
rero I et al (2016) RNA-seq analysis of the
Rhizobium tropici CIAT899 transcriptome
shows similarities in the activation patterns of
symbiotic genes in the presence of apigenin and
salt. BMC Genomics 17:198
 Chapter 15

Isolation of Rhizobial Extracellular Membrane Vesicles

from Bacteroids
Paula Ayala-Garcı́a, Irene Jiménez-Guerrero, Mathias Müsken,
Francisco Javier Ollero, José Manuel Borrero-De Acuña,
and Francisco Pérez-Montaño

Abstract
Extracellular-membrane vesicles (EMVs) are spherical buds of the extracellular membrane, commonly
produced by Gram-negative bacteria, known to mediate intricate inter-kingdom communication. In this
context, comprehensive research dissecting the role of EMVs in one of the most complex nature-occurring
molecular dialogues, rhizobium-legume symbiosis, has been so far neglected. During the different stages of
the symbiotic process, rhizobia and their host plants establish a very specific and controlled intercellular
trafficking of signal molecules. Thus, as conveyors of a broad range of molecules into the target cell, EMVs
are gaining weight in the field. Here, we describe a detailed protocol to isolate EMVs from bacteroids of
legume nodules, opening a new door for discovering new authors of the symbiotic process.

Key words Symbiosis, rhizobium, Legume, Bacteroids, Symbiosome, Extracellular membrane vesicles

1 Introduction

Legume plants establish symbiotic interactions with soil-borne

bacteria known as rhizobia. In this mutualist relationship, the
plant develops specific root organs, termed nodules, where rhizobia
convert atmospheric nitrogen to ammonia, a plant-assimilable form
of nitrogen. In exchange, legume supplies bacterium with carbon
source and a stable and protected environment [1].
A successful symbiotic interaction requires a sophisticated
molecular exchange of signals between bacteria and plants. The
symbiosis onset occurs when compatible flavonoids exudated by
the legume roots are recognized by rhizobia. In response to these
flavonoids, bacteria induce the synthesis and secretion of specific
molecules, known as Nod factors (NF), which are sensed by appro-
priate legumes, triggering infection thread (ITs) formation, root
cortex cell division, and finally the nodule formation [2–5]. ITs are

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_15,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

229
230 Paula Ayala-Garcı́a et al.

tubular structures developed by root hair membrane invagination,

through which rhizobia are penetrating until they reach the cortex
cells, where bacteria are released into the cytoplasm of the plant cell
by endocytosis [6, 7]. At this stage, bacteria undergo a differentia-
tion to bacteroids, where the atmospheric nitrogen fixation takes
place. Due to endocytosis, bacteroids are encapsulated by the host
membrane conforming the so-called symbiosomes, reason why the
space between bacteroid and plant cell membrane is named sym-
biosome space (SS) [8, 9]. Thus, the SS acts as unobstructed
interface for material exchange and signal communication between
microsymbionts and host cells [10, 11].
EMVs are spherical, bacterial extracellular membrane-based
structures with an approximate diameter of 40–150 nm [12]. In
general, EMVs are catalogued as transport vehicles for important
biological molecules, including lipids, lipopolysaccharides,
enzymes, signaling molecules, toxins, and nucleic acids [13]. The
formation of EMVs by Gram-negative bacteria seems to be a uni-
versal process, participating these evaginations in processes such as
quorum sensing, digestion of nutrients, immunomodulation, hori-
zontal DNA transfer, excretion of misfolded proteins, or toxin
delivery [14].
In case of rhizobia, insights into the role of EMVs at initial steps
of the symbiotic process are emerging in the past years. Along these
lines, two recent proteomic studies of EMVs isolated from Rhizo-
bium etli and Sinorhizobium fredii in the presence of their respec-
tive nodulation-gene-inducing flavonoids indicate significant
differences in protein cargo when comparing with that present in
EMVs isolated in the absence of these symbiotic signals
[15, 16]. This observation points out the idea that EMVs may be
playing a significant role at early stages of the symbiotic process.
However, to our knowledge, no reports addressing the characteri-
zation of rhizobial EMVs during late stages of symbiosis, i.e., from
bacteroids and/or symbiosomes, have been published so far.
In this chapter, we detail a protocol to successfully isolate
EMVs from nodule bacteroids, which will open a door to analyze
and characterize the EMV cargo by different -omic approaches.

2 Materials

The following protocol is described for the Rhizobium tropici

CIAT899-Phaseolus vulgaris symbiosis, but it could be extended
to any other symbiotic partners. This protocol requires standard
equipment in microbiology, molecular biology, including auto-
clave, biological hood, incubators, shakers, refrigerators, -80 °C
and -20 °C freezers, spectrophotometer, and centrifuges. In addi-
tion, facilities for plant growth as well as routine microbiology and
molecular materials and devices are needed. Unless otherwise
 Extracellular Membrane Vesicles Isolation from Bacteroids 231

specified, prepare all solutions with distillate H2O, and store all
reagents at room temperature. Despite no sterile conditions are
required in Subheading 3.4, it is recommended the use of gloves
and keep the samples on ice.

2.1 Inoculum 1. Rhizobium tropici CIAT899 strain.

Preparation 2. Tryptone yeast (TY) medium: dissolve 3 g yeast extract, 5 g
tryptone, and 0.65 g of CaCl2·2H2O in 1 L of distilled water.
Add agar 2% for TY agar plates. Autoclave at 121 °C for 20 min.
3. Yeast mannitol (YM10) liquid medium: dissolve 500 mg
K2HPO4, 200 mg MgSO4 7H2O, 100 mg NaCl, 400 mg
yeast extract, and 10 g mannitol in 1 L of distilled water. Adjust
pH to 6.8–7 and autoclave at 121 °C for 20 min.
4. Distillated water.
5. Standard Petri dishes.
6. Autoclave.
7. pH meter.
8. Sterile flasks and tubes.

2.2 Plant Inoculation 1. Phaseolus vulgaris seeds.

Assay 2. 1% Agar-water medium: mix 1 g of agar in 100 mL of distilled
water. Autoclave at 121 °C for 20 min.
3. 6% sodium hypochlorite.
4. Sterile distilled water.
5. Perlite.
6. Vermiculite.
7. Ropes.
8. Iron citrate solution: dissolve 5 g of iron citrate in 1 L of
distilled water with heat.
9. Gibson solution: dissolve 2.86 g of H3BO3, 2.08 g of
MnSO4·H2O, 0.22 g of ZnSO4·7H2O, 0.08 g of
CuSO4·5H2O, and 0.13 g of Na2MoO4 in 1 L of distilled water.
10. Fahraeus nitrogen free solution: dissolve 100 mg
CaCl2·2H2O, 120 mg MgSO4·7H2O, 100 mg KH2PO4,
75 mg Na2HPO4·2H2O, 1 mL iron citrate, and 1 mL Gibson
solutions in 1 L of distilled water. Adjust pH to 6.5–7.
11. Standard Petri dishes.
12. Container to mix perlite and vermiculite.
13. Autoclave.
14. Sterile glass bottle for sterilizing seeds.
15. 2 L glass container.
16. Bottom-excised glass bottle.
232 Paula Ayala-Garcı́a et al.

Fig. 1 Schematic view of legumes growth units in nodulation assays, the so-called Leonard jars

17. Leonard jars preparation (Fig. 1):,mix perlite and vermiculate

in a proportion 1:3 (see Note 1). Wash the vermiculite-perlite
mixture 3 times with water. Add 1.5 L of Fahraeus solution 1X
in a 2 L glass container. Fill the bottom-excised glass bottle
with the vermiculite-perlite mixture and place over the Fah-
raeus container, both connected by a rope. Autoclave the jars at
121 °C for 20 min. Once cold, cover the Fahraeus container to
avoid microbial contamination.
18. Plant growth chamber or greenhouse.

2.3 Nodule EMV 1. MMS solution: 40 mM 3-(4-morpholino)-propane sulfonic

Fraction Collection acid, 20 mM KOH, 2 mM MgSO4, and 0.3 M sucrose. Adjust
the pH to 7.0 and autoclave at 121 °C for 20 min.
2. Mortar.
3. Pestle.
4. 40 μm filter.
5. 0.2 μm filter.
6. 10 mL syringes.
7. Centrifuge.
8. 15 mL sterile conical tubes.
9. Centrifuge tubes.
10. Precision balance.
 Extracellular Membrane Vesicles Isolation from Bacteroids 233

2.4 EMV Isolation 1. Phosphate-Buffered Saline (PBS) 10X: dissolve 8 g NaCl, 0.2 g
and Concentration by KCl, 1.44 g Na2HPO4, and 0.245 g KH2PO4 in 1 L of distilled
Ultracentrifugation water. Autoclave at 121 °C for 20 min.
2. 0.2 μm filter.
3. 10 mL syringe.
4. Centrifuge.
5. Centrifuge tubes.
6. Optima-MAX Beckman Coulter ultracentrifuge.
7. MLA-80 Beckman ultracentrifuge rotor.
8. 8 mL ultracentrifuge tubes appropriate for MLA-80 rotor.

3 Methods

3.1 Culture 1. Plate Rhizobium tropici CIAT899 in TY agar plate and incubate
Preparation at 28 °C for 48 h.
2. Inoculate a single colony in 5 mL of TY liquid media. Grow at
28 °C with continuous shaking to stationary phase.
3. Add 1 mL from this culture to20 mL YM10 liquid medium (see
Note 2) and incubate at 28 °C with continuous shaking until
the optical density at 600 nm reaches 0.6 (approximately
109 cells/mL).

3.2 Plant Inoculation 1. If needed, wash Phaseolus vulgaris seeds with sterile distilled
Assay water to remove the bactericide cover (see Notes 3 and 4).
3.2.1 Seed Germination 2. Place seeds in a sterile bottle with 6% sodium hypochlorite
solution for 5 min.
3. Wash with sterile distilled water 6 times.
4. Place seeds in 1% agar-water plates and incubate in the dark at
28 °C for 3 days to germinate them (see Note 5).

3.2.2 Seed Inoculation 1. Place 2 sterilized seedlings per Leonard jar (see Note 6).
and Nodule Harvesting 2. Add 1 mL of bacterial suspension per seed (OD600nm 0.6).
3. Place jars in a controlled plant chamber or greenhouse with the
following conditions: 16 h/26 °C and light, and 8 h/18 °C
dark, with 70% constant humidity.
4. After 30 days post-inoculation (dpi), harvest a total of 100 root
nodules from at least 3 different Leonard jars (see Note 7).

3.3 Symbiosome 1. Grind nodules using mortar and pestle in 10 mL of MMS

Space Collection solution (Fig. 2a, b).
2. Filter the crushed nodule material using 40 μm filters to discard
the plant tissues.
3. Centrifuge the eluents at 0.1 × g for 5 min and discard the
pellets to remove plant debris.
234 Paula Ayala-Garcı́a et al.

Fig. 2 Workflow described in this chapter for the nodule extracellular membrane vesicles (EMVs) isolation. (a)
Legume nodule schematic representation. The symbiosome and bacteroids are indicated by arrows. (b)
Nodule EMVs fraction collection. (c) EMVs isolation and concentration by ultracentrifugation

4. Centrifuge the supernatants at 2.2 × g for 5 min.

5. Collect the supernatants in a 15 mL sterile conical tube.
6. Resuspend the pellets from step 4 in Subheading 3.3 in 5 mL
MMS solution.
7. Centrifuge at 2.2 × g for 5 min (see Note 8).
8. Add the supernatants to the same tubes of step 5 in Subhead-
ing 3.3 (Fig. 2b).

