Industrial Crops & Products 122 (2018) 473–482

Contents lists available at ScienceDirect

Industrial Crops & Products

journal homepage: www.elsevier.com/locate/indcrop

Changes in the physiological characteristics and baicalin biosynthesis T

metabolism of Scutellaria baicalensis Georgi under drought stress
⁎ ⁎
Lin Cheng, Mei Han , Li-min Yang , Li Yang, Zhuo Sun, Tao Zhang
Cultivation Base of State Key Laboratory for Ecological Restoration and Ecosystem Management of Jilin Province and Ministry of Science and Technology, College of
Chinese Medicinal Materials, Jilin Agricultural University, 130118, Changchun, Jilin, PR China

A R T I C LE I N FO A B S T R A C T

Keywords: Drought stress is an important ecologically limiting factor that strongly affects the physiological and biochemical
Scutellaria baicalensis Georgi reactions of medicinal plants and changes the secondary metabolic process. Scutellaria baicalensis Georgi (SBG),
drought stress belonging to the Lamiaceae family, is a traditional medicinal herb that is well known for its high flavonoid
physiological characteristics content. Baicalin is the most important bioactive constituent of these flavonoids. In the current study, the effects
baicalin
of progressive drought stress on plant physiological characteristics and the secondary metabolism of baicalin
secondary metabolism
were investigated during the vegetative period in two-year-old SBG. The results showed that the relative water
content of leaves was reduced, fresh and dry root weight decreased significantly, the contents of mal-
ondialdehyde (MDA), proline (Pro), soluble sugar (SS) and soluble protein (SP) increased, and the activities of
superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX) and glutathione
reductase (GR) increased during mild and moderate drought but were inhibited in severe drought. The content of
baicalin increased significantly under mild drought stress but decreased under severe stress. Meanwhile, the
expression patterns and activities of key enzymes upstream of baicalin biosynthesis including Phenylalanine
ammonialyase (PAL), Cinnamate-4-Hydroxylase (C4H), 4-Coumarate:Coenzyme A Ligase (4CL) and Chalcone
Synthase (CHS), which were in the secondary metabolic pathways, were consistent with the accumulation of
baicalin. These results demonstrate that an appropriate degree of drought stress may promote baicalin accu-
mulation by stimulating the expression and activities of the key enzymes involved in baicalin biosynthesis; in
this process, antioxidant enzyme was closely related to the key enzyme of secondary metabolic pathway, which
plays an important role in regulating the active ingredient accumulation which plays an important role in
regulating baicalin accumulation. During agricultural production, SBG should not be harvested after prolonged
drought but instead should be harvested several days after rain or irrigating to ensure high baicalin content.

1. Introduction affecting in photosynthetic proton and electron transport and changing

Drought stress, one of the most serious abiotic stresses, causes sto-
mata to close and limits photosynthesis, thus impacting the physiolo-
gical processes and productivity of plants, especially the synthesis and
accumulation of secondary metabolites (Boyer, 1970; Selmar and
Kleinwächter, 2013). Drought stress is a deficiency in water supply,
detected as a reduction in soil water content or from the physiological
responses of the plant to water deficit (Ihuoma and Madramootoo,
2017). Under limiting water content of soil, chemical signal is trans-
mitted to the leaf through xylem pathways, which leads to physiological
responses such as stomatal closure, reductions in photosynthesis rate,
in photosynthetic carbon reduction and carbon oxidation cycles (Cornic
and Fresneau, 2002; Zivcak et al., 2014).
The main active compounds in medicinal plants are secondary
metabolites. Therefore drought stress has a greater impact on medicinal
plants. In recent years, several medicinal plants including Bupleurum
chinense DC. (Zhu et al., 2009), Salvia officinalis L. (Nowak et al., 2010)
and Salvia miltiorrhiza Bunge. (Liu et al., 2011b) were intentionally
planted under drought conditions to influence the content of secondary
metabolites. Scutellaria baicalensis Georgi. is a perennial herb in the
Lamiaceae family, and its roots are used to treat heat and dampness (in
traditional Chinese medicine) for detoxification, to promote hemostasis,

Abbreviations: SBG, Scutellaria baicalensis Georgi; MDA, malondialdehyde; Pro, proline; SS, soluble sugar; SP, soluble protein; SO, Dsuperoxide dismutase; PO, Dperoxidase; CAT,
catalase; APX, ascorbate peroxidase; GR, glutathione reductase; PAL, Phenylalanine ammonialyase; C4H, Cinnamate-4-Hydroxylase; 4CL, 4-Coumarate:Coenzyme A Ligase; CHS,
Chalcone Synthase
⁎
Corresponding authors.
E-mail addresses: 429068429@qq.com (L. Cheng), idream9999@126.com (M. Han), 3465637993@qq.com (L.-m. Yang), 184677837@qq.com (Y. Li), 329575068@163.com (Z. Sun),
251073371@qq.com (T. Zhang).

