Journal of Medical Microbiology (2005), 54, 1183–1187 DOI 10.1099/jmm.0.

46160-0

Rapid and simple detection of blaCTX-M genes by

multiplex PCR assay
Li Xu,1,2 Vicki Ensor,2 Savita Gossain,1 Kathy Nye1 and Peter Hawkey1,2
1
Correspondence Health Protection Agency West Midlands Public Health Laboratory, Birmingham Heartlands &
Li Xu Solihull NHS Trust, Birmingham B9 5SS, UK
li.xu@heartofengland.nhs.uk 2
Division of Immunity and Infection, University of Birmingham, UK

Received 18 May 2005
Accepted 5 August 2005
A novel multiplex PCR assay is described (CTX-Mplex PCR) that allows rapid detection of blaCTX-M
genes and discrimination between groups 1, 2, 9 and 25/26. The specificity and sensitivity of the
assay were evaluated with 10 control strains and then applied to 62 clinical isolates. The multiplex
PCR detected and classified blaCTX-M genes with 100 % accuracy. The utilization of a denaturing
HPLC WAVE system to size the PCR products automatically from the multiplex PCR enhances the
assay by saving time and costs.

INTRODUCTION screen for ceftazidime resistance as an indicator of ESBLs

Plasmid-mediated extended-spectrum â-lactamases (ESBLs)
are the predominant cause of transferable resistance to third-
generation cephalosporins in Gram-negative bacteria.
CTX-M-type ESBLs, which are non-TEM and non-SHV
derivatives, represent a new and rapidly growing family of
molecular class-A ESBLs (Bonnet, 2004). On the basis of their
amino acid sequence similarities, they have been classified
into five groups, groups 1, 2, 8, 9 and 25/26, and, to date,
more than 40 CTX-M â-lactamases have been reported
(Bonnet, 2004).
In the past 15 years, CTX-M-type ESBLs have become more
prevalent worldwide (Bonnet et al., 2000; Chanawong et al.,
2002; Moland et al., 2003; Pagani et al., 2003). In the UK, the
first report was of a CTX-M-9-producing isolate (group 9) of
Klebsiella oxytoca in Leeds in 2000 (Alobwede et al., 2003);
subsequently, CTX-M-26 (group 25/26) was recovered from
an outbreak in City Hospital, Birmingham (Brenwald et al.,
2003). CTX-M-9, -14 (group 9) and -15-producing isolates
(group 1) were found in both the community and hospitals
in York (Munday et al., 2004). A more recent surveillance
study from 42 centres showed that CTX-M-15-producing
Escherichia coli were widely scattered throughout the UK
(Woodford et al., 2004). In addition, the first isolation of
CTX-M-3 (group 1) â-lactamase has also been reported
(Winstanley et al., 2004).
The diversity and increasing prevalence of CTX-M-type
ESBLs pose a serious threat to the clinical use of third-
generation cephalosporins for the treatment of severe infec-
tions. What is more alarming is the underdetection of ESBL
production in clinical isolates, as it is common practice to
Abbreviations: DHPLC, denaturing HPLC; ESBL, extended-spectrum
â-lactamase.
Downloaded from www.microbiologyresearch.org by
46160 & 2005 SGM Printed in Great Britain IP: 60.246.68.76
On: Sun, 08 Apr 2018 11:57:41
(Alobwede et al., 2003). However, in contrast with TEM- and
SHV-type ESBLs, most CTX-M producers preferentially
hydrolyse and confer resistance to cefotaxime rather than
ceftazidime. There is an urgent need to use molecular
detection methods that enable the identification and
monitoring of the emergence of CTX-M-type ESBLs. Those
methods which make possible the differentiation of different
gene sequences to establish the epidemiology of these new
ESBLs are particularly needed. PCR has been applied
successfully to characterize blaCTX-M genes, but detection of
all members from five groups required multiple PCRs with
group-specific primers (Canton et al., 2002; Chanawong et
al., 2002; Pitout et al., 2004) or consensus primers which only
amplify few blaCTX-M alleles (Cao et al., 2002; Saladin et al.,
2002). Currently, sequencing is the only method for defini-
tive identification of blaCTX-M genes, which is labour-
intensive, time-consuming and expensive. We report here
the development of a rapid and accurate multiplex PCR assay
(CTX-Mplex PCR) for the simultaneous amplification of all
blaCTX-M genes and differentiation of the five groups.
Furthermore, in order to reduce the time required for gel
electrophoresis, the utilization of denaturing HPLC
(DHPLC) for analysis of the multiplex PCR products was
also investigated.
METHODS
Bacterial strains and antimicrobial susceptibility testing. Ten
blaCTX-M -carrying strains were used as controls to optimize the multi-
plex PCR assay (Table 1). Two non-blaCTX-M -carrying Klebsiella
pneumoniae strains, WH208537 (SHV-12-producing) and WH758373
(SHV-11- and TEM-1-producing) were included as negative controls. A
blinded panel of 62 blaCTX-M -positive isolates (32 Escherichia coli, 24
Klebsiella sp. and 6 Enterobacter cloacae) were tested by the optimized
multiplex PCR. Samples were collected between October 2003 and
1183
L. Xu and others