3.4 Isolation and 1. Centrifuge tubes containing approximately 5.5 mL of symbio-

Concentration of EMVs
by Ultracentrifugation
some space samples at 7000 × g and 4 °C for 20 min.
2. Discard the pellets and filter the supernatants using 0.2 μm
filters.
3. Place the filtered eluents in ultracentrifuge tubes appropriate
for Beckman 70.1 Ti Rotor and balance to 10-2 × g accuracy.
4. Ultracentrifuge samples at 150,000 × g at 4 °C for 2 h (see Note
9).
5. Carefully remove completely the supernatant with the help of a
microtip.
6. Resuspend the pellet in 100 μL of PBS buffer and store EMVs
samples at 4 °C (Fig. 2c) (see Note 10).
 Extracellular Membrane Vesicles Isolation from Bacteroids 235

3.5 Integrity and 1. Microscopy for EMVs integrity evaluation, lipid dye, and nano-
Quantification of EMVs particle tracking analysis for EMVs quantification are described
in detail in the Chapter 14.

4 Notes

1. Make the perlite-vermiculite mix in a ventilated room and use

mask to prevent inhalation of dust from the perlite stock.
2. TY is a rich medium to grow optimally R. tropici CIAT899
from -80 °C stock. However, it presents high salt concentra-
tion that might interfere with the plant growth. Thus, YM10
medium is used to prepare the inoculant after growing this
bacterium on TY plates from -80 °C.
3. P. vulgaris seeds used for this experiment have a red bactericide
covert, which is easily removed with water and hand gently rub.
4. Because not all seeds germinate, the number of seeds needed
for the experiment should be higher than strictly required.
5. Time required for seed germination is usually 2–3 days.
6. Number of seedlings per Leonard jar depends on the plant and
jar size. For small plants such as Lotus japonicus, 2–3 seedlings
are recommended, while for bigger plants such as Phaseolus
vulgaris, sow only one seedling.
7. The nodule harvesting time point varies according to the plant
growth period and the number of nodules developed by the
legume, which in turn depends on the rhizobia-legume part-
ner. R. tropici CIAT899-P. vulgaris symbiosis provides many
nodules (approximately 100 nodules per plant – after 30 dpi).
8. The pellet resulted from this centrifugation corresponds to the
bacteroid cells.
9. Before ultracentrifugation, tube weights must be perfectly
equalized in a precision balance.
10. EMVs are stable at 4 °C for months.

Acknowledgments

This work was supported by research grants: EMERGIA20_00048

from the Junta de Andalucı́a, Consejerı́a de transformacióneconó-
mica, industria, conocimiento y universidades, the ProyEx-
cel_00450 from the Junta de Andalucı́a, Consejerı́a de
Universidad, Investigación e Innovación, the PID2021-
122395OA-I00 and PID2020-118279RA-I00 from the Spanish
Ministry of Science and Innovation.
236 Paula Ayala-Garcı́a et al.
References
1. Oldroyd GE (2013) Speak, friend, and enter:
signaling systems that promote beneficial sym-
biotic associations in plants. Nat Rev Microbiol
11:252–263
2. Cooper JE (2007) Early interactions between
legumes and rhizobia: disclosing complexity in
a molecular dialogue. J Appl Microbiol 103:
1355–1365
3. Ormeño-Orrillo E, Menna P, Almeida LG et al
(2012) Genomic basis of broad host range and
environmental adaptability of Rhizobium tro-
pici CIAT 899 and Rhizobium sp. PRF
81 which are used in inoculants for common
bean (Phaseolus vulgaris L.). BMC Genomics
13:735
4. Geurts R, Bisseling T (2002) Rhizobium Nod
factor perception and signalling. Plant Cell 14:
239–249
5. Janczarek M, Rachwał K, Marzec A et al (2015)
Signal molecules and cell-surface components
involved in early stages of the legume- rhizo-
bium interactions. Appl Soil Ecol 85:94–113
6. Clúa J, Roda C, Zanetti ME et al (2018) Com-
patibility between legumes and rhizobia for the
establishment of a successful nitrogen-fixing
symbiosis. Genes 9:125
7. Mergaert P, Uchiumi T, Alunni B et al (2006)
Eukaryotic control on bacterial cell cycle and
differentiation in the Rhizobium-legume sym-
biosis. Proc Natl Acad Sci U S A 103:5230–
5235
8. Schneider S, Schintlmeister A, Becana M et al
(2019) Sulfate is transported at significant rates
through the symbiosome membrane and is
crucial for nitrogenase biosynthesis. Plant Cell
Environ 42:1180–1189
9. Day D, Poole P, Tyerman S et al (2001)
Ammonia and amino acid transport across sym-
biotic membranes in nitrogen-fixing legume
nodules. Cell Mol Life Sci 58:61–71
10. Luo Y, Liu W, Sun J et al (2022) Quantitative
proteomics reveals key pathways in the symbi-
otic interface and the likely extracellular prop-
erty of soybean symbiosome. J Genet
Genomics 50:7–19
11. Haag AF, Arnold MFF, Myka KK et al (2013)
Molecular insights into bacteroid development
during Rhizobium-legume symbiosis. FEMS
Microbiol 37:364–383
12. Mashburn-Warren LM, Whiteley M (2006)
Special delivery: vesicle trafficking in prokar-
yotes. Mol Microbiol 61:839–846
13. Jan AT (2017) Extracellular membrane vesicles
(EMVs) of Gram-negative bacteria: a perspec-
tive update. Front Microbiol 8:1053
14. Haurat MF, Elhenawy W, Feldman MF (2015)
Prokaryotic membrane vesicles: new insights
on biogenesis and biological roles. Biol Chem
396:95–109
15. Taboada H, Dunn MF, Meneses N et al (2019)
Qualitative changes in proteins contained in
extracellular membrane vesicles produced by
Rhizobium etli grown in the presence of the
nod gene inducer naringenin. Arch Microbiol
201:1173–1194
16. Li D, Li Z, Wu J et al (2022) Analysis of extra-
cellular membrane vesicles indicates that gly-
cerophospholipid metabolism contributes to
early symbiosis between Sinorhizobium fredii
HH103 and soybean. Mol Plant-Microbe
Interact 35:311–322
 Chapter 16

Nod Factor Lipopolysaccharide Purification to Study

Nitrogen-Fixing Bacteria Symbiosis with Legumes
Catherine N. Jacott, Sara Lozano-Morillo, and Pablo del Cerro

Abstract
Nod factors (NF) are lipochitooligosaccharides produced by nitrogen-fixing rhizobia bacteria. They are key
components of the rhizobia-plant signaling exchange required for symbiosis. Thus, techniques to extract,
detect, characterize, and purify NF are crucial for the identification of both rhizobial and plant mechanisms
underlying nitrogen-fixing symbiosis. Here, we describe a method for NF detection using radiolabeling and
thin-layer chromatography. Furthermore, we describe a technique for purifying NF for downstream
analyses.

Key words Nod factors, Chromatography, Nodulation, Rhizobium-legume symbiosis, Nitrogen

fixation

1 Introduction

Rhizobia are nitrogen-fixing bacteria that can form a symbiosis with

legume plants. During this symbiosis, rhizobia convert atmospheric
nitrogen to ammonia, increasing nitrogen availability to the host
plant and improving plant performance. Establishing the legume-
rhizobia symbiotic interaction requires complex molecular commu-
nication between both organisms [1]. A key component of this
signaling exchange is the production, export, and host recognition
of rhizobial Nod factors (NF).
NF are lipochitooligosaccharides produced in response to cer-
tain flavonoids from compatible host plant species. Firstly, compat-
ible flavonoids exudated from legume roots activate rhizobial
NodD proteins [2, 3]. Next, NodD proteins activate the expression
of nodulation (nod) genes which encode proteins involved in the
synthesis and export of NF [4, 5]. Finally, NF are perceived by host
plant receptors which trigger a downstream signaling cascade –
including nuclear calcium spiking and the transcription of genes

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_16,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

237
238 Catherine N. Jacott et al.

required for symbiosis – and finally rhizobial colonization of the

plant root [6, 7].
NF structure, conferred by their backbone and nod gene-
dependent decorations, is key to host compatibility [8, 9]. NF
backbones vary from three to five N-acetyl glucosamine residues
in length. They can have saturated or unsaturated bonds, an N-acyl
chain at their non-reducing end, and different decorations at the
reducing end including fucose, arabinose, or sulfate [10, 11].
The development of various techniques to extract, detect,
characterize, and purify NF was crucial for the identification of
both rhizobial and plant mechanisms underlying nitrogen-fixing
symbiosis [12]. For example, thin-layer chromatography (TLC)
can be a powerful tool to rapidly detect and separate NF. TLC
was first used by Spaink et al. (1992) to detect previously unknown
NF and to demonstrate the role of nodABC genes in synthesizing
the NF backbone structure [13]. This assay involves growing rhi-
zobial cultures in the presence of 14C (N-acetyl-d-[1-14C]-glucos-
amine in the protocol described below, see Subheading 3.2),
extracting radiolabeled NF from culture using n-butanol, and
separating radiolabeled NF using TLC [13]. This technique was
fundamental for investigating the rhizobial genes, host plant flavo-
noid signals, and environmental conditions involved in NF produc-
tion [14–17].
Additionally, the development of NF purification was crucial
for researching NF specificity and the host plant mechanisms
underlying NF recognition and downstream symbiotic signaling
[12]. Purifying NF involves growing rhizobial cultures and extract-
ing NF from cultures using n-butanol, followed by C18 reverse
phase column-based separation to obtain fractions containing NF
(see Subheading 3.3). Purified NF can be used for mass spectrome-
try analysis to identify the NF species produced by different rhizo-
bia and the rhizobial genes involved [16]. They are also routinely
used in experiments with host plants to investigate the plant signal-
ing cascade required for rhizobial colonization, for example,
NF-induced nuclear calcium spiking and transcription of symbiotic
genes [10, 18–22].
Here, we describe rhizobial growth conditions for NF produc-
tion (see Subheading 3.1) and downstream analysis and purification
of NF:NF detection using radiolabeling and TLC (see Subheading
3.2) and NF purification (see Subheading 3.3) (Fig. 1).

2 Materials

The following equipment and materials are required for rhizobial

growth and NF production, NF detection using radiolabeling, and
NF purification.
 Nod Factor Purification 239

Fig. 1 Snapshot of the methods for radiolabeling, thin-layer chromatography, and extraction of Nod factors

2.1 Rhizobial Growth 1. Tryptone yeast (TY) medium: dissolve 3 g yeast extract, 5 g
for NF Production tryptone, and 0.65 g of CaCl2 2H2O in 1 L of distilled water.
Add agar 2% for TY agar plates. Autoclave at 121 °C for 20 min.
240 Catherine N. Jacott et al.