https://doi.org/10.1016/j.indcrop.2018.06.030
Received 12 January 2018; Received in revised form 28 April 2018; Accepted 8 June 2018
0926-6690/ © 2018 Elsevier B.V. All rights reserved.
L. Cheng et al.
and as a tocolytic (Zhao et al., 2016). It is widely distributed in the arid
and semiarid areas of China, Russia, Mongolia, Europe and Japan
(Shang et al., 2010). Increasing market demand has nearly depleted the
natural populations of the plant, but S. baicalensis is now widely culti-
vated in most areas of the world (Bochořáková et al., 2003; Liu et al.,
2017). The physiological mechanisms that contribute to SBG’s adapta-
tion to drought conditions have not been clearly elucidated.
Plant physiological characteristics change under stressful environ-
mental conditions such as during drought, floods, and frost.
Malondialdehyde (MDA)is regarded as an indicator of abiotic stress and
is the end product of membrane-lipid peroxidation following oxidative
damage. Under drought stress, the content of MDA increased with the
increasing of membrane-lipid peroxidation (Rahimi et al., 2018). Plants
mainly reduce the damage of these oxides by controlling the anti-
oxidant system and regulating the content of osmoregulating com-
pounds (Blokhina et al., 2003; Morgan, 1984). The antioxidant system
consists of both enzymatic antioxidant enzymes including SOD (su-
peroxide dismutase), POD (peroxidase) and CAT (catalase) and non-
enzymatic antioxidant enzymes such as APX (ascorbate peroxidase) and
GR (glutathione reductase). The non-enzymatic antioxidant system also
includes phenols and flavonoids, which have higher pharmacological
activity (Bozin et al., 2008). The main osmoregulating substances used
by plants are mainly composed of Pro (proline), SS (soluble sugar) and
SP (soluble protein) (Liu et al., 2011b). In the early stage of drought
stress, the activities of antioxidant enzymes enhanced and osmor-
egulation substances synthesis increased. However, the activities of
antioxidant enzymes inhibited and the content of osmotic regulation
decreased duration of drought stress (Anjum et al., 2011; Aziz et al.,
2018).
The formation of secondary metabolites in medicinal plants is clo-
sely related to the growth environment. Baicalin, the main active in-
gredient of S. baicalensis, is an important flavonoid compound (Makino
et al., 2008). Baicalin is mainly distributed in the root and is synthe-
sized by the flavonoid pathway, which is part of phenylpropanoid
metabolism (Noel et al., 2005). Naringin is the intermediate of flavo-
noid biosynthesis. The general metabolic pathway for the biosynthesis
of flavonoids involves phenylalanine ammonialyase (PAL), cinnamoyl
4-hydroxylase (C4H) and 4-Coumarate: Coenzyme A Ligase (4CL), fol-
lowed by chalcone synthase (CHS). Baicalin is formed by other down-
stream enzymes (Fig. 1). The previous studies showed that environ-
mental factors could promote the expression of key enzyme gene in
secondary metabolic pathway and increase the content of baicalin
(Chen et al., 2010; Xu et al., 2010; Yang et al., 2011). The expression of
these key enzymes in the flavonoid metabolic pathway plays an im-
portant role in the synthesis of baicalin (Zhao et al., 2016).
Water is an essential ecological component of plant growth and
development, and the plant root system is the major moisture absorbing
organ. Therefore, soil water content is crucial to the production and
quality of root metabolites (Kliebenstein and Osbourn, 2012; Ncube
et al., 2012). Generally, drought stress severely impacts crop produc-
tion and is unfavorable to agriculture. However, medicinal plants
growing in semiarid areas have been shown to have a relatively high
content of medicinal compounds (Kleinwächter and Selmar, 2015).
Some studies have shown that an appropriate degree of drought stress
474
Industrial Crops & Products 122 (2018) 473–482
induces secondary metabolic processes and increases secondary meta-
bolites (Zhu et al., 2009; Bettaieb et al., 2009; Nowak et al., 2010;
Bettaieb et al., 2011; Liu et al., 2011a). Nevertheless, economic effi-
ciency may be constrained by normal plant growth conditions in these
cases. Finding the perfect balance between medicinal plant production
and quality by controlling soil water content is important for increasing
both the quality and yield of medicine.
In the present study, physiological drought indicators including leaf
water status, antioxidant enzymes, osmoregulating molecules and sec-
ondary metabolism (key enzyme activities, gene expression, and sec-
ondary metabolites) were analyzed. This study attempts to illuminate
the mechanisms underlying the physiological and biochemical re-
sponses of SBG to drought stress and provide guidelines for the culti-
vation of SBG with high baicalin content.
2. Materials and methods
2.1. Plant materials
The plant material used was biennial SBG. The seeds of SBG were
purchased from Hebei Province and potted in early April 2014. The
dimensions of the pots were 30.50 cm deep, with a rim diameter of
31.20 cm, a base diameter of 20.00 cm, and a soil depth of 28.00 cm.
Each pot was buried entirely in the soil and kept at the same tem-
perature as the soil. The soil used in the experiment was sandy loam,
with 25.74 g/kg of organic matter, 99.47 mg/kg of alkali nitrogen,
27.24 mg/kg of available phosphorus, and an available potassium
content of 136.78 mg/kg. The saturated water content of the soil was
33.86%. Plant emergence occurred in mid-May, and three shoots of
approximately the same height were kept in each pot. The plants were
provided with a normal water supply for the first year.
2.2. Experimental design
Progressive drought stress was applied during the vegetative period
with two-year-old SBG. The experiment was conducted from June to
July 2015 at the medical botanical garden of Jilin Agricultural
University, Jilin Province, China. The treat group was irrigated with
enough water to reach saturation, i.e., the soil water content was ap-
proximately 33.86%; the soil water content of the control group was
maintained at a normal level of 26.00% based on the average rainfall
over 10 years in the Changchun area. The soil moisture was monitored
using an HH2 soil moisture tester (Delta-t Devices Ltd, UK) every day
until the SBG plants wilted. Samples were taken in triplicate every 2
days. The samples were collected at 10:00 am and brought back to the
lab in ice chests. The roots were immediately washed clean, frozen with
liquid nitrogen, and stored at -80 °C. A rain shelter was set up during
the experiment; the plastic film was rolled up on sunny days and re-
placed at night and on rainy days.
2.3. Determination of fresh and dry root weight
The roots of S. baicalensis were washed by tap water and rinsed
three times with distilled water, then the surface moisture was wiped