Table 1. Control strains used in evaluating CTX-Mplex PCR

Isolate Species bla genes (subgroup) Source

QE15 Escherichia coli CTX-M-15 (group 1) Birmingham, UK

GZ3 Escherichia coli CTX-M-3 (group 1) Guang Zhuo, China
F1 Escherichia coli CTX-M-1 (group 1) Paris, France
Y19 Escherichia coli CTX-M-9 (group 9) York, UK
Y15 Escherichia coli CTX-M-14 (group 9) York, UK
TRA Escherichia coli CTX-M-21 (group 9) Paris, France
F2 Escherichia coli CTX-M-2 (group 2) Paris, France
TLR Escherichia coli CTX-M-20 (group 2) Paris, France
ESBL530 Escherichia coli CTX-M-25 (group 25/26) Manitoba, Canada
H610 Klebsiella pneumoniae CTX-M-26 (group 25/26) Birmingham, UK
WH208537 Klebsiella pneumoniae SHV-12 Birmingham, UK
WH758373 Klebsiella pneumoniae SHV-11 and TEM-1 Birmingham, UK

February 2004 from 13 hospitals in the West Midlands area of the UK
and between 1998 and 2001 from two hospitals in Wuhan and Beijing,
China. Twenty-three of 32 Escherichia coli and 20 of 24 Klebsiella isolates
were from hospital patients and the remaining 19 isolates were collected
from community patients (faeces samples were submitted to Birming-
ham Heartlands Hospital for the diagnosis of diarrhoeal disease). The
DNA sequence identity of all blaCTX-M genes of clinical isolates and
control strains was confirmed by bidirectional sequencing of their PCR
products using Beckman CEQ2000 protocols. The initial sample
screening and antibiotic susceptibility testing were performed as
described previously (Munday et al., 2004).
Multiplex PCR assay (CTX-Mplex PCR). To confirm that each
primer set was sufficient for the amplification of a subgroup(s)-specific
fragment, a monoplex PCR was first performed with each individual
primer set using 10 phenotypically and genotypically well-characterized
CTX-M-type ESBL-producing control strains. The specificity of the
primers was then evaluated with the combined primer sets in the
multiplex PCR with different PCR cycling parameters. PCR amplifica-
tion was performed with template DNA prepared from the heat
treatment of a bacterial suspension (95 8C, 5 min). Five microlitres
template DNA was added to a 50 ìl reaction mixture containing 25 mM
Tris/HCl, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP (Qiagen), all
primers at various concentrations and 2.5 U Taq polymerase (Qiagen).
The cycling parameters were as follows: 95 8C for 2 min followed by 30
cycles of 95 8C for 1min, 55 8C for 1 min and 72 8C for 1 min, with a final
extension at 72 8C for 10 min. Four microlitres of the PCR product was
mixed with 2 ìl loading buffer and separated on a 2 % agarose gel in TBE
buffer. Amplified products were visualized with UV light after staining
with ethidium bromide.
Duplex detection of different groups of blaCTX-M -carrying isolates by the
multiplex PCR was also evaluated by mixing DNA templates from two
groups (5 ìl each).
DHPLC analysis of multiplex PCR products. To investigate the
possibility of further shortening the time needed for gel electrophoresis
of multiplex PCR products and to develop a high-throughput assay for
screening blaCTX-M genes, the multiplex PCR amplicons from one and