2. Appropriate antibiotics (if required for rhizobial selection).

3. B- minimal medium base: 10 g/L mannitol, 0.55 g/L
MgSO4·7H2O, 0.55 g/L KNO3, and 1.3 g/L Ca
(NO3)2·4H2O.
4. Trace elements (400X): 0.609 g/L MnSO4·H2O, 0.1 g/L
ZnSO4·7H2O, 1.27 g/L H3BO3, 0.4 g/L Na2MoO4·2H2O,
and 0.04 g/L CuSO4·5H2O.
5. Vitamins solution: 1 mg/mL thiamine, 0.5 mg/mL biotin.
Autoclave at 0.7 atmosphere for10 min.
6. Fe-EDTA solution: 1.3 g Fe(III)-EDTA in 100 mL distilled
water (dH2O).
7. Phosphate solution: 1.36 g K2HPO4 in 100 mL dH2O.
8. B- minimal medium: Add 2.5 mL trace elements, 2.5 mL
Fe-EDTA, 1 mL vitamins solution, and 10 mL phosphate
solution and complete to a final volume of 1 L with B- base
solution.
9. Appropriate flavonoid (at a concentration required for Nod-
factor induction) (see Note 1).
10. Laminar flow hood.
11. Incubator at 28 °C (for rhizobia plates).
12. Shaking incubator at 28 °C (for rhizobia cultures).

2.2 Radiolabeling 1. N-acetyl-d-[1-14C]-glucosamine (0.2 μCi) (specific activity,

and Thin-Layer 0.05 mCi) (see Note 2).
Chromatography 2. n-Butanol (absolute).
3. Acetonitrile (absolute).
4. TLC (thin-layer chromatography) plate (see Note 3).
5. Flat-bottomed TLC chamber.
6. Photographic film (see Note 4).
7. Shaking incubator at 28 °C in designated radioactivity area.
8. Shaker (room temperature) in designated radioactivity area.
9. Centrifuge (for 2 mL tubes) in designated radioactivity area.
10. Speed-vacuum concentrator in designated radioactivity area.
11. Phosphor image system (method to detect radioactive
material).

2.3 NF Purification 1. n-Butanol (absolute).

2. C18 cartridge (see Note 5).
3. Methanol (absolute).
4. Large centrifuge (capacity for 250/500/1000 mL bottles).
 Nod Factor Purification 241

5. Peristaltic pump + inlets.

6. Shaking incubator at 28 °C.

3 Methods

3.1 Rhizobial Growth
for NF Production
1. Streak out the desired rhizobial strain on the TY plate contain-
ing antibiotics (if required).
2. Incubate at 28 °C for 2–4 days (according to the strain growth
rate; see Note 6).
3. Inoculate one colony in 10 mL of TY medium containing
antibiotics (if required).
4. Incubate culture (with shaking) for 2–4 days (according to the
strain growth rate).

3.2 Radiolabeling 1. Inoculate 200 μL of culture (from Subheading 3.1) in 5 mL of

and Thin-Layer B- minimal medium supplemented with the appropriate
Chromatography NF-inducing flavonoid (if necessary; see Note 1).
3.2.1 Radiolabeling of NF
2. Incubate culture (with shaking) at 28 °C for 2–4 days (accord-
ing to the strain growth rate).
3. Inoculate 50 μL of culture in 1 mL of B- minimal medium
supplemented with the appropriate NF-inducing flavonoid
(if necessary).
4. Move tubes to the designated radioactivity area.
5. Add 0.2 μCi of N-acetyl-d-[1-14C]-glucosamine (specific activ-
ity, 0.05 mCi) to each tube.
6. Incubate culture (with shaking) at 28 °C for 3–5 days (accord-
ing to the strain growth rate).

3.2.2 NF Extraction 1. Prepare a 1:1 mix of n-butanol:dH2O and shake for 10 h and
then leave for another 10 h without shaking to allow phase
separation. Collect the upper phase (n-butanol saturated with
water) (see Note 7).
2. Centrifuge the cultures (from step 4 of Subheading 3.2.1) at
10,000 × g for 15 min. Collect supernatant (approx. 1 mL) in a
new tube. Discard tube with pellet.
3. Add 500 μL of n-butanol saturated with water. Shake during
3–4 h at room temperature.
4. Centrifuge tubes at 10,000 × g for 3 min. Collect the upper
phase (containing NF) in a new tube.
5. Use a vacuum centrifuge and a speed-vacuum concentrator
until the liquid has evaporated.
6. Resuspend the remaining precipitate in 20–30 μL of n-butanol
saturated with water (see Notes 8 and 9).
242 Catherine N. Jacott et al.

Fig. 2 Thin layer chromatography analysis of NF produced by Rhizobium tropici CIAT 899 and its different nodA
mutant derivatives in the presence of 14C-labeled N-acetyl glucosamine cultures were induced with 3.7 μM
apigenin (+). Control without apigenin (-). (This figure is adapted from del Cerro et al. (2019) [23] with the
permission of the publisher (Springer Nature))

3.2.3 Thin-Layer
Chromatography
1. Load the samples at the base of the TLC plate (see Note 10).
Allow plates to dry (see Note 11).
2. Place the TLC plate in a flat-bottomed TLC chamber using a 1:
1 mix of acetonitrile/dH2O as the mobile phase.
3. Put the lid in the TLC chamber and seal using grease (see Note
12).
4. Wait for 30–90 min until the mobile phase reaches the top of
the plate via capillarity.
5. Expose the TLC plate to a photographic film for 7 days (see
Note 13).
6. Reveal the film in a phosphor image system. Example TLC
result (Fig. 2).

3.3 NF Purification 1. Inoculate 1 mL of culture (from Subheading 3.1) in 100 mL of

3.3.1 Generating a Large
Volume of NF-Producing
Rhizobia
B- minimal medium supplemented with the appropriate
NF-inducing flavonoid (if necessary; see Note 1).
2. Incubate culture (with shaking) at 28 °C for 2–4 days (accord-
ing to the strain growth rate; see Note 6).
3. Inoculate 100 mL of culture in 1 L of B- minimal medium with
the appropriate NF-inducing flavonoid (if necessary).
4. Incubate at 28 °C for 3–5 days (according to the strain
growth rate).
 Nod Factor Purification 243

3.3.2 NF Extraction and 1. Divide culture into centrifuge-compatible tubes (e.g., 250 mL
Purification tubes) and centrifuge at max speed.
2. Collect supernatant (approx. 1 L) in a new flask. Discard
pellets.
3. Add 300 mL of n-butanol. Shake for 24 h at room temperature
followed by 12 h to allow phase separation.
4. Collect the upper phase (containing NF) in a new tube.
5. Pump the collected liquid phase through a C18 cartridge (see
Note 14).
6. Elute the sample in five different concentrations of methanol
(in dH2O): 2.5 mL of 20%, 40%, 60%, 80%, and 100%
methanol.
7. Check which fraction contains NF by assaying biological activ-
ity in a compatible host plant (NF-induced root hair deforma-
tion/calcium splining/symbiosis gene expression). NF are
usually present in the 60%, 80%, and 100% fractions.

4 Notes

1. For some rhizobial strains, for example, for the Mesorhizobium

loti R7Astrain, the flavonoid inducer is unknown. In these
cases, we recommend using root exudates from the compatible
legume to induce NF synthesis. An alternative is performing
conjugation to introduce a vector carrying the nodD gene from
a different rhizobial strain where the flavonoid inducer is
known. This will not affect the NF decoration of the sample.
2. We use N-acetyl-d-[1-14C]-glucosamine (Perkin-Elmer, Wal-
tham, MA); however, other 14C-labeled compounds can be
used, for example, 14C-acetate [13].
3. We use glass TLC plates (RP-18F254S; Merck, Darmstadt,
Germany), but other types of TLC plates (e.g., silica) and
suppliers can be used.
4. We use Fuji BAS-IIIs film, but other suppliers of photographic
film for exposing radioactivity can be used.
5. We use C18 cartridges (Sep-Pak; Waters, Elstree, UK), suppli-
ers, and cartridges for solid phase extraction.
6. For all incubation steps in the above protocols, incubate rhizo-
bial cultures until they reach the stationary growth phase
(approximately) to ensure sufficient rhizobial growth and NF
production. Some rhizobia reach the stationary phase in 48 h
but others in 72–96 h.
244 Catherine N. Jacott et al.

7. After mixing n-butanol with dH2O, it is important to take the

upper phase. This phase corresponds to the polar phase of the
mixture. It is important to wait at least 10 h to make sure that
only the phase containing n-butanol is taken.
8. After the liquid evaporates, a “desiccated precipitate” will
remain. This precipitate will be resuspended with n-butanol
saturated with water.
9. During the vacuum centrifugation, wait until all the liquid is
evaporated. This way, you can resuspend the NF samples in
equal volumes of n-butanol saturated with water to obtain NF
concentrations roughly in equal ranges.
10. When loading the samples in the TLC, we recommend doing it
at least 2 cm from the bottom of the plate. This will be
important when we put the plate into the TLC chamber. The
TLC chamber will contain acetonitrile/dH2O. The level of this
solution should be lower than the loading point of the TLC
plate.
11. Start by loading only 10 μL of each sample at the bottom of the
TLC plate. Wait for the sample to dry before considering
adding a greater volume of the sample. If you add too much
volume in one go, the samples may spread and mix as the TLC
plate absorbs the sample. You can use a fan or hair dryer to
accelerate the drying.
12. We recommend using silicon-based grease to seal the TLC
chamber. If you do not have this material in your lab, thick
hand/feet cream will do the job.
13. Initially expose the TLC plate to photographic film for 7 days.
Depending on the signal obtained in the film, we recommend
extending or reducing the number of days of exposure. More-
over, larger or smaller volumes of the sample can be loaded in
the TLC plates.
14. Sep-Pak C18 cartridges are a type of solid-phase extraction
product. They are made of high-purity silica and coated with
C18, which is a hydrophobic and non-polar stationary phase.
The C18 coating is effective in selectively retaining non-polar
and moderately polar compounds such as steroids and lipids
(like NF) while allowing more polar compounds such as sugars
and amino acids to pass through. These cartridges are widely
used in sample preparation for liquid chromatography and
mass spectrometry analysis.

References

1. Oldroyd GED (2013) Speak, friend, and enter:
signaling systems that promote beneficial sym-
biotic associations in plants. Nat Rev Microbiol
11:252–263
2. Hassan S, Mathesius U (2012) The role of
flavonoids in root-rhizosphere signalling:
opportunities and challenges for improving
plant-microbe interactions. J Exp Bot 63:
3429–3444