Fig. 1. Baicalin metabolic pathway in Scutellaria baicalensis
Georgi. (I) Synthesis pathway upstream of baicalin (phenyl-
propanoid metabolism). (II) Baicalin synthesis from the fla-
vonoid metabolic pathway. Enzyme abbreviations: PAL, phe-
nylalanine ammonialyase; C4H, cinnamate 4-hydroxylase;
4CL, 4-coumarate-CoA ligase; CHS, chalcone synthase.
L. Cheng et al.
off the roots with filter paper, the fresh weight (FW) was recorded, the
roots were oven dried at 70℃ for 72 h, and then the dry weight (DW)
was recorded.
2.4. Leaf water content
The relative water content of leaves was measured using the method
of Barrs and Weatherley, (1962). The leaves from the top 5 cm were
measured. First, the fresh leaves were weighed (FW); then, submerged
in distilled water for 12 h, and the swollen leaves were weighed (TW).
Finally, the leaves were kept at 70℃ for 24 h until a constant weight
was reached (DW). The formula RWC (%) = (FW - DW)/ (TW - DW) ×
100 was used to calculate the relative leaf water content.
2.5. Analysis of malondialdehyde and osmoregulating substances
The concentrations of malondialdehyde, proline, soluble sugar and
soluble protein were measured using the methods of Zhang and Chen
(2008) with the following modifications: for determining the mal-
ondialdehyde concentration, 0.5 g of fresh SBG root was used and 3 mL
of 5% TCA was added; for determining the proline concentration, 1.0 g
of fresh root was used and 6 mL of sulfosalicylic acid dihydrate was
added; the soluble sugar concentration was determined using 0.8 g of
fresh root with 10 mL of distilled water added; and soluble protein was
determined using 0.5 g of root with 5 mL of distilled water added for
grinding. The remaining steps followed protocol.
2.6. Antioxidant enzyme extraction and determination of enzyme activity
The preparation of a crude enzyme extract was modified from Ba’s
method (Ba et al., 2013). Then, 0.3 g of root was frozen in liquid ni-
trogen and ground into a powder. A homogenization solution consisting
of 3 mL of 0.05 mol/L of phosphate buffer with a pH of 7.8 containing
0.2 mM of EDTA (polyvinylpyrrolidone), 0.2 mM of ascorbic acid and
2% PVP was prechilled to 4℃. The sample was ground into a homo-
genate, transferred to a centrifuge tube, and buffer was added to make a
final volume of 5 mL. The sample was then centrifuged at 4℃ at
10000 r/min for 15 min, and the supernatant was used for enzyme ac-
tivity assays. SOD, POD, and CAT enzyme-linked immunoassay kits
were used to measure enzyme activity (Shanghai enzyme-linked bio-
technology co., China.), and activities were expressed in U/g*min.
The method used to determine APX activity was modified from
Nakano and Asada (1981). Then, 0.5 g of fresh root was added to 5 mL
of extraction buffer (0.5 mmol/L of PBS with a pH = 7.0, 1 mmol/L of
AsA, and 1 mmol of EDTA), and activity was defined as 1 enzyme ac-
tivity unit (U) per min. APX activity was expressed in μmol min-1mg-1.
The method used to determine GR activity was adopted from Foyer
and Halliwell (1976). Briefly, 0.2 g of root was added to 2 mL of ex-
traction buffer (0.5 mmol/L phosphate buffer solution, pH = 7.8, con-
taining 1% PVP and 0.1 mol/L of EBTA), homogenized in an ice bath,
and centrifuged at 8000 g/min at 4℃ for 15 min, and the supernatant
Table 1
Primers used for qRT-PCR.
Gene Accession No. Primer sequence
5’-3’
PAL HM062777.1 F: GGACTGGCCTCTATTGCTCT
R: CAGCCTTAACGTACGCACTC
C4H HM062778.1 F: AGGCCGGAAAGATTCTTGGA
R: TTCTCAGTGGTGTCGAGCTT
4CL AB166768.1 F: GGCGAGATTTGCATCAGAGG
R:GAGGGGTGATTGAGGAGGAG
CHS EF512579.1 F: AAGTCCAAGATCACCCACGT
R: GGAAAGTGATGGCGGTGATC
18SrRNA FJ609732.1 F: GGAAAGTGATGGCGGTGATC GCGCCAAGGAAAACCAAAAG
R: GATGGTTCACGGGATTCTGC
475
Industrial Crops & Products 122 (2018) 473–482
was used for enzyme activity assays. GR enzyme activity was expressed
in U min-1g-1.
2.7. Determination of key enzyme activities in the baicalin biosynthesis
pathway
An improved crude extraction method for PAL was obtained from
Lister and Lancaster (1996). Then, 0.3 g of Scutellaria root was added to
3 mL of precooled 0.05 mol/L boric acid buffer solution (pH = 8.8, with
0.03 g of PVP, 7.0 mol/L of mercaptoethanol, 1.0 mol/LEDTA of Na2,
and 7% glycerol) and ground under liquid nitrogen. The homogenate
was then centrifuged at 4℃ and 12000 r/min for 15 min.
The C4H crude extraction method was adapted from Lamb and
Rubery (1975) and improved slightly. Briefly, 1.0 g of Scutellaria root
was added to 6 mL of prechilled 50 mol/L Tris - HCL buffer (pH = 8.9,
with 15 L of mercaptoethanol, 4 L of MgCl2, 5 L of VC, 10 μmol/L
Leupeptin, 1 L of PMSF, 0.15% PVP, and 10% glycerol), and samples
were then ground under liquid nitrogen until homogenized, and cen-
trifuged at 12000 r/min for 15 min.
Preparation of 4CL crude extracts was improved slightly from
Knobloch and Hahlbrock (1977). Then, 0.3 g of Scutellaria root was
ground in liquid nitrogen using a grinding mill, 5 mL of extraction
buffer was added, and samples were incubated in an ice bath for 1 h
before centrifuging at 12000 r/min at 4℃ for 10 min.
The CHS crude extracts were prepared using a slightly improved
method from Ju et al. (1995) in which 0.5 g of Scutellaria root was
added to 5 mL of a 0.01 mol/L phosphate buffer solution (pH = 7.5,
containing 3 mmol/L EDTA and 10 mmol/L of the light inhibiting en-
zyme phthalein), and centrifuged at 4℃ at 12000 r/min for 15 min.
PAL, C4H, 4CL and CHS enzyme-linked immunoassay kits were used to
measure enzyme activity and activities were expressed in U/g*min.
2.8. Extraction of RNA and gene expression of key enzymes
Total RNA from S. baicalensis roots was extracted with an RNeasy
Plant Mini Kit, following the manufacturer’s protocol, and purified
using the Oligotex mRNA Mini Kit. A P330 nanophotometer was used to
determine RNA purity and concentration. Following the methods out-
lined for reverse transcription in the BioTeke Super RT kit, the total
RNA was used as a template and oligo-dT primer to reverse transcribe
RNA into cDNA, which was then stored at −20 °C. Using the 18SrRNA
as an internal reference, the relative gene expression levels of PAL, C4H,
4CL, and CHS were determined (primer information is listed in
Table 1). Each 20 μL PCR reaction contained 10 μL of 2 × SYBR Premix
Ex Taq, and the optimum amounts of primer and cDNA were 0.8 μL and
1.0 μL, respectively. The reaction sequence was as follows: 30 s at 94 °C
for pre-denaturation, 5 s at 95 °C for denaturation, 30 s at 55 °C for
annealing, and 30 s at 72 °C for extension. This thermal cycle was re-
peated 40 times. The reaction was carried out in an Agilent Mx 3000 P
quantitative PCR instrument.
Annealing temperature (℃) Product length (bp)
58.9 202
59.0 203
58.6 227
59.0 235
58.8 188
L. Cheng et al. Industrial Crops & Products 122 (2018) 473–482

