Journal of Ethnopharmacology 324 (2024) 117763

Contents lists available at ScienceDirect

Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jethpharm

Aqueous distillate of mature leaves of Vernonia zeylanica (L.) Less. and

Mallotus repandus (Rottler) Müll. Arg. cued from traditional medicine
exhibits rapid wound healing properties
Praneeth Ratnayake a, Udaya Samaratunga b, 1, Inoka Perera a, Jayamini Seneviratne c,
Preethi Udagama a, *
a
Center for Immunology and Molecular Biology, Department of Zoology and Environment Sciences, Faculty of Science, University of Colombo, Colombo 08, Sri Lanka
b
Department of Ayurveda Basic Principles, Wickramarachchi Ayurveda Institute University of Kelaniya, Sri Lanka
c
Dermatology Unit, Lady Ridgeway Hospital for Children, Colombo 08, Sri Lanka

A R T I C L E I N F O A B S T R A C T

Handling Editor: V Kuete Ethnopharmacological relevance: Sri Lankan traditional medicine uses Vernonia zeylanica and Mallotus repandus
broadly for the treatment of a multitude of disease conditions, including wound healing.
Keywords: Aim of the study: We aimed to scientifically validate the safety and efficacy of wound healing of an aqueous
Wound healing distillate of Vernonia zeylanica and Mallotus repandus (ADVM) mature leaves, tested on primary human dermal
Aqueous herbal distillate
fibroblasts.
Vernonia zeylanica
Materials and methods: Human dermal fibroblasts isolated from clinical waste from circumcision surgery were
Mallotus repandus
Primary human dermal fibroblasts characterized by flowcytometry and trilineage differentiation. The MTT dye reduction assay, and the ex vivo
Skin regeneration wound healing scratch assay established wound healing properties of ADVM using the primary human dermal
fibroblast cell line. Upregulation of genes associated with wound healing (MMP3, COL3A1, TGFB1, FGF2) were
confirmed by RT qPCR. GC-MS chromatography evaluated the phytochemical composition of ADVM.
Results: Compared to the synthetic stimulant, β fibroblast growth factor, ADVM at 0.25% concentration on the
primary dermal fibroblast cell line exhibited significant ex vivo, (i) 1.7-fold % cell viability (178.7% vs 304.3 %,
p < 0.001), (ii) twofold greater % wound closure (%WC) potential (47.74% vs 80.11%, p < 0.001), and (iii)
higher rate of % WC (3.251 vs 3.456 % WC/h, p < 0.05), sans cyto-genotoxicity. Up regulated expression of
FGF2, TGFB1, COL3A1 and MMP3, genes associated with wound healing, confirmed effective stimulation of
pathways of the three overlapping phases of wound healing (P < 0.05). GC-MS profile of ADVM characterized
four methyl esters, which may be posited as wound healing phytochemicals.
Conclusions: Exceeding traditional medicine claims, the ex vivo demonstration of rapid skin regeneration, reit­
erated by upregulated expression of genes related to wound healing pathways, sans cytotoxicity, propounds
ADVM, cued from traditional medicine, as a potential safe and effective natural stimulant for rapid wound-
healing. Additionally, it may serve as an effective proliferative stimulant of dermal fibroblasts for cell ther­
apy, with potential in reparative and regenerative therapy of skin disorders.

1. Introduction
Wound management is an extremely important aspect of healthcare.
It plays a critical role in facilitating healing, preventing infection,
reducing scarring, minimizing pain and discomfort, and support quality
of life. The art of proper wound care encompasses a range of practices
that lead to transformative benefits. These practices encourage the
growth of new tissue, expedite the closure of wounds, and mitigate the
risk of further trauma (Dryden et al., 2013).
Wound healing, a cascade of interlinked and complex biological re­
sponses to re-establish tissue integrity by substituting damaged tissue
with new tissue, consists of three main sequential stages; i) inflamma­
tion, ii) proliferation, where wound closure takes place by extensive
proliferation and infiltration of cells from dermal stem cell niches
(DesJardins-Park et al., 2019; Ge et al., 2017), and iii) remodeling where