3. Cooper JE (2007) Early interactions between
legumes and rhizobia: disclosing complexity in
a molecular dialogue. J Appl Microbiol 103:
1355–1365
4. Schlaman HRM, Phillips DA, Kondorosi E
(1998) Genetic organization and transcrip-
tional regulation of rhizobial nodulation
genes. In: Spaink HP, Kondorosi A, Hooykaas
PJJ (eds) The Rhizobiaceae: molecular biology
of model plant-associated bacteria. Springer,
Dordrecht, pp 361–386
5. Peck MC, Fisher RF, Long SR (2006) Diverse
flavonoids stimulate NodD1 binding to nod
gene promoters in Sinorhizobium meliloti. J
Bacteriol 188:5417–5427
6. Dénarié J, Debellé F, Promé JC (1996) Rhizo-
bium lipo-chitooligosaccharide nodulation fac-
tors: signaling molecules mediating
recognition and morphogenesis. Annu Rev
Biochem 65:503–535
7. Radutoiu S, Madsen LH, Madsen EB et al
(2003) Plant recognition of symbiotic bacteria
requires two LysM receptor-like kinases.
Nature 425:585–592
8. Dénarié J, Cullimore J (1993) Lipo-
oligosaccharide nodulation factors: a new class
of signaling molecules mediating recognition
and morphogenesis. Cell 74:951–954
9. Downie JA, Walker SA (1999) Plant responses
to nodulation factors. Curr Opin Plant Biol 2:
483–489
10. Oldroyd GED, Mitra RM, Wais RJ, Long SR
(2001) Evidence for structurally specific nega-
tive feedback in the nod factor signal transduc-
tion pathway. Plant J 28:191–199
11. Folch-Mallol JL, Marroqui S, Sousa C et al
(1996) Characterization of Rhizobium tropici
CIAT899 nodulation factors: the role of nodH
and nodPQ genes in their sulfation. Mol Plant-
Microbe Interact 9:151–163
12. Roche P, Debellé F, Maillet F et al (1991)
Molecular basis of symbiotic host specificity in
rhizobium meliloti: nodH and nodPQ genes
encode the sulfation of lipo-oligosaccharide
signals. Cell 67:1131–1143
13. Spaink HP, Aarts A, Stacey G et al (1992)
Detection and separation of Rhizobium and
Bradyrhizobium Nod metabolites using thin-
layer chromatography. Mol Plant-Microbe
Interact 5:72–80
14. del Cerro P, Megı́as M, López-Baena FJ et al
(2019) Osmotic stress activates nif and fix
genes and induces the Rhizobiumtropici CIAT
Nod Factor Purification 245
899 Nod factor production via NodD2 by
up-regulation of the nodA2 operon and the
nodA3 gene. PLoS One 14:e0213298
15. del Cerro P, Pérez-Montaño F, Gil-Serrano A
et al (2017) The Rhizobiumtropici CIAT
899 NodD2 protein regulates the production
of Nod factors under salt stress in a flavonoid-
independent manner. Sci Rep 7:1–10
16. Bek AS, Sauer J, Thygesen MB et al (2010)
Improved characterization of nod factors and
genetically based variation in LysM receptor
domains identify amino acids expendable for
nod factor recognition in Lotus spp. Mol
Plant-Microbe Interact 23:58–66
17. Lortet G, Méar M, Lorquin J et al (1996) Nod
factor thin-layer chromatography profiling as a
tool to characterize symbiotic specificity of rhi-
zobial strains: application to Sinorhizobiumsa-
heli, S. teranga, and Rhizobium sp. strains
isolated from Acacia and Sesbania. Mol Plant-
Microbe Interact 9:736–747
18. Wais RJ, Keating DH, Long SR (2002)
Structure-function analysis of nod factor-
induced root hair calcium spiking in Rhizo-
bium-legume symbiosis. Plant Physiol 129:
211–224
19. Miwa H, Sun J, Oldroyd GED, Downie JA
(2006) Analysis of calcium spiking using a
cameleon calcium sensor reveals that nodula-
tion gene expression is regulated by calcium
spike number and the developmental status of
the cell. Plant J 48:883–894
20. Miwa H, Sun J, Oldroyd GED, Downie JA
(2006) Analysis of Nod-factor-induced calcium
signaling in root hairs of symbiotically defective
mutants of Lotusjaponicus. Mol Plant-Microbe
Interact 19:914–923
21. Amor BB, Shaw SL, Oldroyd GED et al (2003)
The NFP locus of Medicagotruncatula controls
an early step of Nod factor signal transduction
upstream of a rapid calcium flux and root hair
deformation. Plant J 34:495–506
22. Geurts R, Fedorova E, Bisseling T (2005) Nod
factor signaling genes and their function in the
early stages of Rhizobium infection. Curr Opin
Plant Biol 8:346–352
23. del Cerro P, Ayala-Garcı́a P, Jiménez-Guer-
rero I et al (2019) The non-flavonoid induc-
ible nodA3 and the flavonoid regulated
nodA1 genes of rhizobium tropici CIAT
899 guarantee nod factor production and
nodulation of different host legumes. Plant
Soil 440:185–200
 Chapter 17

A Novel System to Selective Tagging of Sinorhizobium fredii

Symbiotic Plasmids
Ana Marı́a Cutiño, Marı́a del Carmen Sánchez-Aguilar,
José Enrique Ruiz-Sáinz, Marı́a del Rosario Espuny,
Francisco Javier Ollero, and Carlos Medina

Abstract
Conventional systems used to tag and transfer symbiotic plasmids (pSyms) of rhizobial strains are based in
mutagenesis with transposons. In those processes, numerous clones must be analyzed to find one of them
with the transposon inserted in the pSym. Following this strategy, the insertion might interrupt a gene that
can affect the symbiotic phenotype of the bacteria tagged. Here, we have developed a new system based in
homologous recombination that generates Sinorhizobium fredii strains with pSyms tagged by the insertion
of a suicide vector which harbor a truncated copy of S. fredii HH103 nodZ gene, a mob site, and a
kanamycin-resistant gene. When it is introduced by conjugation in a S. fredii strain, the vector integrates
in pSym by only one recombination event. This pSym tagged can be transferred in matting experiments to
other strains in the presence of a helper plasmid. Following this method, we have tagged several strains and
transferred their pSyms to a recipient strain demonstrating the potential of this new system.

Key words Symbiosis, Legume, Sinorhizobium fredii, pSym tagging, Electrophoresis

1 Introduction

Bacteria of the Rhizobiaceae family commonly known as rhizobia

include, among others, the genera Allorhizobium, Azorhizobium,
Bradyrhizobium, Mesorhizobium, Rhizobium, and Sinorhizobium.
These rhizobial strains can induce atmospheric nitrogen-fixing
structures, named nodules, on the roots of plants belonging to
Leguminosae family [1]. Many of the genes that support the infor-
mation involved on the invasion of plant tissues and the nitrogen
fixation are located on large plasmids called symbiotic plasmids or
pSyms in some genera like Sinorhizobium, while in other as

Ana Marı́a Cutiño and Marı́a del Carmen Sánchez-Aguilar contributed equally to this work

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_17,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

247
248 Ana Marı́a Cutiño et al.

Bradyrhizobium and some species of Mesorhizobium are contained

in the chromosome [2]. The pSyms can be transferred by conjuga-
tion between different strains conferring in many cases symbiotic
characteristics from one strain to another. Many studies of hybrid
strains generated by transference of symbiotic plasmids to different
genetic backgrounds were carried out some years ago revealing
interesting results as alteration in host range of recipient strains
[2–5]. Transposons containing antibiotic-resistance genes were
generally used to tag the pSyms of rhizobial strains and assist its
tracing on mating experiments. Many ingenious systems based on
transposons mutagenesis were designed in the early 1980s in order
to contribute to the studies of pSyms transference processes
between rhizobial strains [6–9]. However, the labeling and cura-
tion of pSyms in rhizobial strains was still tedious, since numerous
clones must be analyzed to find one of them with the transposon
integrated into the pSym but not in another locus.
Here we show a novel system to tag pSyms of Sinorhizobium
fredii strains, based on homologous recombination. With just two
conjugations, we can tag a symbiotic plasmid and transfer it to a
recipient strain cured of its own pSym. We have cloned a DNA
fragment of S. fredii strain HH103, containing a fragment of the
nodZ gene (involved on LCO fucosylation) with its promoter in a
non-replicative vector in rhizobial strains as pK18mob [10] to
generate the plasmid pMUS573 (Fig. 1a). The tagging of the
pSym consists on introducing by conjugation this plasmid in the
desired S. fredii strain and selected kanamycin (Km)-resistant colo-
nies. Therefore, transconjugants have integrated the complete vec-
tor into the pSym by one homologous recombination event which
involves the nodZ gene fragment located on the pSym and the
fragment cloned on pMU573 plasmid, regenerating one complete
and functional copy of nodZ gene. The fucosylation of the LCO and
the phenotypic performance (number and weight of nodules and
plant-top dry weight) of such tagged strains remain intact respect-
ing parental strains.
Plasmid pMUS573 in addition to a Km-resistance gene also
carries the mobilization (mob) site, which allows the mobilization
and tracking of the entire pSym (Fig. 1b). In a second conjugation,
we can transfer this tagged pSym to another strain cured of its own
pSym in the presence of a helper plasmid (Fig. 1c). The tagging and
transference can be checked by PCR and the transference visualized
by plasmid electrophoresis assays [11]. This protocol has been used
during decades, but in this report, we include all the modifications
and updates needed to carry it out to catalogue large collections of
bacteria.
 Rhizobial pSym Selective Tagging 249

Fig. 1 pSym tagging and transference in S. fredii strains. (a) pMUS573 plasmid. (b) Integration of plasmid
pMUS573 in S. fredii pSym by only one recombination event. (c) Schematic representation of pSym
transference from a tagged donor strain to a pSym cured strain. NB: Gene promoter (nodbox); mob:
mobilization site; Km: kanamycin-resistance gene. Primers used for detection of amplification (NodZfw and
Kmrev) and PCR product are indicated

2 Materials

Standard equipment in Microbiology is required, including laminar

flow hoods, autoclave, pipets, microcentrifuge tubes, Petri plates,
shakers, static incubators, spectrophotometer, etc.

2.1 Bacterial Strains, 1. Escherichia coli strains used: E. coli S17-λpir [12] as donor in
Vectors, Media, and biparental mating containing pMUS573 plasmid resistant to
Antibiotics Km for pSym’s tagging and E. coli strain HB101 containing
pRK2013 helper plasmid for triparental mating [13].
2. Sinorhizobium fredii strains tagged: 042B [14]; HH103 [15];
USDA257 [16]; HH17 [17]; S5 [17]; S44 [17]; AB032;
HWG35 [17]; and B50 [17]. All of them are rifampicin (Rif)-
resistant derivatives and were used to be tagged their pSym
with pMUS573 plasmid.
3. Sinorhizobium fredii strain pSym’s recipient strain: USDA193
pSym-resistant to spectinomycin (Spc) [15].
4. Sinorhizobium fredii hybrid strains: USDA193 pSym- contain-
ing pSyms from 042B, HH103, USDA257, HH17, S5, S44,
AB032, HWG35, and B50.
5. Luria-Bertani (LB) medium [18]: 5 g/L NaCl, 10 g/L tryp-
tone, and 5 g/L yeast extract. Add 20 g/L agar for solid
medium. Autoclave 121 °C for 20 min.
250 Ana Marı́a Cutiño et al.

6. Tryptone yeast (TY) medium [19]: 0.9 g/L CaCl2·2H2O, 5 g/

L tryptone, and 3 g/L yeast extract. Add 20 g/L agar for solid
medium. Autoclave 121 °C for 20 min.
7. Antibiotic stocks: Dissolve in water 50 mg/mL spectinomycin;
50 mg/mL kanamycin; and 20 mg/mL nalidixic acid. Dissolve
in methanol 12.5 mg/mL rifampicin.
8. NaCl.

2.2 PCR Analysis 1. Thermocycler.

2. PCR microtubes.
3. Distilled water.
4. Conventional polymerase master mix.
5. Primers: NodZfw 5′ CCCAGGACCATTCTTCCCAA 3′.
Km reverse5′ GAAGGCGATGCGCTGCGAA 3′.
6. Toothpicks.
7. DNA molecular weight marker.
8. 25% (v/v) glycerol.

2.3 Bi- or Triparental 1. Bacterial strains (see Subheading 2.1).

Mating 2. Microcentrifuge.
3. 1.5 mL microcentrifuge tubes.
4. TY medium (see Subheading 2.1).
5. Streaking loop.
6. 0.22 μm Durapore membrane filters (optional).
7. Tweezers (optional).