Table 2
Correlation analysis among baicalin, physiological stress indicators, and secondary metabolism in plants under drought stress
Ban SOD POD CAT APX GR MDA PRO SS SP Mpal Mc4h M4cl Mchs Gpal Gc4h G4cl Gchs

** * ** *
Ban 1 0.73 0.99 0.99** 0.89 0.79 0.32 0.22 -0.11 0.29 0.77 0.96 0.66 0.89 0.49 0.79 -0.41 -0.10
SOD 1 0.72 0.72 0.94* 0.97** -0.17 -0.21 -0.50 -0.20 0.98** 0.80 0.97** 0.81 0.58 0.96** 0.17 0.19
POD 1 1.00** 0.88* 0.76 0.31 0.21 -0.13 0.28 0.75 0.97** 0.63 0.91* 0.44 0.76 -0.72 -0.12
CAT 1 0.88* 0.76 0.31 0.21 -0.13 0.28 0.75 0.97** 0.63 0.91* 0.44 0.76 -0.72 -0.12
APX 1 0.93* 0.13 0.08 -0.26 0.10 0.93* 0.92* 0.88* 0.85 0.50 0.97** -0.01 -0.03
GR 1 -0.15 -0.21 -0.49 -0.18 0.99** 0.79 0.98** 0.83 0.73 0.94* 0.32 0.31
MDA 1 0.99** 0.89* 0.99** -0.20 0.25 -0.27 -0.08 -0.34 0.07 -0.69 -0.81
PRO 1 0.92* 0.98** -0.26 0.17 -0.31 -0.18 -0.42 0.03 -0.74 -0.85
SS 1 0.91** -0.54 -0.20 -0.54 -0.52 -0.48 -0.27 -0.61 -0.72
SP 1 -0.23 0.21 -0.29 -0.12 -0.32 0.03 -0.66 -0.79
Mpal 1 0.80 0.98** 0.85 0.68 0.94* 0.28 0.29
Mc4h 1 0.68 0.92* 0.34 0.83 -0.17 -0.19
M4cl 1 0.74 0.73 0.92* 0.37 0.38
Mchs 1 0.52 0.75 0.13 0.14
Gpal 1 0.52 0.82 0.75
Gc4h 1 0.30 0.01
G4cl 1 0.98**
Gchs 1

Ban: baicalin; SOD: Superoxide Dismutase; POD: peroxidase; CAT: catalase; APX: ascorbate peroxidase; GR: glutathione reductase; MDA: malondialdehyde; PRO:
proline; SS: Soluble sugar; SP: Soluble protein; Mpal: PAL enzyme; Mc4h: C4H enzyme; M4cl: 4CL enzyme; Mchs: CHS enzyme; Gpal: PAL gene; Gc4h: C4H gene;
G4cl: 4CL gene; Gchs: CHS gene
* indicates a significant correlation (p < 0.05).
** indicates a significant correlation (p < 0.01).