* Corresponding author.
E-mail address: preethi@zoology.cmb.ac.lk (P. Udagama).
1
Deceased March 26, 2022.

https://doi.org/10.1016/j.jep.2024.117763
Received 1 November 2023; Received in revised form 3 January 2024; Accepted 11 January 2024
Available online 20 January 2024
0378-8741/© 2024 Elsevier B.V. All rights reserved.
P. Ratnayake et al.
Abbreviations
ADVM Aqueous distillate of Vernonia zeylanica and Mallotus
repandus
RT qPCR real time quantitative PCR
GC-MS gas chromatography mass spectroscopy
hMSCs human Mesenchymal Stem Cells
MTT 3(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium
bromide
DMSO Dimethyl Sulfoxide
ALS alkali-labile sites
SSB single strand breaks
NIST National Institute Standard and Technology
%WC percentage Wound closure
%CP percentage cell proliferation
MMP3 Matrix metallopeptidase 3 gene
COL3A1 Collagen type III alpha 1 chain gene
GAPDH Glyceraldehyde -3-phosphate dehydrogenase gene
TGFB1 Transforming growth factor beta 1
FGF2 Fibroblast growth factor 2
βFGF beta Fibroblast growth factor
ECM Extra cellular matrix
the extracellular matrix is slowly modeled, and increases in strength
(Velnar et al., 2009). Each stage is accompanied by a substantial amount
of biomolecule signaling which is responsible for the communication
between cells and tissue. Wound closure is facilitated by the coordinated
movement of groups of cells intercellularly connected, and with a col­
lective polarity (Falanga, 2005).
Cell proliferation involves a major proportion of the wound healing
timeline. Therefore, most of the wound healing acceleration therapeutic
modalities are based on facilitating cell proliferation. Wound healing
treatment modalities are widely based on dermal fibroblasts (Kouhba­
naninejad et al., 2018; Zuliani et al., 2013), where viable fibroblasts are
delivered to the wound site or the behavior of fibroblast are manipulated
onsite (Desjardins-Park et al., 2018). Fibroblasts play a major role in the
proliferation stage by providing cells for both tissue regeneration, and
secretion of extracellular matrix and growth factors (Kouhbananinejad
et al., 2018).
As dermal fibroblast proliferation is imperative in wound healing
drug discovery studies, identifying fibroblast proliferation stimulants is
critical. A number of growth factors, cytokines and other biological
factors, identified as stimulants of dermal fibroblast proliferation in the
cellular environment, are isolated, purified and commercially made
available as products of recombinant DNA technology or as synthetic
products. Throughout usage, these proved to have a short half-life
rendering these less effective and costly (Teixeira et al., 2020). Also,
the potential risk of allergic reactions may occur depending on the hy­
persensitivity nature of the patient (Fitzpatrick, 2005; Ratnayake et al.,
2022; Udalamaththa et al., 2016).
Therefore, current investigations on stimulants attempt to minimize
the said issues by exploring plant derived natural products based on
ethnopharmacological cues (Ratnayake et al., 2022; Udalamaththa
et al., 2016). Mono or polyherbal formulations based on time tested
traditional medicine knowledge had demonstrated promising results in
fibroblast proliferation leading to potential drug candidates with pos­
sibility for commercializing; these are associated with low product costs
and shorter timelines in the modern drug discovery pipeline (Addis
et al., 2020; Kikowska et al., 2018; Rameshk et al., 2018). Abundant
availability and affordability have made natural bioactive compounds a
potential alternative for synthetic stimulants in stem cell therapy.
Sri Lankan Traditional Medicine (SLTM) dates back approximately to
2500 BC, believed to be pioneered by King Ravana, and offers treatment
2