2.4 Agarose Gel 1. Agarose.

Components 2. Distilled water.
3. Tris-Borate EDTA (TBE) 1X 10.8 g/L Trizma-base, 5.5 g/L
H3BO3, and 0.93 g/L EDTA disodium salt. pH gets automat-
ically adjusted to 8.3.
4. 15% SDS in TBE1X.
5. Electrophoresis tray (25–30 cm long).
6. Electrophoresis comb.
7. Methacrylate or crystal bar 5–7 mm width, same length than
the comb.
8. Adhesive tape.

2.5 Symbiotic 1. Tris-Ficoll solution: 12.5% (w/v). Ficoll in 0.025 Tris-HCl,

Plasmids and pH 8 (see Note 1).
Electrophoresis 2. 37% HCl.
 Rhizobial pSym Selective Tagging 251

3. Lysozyme stock solution: dissolve 5 mg lysozyme in 250 μL of

sterile H2O in a 1.5 mL tube by flicking (avoid the use of
vortex). This solution must be freshly prepared.
4. RNase stock solution (DNase-free): 400 μg/mL ribonuclease
A in 10 mM Tris-HCl, pH 7.5, and 15 mM NaCl. Heat to
100 °C for 15 min to eliminate DNase and store as 50 μL
aliquots at -20 °C. Aliquots can be used after thawing and
re-freezing.
5. Tracing blue loading dye: 0.55% (w/v) bromophenol blue in
Tris-Ficoll solution.
6. Resuspension buffer: 300 μL Tris-Ficoll solution, 100 μL lyso-
zyme stock solution, 25 μL RNase stock solution, and
25 μLtracing blue loading dye.
7. Syringe.
8. Electrophoresis device.
9. 1 μg/mL ethidium bromide
10. U.V. transilluminator with image caption system.

3 Methods

3.1 Sinorhizobium 1. Plate Sinorhizobium recipient strains in TY agar plates contain-

Strain pSym’s Tagging ing appropriated antibiotics (Rif in our case), and incubate at
by Biparental Mating 28 °C for 48 h. Plate E. coli S17-1 pMUS573 (donor strain) in
LB agar containing Km, and incubate at 37 °C for 24 h.
2. Inoculate a single colony of Sinorhizobium strains in 5 mL of
TY liquid medium containing appropriated antibiotics, and
grow it at 28 °C with continuous shaking up to exponential
phase for 1–2 days. Inoculate a single colony of E. coli in 5 mL
of LB medium containing Km, and grow it at 37 °C with
continuous shaking up to exponential phase for 24 h.
3. Transfer 1 mL of donor strain and 1.5 mL of recipient strain to
microcentrifuge tubes, and centrifuge them during 3 min at
8000 rpm in a table top microcentrifuge; then discard superna-
tant (see Note 2).
4. Wash cultures twice by adding 1 mL of fresh TY medium to
previous pellets, followed by centrifugation at 8000 rpm in a
table top microcentrifuge during 3 min to eliminate residual
antibiotics.
5. Resuspend bacterial pellet of donor strain with 50 μL of TY
medium and transfer the suspension to the tube containing
bacterial pellet of recipient strain.
252 Ana Marı́a Cutiño et al.

6. Resuspend bacterial pellet of recipient strain with donor bacte-

ria suspension to mix both bacteria, and spot it in a TY plate (see
Note 3).
7. Incubate the plates at 28 °C overnight horizontally to prevent
bacterial samples from spilling out of the drop.
8. Collect biomass with a streaking loop and resuspend it in 1 mL
of TY medium (see Note 4) and resuspend it with a pipet.
9. Plate 100 or 150 μL in TY medium containing appropriate
antibiotics (50 μg/mL Rif, 50 μg/mL Km, 20 μg/mL Nal in
our case), and incubate plates at 28 °C until Sinorhizobium
transconjugant colonies are visible (see Note 5).

3.2 Validation of To exclude the clones that are spontaneously resistant to Km, a
pSym’s Tagging by PCR using primers is contained in the sequence of the integration
PCR Analysis locus and the inserted element. Therefore, primers from nodZ and
Km-resistance gene will be used.
1. Pick colonies with toothpicks and replicate them in plates con-
taining the selective medium and LB plates. Incubate them at
28 °C for 2–3 days and exclude of further analysis those colo-
nies that have grown on LB and selective medium (see Note 6).
2. To confirm positives colonies, PCR from crude extracts can be
done by boiling for 5 min a small portion of biomass in 100 μL
of distilled water in a 1.5 mL tube.
3. Centrifuge for 1 min at maximal speed in a table top centrifuge
the boiled sample, and use 2–5 μL of the sample in a conven-
tional PCR. The primers used are NodZfw/ Km reverse (see
Subheading 2.2 for sequence).
4. This reaction must amplify a fragment around 1.9 Kb of DNA
in positive clones that ranges from the beginning of the
truncated copy of nodZ gene to the end of Km-resistance
gene (Fig. 1b).
5. Purify one or two positive clones in selective medium for
further analysis and store it on 25% (v/v) glycerol to store it
at -80 °C.

3.3 pSyms The analysis symbiotic phenotypes of hybrid strains or chimeras

Transference from generated by intraspecific transfer of pSyms in S. fredii strains
Tagged Strains to S. became feasible when cured strains are used as receptors to avoid
fredii Cured Strains the possible incompatibility or redundancy between two different
pSyms into the same strain. The curation of pSyms is not always
possible in S. fredii since occasionally it harbors essential genes;
however, different technics have been designed to perform such
curations [20]. Different Sinorhizobium strains cured from its own
symbiotic plasmids have been used as recipient of pSyms. Here we
report USDA193pSym- as genetic background since previous
 Rhizobial pSym Selective Tagging 253

studies demonstrated that it is an efficient recipient of pSyms in

mating experiments. Triparental mating using helper strains is
required to transfer tagged pSyms to USDA193 pSym-. Plates of
TY containing USDA193 pSym- and LB with E. coli PRK2013
helper plasmids should be prepared prior to start.
1. Prepare 5 mL of TY liquid medium from a single colony of
Sinorhizobium tagged strains containing Km and from
USDA193 pSym-, and grow it at 28 °C with continuous
shaking up to exponential phase for 1–2 days. Inoculate a single
colony of E. coli in 5 mL of LB medium containing Km, and
grow it at 37 °C with continuous shaking up to exponential
phase for 24 h.
2. Transfer 1.5 mL of donor and recipient strains and 1 mL of
helper strain to microcentrifuge tubes, and centrifuge them
during 3 min at 8000 rpm in a table top microcentrifuge;
then discard supernatant.
3. Proceed with the mating as described in Subheading 3.1 steps
4 to 8 with three microcentrifuge tubes passing liquid from
donor to helper and to recipient strain finally.
4. Plate 100 or 150 μL in TY medium containing appropriate
antibiotics (50 μg/mL Spc, 50 μg/mL Km, 20 μg/mL Nal in
our case), and incubate plates at 28 °C until Sinorhizobium
USDA193 transconjugant colonies are visible (see Note 7).

3.4 Validation of As described in Subheading 3.2, spontaneously resistant clones

pSyms Transference must be excluded for further analysis using the same approach
by PCR Analysis than described there.
1. Pick colonies with toothpicks and replicate them in plates con-
taining the selective medium of this second mating, the anti-
biotics of the donor strain, and LB plates. Incubate them at
28 °C for 2–3 days and exclude for further analysis those
colonies that have grown on LB and selective medium, since
they probably are E. coli, and those colonies that have grown on
selective medium and antibiotics of the donor strain since they
probably are donors spontaneous to spectinomycin (see Notes
6 and 7).
2. Proceed as in Subheading 3.2 steps 2 to 5 to check positive
transconjugants.

3.5 Preparation of To double-check that the positive colonies from Subheading 3.4
Agarose Gel for in-well are not false positives, the visualization of the plasmid mobilization
Cell Lysis to the recipient strain must be done. The protocol that we have
used to detect pSyms transference is based on the method described
by Eckhardt [21]. To visualize plasmids higher than 50 Kb up to
1 Mb in agarose gels, it is essential to lysate the bacteria holding
254 Ana Marı́a Cutiño et al.

Fig. 2 pSym electrophoresis gel assembling. (a, b) Comb with crystal bar assembling. (c) Gel tray preparation.
(d) Trench generation containing SDS-agarose. (e) Gel tray position in the electrophoresis device, the direction
of DNA migration is indicated

them (since they cannot be extracted intact) in a gel containing

detergents. These gels have a low agarose concentration and have
to be prepared with care to prevent its breakage.
1. Prepare 100 mL of 0.5% agarose in TBE 1X.
2. Prepare 10 mL of 0.4% agarose containing SDS. To do that,
transfer 8 mL of 0.5% agarose to a bottle and add 2 mL 15%
SDS in TBE1X and keep them at 56 °C until its use.
3. Prepare a comb with a methacrylate or crystal bar sticked with
adhesive tape behind the wells (Fig. 2a, b).
4. Prepare the gel electrophoresis tray sealing the ends and put the
comb at 2 cm to one of the ends with the methacrylate or
crystal bar looking outside the gel as indicated in Fig. 2c.
 Rhizobial pSym Selective Tagging 255

5. Pour the remaining 0.5% agarose from step 1 into the tray and
let it polymerize at room temperature for 20–30 min (see Note
8).
6. Once polymerized, carefully remove the methacrylate or crystal
bar. When the bar is removed, a gap or trench will remain
behind the wells and fill it with 0.4% agarose containing SDS,
approx. 5–7 mL (see Note 9). Let it polymerize for 5–10 min
(Fig. 2d).
7. Remove the comb with care since the SDS make the agarose
sticky and the trench can be extracted from the gel.

3.6 Culture If the transconjugants are resistant to the appropriate antibiotics,

Preparation for pSyms sensitive to donor resistances and positives in the PCR test, it is
Electrophoresis likely that the transconjugant is a hybrid strain containing the
USDA193 genetic background with the pSym of the donor strain.
However, an electrophoretic plasmid profile must be done to con-
firm the transference. Prior to start the preparation of the cultures,
ensure that the agarose gel from Subheading 3.5 is prepared.
1. Plate Sinorhizobium donor, recipient, and transconjugant
strains in TY agar plates and incubate them at 28 °C for 48 h.
2. Inoculate a single colony of Sinorhizobium in 5 mL of TY liquid
medium. Grow at 28 °C with continuous shaking up to sta-
tionary phase for 2–3 days.
3. Inoculate TY liquid tubes with stationary phase cultures and
incubate at 28 °C to reach an optical density at 480 nm of
0.2–0.3 (see Notes 10 and 11).
4. Transfer 0.5 mL of cultures that reached an OD480 of 0.2–0.25
to a microcentrifuge tube (see Note 12). Centrifuge them
during 3 min at 8000 rpm in a table top microcentrifuge;
then discard supernatant.
5. Wash cultures twice by adding 1 mL of TBE 1X to previous
pellets, followed by centrifugation at 8000 rpm in a table top
microcentrifuge during 3 min, and carefully discard the super-
natant (see Note 13).
6. Keep the samples on ice while preparing the electrophoresis
device. This is important to prevent the residual growth of the
cells or their uncontrolled lysis.
7. Carefully put the tray with the gel in the electrophoresis tank
containing TBE 1X, placing the wells in the negative pole
(Fig. 2e) ensuring that the agarose plus SDS trench is not
broken and load the samples in the wells (see Note 14).
8. Resuspend the pellets in 20 μL of resuspension buffer (see
Subheading 2.5) preventing the generation of bubbles, and
immediately load them into the wells.
256 Ana Marı́a Cutiño et al.