Fig. 2. Changes in soil water content and relative water content in leaves under drought stress.(a) Changes in the soil water content under drought stress. (b) Changes
in the relative water content of leaves under drought stress. The data are expressed as the mean ± SD (standard deviation, n = 3). * indicated that the treat group and
control group are significantly different at the 0.05 level.

2.9. Determination of baicalin content 3. Results

Next, 0.30 g of root powder was added to 12 mL of 70% ethanol.
This mixture was extracted for 6 min using the CEM MARS 5 Microwave
Accelerated Reaction System (CEM Corporation, USA) at a constant
temperature of 80 °C. The samples were then filtered, and the total
volume was brought to 25 mL by adding 70% ethanol. Precisely 1 mL of
solution was added to a 25 mL volumetric flask, and 70% ethanol was
used to fill the volume to the mark. The resulting solution was filtered
through a 0.45 μm microporous membrane before sample injection
(Table 2).
A standard curve was established using the baicalin standard
sample. The high-performance liquid chromatography (HPLC) was used
elution procedure described in Han et al. (2011) to determine baicalin
content, which was calculated according to the standard curve equation
y = 2531.41 x-97.21 (r2 = 0.9998).
2.10. Statistical analysis
The relative expression of the target genes was analyzed using the 2-
ΔΔCt
method (Livak and Schmittgen, 2001). Excel 2010 was used to
arrange the raw data. SPSS 19.0 was used for single-factor variance
analysis and Pearson correlation statistical analysis. Origin 9.1 was used
to graph the data.
3.1. Soil water content and relative leaf water content
In order to explore the physiological and ecological responses of
SBG to water stress and determine which of the plant’s nodes were
affected the most, plants in the treat group were initially saturated with
water, and then irrigation was stopped until the plants wilted. The soil
water content and relative water content of the leaves in the control
group were not significantly changed over the course of the experiment
(p > 0.05). The water content of the treat group was lower than for the
control group by the 4th day, at which point the plants began to show
signs of drought stress. The soil water content during the experiment
decreased from 33.86% to 9.89%. According to Hsiao’s classification
standards for drought stress (Hsiao 1973), mild drought stress occurs
between 4∼8 days, moderate stress occurs between 8∼12 days, and
severe stress occurs beyond 12 days (Fig. 2a). During the study, the
relative water content of the leaves declined due to drought stress. By
the 10th day, the water content of leaves from the treated plants was
significantly lower than those of the control group. By the 20th day, the
water content of the treatment group was only 76.21% that of the
control group. Therefore, the physiological changes of SBG were further
analyzed at 4 d, 8 d, 12 d, 16 d and 20 d based on the soil water content
and relative water content of leaves.