Journal of Ethnopharmacology 324 (2024) 117763
methods for a range of diseases (Sharma, 2000). SLTM focuses on
wellness and health based on personalized treatment methods and is
principally known for its natural reagents and remedies, extracted from
the environment in an eco-friendly manner.
Species of Vernonia, a widespread genus of the family Asteraceae
(Keeley and Jones, 2016), are used extensively for wound healing in
many parts of the world (Adetutu et al., 2011; Leite et al., 2002; Man­
junatha et al., 2005; Ragunathan et al., 2009). V. zeylanica is a major
endemic weed found in both dry and wet areas of lower elevations below
900m in Sri Lanka (Jayaweera, 1982). Extracts of leaves and stem parts
of V. zeylanica are used to treat boils, eczema, asthma, and fractures in
SLTM. Aqueous stem extract of V. Zeylanica shows antinociceptive ac­
tivity (Ratnasooriya et al., 2007), while a hexane extract demonstrated
wound healing potential of the plant (Samarasinghe et al., 2022).
Mallotus is one of the richest genera in the Euphorbiaceae family with
approximately 150 species distributed in tropical and sub-tropical areas
in Asia and Australia (Hasan et al., 2014). Extracts of Mallotus plant
species are widely used in analgesic, anti-inflammatory, antioxidant,
antiviral and antimicrobial treatment (Hasan et al., 2014, 2018; Zhang
et al., 2021). Mallotus repandus is an extensively used plant in traditional
medicine in many Asian countries. M. repandus is used as an
anti-inflammatory drug and as a therapy for itching, arthritis, hepatitis
and liver cirrhosis with significant antinociceptive activity (Lin et al.,
1995; Saijo et al., 1989). More importantly, according to ola leaf scripts
of Sri Lankan traditional medicine (SLTM), M. repandus contains highly
potent wound healing properties.
In this study we investigated the wound healing potential (i.e.
fibroblast viability, % wound closure, rate of % wound closure, phyto­
chemical constituents, cyto-genotoxicity, and mechanistic basis) of the
aqueous distillate of Vernonia zeylanica and Mallotus repandus mature
leaves (ADVM), cued from Sri Lankan traditional medicine, tested ex
vivo on in-house developed and characterized primary human dermal
fibroblasts.
2. Material and methods
Ethical approval
Ethical Clearance for the study was obtained from the Ethics Review
Committee of the Lady Ridgeway Hospital for Children, Colombo 8, Sri
Lanka (ERC -LRH/DA/01/2016).
2.1. Cell culture
Human neonatal prepuce from routine circumcision surgery was
used to establish primary dermal fibroblast cells and keratinocytes.
dermal fibroblast cells were established by the explant method (Vangi­
puram et al., 2013), and were characterized by immunophenotyping and
trilineage differentiation. Primary dermal fibroblast cells were grown in
Dulbecco’s modified Eagle’s Medium (Sigma-Aldrich, Germany) sup­
plemented with 10 % fetal bovine serum (FBS) (Euroclone, Italy) and 1%
Antimicrobial/Antifungal solution (Sigma-Aldrich, Germany). Cell sur­
face markers were selected according to the ISCT guidelines (Dominici
et al., 2006); immunophenotyping was carried out according to the
manufacturer’s instructions (BD stemflow human Mesenchymal Stem
Cell [hMSC] analysis kit, BD Biosciences, USA). Functional character­
ization via trilineage differentiation was performed using in-house
prepared chemical cocktails as described previously (Venugopal et al.,
2011). Oil red O staining of pre-adipocytes and Alician Blue staining of
chondrocyte aggregates were performed 14 days post treatment, while
calcium deposits in the cells were stained with Alizarin Red S on day 21.
Human primary keratinocyte culture was established by the diges­
tion method on epidermal tissue obtained from human neonatal prepuce