two representatives of the five groups were analysed on the DHPLC
WAVE microbial analysis system (Transgenomic Inc.) using the non-
denaturing program (non-DHPLC). Five microlitres of each sample
containing 2 ìl PCR product and 3 ìl water was injected onto a
DNASep column. A 7.6 min gradient at a flow rate of 0.9 min 1 was
used for the separation of PCR amplicons. The gradient size range was
set at 20 to 1100 bp and all samples were analysed at 50 8C. The buffers
Downloaded from www.microbiologyresearch.org by
1184 IP: 60.246.68.76
On: Sun, 08 Apr 2018 11:57:41
used for the gradient were buffer A, 0.1 M triethylammonium acetate,
buffer B, 0.1 M triethylammonium acetate/25 % acetonitrile and buffer
D, 75 % acetonitrile. Peaks that exhibited an absorbance measured as
greater than 1 mV were considered as genuine peaks representing PCR
fragments.
RESULTS AND DISCUSSION
Identification of blaCTX-M subgroup-specific
primers
The sequences of each blaCTX-M subgroup were aligned with
CLUSTAL W and Genedoc. The sequence alignments were
generated from 17 strains of group 1 (CTX-M-1, -3, -10, -11,
-12, -15, -22, -23, -27, -28, -29, -30, -32, -33, -34, -36, -37 and
-42), 9 strains of group 2 (CTX-M-2, -4, -5, -6, -7, -20, -31, -
35 and Toho-1) and 11 strains of group 9 (CTX-M-9, -13, -
14, -16, -17, -18, -19, -21, -24, -38 and Toho-2). The
sequences from six strains, three from group 8 (CTX-M-8,
CTX-M-40 and CTX-M-41) and three from group 25/26
(CTX-M-25, -26 and -39), were aligned together. They have
previously all been classified within group 8 (Tzouvelekis et
al., 2000) and consequently this study will identify groups 8
and 25/26 as one group. The group-specific primer sets were
designed in the highly conserved region of the alignments.
The derived primer sets were subsequently aligned against all
other members of different group sequences in order to
reduce the risk of cross-reactivity. A total of four primer sets
were identified to amplify an internal region of the blaCTX-M
genes from the five groups. Primer pairs CTXM7 and
CTXM8, CTXM17 and CTXM18 and CTXM11 and
CTXM12 are specific to groups 1, 2 and 9, while CTXM19
and CTXM20 amplify both groups 8 and 25/26. CTXM19
and CTXM20 have 100 % sequence similarity with group 25/
26 and only one base mismatch in both the 59 and 39 ends
with group 8. We were not able to test CTXM19 and
CTXM20 with blaCTX-M-8 -carrying strains as these were not
available to us. The amplified multiplex PCR fragments from
isolates representing groups 1, 2, 9, 8 and 25/26 ranged from
207 to 341 bp (Table 2).
Journal of Medical Microbiology 54
 Detection of blaCTX-M genes by multiplex PCR assay

Table 2. Primers used in this study

blaCTX-M subgroup Primer Sequence (59–39) Position PCR product Primer concentration
(bp) (pmol)

Group 1 CTXM7 GCGTGATACCACTTCACCTC 540–559 260 10

CTXM8 TGAAGTAAGTGACCAGAATC 780–779 10
Group 2 CTXM17 TGATACCACCACGCCGCTC 543–561 341 20
CTXM18 TATTGCATCAGAAACCGTGGG 863–883 20
Groups 8 and 25/26 CTXM19 CAATCTGACGTTGGGCAATG 582–601 207 20
CTXM20 ATAACCGTCGGTGACAATT 855–873 20
Group 9 CTXM11 ATCAAGCCTGCCGATCTGGTTA 298–319 293 40
CTXM12 GTAAGCTGACGCAACGTCTGC 570–590 40