476
L. Cheng et al.
3.2. Fresh weight and dry weight of roots
The fresh and dry weights of SBG are important yield indexes, and
the study found that changes in the fresh and dry weights due to the
effects of drought stress basically followed the same trend. In the mild
drought stress phase (4th∼8th day), DW and FW gradually decreased,
but there was no significant difference. As the duration of stress was
extended, the stress level increased, and both FW and DW dropped
significantly by the 16th day (p < 0.05) compared with the control
group. FW and DW of the roots had decreased by 52.94% and 33.33%
compared with the control, respectively, by the 20th day (Fig. 3).
3.3. Malondialdehyde and the content of osmoregulating substances
Malondialdehyde is the final product of membrane lipid peroxida-
tion, and its content increases when a plant is subjected to oxidative
stress. During drought stress, MDA content increased gradually and was
significantly higher than in the control plants (p < 0.05) by the 12th day
and was approximately 1.66 times higher than in the control group
(Fig. 4a). At the same time, osmoregulating substances including Pro,
SS and SP contents increased during the entire drought period. Pro, SS
and SP contents were significantly lower than in the control group at
the 8th, 8th, and 12th day, respectively (p < 0.05). At the end of the
experiment, the contents of Pro, SS, and SP in the treatment group were
2.26, 2.98, and 2.98 times higher than those in the control group, re-
spectively (Fig. 4b–d).
3.4. Antioxidant enzyme activity
The effect of drought stress on antioxidant enzyme activity in the
root is shown in Fig. 5. Under drought stress, the activities of enzymatic
antioxidant enzymes including SOD, POD, and CAT initially increased
but later decreased. The activities of all three enzymes peaked on the
12th day and were 1.77, 2.78, and 3.11 times higher than in the control
group (Fig. 5a–c).
The activities of APX and GR, non-enzymatic antioxidant enzymes,
increased up to the 12th day and were 3.53 times and 3.34 times higher
than in the control group, respectively (Fig. 6a–b). The activities of all
five antioxidant enzymes decreased under severe drought stress; how-
ever, the activities were comparable to the levels of the control group
on different days. SOD, POD and CAT were reduced to control levels by
the 16th day, while APX and GR did not reach control levels until the
20th day. This indicates that the antioxidant enzyme system in SBG
477
Industrial Crops & Products 122 (2018) 473–482
Fig. 3. Effects of drought stress on the fresh and dry root weights
of SBG.
(a) Changes in root fresh weight under drought stress. (b) Changes
in root dry weight under drought stress. The data are expressed as
the mean ± SD (n = 9). * indicated that the treat group and
control group are significantly different at the 0.05 level. ** in-
dicated that the treat group and control group are significantly
different at the 0.01 level.
plants responded to drought stress.
3.5. Expression of key enzymes
The expression of key enzymes involved in baicalin biosynthesis of
S. baicalensis was altered under drought stress. In general, the expres-
sion of four key enzyme genes in the biosynthetic pathway of baicalin
increased initially and then decreased later, but differences existed in
the dynamic change of each gene (Fig. 7). As shown in Fig. 7a, the
expression of PAL peaked on the 8th day and was significantly higher
than in the control group (p < 0.01); PAL was highly expressed until the
12th day, but after 16 days when drought stress was severe, PAL ex-
pression decreased. By 20th day, PAL expression was significantly lower
than in the control group (p < 0.05). The expression of C4H was sig-
nificantly higher than it was in the control group on the 8th day
(p < 0.05) through the 12th day (p < 0.01), but after 16 days its ex-
pression fell to the control level. The expression of 4CL peaked on the
8th day in the treated group but declined thereafter. The expression
pattern of CHS was similar to that of 4CL, but its expression level was
significantly higher than that of the control group by the 4th day at the
beginning of mild drought stress and continued until 12 days when the
expression was reduced. The expression of both 4CL and CHS was sig-
nificantly lower than in the control group (p < 0.05) during severe
drought stress. In general, the gene expression of four key enzymes
related to baicalin biosynthesis increased under mild and moderate
drought stress, but under severe drought stress, the gene expression
decreased. Thus, the secondary metabolic processes of medicinal plants
are notably influenced at the transcriptional level by changes in soil
water content.
3.6. Activity of the key enzymes
Changes under drought stress in the activities of the key enzymes
upstream of baicalin are shown in Fig. 8. The activity of the 4 key
enzymes followed a decreasing trend after an initial increase. PAL ac-
tivity was significantly higher than the control (p < 0.05) on the 8th
day, and its activity peaked on the 12th day; then, its activity gradually
decreased until it was significantly lower than the control group
(p < 0.05). Unlike the activity of PAL in the initial stage of severe
drought stress (12th to the 16th day), C4H activity gradually decreased
but was still significantly higher than the control (p < 0.01). However,
by the 20th day, C4H activity in the treated group was lower than the
control group, but the difference was not significant (p > 0.05). The
L. Cheng et al.
activity of 4CL was significantly higher than in the control group
(p < 0.01) on the 8th and 12th days. However, its activity was inhibited
under severe drought stress, especially on the 20th day, when 4CL ac-
tivity was significantly lower in the treated group than in the control
group (p < 0.05). The pattern of CHS activity differed from the other
three enzymes. CHS activity did not change drastically and was only
significantly higher than the control (p < 0.05) during mild and mod-
erate drought stress.
3.7. Baicalin content
The baicalin content of plants under drought stress is shown in the
Fig. 9, and it followed a decreasing trend after an initial increase.
Baicalin content began to increase in the treat group after the 4th day
478
Industrial Crops & Products 122 (2018) 473–482
Fig. 4. Changes in the concentrations of mal-
ondialdehyde and osmoregulating substances
during drought stress. (a) Changes in mal-
ondialdehyde (MDA) content during drought
stress. (b) Changes in proline content during
drought stress (c) Changes in soluble sugar
content during drought stress. (d) Changes in
soluble protein content during drought stress.
The data are expressed as the mean ± SD
(n = 5). * indicated that the treat group and
control group are significantly different at the
0.05 level. ** indicated that the treat group and
control group are significantly different at the
0.01 level.
and peaked at approximately 15.54% on the 12th day. It increased by
51.60% comparing to the control group. Then baicalin content gradu-
ally decreased until it was 15.34% lower than the control on 20th day. It
can be seen that the soil moisture content greatly influences baicalin
content in SBG. In terms of the total baicalin yield, the total baicalin
content was highest after 12 days of drought stress, and it was sig-
nificantly higher than in the control (p < 0.01), however, comprehen-
sive yield of baicalin significantly decreased on 20th day. Saturating the
soil initially and harvesting SBG after 12 days without water would
potentially maximize baicalin yield.
Fig. 5. Effects of drought stress on the activities of
SOD, POD and CAT. (a) Changes in SOD activity under
drought stress (b) Changes in POD activity under
drought stress (c) Changes in CAT activity under
drought stress. The data are expressed as the
mean ± SD (n = 3). * indicated that the treat group
and control group are significantly different at the 0.05
level. ** indicated that the treat group and control
group are significantly different at the 0.01 level.
L. Cheng et al.
3.8. The correlation between physiological stress indicators and baicalin
was investigated
Baicalin was significantly correlated with POD, CAT and Mc4h ac-
tivities (p < 0.01) as well as with APX and Mchs activities (p < 0.05).
SOD activity was significantly correlated with Mc4H (p < 0.01) and
Mchs (p < 0.05) activities. APX was significantly correlated with Mpal,
Mc4h and M4cl activities (p < 0.05). PAL, C4H, 4CL and CHS expres-
sion was positively associated with the activities of corresponding en-
coded proteins, but none were significant. The changes at the tran-
scriptional level may not accurately reflect the changes in protein
activities.
479
Industrial Crops & Products 122 (2018) 473–482
Fig. 6. Effects of drought stress on the activities of APX and
GR. (a) Changes in APX activity under drought stress (b)
Changes in GR activity under drought stress. The data are ex-
pressed as the mean ± SD (n = 3). * indicated that the treat
group and control group are significantly different at the 0.05
level; ** indicated that the treat group and control group are
significantly different at the 0.01 level.
4. Discussion
The main active components of medicinal plants are secondary
metabolites. These secondary metabolites play an important role in the
treatment of digestive ailments, respiratory problems, reproductive
problems, urinary tract infections, degenerative diseases, nervous
system disorders and other ailments (Moteetee et al., 2018). Therefore,
the content of secondary metabolites is the key factor to evaluate the
quality of medicinal herbs. Scutellaria baicalensis Georgi is one of the
medicinal species from the family of Lamiaceae and well known by high
flavonoids content which are the largest group of plant phenols and the
most studied (Oksana et al., 2012; Sytar et al., 2016). The main com-
ponents of the SBG are flavone derivatives including baicalin, wogo-
noside, baicalein and wogonin which have the functions for the treat-
ment of breast cancer, lung carcinoma, gastric adenocarcinoma and
Fig. 7. Effects of drought stress on the expres-
sion of key enzyme genes. (a) Changes in PAL
expression under drought stress. (b) Changes in
C4H expression under drought stress. (c)
Changes in 4CL expression under drought
stress. (d) Changes in CHS gene expression
under drought stress. The data are expressed as
the mean ± SD (n = 3). * indicated that the
treat group and control group are significantly
different at the 0.05 level. ** indicated that the
treat group and control group are significantly
different at the 0.01 level.
L. Cheng et al. Industrial Crops & Products 122 (2018) 473–482

Fig. 8. Effects of drought stress on key enzyme activities. (a) Changes in PAL activity under drought stress. (b) Changes in C4H activity under drought stress. (c)
Changes in 4CL activity under drought stress (d) Changes in CHS activity under drought stress. The data are expressed as the mean ± SD (n = 3). * indicated that the
treat group and control group are significantly different at the 0.05 level. ** indicated that the treat group and control group are significantly different at the 0.01
level.

Fig. 9. Changes in the baicalin content and total baicalin yield under drought stress. (a) Changes in the baicalin content under drought stress. (b) Changes in the total
yield of baicalin under drought stress (total yield of baicalin = root dry weight × bacailin content ). The data are expressed as the mean ± SD (n = 9). * indicated
that the treat group and control group are significantly different at the 0.05 level. ** indicated that the treat group and control group are significantly different at the
0.01 level.