Fig. 3 Transference of symbiotic plasmids of S. fredii strains to USDA193 strain cured of its pSym.Lane1:
193C; 2: 193C(pSym042B); 3: 042B; 4: 193C(pSymHH103); 5: HH103; 6: 193C(pSymUSDA257); 7: USDA257;
8: 193C(pSymHH17); 9: HH17; 10: 193C(pSymS5); 11: S5; 12: 193C(pSymS44); 13: S44; 14: 193C(pSy-
mAB032); 15: AB032; 16: 193C(pSymHWG35); 17: HWG35; 18: 193C(pSymB50); 19: B50. Note the presence
of pSym plasmids in lanes 2, 4, 6, 8, 10, 12, 14, 16 and 18 in comparision with lane 1

9. For the first 30 min, apply a low voltage around 20–25 V to let
the lysis occur in the well.
10. Once the blue color of the tracer is visible outside the well,
increase the voltage to 100 V, and let the electrophoresis run
for 3–4 h until the blue tracer is closed to the end of the gel (see
Note 15).
11. Stain gel in ethidium bromide solution for 20 min, and destain
it for other 20 min in distillated water.
12. Visualize the plasmids in a U.V. system (Fig. 3).

4 Notes

1. To prepare properly the Tris-Ficoll solution, proceed as fol-

lows. Prepare 1 M Tris-HCl buffer by first dissolving 12.11 g
Trizma base in 80 mL H2O. Add 4.2 mL 37% HCl taking care
with the acid-to-water-heating, and fix the pH to 8. Cool the
solution and bring the volume to 100 mL with H2O. Dilute
40 times to a final concentration of 0.025 M Tris-HCl. Dis-
solve 1.25 g Ficoll in 10 mL 0.025 M Tris-HCl and spare in
1 mL aliquots that can be stored at -20 °C for years.
2. Ensure that the recipient strain has an optimal optic density
corresponding to exponential growth phase. It is not strictly
necessary to measure it; however, for this kind of strains, an OD
at 600 nm of 0.6–0.8 is suitable. If the OD is higher, dilute the
culture and grow for several hours.
3. The most concentrate is the drop containing both bacteria; the
better maximizes the conjugation frequency; therefore, reduce
the volume of the drop as much as you can (40–50 μL is
 Rhizobial pSym Selective Tagging 257

enough) avoiding splashes or liquid spreading in the plate. The

drop can be optionally placed on a 0.22 μm nylon membrane
filter.
4. If all the content of the biomass will be plated, liquid TY
medium is fine for resuspension. In case that only a portion
of the sample will be plated, resuspend it in 1 mL of 25% (v/v)
glycerol to freeze the rest of the mating. Conjugations can be
stored at -80 °C for years.
5. Sinorhizobium transconjugants colonies usually appear after
4–7 days of plating. Nalidixic acid (Nal) can be included to
the selective medium to eliminate E. coli donors since Sinorhi-
zobium strains are naturally resistant to this antibiotic.
6. This is carried out to exclude E. coli spontaneous colonies to
selective medium, since it is unlike that Sinorhizobium strains
grow in LB medium. However, this should be tested before
assuming it.
7. Take in consideration that pRK2013 plasmid from E. coli con-
fers resistance to Km to this bacterium; thus, nalidixic acid at
this point is needed to eliminate it. Ensure that the donor and
the recipient strains are not resistant to the same antibiotics. In
this case, USDA 193 is resistant to spectinomycin; therefore,
the donor strain cannot be resistant to this antibiotic.
8. During this time, the preparation of the cultures in the Sub-
heading 3.6 can be done.
9. To avoid breaks on the gel, slightly bend the edge of the
adhesive tape prior to fix it to easily remove it and withdraw
the crystal bar. Add slowly the SDS containing agarose to
prevent the formation of foam.
10. Since the Sinorhizobium strains have similar generation times
and to avoid the use of distinct volumes of inocula, for large
bacterial collections, we use to inoculate 5 mL of TY tubes with
20 μL of stationary phase culture, and incubate it at 28 °C
under static conditions overnight. Higher volumes up to
100 μL can be applied for slow growers.
11. If some strains produce large amounts of extracellular polysac-
charides, TY liquid medium containing 5 g/L of NaCl can be
used to grow the bacteria while reducing the production of
such polysaccharides.
12. This is one of the key points of the experiment. An adequate
volume with an optimal OD480 must be chosen to make a
correct lysis on the well. We recommend 0.5 mL of 0.2–0.25
OD480 cultures, but volumes can be ranged from 0.3 to
0.5 mL if the OD480 is higher, up to 0.4, no more than this
value. Values under 0.16–0.17 OD480 usually have low bio-
mass and should be allowed to grow to 0.2 OD480.
258 Ana Marı́a Cutiño et al.

13. The biomass must be visible at the bottom of the tube as a small
and white spot no bigger than a grain of salt. After the last
centrifugation, the liquid remaining in the tube have to be
removed using a syringe since it can increase the volume of
the sample to be loaded in the gel.
14. The SDS migrates from the negative to the positive pole as the
DNA do, for that reason the trench have to be behind the wells
to let the SDS lysate the cells while they are still in the well.
15. Smaller gels can be prepared but never shorter than 15 cm.
Long trays can be shortened fixing a methacrylate or crystal bar
in the middle of the tray.

Acknowledgments

This work was funded by the Spanish Ministry of Science and

Innovation, grant number PID2019-107634RB-I00, and sup-
ported by FEDER funds, grant number FEDER-US 1259948.

References

1. Oldroyd GE (2013) Speak, friend, and enter:
signaling systems that promote beneficial sym-
biotic associations in plants. Nat Rev Microbiol
11:252–263
2. Hoykaas PJJ, van Brussel AAN, den Dulk-Ras
H et al (1981) Sym plasmid of Rhizobium tri-
folii expressed in differentrhizobial species and
Agrobacterium tumefaciens. Nature 291:351–
353
3. De Jong TM, Brewin NJ, Phillips DA (1981)
Effects of plasmid content in rhizobium legu-
minosarum on pea nodule activity and plant
growth. J Gen Microbiol 124:1–7
4. Brewin NJ, Wood EA, Young JPW (1983)
Contribution of the symbiotic plasmid to the
competitiveness of Rhizobium leguminosarum.
J Gen Microbiol 129:2973–2977
5. Djordjevic MA, Zurkowski W, Shine J et al
(1983) Sym plasmid transfer to various symbi-
otic mutants of Rhizobium trifolii,
R. leguminosarum and R. meliloti. J Bacteriol
156:1035–1045
6. Simon R, Priefer U, Pühler A (1983) Vector
plasmids for in vivo and in vitro manipulations
of Gram-negative bacteria. In: Pühler A
(ed) Molecular genetics of the bacteria-plant
interaction. Springer, Berlin, p 98
7. Simon R (1984) High frequency mobilization
of gram-negative bacterial replicons by the
in vivo constructed Tn5-Mob transposon.
Mol Gen Genet 196:413–420
8. Simon R, Quandt J, Klipp W (1989) New deri-
vatives of transposon Tn5 suitable for mobili-
zation of replicons, generation of operon
fusions and induction of genes in Gram- nega-
tive bacteria. Gene 80:161–169
9. Hynes MF, Quandt J, O’Connell MP et al
(1989) Direct selection for curing and deletion
of rhizobium plasmids using transposons carry-
ing the Bacillus subtilis sacB gene. Gene 78:
111–120
10. Sch€afer A, Tauch A, J€ager W et al (1994) Small
mobilizable multi-purpose cloning vectors
derived from the Escherichia coli plasmids
pK18 and pK19: selection of defined deletions
in the chromosome of Corynebacterium gluta-
micum. Gene 145:69–73
11. Espuny MR, Ollero FJ, Bellogı́n RA et al
(1987) Transfer of the Rhizobium legumino-
sarum biovar trifolii plasmid pRtr5a to a strain
of Rhizobium sp. that nodulates on Hedysar-
umcoronarium. J Appl Bacteriol 63:13–20
12. Simon R, Priefer U, Puhler A (1983) A broad
host range mobilization system for in vivo
genetic engineering: transposon mutagenesis
in gram negative bacteria. Biotechnol 1:784–
791
13. Figurski DH, Helinski DR (1979) Replication
of an origin-containing derivative of plasmid
RK2 dependent on a plasmid function
provided in trans. Proc Natl Acad Sci U S A
76:1648–1652

14. Noreen S, Schlaman HRM, Bellogı́n RA et al
(2003) Alfalfa nodulation by Sinorhizobium
fredii does not require sulfated nod-factors.
Func Plant Biol 30:1219–1232
15. Buendı́a-Claverı́a AM, Chamber M, Ruiz-
Sainz JE (1989) A comparative study of the
physiological characteristics, plasmid content
and symbiotic properties of different Rhizo-
bium frediistrains. Syst Appl Microbiol 12:
203–209
16. Keyser HH, Bohlool BB, Hu TS et al (1982)
Fast-growing rhizobia isolated from root
nodules of soybean. Science 215:1631–1632
17. Yang SS, Bellogı́n RA, Buendı́a A et al (2001)
Effect of pH and soybean cultivars on the
quantitative analyses of soybean rhizobia popu-
lations. J Biotechnol 91:243–255
Rhizobial pSym Selective Tagging 259
18. Sambrook J, Fritsch EF, Maniatis T (1989)
Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor
19. Beringer JE (1974) R factor transfer in Rhizo-
bium leguminosarum. J Gen Microbiol 84:
188–198
20. Morrison NA, Hau CY, Trinick MJ (1983)
Heat curing of a Sym plasmid in a fast-growing
Rhizobium sp. that is able to nodulate legumes
and the nonlegume Parasponia sp. J Bacteriol
153:527–531
21. Eckardt T (1978) A rapid method for the iden-
tification of plasmid deoxyribonucleic acid in
bacteria. Plasmid 1:584–588
 Chapter 18

New Inoculation Strategy for Legume Based

on Rhizobium-Metabolite Co-encapsulation
Adriana B. Cesari, Verónica E. Castilla Marı́n, Luciana Nieva Muratore,
Natalia S. Paulucci, and Marta S. Dardanelli

Abstract
The new strategies that are trying to be developed to protect microorganisms for a successful application
have generated various types of granulated, powdered, or liquid formulations. In this work, we have
developed a rhizobial encapsulation system for legumes accompanied by metabolites to enhance
microorganism-plant communication. This novel way of producing a biofertilizer for legumes was devel-
oped based on alginate, a degradable compound that allows environmentally friendly use. This way of
generating an inoculant allows it designing by making different molecular combinations for different
purposes, being a double inoculant, biological and molecular.