Specificities of the multiplex PCR M 1 2 3 4 5 6 7 8 9 10 11 12 13 M

The monoplex PCR amplification with 10 blaCTX-M -carrying
control strains exhibited four distinct bands corresponding 600
to the expected sizes, i.e., 207, 260, 293 and 341 bp (not
450
shown). The specificity of the primers was then evaluated
341
with the combined primer sets in the multiplex PCR. Using 350
20 pmol for each primer, a specific PCR fragment was 300 293
obtained for groups 1, 2 and 25/26, and non-specific 250 260
products were seen. Although the primer set for group 1 200 207
showed a lack of similarity with sequences of all the other
150
groups, a faint cross-reactive band with group 9 was ob-
served. To optimize the multiplex PCR assay and ensure
specificity and reliability, primer sets were mixed in different
ratios in multiplex PCRs. The best results, which resulted in
the loss of non-specific banding from the primer pair for Fig. 1. CTX-Mplex PCR analysis of blaCTX-M control strains. Lanes: M,
group 1 to group 9 template, were obtained with the 50 bp ladder; 1, ESBL530 (CTX-M-25, group 25/26); 2, H610 (CTX-
following primer concentrations: 10 pmol for CTXM7 and M-26, group 25/26); 3, F1 (CTX-M-1, group 1); 4, GZ3 (CTX-M-3,
CTXM8, 20 pmol for CTXM13, CTXM14, CTXM18 and group 1); 5, QE15 (CTX-M-15, group 1); 6, Y19 (CTX-M-9, group 9);
CTXM19 and 40 pmol for CTXM11 and CTXM12. No 7, Y15 (CTX-M-14, group 9); 8, TRA (CTX-M-21, group 9); 9, F2
products were obtained from control strains that produced (CTX-M-2, group 2); 10, TLR (CTX-M-20, group 2); 11, WH208537
SHV-11, SHV-12 and TEM-1 (Table 2 and Fig. 1). (SHV-12); 12, WH758373 (SHV-11 and TEM-1); 13, water negative
control.

Simultaneous detection of two groups of blaCTX-M Evaluation of multiplex PCR with clinical isolates
DNA templates containing combinations of CTX-M-produ- The 62 clinical blaCTX-M -positive isolates included 43 from
cing control strains of groups 1, 2, 9 and 25/26 were evaluated group 1 (40 CTX-M-15 and three CTX-M-3), 16 belonging
with the multiplex PCR. The results are shown in Fig. 2(a). to group 9 (10 CTX-M-14 and six CTX-M-9) and three CTX-
This experiment demonstrated that our assay could accur- M-26 producers (group 25/26). No group 2 or group 8
ately detect the presence of CTX-M â-lactamase genes from clinical isolates were available to us. All of the isolates were
two different groups within the same isolate. characterized in our laboratory previously by a standard
PCR-based method using group-specific primers in four
The results of DHPLC analysis of multiplex PCR products separate PCRs (Munday et al., 2004). Multiplex PCR testing
are shown in Fig. 2(b). The group-specific fragments gener- of these 62 clinical isolates was performed in a blinded
ated from multiplex PCR could be rapidly and accurately fashion. The results revealed 100 % concordance with the
identified by non-DHPLC analysis. The various peaks at data obtained from our standard single PCR-based assay.
different retention times (3.13 min for group 25/26, 3.43 min
for group 1, 3.64 min for group 9 and 3.90 min for group 2) Since the early 1990s, the rapid expansion of the CTX-M-type
correlate with the bands in Fig. 1 (single template) (group 25/ of ESBLs has created concern in the public health community
26, 207 bp; group 1, 260 bp; group 9, 293 bp and group 2, 341 worldwide. Several outbreaks caused by CTX-M-type ESBLs
bp) and Fig. 2(a) (two templates) (group 1 plus group 2, 260 have been reported (Baraniak et al., 2002; Boyd et al., 2004;
and 341 bp; group 25/26 plus group 9, 207 and 293 bp; group Woodford et al., 2004; Yan et al., 2000). In the UK, a recent
25/26 plus group 2, 207 and 341 bp). study identified an epidemic CTX-M-15-producing Escher-
Downloaded from www.microbiologyresearch.org by
http://jmm.sgmjournals.org IP: 60.246.68.76 1185
On: Sun, 08 Apr 2018 11:57:41
L. Xu and others

(a) (b)
100
M1 2 3 3·13 min CTX-M-26, group 25/26
90
650 3·43 min CTX-M-15, group 1
80
3·64 min CTX-M-9, group 9
400 70

Absorbance (mV)
350
300 60 3·90 min CTX-M-2, group 2
250
200 group 25/26 1 group 1
50
150 group 25/26 1 group 9
40
group 25/26 1 group 2
group 25/26 1 30
group 2 group 1 1 group 9
20
group 25/26 1 group 1 1 group 2
group 9 10
group 1 1 group 9 1 group 2
0
group 2 2 3 4 5 6 7
Time (min)