480
L. Cheng et al.
malignant brain tumor (Min, 2009; Scheck et al., 2006).
Two-year-old SBG vegetative growth was systematically studied in
order to explore its physiological responses to drought stress. In this
experiment, drought stress was divided into three stages based on the
Hsiao classification method for the degree of drought stress and mor-
phological indicators. From 4-8 days, there was no significant change in
morphology, and the soil moisture content was 25.35%-19.35%.
Moderate drought stress occurred from 8-12 days, when the soil
moisture was reduced to 15.68%. The relative leaf water content was
reduced to 75.25%, and leaves began to wilt. MDA, Pro, SS, and SP
content gradually rose, indicating that the plant was suffering from
oxidative damage at this stage. The third stage is severe drought stress
(after 12 days), and during this stage, the leaves yellowed and easily
shed, and the water content dropped to 51% of the control. At this
stage, MDA, Pro, SS, and SP contents reached the maximum. Drought
stress is known to affect the growth and metabolism of plants (Bohnert
and Jensen, 1996). In this study, drought stress significantly inhibited
root growth.
The metabolic system for scavenging reactive oxygen in the plant is
unbalanced under abiotic stress conditions, which leads to the accu-
mulation of reactive oxygen species, causing damage to the plant
membrane system (Nxele et al., 2017). SOD, POD, and CAT are im-
portant parts of the non-enzymatic antioxidant system in plants, which
can convert O2- into H2O (Helaly et al., 2017). Drought stress could
promote the activities of SOD, POD, and CAT to a certain degree. In the
present study, these three enzymes had higher activity in mild and
moderate drought stress to help keep the plant functioning normally,
which is consistent with previously published studies (Antoniou et al.,
2017). Three kinds of enzymes had the same response to drought stress,
but the rates at which enzyme activity increased and the timing of the
peak activity differed. Under drought stress, the synergy of the different
enzymes is needed to jointly combat oxidative damage in the plant.
However, under severe stress, the activities of three enzymes were
significantly reduced, probably because the reactive oxygen species
content exceeded the capacity of the antioxidant enzyme system in vivo
of plant. APX and GR are non-enzymatic antioxidant enzymes that re-
spond to drought stress. In this study, both were increased in SBG plants
under mild and moderate drought stress but decreased during severe
drought stress. The reason for this is that free radical scavenging was
impaired (Liu et al., 2011a, 2011b). The malondialdehyde content is an
indicator of the degree of lipid peroxidation in the cell membrane, and
drought stress can induce lipid peroxidation (Zhao and Tan, 2005). In
this study, MDA content continued to rise during the drought period
and reached its highest level under severe drought stress, which is
contrary to the change in antioxidant enzyme activity. On the one hand,
under severe drought stress, membrane lipid peroxidation increased,
resulting in the accumulation of MDA. On the other hand, increased
MDA content inhibits the activity of protective enzymes and exacer-
bates damage to cell membranes. This is consistent with the results of
the analysis of MDA content in plants under drought stress. Osmor-
egulating is an important physiological mechanism that allows plants to
adapt to environmental stress. By adjusting the content of osmor-
egulating substances within the cells, plants can maintain cell turgor
pressure and normal physiological processes (Fu et al., 2011). In this
study, the contents of proline, soluble sugar and soluble protein in-
creased during drought stress and peaked under severe drought stress,
which was consistent with previous research (Mutava et al., 2015; Wu
et al., 2014; Liu and Chan, 2015). When SBG was subjected to drought
stress, cells increased the content of osmoregulating compounds to
maintain osmotic balance and the water content of the plant.
PAL, C4H, 4CL and CHS are the key genes in the baicalin bio-
synthesis pathway, and the product of gene expression is the enzyme,
but high expression does not always indicate higher enzyme activity.
Enzyme activity has a more direct relationship to baicalin accumulation
during drought stress. In this study, drought stress influenced the ex-
pression of the key enzymes needed for baicalin biosynthesis. The study
481
Industrial Crops & Products 122 (2018) 473–482
found that expression of the four key enzymes under mild and moderate
drought stress was significantly higher than in the controls, but under
severe drought stress, the gene expression was significantly reduced.
Coincidentally, the activity of key enzymes in the baicalin biosynthesis
pathway and the expression of the corresponding genes are consistent
in the pattern of response to drought stress. This demonstrates that the
key enzymes needed for baicalin biosynthesis respond to drought stress
first at the transcriptional level and then by changes in enzymatic ac-
tivities, which ultimately influences the biosynthesis and accumulation
of baicalin.
The baicalin content is used as the standard for judging its quality of
SBG (Zhao et al., 2016). In this study, the baicalin content was in-
creased by mild and moderate drought stress but was significantly in-
hibited by severe drought stress. This is consistent with the results of
other studies on the accumulation of secondary metabolites in medic-
inal plants under drought stress (Yadav et al., 2014; Zahir et al., 2014;
Jia et al., 2015). Drought stress can affect secondary metabolic pro-
cesses. Namely, under appropriate radix Scutellaria responds by in-
creasing the activities of protective enzymes and the amounts of os-
moprotective compounds to protect cells from oxidative stress. This
promotes the biosynthesis of baicalin via the expression of key enzymes
in the biosynthetic pathway and enhances secondary metabolite accu-
mulation and enzymatic activities, eventually increasing the content of
baicalin. Under severe drought stress, baicalin content and antioxidant
enzyme activity were significantly negatively correlated, and genes
expression levels and enzyme activities were significantly positively
correlated. Antioxidant enzymes can promote or inhibit the gene ex-
pression and activities of key enzymes involved in baicalin secondary
metabolism and affect the accumulation of baicalin.
5. Conclusions
The activities of antioxidant enzymes and osmoprotective com-
pounds increased in order to remediate oxidative damage occurred in
SBG under drought stress. Although this reduced the yield of radix
Scutellariae, secondary metabolism and baicalin biosynthesis were sti-
mulated. Mild and severe drought stress had opposite effects on the
baicalin content of radix Scutellariae. Therefore, during the cultivation
of Scutellaria baicalensis Georgi., soil moisture content should be prop-
erly controlled to maintain a balance between appropriate protective
enzyme activity and increased baicalin content in Scutellaria root. The
results of this study are of great significance to cultivators and re-
searchers of medicinal plants.
Conflict of interest
The Authors declare that they have no conflicts of interest.
Ethical Approval
This article does not contain any studies with human or animal
subjects.
Acknowledgements
This work was supported by National Natural Science Foundation of
China (grant numbers 31570327 and 31070292); Scientific and tech-
nological development project of Jilin Province (grant number
20150204067YY)
References
Anjum, S.A., Xie, X.Y., Wang, L.C., Saleem, M.F., Man, C., Lei, W., 2011. Morphological,
physiological and biochemical responses of plants to drought stress. African Journal
of Agricultural Research 6 (9), 2026–2232.
Aziz, A., Akram, N.A., Ashraf, M., 2018. Influence of natural and synthetic vitamin C
L. Cheng et al.
(ascorbic acid) on primary and secondary metabolites and associated metabolism in
quinoa (Chenopodium quinoa Willd.) plants under water deficit regimes. Plant
Physiology and Biochemistry 123, 192–203.
Antoniou, C., Chatzimichail, G., Xenofontos, R., Pavlou, J.J., Panagiotou, E., Christou, A.,
Fotopoulos, V., 2017. Melatonin systemically ameliorates drought stress-induced
damage in Medicago sativa plants by modulating nitro-oxidative homeostasis and
proline metabolism. Journal of Pineal Research 62 (4) p. e12401.
Ba, Q.S., Zhang, G.S., Wang, J.S., Che, H.X., Liu, H.Z., Niu, N., Shou Cai Ma, S.C., Wang,
J.W., 2013. Relationship between metabolism of reactive oxygen species and che-
mically induced male sterility in wheat (Triticum aestivum L.). Canadian Journal of
Plant Science 93 (4), 675–681.
Barrs, H.D., Weatherley, P.E., 1962. A Re-Examination of the Relative Turgidity
Technique for Estimating Water Deficits in Leaves. Australian Journal of Biological
Sciences 15 (3), 413–428.
Bettaieb, I., Hamrouni-Sellami, I., Bourgou, S., Limam, F., Marzouk, B., 2011. Drought
effects on polyphenol composition and antioxidant activities in aerial parts of Salvia
officinalis L. Acta Physiologiae Plantarum 33, 1103–1111.
Bettaieb, I., Zakhama, N., Aidi Wannes, W., Kchouk, M.E., Marzouk, B., 2009. Water
deficit effects on Salvia officinalis fatty acids and essential oils composition. Scientia
Horticulturae 120, 271–275.
Blokhina, O., Virolainen, E., Fagerstedt, K.V., 2003. Antioxidants, Oxidative Damage and
Oxygen Deprivation Stress: a Review. Annals of Botany 91, 179–194. http://dx.doi.
org/10.1093/aob/mcf118.
Bochořáková, H., Paulová, H., Slanina, J., Musil, P., Táborská, E., 2003. Main flavonoids
in the root of Scutellaria baicalensis cultivated in Europe and their comparative an-
tiradical properties. Phytotherapy Research 17, 640–644.
Bohnert, H.J., Jensen, R.G., 1996. Strategies for engineering waterstress tolerance in
plants. Tends in Biotechnology 14 (3), 89–97.