Key words Peanut, Encapsulation, Nodulation, Rhizobia, Metabolite

1 Introduction

Among all the inescapable factors for agriculture, microorganisms

and those with plant growth promoting functions (PGPM) play a
major role not only for plant development and health but also for
the soil [1]. Among the new strategies that are being developed to
protect PGPMs in the soil in order to ensure their successful
application, several types of granulated, powdered, or liquid for-
mulations have been generated with the addition of molecules of
different nature that exert an inducing or protective effect against
stress factors.
Plants through their roots release compounds with diverse
biological functions in order to communicate with PGPMs and to
be able to inhabit the soil. They are sources of biologically active
compounds, for defense, chemoattraction, solubilization, signal-
ing, etc. Chemically, the compounds released to the soil are
known as exudates [1]. The exchange of molecular signals between
the host plant and PGPMs is an important step for effective growth

Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6_18,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2024

261
262 Adriana B. Cesari et al.

promotion. Improving the efficiency of legume inoculation is

extremely important when considering economic costs, and an
advantage offered by this strategy is that the inducers act at low
concentrations and the pre-activation of PGPMs (rhizobacteria)
used as inoculants is undoubtedly economically justified.
In order to have biological activity, such molecules must be able
to reach the site of action without losing integrity. Plant bioactive
compounds have limited water solubility and poor bioavailability
and can be easily modified by environmental factors such as tem-
perature, pH, and light. Therefore, in order to preserve their
structural integrity, these types of molecules must be protected by
a formulation with the ability to release them without losing their
biological activity [2, 3].
Previous studies by our group revealed the extensive metabolic
production of peanut roots including naringenin and hesperidin,
oleic acid, auxins, and organic acids (malic, fumaric and citric)
[2, 3]. Therefore, these molecules could have a potential innovative
technological use when applied in formulations and during their
subsequent use in the induction of growth promotion under stress
situations.
Encapsulation is currently of great interest for the development
of new biofertilizers to promote innovative products in the market
and effectively achieve the quality agriculture desired by environ-
mental and economic policies. Encapsulation involves the coating
or entrapment of microbial cells inside microbial cells within a
polymeric material to produce microspheres that are permeable to
nutrients, gases, and metabolites in order to maintain cell viability
within them [4]. It therefore provides a protective environment for
both microorganisms and molecules. Although several works on
encapsulation of microorganisms can be found in the literature,
they are scarce when dealing with the use of rhizobia for legumes.
Immobilized rhizobacteria are known to play a very important
role in promoting plant growth in cropping systems, as the
encapsulated cells could be slowly released into the soil when soil
microorganisms break down the polymeric matrix, providing
enhanced long-term efficacy of the inoculant [3]. Among the bio-
polymers used as support materials for encapsulation, many
researches propose the use of starch, carbohydrates, cellulose, algi-
nate, chitosan, dextrans, lignin, and polyamino acids. Our working
group has previously studied the encapsulation of molecules impor-
tant for communication between peanut and rhizobacteria (narin-
gin and citric acid) in a biodegradable synthetic polymer,
polycaprolactone (PCL). However, for PGPM encapsulation, the
most commonly used polymer is alginate, as it is biodegradable,
nontoxic, and biocompatible [2, 3].
Our aim is to develop alginate-based legume biofertilizers that
allow simultaneous in-furrow inoculation of rhizobia and mole-
cules that enable rapid rhizobium-legume interaction.
 New Encapsulation-Based Inoculation Strategy for Legumes 263

2 Materials

Prepare all solutions using distilled water and analytical grade

reagents. All the material needs convenient sterilizing. All manip-
ulations must be done under aseptic conditions (the employment of
a laminar flow cabinet is strongly recommended). Diligently follow
all waste disposal regulations when disposing waste materials.

2.1 Bacterial Strain 1. Bradyrhizobium SEMIA6144, regularly used in laboratory,

peanut symbiont.
2. Yeast Extract Mannitol (YEM) medium [5]: Mannitol 10 g/L,
yeast extract 0.5 g/L, MgSO4·7H2O 0.2 g, NaCl 0.1 g,
K2HPO4 0.5 g, and CaCl2 0.05 g. Autoclave for 20 min at
120 °C. Store at room temperature or 4 °C. For solid medium
(YEMA), add before autoclaving 1.5% Agar (15 g/L).
3. Physiological solution (0.9% NaCl p/v).

2.2 Encapsulation 1. 2 g sodium alginate (Na-Alg).

2. 100 mL of water (45 °C).
3. 2% CaCl2 solution.
4. 500 mL of saline solution (0.9% p/v NaCl).

2.3 Conservation 1. Capsules should be stored at 4 °C until use.

3 Methods

3.1 Culture 1. Prepare the inoculation of new culture media from pre-cultures
Conditions on the same type of media. For the bacterial growth study, cells
are initially cultured in flasks containing 50 mL of YEM
medium and incubated at 28 °C with shaking at 150 rpm.
Cells at the late exponential growth phase are used to inoculate
new culture to an initial optical density of 0.1 (600 nm). Cul-
tures are incubated at 28 °C with shaking at 150 rpm until the
stationary phase (110 h for SEMIA6144, see Note 1).
2. Follow bacterial growth by measuring the viable cell count
using the droplet technique [5]. For this, take 100 μL of the
culture and mix with 900 μL of physiological solution in an
Eppendorf tube. From this dilution, make serial dilutions of
1/10. From each dilution, take 100 μL and sow with a spatula
on a plate with YEM culture medium. Incubate plates at 28 °C
until colony formation. The count values are expressed as
colony forming units per milliliter of culture (CFU mL-1)
(see Note 2).
264 Adriana B. Cesari et al.

3.2 Encapsulation To entrap microorganisms in an alginate matrix, we follow the ionic

Technique gelation technique described by Joe et al. [6] based on the previous
work of Bashan et al. [7]. Proceed as detailed below.
1. Dissolve 2 g of sodium alginate (Na-Alg) in 100 mL of water
(45 °C), under continuous magnetic low stirring at room
temperature for 2 h. Then, autoclave the solution.
2. Mix a 50 mL suspension of bacterial culture (SEMIA6144)
under aseptic conditions with 80 mL of the 2% Na-Alg solu-
tion, with stirring at 30 °C for 1 h. The alginate beads are
obtained by the ionic gelation method, where the sodium
alginate solution is dripped into a 2% CaCl2 solution, leaving
it in contact for 30 min [8]. The beads are then separated from
the suspension and washed 3 times with 500 mL of saline
solution.
3. Allow the beads to cure in the CaCl2 solution for 30 min.
4. When the encapsulation process contains plant metabolites for
symbiosis, flavonoids produced by the roots of the legume
under study can be applied together with the bacteria. We
used naringin at a concentration of 1 mM [4].
5. Once the beads (Ca-Alginate) have been obtained, store them at
4 °C for different periods of time (between 1 and 12 months).

3.3 Cell Count in 1. Place 0.2 g of Alg-bacteria beads and Alg-metabolite-bacteria

Alginate Beads beads (previously stored at 4 °C from step 5 in Subheading
3.2), in 5 mL of citrate buffer (pH 7) at 28 °C for 30 min to
achieve the breakdown of the beads and the release of trapped
bacteria [4].
2. Place serial dilutions and count viable cells using the microdrop
technique described by da Silva [9]. Repeat each serial dilution
three times, 20 μL, and seed each drop in a quarter of a petri
dish with YEMA culture medium. Each plate contains 4 dilu-
tion counts. The plates are incubated at 28 °C until the appear-
ance of colonies. The results are expressed as CFU.bead-1 (see
Notes 3 and 4) (Fig. 1, Table 1).

4 Notes

1. The technique is described here using a peanut symbiont bac-

terium, but the same technique can be applied to other rhizo-
bacteria following this protocol.
2. Different media can be used for bacterial counts. Here we use
YEM with Congo red dye.
3. The time selected for storage can be between 1 and 36 months.
4. CFU that can be encapsulated depends on the growth phase.
We use stationary phase bacteria.
 New Encapsulation-Based Inoculation Strategy for Legumes 265

Fig. 1 Immobilization of microbial inoculants in alginate beads by ionic gelation technique; (a, b) alginate-
bacteria bead, (c) photography of alginate beads (1 mm in diameter) [3]

Table 1
Number of viable bacteria of Bradyrhizobium SEMIA6144 in Alg-beads during storage at 4 °C

Alginate beads Bead diameter (mm) N° cell.fresh.bead-1

SEMIA6144 1 ± 0.03 2.7.107 ± 7.102
Values shown are the mean ± SD of three independent pairs of triplicate experiments [3]