Fig. 2. CTX-Mplex PCR analysis of blaCTX-M control strains with mixed templates. (a) Agarose gel electrophoresis of PCR fragments
generated by CTX-Mplex PCR. Lanes: M, 50 bp ladder; 1, QE15 (CTX-M-15, group 1) plus F2 (CTX-M-2, group 2); 2, H610 (CTX-M-
26, group 25/26) plus Y19 (CTX-M-9, group 9); 3, H610 (CTX-M-26, group 25/26) plus F2 (CTX-M-2, group 2). (b) WAVE DHPLC
analysis of PCR products amplified by CTX-Mplex PCR using single and two mixed templates. Details of representative control strains
from each subgroup were as in (a). The templates used in each PCR were as follows: (from top to bottom) CTX-M-26; CTX-M-15;
CTX-M-9; CTX-M-2; CTX-M-26 plus CTX-M-15, CTX-M-26 plus CTX-M-9; CTX-M-26 plus CTX-M-2; CTX-M-15 plus CTX-M-9;
CTX-M-15 plus CTX-M-2; and CTX-M-9 plus CTX-M-2.

ichia coli with more than 100 community and in-patient
isolates involved (Woodford et al., 2004). To date, in
addition to 15 OXA-type, 55 SHV-type and 135 TEM-type,
more than 40 CTX-M-type ESBLs have been identified
(http://www.lahey.org/studies/webt.htm). To combat the
technical difficulties encountered in molecular detection
and characterization of these â-lactamases, especially ESBLs,
multiplex PCR methods have been successfully developed for
simultaneous amplification of three â-lactamase genes,
blaTEM, blaSHV and blaOXA-1 , and ampC (Colom et al., 2003;
Perez-Perez & Hanson, 2002). The multiplex PCR assay
described in this study offers an accurate, sensitive and rapid
method for screening and identification of all of the blaCTX-M
genes encoding ESBLs. The four pairs of multiplex PCR
primers designed in this study were based on sequence
alignments generated from all of the published blaCTX-M
gene sequences in GenBank. The group-specific fragments
ranging from 207 to 341 bp were clearly separated and
visualized by gel electrophoresis. There was no discrepancy
between results obtained by single and multiplex PCRs for all
control strains evaluated. High specificity of the assay was
demonstrated using 10 control strains as well as clinical
isolates. During the preparation of this paper, Woodford et
al. (2005) described a multiplex PCR method for the
detection of CTX-M-type ESBLs; however, like the current
study, they were not able to test strains from group 8
producers.
The occurrence or association of more than one â-lactamase
within the same isolate (such as CTX-M-14 and SHV-12;
CTX-M-9 and SHV-36; CTX-M-15 and TEM-2; TEM-1,
Downloaded from www.microbiologyresearch.org by
1186
On: Sun, 08 Apr 2018 11:57:41
OXA-1 and CTX-M-3 etc.) has been reported (Arpin et al.,
2003; Chanawong et al., 2002; Colom et al., 2003; Karim et al.,
2001; Munday et al., 2004), although, so far, strains carrying
multiple blaCTX-M genes have not been observed. However,
given the nature of involvement of different genetic elements
in the mobilization of bla genes, it is not impossible that dual
or multiple expression of blaCTX-M genes within the same
isolate may arise. Thus, a method such as the multiplex PCR
developed in this study that is able to detect the presence of
one or more blaCTX-M genes, as well as differentiate between
the blaCTX-M groups, can have significant clinical relevance
in diagnosis, epidemiological studies and surveillance
programmes.
DHPLC can be used to separate PCR products by DNA
sequence and size, enabling bacterial identification and
molecular characterization of antibiotic-resistance genes
(Cooksey et al., 2002; Eaves et al., 2002; Hurtle et al., 2003).
Accurate sizing of PCR products has been used for Myco-
bacterium tuberculosis typing and PCR product analysis to
differentiate AmpC â-lactamases (Evans et al., 2004; Perez-
Perez & Hanson, 2002; Tzouvelekis et al., 2000). The
application of the DHPLC WAVE technology to the analysis
of multiplex PCR products developed in this study has clear
advantages. The PCR products are processed in a 96-well
autosampler unit and injected continuously onto the column
for analysis without any time-consuming pre-manipula-
tions, such as purification and denaturation. The accuracy,
flexibility and high throughput capability of multiplex-
DHPLC represents a superior method for the analysis of
multiplex PCR products compared with gel electrophoresis.
IP: 60.246.68.76 Journal of Medical Microbiology 54