Boyer, J.S., 1970. Leaf enlargement and metabolic rates in corn, soybean, and sunflower
at various leaf water potentials. Plant Physiology 46 (2), 233–235. http://dx.doi.org/
10.1104/pp.46.2.233.
Bozin, B., Mimica-Dukic, N., Samojlik, I., Goran, A., Igic, R., 2008. Phenolics as anti-
oxidants in garlic (Allium sativum L., Alliaceae). Food Chemistry 111 (4), 925–929.
Chen, S.Q., Yuan, Y., Luo, Y.J., Huang, L.Q., Chen, P., Li, X.M., 2010. Effects of light on
flavonoids accumulation and related gene expression in suspension cultures of
Scutellaria baicalensis. China Journal of Chinese Materia Medica 35 (6), 682–685.
Cornic, G., Fresneau, C., 2002. Photosynthetic Carbon Reduction Carbon Oxidation Cycles
are the Main Electron Sinks for Photosystem II Activity During a mild Drought.
Annals of Botany 89, 887–894.
Foyer, C.H., Halliwell, B., 1976. The presence of glutathione and glutathione reductase in
chloroplasts: A proposed role in ascorbic acid metabolism. Planta 133 (1), 21–25.
Fu, G.F., Song, J., Xiong, Ji., Li, Y.R., Chen, H.Z., Le, M.K., Tao, L.X., 2011. Changes of
Oxidative Stress and Soluble Sugar in Anthers Involve in Rice Pollen Abortion Under
Drought Stress. Agricultural Sciences in China 10 (7), 1016–1025.
Han, Z.M., Guo, H.L., Chang, B., Hu, S.B., Han, M., Yang, L.M., 2011. Extracting tech-
nology of baicalin by microwave from Scutellaria baicalensis Georgi. Lishizhen
Medicine and Materia Medica Research 22, 2840–2841 In Chinese.
Helaly, M.N., El-Hoseiny, H., El-Sheery, N.I., Rastogi, A., Kalaji, H.M., 2017. Regulation
and physiological role of silicon in alleviating drought stress of mango. Plant
Physiology and Biochemistry 118, 31–44.
Hsiao, T.C., 1973. Plant response to stress. Annual Review of Plant Physiology 24,
519–570.
Ihuoma, S.O., Madramootoo, C.A., 2017. Recent advances in crop water stress detection.
Computers and Electronics in Agriculture 141, 267–275.
Jia, X., Sun, C.S., Li, G.Y., Li, G.B., Chen, G.L., 2015. Effects of progressive drought stress
on the physiology, antioxidative enzymes and secondary metabolites of Radix
Astragali. Acta Physiol Plant 37, 262.
Ju, Z.G., Liu, C.L., Yuan, Y.B., 1995. Activities of chalcone synthase and UDPGal: flavo-
noid-3-o-glycosyltransferase in relation to anthocyanin synthesis in apple. Scientia
Horticulturae 63 (3-4), 175–185.
Kleinwächter, M., Selmar, D., 2015. New insights explain that drought stress enhances the
quality of spice and medicinal plants: potential applications. Agronomy for
Sustainable Development 35, 121–131.
Kliebenstein, D.J., Osbourn, A., 2012. Making new molecules-evolution of pathways for
novel metabolites in plants. Current Opinion in Plant Biology 15 (4), 415–423.
Knobloch, K.H., Hahlbrock, K., 1977. 4-Coumarate: CoA ligase from cell suspension
cultures of Petroselinum hortense Hoffm: Partial purification, substrate specificity,
and further properties. Archives of Biochemistry and Biophysics 184 (1), 237–248.
Lamb, C.J., Rubery, P.H., 1975. A spectrophotometric assay for trans-cinnamic acid 4-
hydroxylase activity. Analytical Biochemistry 68 (2), 554–561.
Lister, C.E., Lancaster, J.E., 1996. Developmental Changes in Enzymes Biosynthesis in the
Skins of Red and, 2018 Biosynthesis in the Skins of Red and of Flavonoid Green Apple
Cultivars. Journal of the Science of Food and Agriculture. 71 (3), 313–320.
Liu, C.C., Liu, Y.G., Guo, K., Fan, D.Y., Li, G.Q., Zheng, Y.R., Yu, L.F., Yang, R., 2011a.
Effect of drought on pigments, osmotic adjustment and antioxidant enzymes in six
woody plant species in karst habitats of southwestern China. Botany 71 (2), 174–183.
Liu, H.Y., Wang, X.D., Wang, D.H., Zou, Z.R., Liang, Z.S., 2011b. Effect of drought stress
on growth and accumulation of active constituents in Salvia miltiorrhiza Bunge.
Industrial Crops and Products 33 (1), 84–88.
Liu, R.X., Song, G.H., Wu, P.G., Zhang, X.W., Hu, H.J., Liu, J., Miao, X.S., Hou, Z.Y.,
Wang, W.Q., Wei, S.L., 2017. Distribution patterns of the contents of five biologically
activate ingredients in the root of Scutellaria baicalensis. Chinese Journal of Natural
482
Industrial Crops & Products 122 (2018) 473–482
Medicines 15 (2), 152–160.
Liu, X., Chan, Z.L., 2015. Application of potassium polyacrylate increases soil water status
and improves growth of bermudagrass (Cynodon dactylon) under drought stress
condition. Scientia Horticulturae 197, 705–711.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-
Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408.
Makino, T., Hishida, A., Goda, Y., 2008. Comparisno of the major flavonoid content of S.
baicalensis, S. lateriflora, and their commercial products. Journal of Natural
Medicines 62, 294–299.
Min, L.W., 2009. New therapeutic aspects of flavones: The anticancer properties of
Scutellaria and its main active constituents Wogononin, Baicalein and Baicalin.
Cancer Treatment Reviews 35, 57–68.
Morgan, J.M., 1984. Osmoregulation and water stress in higher plants. Annual Review of
Plant Physiology 35, 299–319.
Moteetee, A., Moffett, R.O., Seleteng-Kose, L., 2018. A review of the ethnobotany of the
Basotho of Lesotho and the Free State Province of South Africa (South Sotho). South
African Journal of Botany. http://dx.doi.org/10.1016/j.sajb.2017.12.012.
Mutava, R.N., Prince, S.J.K., Syed, N.H., Song, L., Valliodan, B., Chen, W., Nguyen, H.T.,
2015. Understanding abiotic stress tolerance mechanisms in soybean: A comparative
evaluation of soybean response to drought and flooding stress. Plant Physiology and
Biochemistry 86, 109–120.
Nakano, Y., Asada, K., 1981. Hydrogen Peroxide is Scavenged by Ascorbate-specific
Peroxidase in Spinach Chloroplasts. Plant and Cell Physiology 22 (5), 867–880.
Ncube, B., Finnie, J.F., Staden, J.V., 2012. Quality from the field: The impact of en-
vironmental factors as quality determinants in medicinal plants. South African
Journal of Botany 82, 11–20.
Noel, J.P., Austin, M.B., Bomati, E.K., 2005. Structure-function relationships in plant
phenylpropanoid biosynthesis. Current Opinion in Plant Biology 8, 249–253.
Nowak, M., Kleinwäechter, M., Manderscheid, R., Selmar, D., 2010. Drought stress in-
creases the accumulation of monoterpenes in sage (Salvia officinalis), an effect that is
compensated by elevated carbon dioxide concentration. Journal of Applied Botany
and Food Quality 83 (2), 133–136.
Nxele, X., Klein, A., Ndimba, B.K., 2017. Drought and salinity stress alters ROS accu-
mulation, water retention, and osmolyte content in sorghum plants. South African
Journal of Botany 108, 261–266.
Oksana, S., Marian, B., Mahendra, R., Bo, S.H., 2012. Plant phenolic compounds for food.
pharmaceutical. Journal of Medicinal Plants Research 6 (13), 2526–2539.
Rahimi, Y., Taleei, A., Ranjbar, M., 2018. Long-term water defict modulates antioxidant
capacity of peppermint (Mentha piperita L.). Scientia Horticulturae 14, 36–43.
Scheck, A.C., Perry, K., Hank, N.C., Clark, W.D., 2006. Anticancer activity of extracts
derived from the mature roots of Scutellaria baicalensis on human malignant brain
tumor cells. BMC Complementary and Alternative Medicine 6, 27.
Selmar, D., Kleinwächter, M., 2013. Influencing the product quality by deliberately ap-
plying drought stress during the cultivation of medicinal plants. Industrial Crops and
Products 42, 558–566.
Shang, X.F., He, X.R., He, X.Y., Li, M.X., Zhang, R.X., Fan, P.C., Zhang, Q.L., Jia, Z.P.,
2010. The genus Scutellaria an ethnopharmacological and phytochemical review.
Journal of Ethnopharmacology 128, 279–313.
Sytar, O., Hemmerich, I., Zivcak, M., Rauh, C., Brestic, M., 2016. Comparative analysis of
bioactive phenolic compounds composition from 26 medicinal plants. Saudi Journal
of Biological Sciences. http://dx.doi.org/10.1016/j.sjbs.2016.01.036.
Wu, S.W., Hu, C.X., Tan, Q.L., Nie, Z.J., Sun, X.C., 2014. Effects of molybdenum on water
utilization, antioxidative defense system and osmotic-adjustment ability in winter
wheat (Triticum aestivum) under drought stress. Plant Physiology and Biochemistry
83, 365–374.
Xu, H., Park, N.I., Li, X.H., Kim, Y.K., Lee, S.Y., Park, S.U., 2010. Molecular cloning and
characterization of phenylalanine ammonia-lyase, cinnamate 4-hydroxylase and
genes involved in flavone biosynthesis in Scutellaria baicalensis. Bioresour Technol.
101, 9715–9722.
Yadav, R.K., Sangwan, R.S., Sabir, F., Srivastava, A.K., Sangwan, N.S., 2014. Effect of
prolonged water stress on specialized secondary metabolites, peltate glandular tri-
chomes, and pathway gene expression in Artemisia annua L. Plant Physiology and
Biochemistry 74, 70–83.
Yang, Z.C., Yuan, Y., Chen, M., Shuai, L.F., Xiao, Q., Lin, S.F., 2011. Effects of PEG stress
on flavonoids accumulation and related gene expression in suspension of Scutellaria
baicalensis. China Journal of Chinese Materia Medica 36 (16), 2157–2161.
Zahir, A., Abbasi, B.H., Adil, M., Anjum, S., Zia, M., 2014. Synergistic effects of drought
stress and photoperiods on phenology and secondary metabolism of Silybum mar-
ianum. Applied Biochemistry and Biotechnology 174 (2), 693–707.
Zhang, Z.A., Chen, Z.Y., 2008. Guide to plant physiology experiment. Jilin University
Press, Jilin, China In Chinese.
Zhao, H.J., TAN, J.F., 2005. Role of calcium ion in protection against heat and high
irradiance stress-induced oxidative damage to photosynthesis of wheat leaves.
Photosynthetica 43 (3), 473–476.
Zhao, Q., Chen, X.Y., Martin, C., 2016. Scutellaria baicalensis, the golden herb from the
garden of Chinese medicinal plants. Science Bulletin 61, 1391–1398.
Zhu, Z.B., Liang, Z.S., Han, R.L., Wang, X., 2009. Impact of fertilization on drought re-
sponse in the medicinal herb Bupleurum chinense DC.:Growth and saikosaponin pro-
duction. Industrial Crop and Products 29, 629–633.
Zivcak, M., Kalaji, H.M., Shao, H.B., Olsovska, K., Breatic, M., 2014. Photosynthetic
proton and electron transport in wheat leaves under prolonged moderate drought
stress. Journal of Photochemistry and Photobiology B: Biology 137, 107–115.