References
1. Dardanelli M, Fernández F, Espuny M et al
(2008) Effect of Azospirillum brasilense coino-
culated with Rhizobium on Phaseolus vulgaris
flavonoids and Nod factor production under
salt stress. Soil Biol Biochem 40:2713–2721
2. Cesari AB, Paulucci NS, López-Gómez M et al
(2019) Restrictive water condition modifies the
root exudates composition during peanut-
PGPR interaction and conditions early events,
reversing the negative effects on plant growth.
Plant Physiol Biochem 142:519–527
3. Cesari AB, Paulucci NS, Yslas EI, Dardanelli MS
(2020) Immobilization of Bradyrhizobium and
Azospirillum in alginate matrix for long time of
storage maintains cell viability and interaction
with peanut. Appl Microbiol Biotechnol 104:
10145–10164
4. John RP, Tyagi RD, Brar SK et al (2011)
Bio-encapsulation of microbial cells for targeted
agricultural delivery. Crit Rev Biotechnol 30:
211–226
5. Somasegaran P, Hoben H (1994) Handbook for
rhizobia. Methods in legume-rhizobium tech-
nology, 1st edn. Springer, New York, pp
332–341
6. Joe MM, Karthikeyan B, Chauhan PS et al
(2012) Survival of Azospirillum brasilense floc-
culated cells in alginate and its inoculation effect
on growth and yield of maize under water deficit
conditions. Eur J Soil Biol 50:198–206
7. Bashan Y, Hernandez JP, Leyva LA, Macario B
(2002) Alginate microbeads as inoculant carriers
for plant growth-promoting bacteria. Biol Fertil
Soils 35:359–368
8. Bashan Y, de-Bashan LE, Prabhu SR, Hernan-
dez JP (2014) Advances in plant growth-
promoting bacterial inoculant technology: for-
mulations and practical perspectives
(1998–2013). Plant Soil 378:1–33
9. da Silva R (1996) Tecnica de Microgota para
contagem de células bacterianas viaveisemuma-
suspensao. Universidade Federal de Vi1osa,
Vi1osa
 INDEX
A Bioinformatics .......................................24, 185, 189, 200
Acidovorax
avenae ........................................................... 72, 75, 76
citrulli .......................... 72, 81, 82, 84–87, 89, 91, 93
Affinity chromatography............................................... 197
Agrobacterium tumefaciens.................................. 116, 166
Alginate.................................................. 72, 134, 262–265
Allelic
exchange .................................................101, 103–106
heterogeneity............................................................. 22
Alpha-proteobacteria (α-proteobacteria) ............ 145, 180
Anhydrotetracycline (AHT) ............................... 167–169,
172–174, 176
Antibiotic resistance .............. 8, 9, 12, 71, 106, 118, 248
Antibodies ....................................... 11, 12, 99, 107, 169,
172, 173, 175, 176, 185, 199
Association study.......................................................19–28
Avidin/streptavidin ..................................... 154, 184, 195
B Competitive index (CI) ....................................... 125, 127
Bacteria
bacteria-host interactions............................... 166, 220
conjugation..................................................... 248, 256
effector............................................................ 165–177
growth ............................................9, 71, 74, 97, 115,
116, 137, 138, 201, 206, 263
lysis ............................... 140, 168, 172, 176, 180–182
pathogens ............................................................72, 96
physiology................................................................ 179
Bacterial fruit blotch (BFB)............................................ 81
Bacterial motility
sliding.............................................................. 206, 207
surface ............................................................. 205–216
swarming ........................................................ 206, 207
swimming ................................................. 82, 205–216
twitching................................................ 82, 83, 91, 93
Bacteroids .......................................... 146, 179, 184, 193,
205, 229–235
Beta-glucans (β-glucans)..............................134–136, 141
Biacore system ............................................................... 147
Biocontrol.......................................................48, 115–128
Biofilm development....................................................... 72
Biofilms ..........................71, 72, 82, 83, 91–93, 134, 135
Carlos Medina and Francisco Javier López-Baena (eds.), Host-Pathogen Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 2751, https://doi.org/10.1007/978-1-0716-3617-6,
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer
Nature 2024
267
Biopolymers.........................................133, 134, 136, 262
Biotic stress.................................................................... 134
Biotinylation ...................... 150, 154, 155, 184, 194, 195
Botrytis cinerea ..........................................................47–66
Botrytis virus F (BVF) ......................................48, 49, 51,
53–61, 64, 65
C
Case-control study .......................................................... 24
cDNA synthesis .......................................... 50, 51, 55, 56,
64, 190, 191
Cell
adhesion...............................................................71, 72
cycle ....................................................... 167, 169, 174
Chromatography
thin layer (TLC) ............................ 238, 240, 242–244
Chronic infection .......................................................... 134
Competition assays............................................... 115–128
Confocal microscopy ..........................108, 109, 176, 201
Conjugation ...........................................33, 98, 100, 111,
180, 243, 248, 256, 257
Covid-19 pandemic .......................................5, 12, 20, 28
CRP/FNR-type protein ............................................... 146
Cucurbit.....................................................................81, 82
Culture growth ........................................... 160, 182, 209
Cyclic diguanylate (c-di-GMP) .......................... 135, 136,
140, 141
D
Data analysis ............................................ 25, 26, 155–159
Defense suppression........................................................ 96
Dextrans......................................................................... 262
DNA
extraction ....................................................59, 85, 106
ligation ....................................................................... 57
restriction..................................................86, 107, 195
E
Electroporation ..................... 86, 99, 103, 117, 118, 128
Encapsulation ....................................................... 262–264
Epifluorescence microscope...........................42, 174, 176
 HOST-PATHOGEN INTERACTIONS: METHODS AND PROTOCOLS
268 Index
Escherichia coli .............................................. 6, 52, 57, 59,
65, 84–87, 93, 97, 98, 101–103, 105, 148, 150,
153, 156, 180, 182, 186, 190, 192, 193, 195,
197, 199, 249, 251, 253, 257
Exopolysaccharide (EPS) ....................... 72–78, 134, 135,
138, 140, 141
Extracellular membrane vesicles (EMVs) .......... 219–226,
229–235
F L
Flagella .......................................... 82, 206, 207, 213, 214
Flavonoids ..........................................205–207, 215, 220,
229, 230, 237, 238, 240–243, 264
Flow cells system .................................................. 147, 155
Flow cytometry .............................. 96, 97, 108–110, 175
Fluorescence microscopy ..................................33, 34, 44,
96, 167, 172
Fluorescent dye .........................................................34, 45
Fluorescent reporter genes .................... 96, 97, 103–106,
109, 110
Fungus ....................................................... 48, 53, 62, 135
G Microbiological techniques .......................................... 150
Gel electrophoresis
agarose ....................................................................... 63
polyacrylamide................................................ 188, 192
Gene
cloning ......................................48, 50–52, 57–58, 64,
84, 92, 159, 167, 180, 184, 185, 196
expression ........................................ 95–112, 200, 243
regulation..................... 166, 167, 179, 180, 192–199
sequencing ................................................................. 25
variant .................................................................. 24–25
Genetic reporter assay................................................... 198
Genome-wide association study (GWAS)......... 20, 25–28
Genotyping techniques.............................................26, 27
GFP ....................... 43, 97, 108–111, 174, 184, 190, 193
Growth curves ............................................................... 140
H P
HeLa cells ............................................ 166–168, 171–175
Hepatitis ............................................................. 20, 23, 27
Heterologous expression system .................................. 166
Host-infection ................................................................. 72
Host-pathogen genetic .............................................19–28
Human genetics .............................................................. 28
Human immunodeficiency virus (HIV) ................ 6, 7, 9,
12–14, 20, 24, 28
Hybridization
northern blot.................................................. 183, 187
southern blot ................................... 99, 100, 106–108
I
Image processing.................................................. 109–111
Immune system ................................ 4, 5, 7, 8, 13, 15, 27
Immunoblotting ........................................................... 199
Infection mechanism....................................................... 72
Inoculants ...................................146, 211, 235, 262, 265
In planta bacterial growth measurements................... 116
LC-MS ........................................................................... 196
Lentivirus ............................................... 34, 35, 37–40, 45
Lipochitooligosaccharide (LCO) ........................ 237, 248
Live-cell imaging ......................................... 37, 41, 43, 44
M
Malaria ..................................................... 4, 10, 11, 13–15
Mating
biparental .............................. 180, 193, 197, 199, 249
tetraparental.............................................. 98, 100–104
triparental ...............................................249–251, 253
Melon.....................................................81, 85, 86, 89, 90
Microoxia....................................................................... 146
Mixed-linkage β-glucan (MLG) .......................... 135–142
mRNA target............................................... 185, 197, 198
Multiplicity of infection (MOI) ............................. 39, 42,
43, 45, 171
Mycovirus ........................................................... 48, 54, 61
N
NanoSight system ......................................................... 225
Nicotiana benthamiana .................................82, 117, 121
Nitrogen fixation.................................146, 206, 230, 247
Nodulation ............... 134, 187, 195, 206, 220, 232, 237
Nodulation factors (Nod-factors, NF) .............. 206, 220,
221, 229, 237–244
Northern blotting ........................................183, 186–189
Pathogens
pathogen-host interaction ........................... 4, 5, 8, 11
pathogen/microbe-associated molecular patterns
(PAMPs/MAMPs) ............................................ 3, 7
pattern recognition receptors (PRRs)........... 3, 7, 135
Pathosystem..................................................................... 83
Peanut ................................................................... 262–264
Pharmacology.................................................................. 15
Phenotypic heterogeneity ............................................... 96
Phytopathogens.................................... 72, 116, 118–123,
125, 127, 128
 HOST-PATHOGEN INTERACTIONS: METHODS
pK18mob........................................................................ 248
Plant
inoculation......................................... 85–91, 231, 233
pathogen ................................................... 96, 115–128
pathogenic fungi ....................................................... 48
Plant growth promoting microorganisms
(PGPM) .................................................... 261, 262
Polymerase chain reaction (PCR) .......................... 49, 51,
52, 55–57, 59, 64, 65, 84–88, 92, 104, 112, 117,
119, 127, 137, 142, 156, 183, 184, 190–192,
194, 195, 197, 199–202, 248–250, 252–254
Promoter ........................................... 48, 49, 64, 97, 146,
147, 149, 150, 155–158, 160, 162, 166, 167,
174, 180, 181, 184, 185, 190, 193–195, 198,
200, 201, 205, 248, 249
Protein
expression ................ 24, 45, 148, 150–153, 160, 166
purification .................. 148, 150, 153–154, 160, 161
tagging ............................................. 34, 150–154, 198
Protein-DNA interaction...........147, 151, 156, 158, 160
Protoplasts ....................................................48, 60–62, 66
Pseudomonas
aeruginosa................................................................ 134
putida.................................... 115–119, 121, 134, 166
syringae ........................................72, 82, 95–112, 116
Public health......................................3–5, 8, 9, 11–15, 26
Q Symbiosome ................................................ 230, 233, 234
Quorum sensing................................................... 195, 230
R
Radiolabeling.............................. 189, 200, 201, 238–242
Ralstonia solanacearum ............................................72, 82
Rapid amplification of the 5’/3’-cDNA ends
(RACE) ............................................ 183, 189, 191
Real-time quantitative reverse transcription PCR
(RT-qPCR) ...................45, 50, 64, 187, 199, 200
Red stripe disease ............................................................ 73
Reporter gene...............................................109–111, 174
Reverse genetics ........................................................47–66
Reverse transcription.................................................9, 183
Rhizobia............................................. 134, 135, 145, 146,
179, 182, 205–216, 219–226, 229, 230, 237,
238, 240, 242, 243, 247, 262
Rhizobium-legume symbiosis ...................................... 220
Rhizobium tropici ....................................... 221, 223, 230,
231, 233, 235, 242
RNA
extraction ....................... 49, 54, 56, 61, 63, 181, 182
purification .............................................................. 187
sequencing (RNAseq) ...................179, 188, 189, 200
small noncoding RNAs (sRNAs) ................. 179–181,
184–201
Rotavirus................................................ 34, 37, 41–43, 45
AND PROTOCOLS
Index 269
S
Saccharum spp................................................................. 72
Salicylate .....................................166, 168, 169, 172, 173
Salmonella enterica ................................................ 96, 168
SARS-CoV-2 ............................................. 5–7, 11, 13, 28
Seed................................................ 38–41, 85, 86, 89, 90,
173, 176, 231, 233, 235, 264
Sensorgram .................................................. 151, 157, 158
Shigella ............................................................................... 6
Single-cell methods .................................................95–112
Single-tag nucleotide polymorphisms (SNPs).............. 25,
26, 28
Sinorhizobium
fredii..............................206–209, 213, 230, 247–258
meliloti ..........................................135, 137, 180, 186,
195, 198, 200, 201, 206
Southern blot ........................................99, 100, 106, 108
Soybean................................................................. 146, 207
Statistical analysis .......................................................... 127
Study design ..............................................................21, 25
Subcellular localization ........................................ 165–177
Surface plasmon resonance (SPR)...................... 147, 150,
151, 156, 158, 161
Susceptibility............................................ 5, 19, 20, 23, 28
Symbiosis ............................................146, 205–207, 220,
229, 230, 235, 237–244, 264
Symbiotic plasmid (pSym)
tagging ............................................................ 247–258
Synthetic virus ................................................................. 47
T
Therapeutic approaches .......................... 8–11, 13, 14, 28
Tomato .......................................................................... 116
trans-acting sRNAs (trans-sRNAs)............ 180, 186, 197
Transcription
factors............................................146, 147, 159, 160,
190, 193, 195, 201
regulation....................................... 179, 190–196, 198
start sites (TSS) .................... 180, 190, 195, 199–201
Transfection................................................ 37–39, 48, 51,
59–62, 65, 66, 169, 173, 176
Transformation.....................................48, 60, 86, 87, 99,
101, 103, 112, 150, 151, 190, 192, 199
Transmission electron microscopy (TEM) .................207,
209, 213, 214, 222, 225
Tuberculosis (TB) ................................. 4, 8, 9, 11–13, 20
Type III
effector..................................................................... 165
secretion system (T3SS).......................................6, 82,
95–97, 99, 107–109, 206, 220
Type IV pili (T4P) .......................................................... 82
Type VI secretion system (T6SS)....................... 115, 116,
119–123, 128
 HOST-PATHOGEN INTERACTIONS: METHODS AND PROTOCOLS
270 Index
U W
Ultracentrifugation .................... 221, 222, 226, 233–235 Watermelon .................................... 81, 82, 85, 86, 89, 90
Western-blot ......................................................... 186, 199
V Whole genome sequencing (WGS).............................. 197
Viral infectious clone ................................................47–66
Y
Virulence factors (VFs) ......................... 3, 6, 7, 71–78, 95
Virus........................................ 6, 7, 9, 11, 13, 20, 37, 41, Yersinia ........................................................................6, 96
42, 44, 45, 47, 48, 58, 61, 62, 65, 66