To conclude, we report here the development of a specific,
sensitive and fast multiplex PCR assay for the detection of all
blaCTX-M genes and discrimination between groups. We have
also demonstrated the feasibility of utilizing DHPLC WAVE
technology in screening a large number of clinical isolates at
low labour cost and in a time-saving procedure.
ACKNOWLEDGEMENTS
We thank Dr Guillaume Arlet (Hôpital Tenon, Paris, France),
Dr Michael Mulvey (National Microbiology Laboratory, Manitoba,
Canada) and Dr Jianhui Xiong (representing Guangzhou Antimicrobial
Resistance Surveillance Group, China) for supplying control strains.
REFERENCES
Alobwede, I., M’Zali, F. H., Livermore, D. M., Heritage, J., Todd, N. &
Hawkey, P. M. (2003). CTX-M extended-spectrum beta-lactamase
arrives in the UK. J Antimicrob Chemother 51, 470–471.
Arpin, C., Dubois, V., Coulange, L. & 10 other authors (2003).
Extended-spectrum beta-lactamase-producing Enterobacteriaceae
in community and private health care centers. Antimicrob Agents
Chemother 47, 3506–3514.
Baraniak, A., Fiett, J., Sulikowska, A., Hryniewicz, W. & Gniadkowski,
M. (2002). Countrywide spread of CTX-M-3 extended-spectrum beta-
lactamase-producing microorganisms of the family Enterobacteriaceae
in Poland. Antimicrob Agents Chemother 46, 151–159.
Bonnet, R. (2004). Growing group of extended-spectrum beta-
lactamases: the CTX-M enzymes. Antimicrob Agents Chemother 48,
1–14.
Bonnet, R., Sampaio, J. L., Labia, R., De Champs, C., Sirot, D., Chanal,
C. & Sirot, J. (2000). A novel CTX-M beta-lactamase (CTX-M-8) in
cefotaxime-resistant Enterobacteriaceae isolated in Brazil. Antimicrob
Agents Chemother 44, 1936–1942.
Boyd, D. A., Tyler, S., Christianson, S. & 7 other authors (2004).
Complete nucleotide sequence of a 92-kilobase plasmid harboring the
CTX-M-15 extended-spectrum beta-lactamase involved in an outbreak
in long-term-care facilities in Toronto, Canada. Antimicrob Agents
Chemother 48, 3758–3764.
Brenwald, N. P., Jevons, G., Andrews, J. M., Xiong, J. H., Hawkey, P. M. &
Wise, R. (2003). An outbreak of a CTX-M-type beta-lactamase-
producing Klebsiella pneumoniae: the importance of using cefpodoxime
to detect extended-spectrum beta-lactamases. J Antimicrob Chemother
51, 195–196.
Canton, R., Oliver, A., Coque, T. M., Varela, M. C., Perez-Diaz, J. C. &
Baquero, F. (2002). Epidemiology of extended-spectrum beta-
lactamase-producing Enterobacter isolates in a Spanish hospital during
a 12-year period. J Clin Microbiol 40, 1237–1243.
Cao, V., Lambert, T. & Courvalin, P. (2002). ColE1-like plasmid pIP843
of Klebsiella pneumoniae encoding extended-spectrum beta-lactamase
CTX-M-17. Antimicrob Agents Chemother 46, 1212–1217.
Chanawong, A., M’Zali, F. H., Heritage, J., Xiong, J. H. & Hawkey, P. M.
(2002). Three cefotaximases, CTX-M-9, CTX-M-13, and CTX-M-14,
among Enterobacteriaceae in the People’s Republic of China. Antimicrob
Agents Chemother 46, 630–637.
Colom, K., Perez, J., Alonso, R., Fernandez-Aranguiz, A., Larino, E. &
Cisterna, R. (2003). Simple and reliable multiplex PCR assay for
detection of blaTEM, bla(SHV) and blaOXA-1 genes in Enterobacter-
iaceae. FEMS Microbiol Lett 223, 147–151.
Cooksey, R. C., Morlock, G. P., Holloway, B. P., Limor, J. & Hepburn, M.
(2002). Temperature-mediated heteroduplex analysis performed by
Downloaded from www.microbiologyresearch.org by
http://jmm.sgmjournals.org IP: 60.246.68.76
On: Sun, 08 Apr 2018 11:57:41
Detection of blaCTX-M genes by multiplex PCR assay
using denaturing high-performance liquid chromatography to identify
sequence polymorphisms in Mycobacterium tuberculosis complex
organisms. J Clin Microbiol 40, 1610–1616.
Eaves, D. J., Liebana, E., Woodward, M. J. & Piddock, L. J. (2002).
Detection of gyrA mutations in quinolone-resistant Salmonella enterica
by denaturing high-performance liquid chromatography. J Clin Micro-
biol 40, 4121–4125.
Evans, J. T., Hawkey, P. M., Smith, E. G., Boese, K. A., Warren, R. E. &
Hong, G. (2004). Automated high-throughput mycobacterial inter-
spersed repetitive unit typing of Mycobacterium tuberculosis strains by a
combination of PCR and nondenaturing high-performance liquid
chromatography. J Clin Microbiol 42, 4175–4180.
Hurtle, W., Bode, E., Kaplan, R. S., Garrison, J., Kearney, B., Shoe-
maker, D., Henchal, E. & Norwood, D. (2003). Use of denaturing high-
performance liquid chromatography to identify Bacillus anthracis by
analysis of the 16S-23S rRNA interspacer region and gyrA gene. J Clin
Microbiol 41, 4758–4766.
Karim, A., Poirel, L., Nagarajan, S. & Nordmann, P. (2001). Plasmid-
mediated extended-spectrum beta-lactamase (CTX-M-3 like) from
India and gene association with insertion sequence ISEcp1. FEMS
Microbiol Lett 201, 237–241.
Moland, E. S., Black, J. A., Hossain, A., Hanson, N. D., Thomson, K. S. &
Pottumarthy, S. (2003). Discovery of CTX-M-like extended-spectrum
beta-lactamases in Escherichia coli isolates from five US states. Anti-
microb Agents Chemother 47, 2382–2383.
Munday, C. J., Whitehead, G. M., Todd, N. J., Campbell, M. & Hawkey,
P. M. (2004). Predominance and genetic diversity of community- and
hospital-acquired CTX-M extended-spectrum beta-lactamases in York,
UK. J Antimicrob Chemother 54, 628–633.
Pagani, L., Dell’Amico, E., Migliavacca, R., D’Andrea, M. M., Giacobone,
E., Amicosante, G., Romero, E. & Rossolini, G. M. (2003). Multiple
CTX-M-type extended-spectrum beta-lactamases in nosocomial iso-
lates of Enterobacteriaceae from a hospital in northern Italy. J Clin
Microbiol 41, 4264–4269.
Perez-Perez, F. J. & Hanson, N. D. (2002). Detection of plasmid-
mediated AmpC beta-lactamase genes in clinical isolates by using
multiplex PCR. J Clin Microbiol 40, 2153–2162.
Pitout, J. D., Hossain, A. & Hanson, N. D. (2004). Phenotypic and
molecular detection of CTX-M-beta-lactamases produced by Escher-
ichia coli and Klebsiella spp. J Clin Microbiol 42, 5715–5721.
Saladin, M., Cao, V. T., Lambert, T. & 7 other authors (2002). Diversity
of CTX-M beta-lactamases and their promoter regions from Enter-
obacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett
209, 161–168.
Tzouvelekis, L. S., Tzelepi, E., Tassios, P. T. & Legakis, N. J. (2000).
CTX-M-type beta-lactamases: an emerging group of extended-
spectrum enzymes. Int J Antimicrob Agents 14, 137–142.
Winstanley, T. G., Ridgway, E. J., Parys, B. T., Woodford, N., Ward, E. &
Livermore, D. M. (2004). First isolation of a CTX-M-3 beta-lactamase
producer in the United Kingdom. Int J Antimicrob Agents 24, 625–627.
Woodford, N., Ward, M. E., Kaufmann, M. E. & 14 other authors (2004).
Community and hospital spread of Escherichia coli producing CTX-M
extended-spectrum beta-lactamases in the UK. J Antimicrob Chemother
54, 735–743.
Woodford, N., Fagan, E. J. & Ellington, M. J. (2005). Development of
multiplex PCR assay for genes encoding CTX-M extended-spectrum
beta-lactamases. Clin Microbiol Infect 11 (Suppl. s2), 121.
Yan, J. J., Ko, W. C., Tsai, S. H., Wu, H. M., Jin, Y. T. & Wu, J. J. (2000).
Dissemination of CTX-M-3 and CMY-2 beta-lactamases among clinical
isolates of Escherichia coli in southern Taiwan. J Clin Microbiol 38,
4320–4325.
1187