samples. Cleaned skin samples were incubated with the enzyme, dis­
pase, at 4 ◦ C for 16 h. Dispase was discarded post-incubation, and the
epidermis peeled off. These epidermal pieces were digested using 0.25%
P. Ratnayake et al.
trypsin in 0.5 mM EDTA. These pieces were vigorously mixed, and the
resultant homogenous cell suspension was centrifuged and washed
twice with PBS. Keratinocytes were cultured in Keratinocytes-Serum
free medium (Gibco, Life technologies). Pure culture was obtained by
selective trypsinization using 0.05% trypsin with 0.05 mM EDTA. Ker­
atinocytes were maintained in serum free conditions. Cell cultures were
maintained at 37 ◦ C, in a 5% CO2 atmosphere in an incubator with 80%–
88% humidity (Memmert, Germany).
2.2. Plant material
Vernonia zeylanica (L.) Less (Synonym: Eupatorium zeylanicum Linn.)
(Family: Asteraceae; Sinhala – pupula, Tamil – kappilai, endemic to Sri
Lanka) and Mallotus repandus (Rottler) Müll. Arg. (Family: Euphorbia­
ceae; English - climbing mallotus, Sinhala – wel keppitiya, Tamil –
konalilai, native to Sri Lanka) were selected for the study, cued from Sri
Lankan traditional medicine. (plant names were checked with
http://www.theplantlist.org on October 18, 2023). Mature leaves of the
two plants were collected from a home garden in Gampaha (longitude-
80◦ 0′ 51.7176″ E, latitude- 7◦ 5′ 14.3160″ N), during February 2021 and
were authenticated by Prof. Siril Wijesundara, currently a Research
Professor at the National Institute of Fundamental Studies, Sri Lanka,
and former Director General of the Department of National Botanic
Gardens Sri Lanka. Voucher specimens (N0-150 and 151) were depos­
ited in the Department of Zoology and Environment Sciences, University
of Colombo (Plate 1).
2.3. Preparation of the aqueous herbal distillate
The aqueous distillate of Vernonia/Mallotus (ADVM) was prepared
using fresh mature leaves, as practiced in SLTM with the two individual
plants. Equal parts, i.e., 250 g each of fresh mature leaves of the two
plants were cleaned and homogenized in 1.5 L of distilled water for 10
min and filtered through eight layers of muslin cloth. Filtrate was sub­
jected to standard hydro distillation by boiling on a heat regulated LP
gas burner at a maximum temperature of 100 ◦ C for approximately 3 h.
The vapour phase was collected into a Liebig condenser at a rate of ~2.5
ml/min.
ADVM was filtered to maintain sterility using a polytetrafluoro­
ethylene (PTFE) 0.45 μm syringe filter (Hyundai, Korea) for use in pri­
mary cell cultures. The final concentrations for treatment were prepared
by diluting the stock distillate v/v with culture medium.
2.4. Cell viability
Cell viability was evaluated using the MTT [3(4,5-dimethylthiazolyl-
2)-2,5-diphenyltetrazolium bromide] dye reduction assay (Bellagamba
et al., 2016). Briefly, cells were plated in a 96 well plate (Corning, USA)
at a seeding density of 5 × 103 cells/well and incubated at 37 ◦ C in a CO2
incubator for 24 h. Thereafter, the remaining medium was aspirated,
and cells were treated for 24 h with a series of concentrations of the
herbal distillate (4%, 2%, 1.5%, 1%, 0.5%, 0.25% and 0.125%) in cul­
ture medium. The positive control (synthetic growth factor - β fibroblast
growth factor [bFGF at 4 ng/μl, Sigma-Aldrich, USA]), and normal
control (sans treatment) were maintained in culture medium. After 24
hours, 20 µl of MTT solution (5 mg/ml) was dispensed into each well and
incubated at 37 ◦ C for 4 hours in a CO2 incubator. Next, the culture
medium with MTT was partially aspirated in each well and replaced
with 100 µl of dimethyl sulfoxide (DMSO-Sigma-Aldrich). The plate was
manually shaken for 10 minutes to dissolve the MTT crystals. The re­
action was spectrophotometrically measured at 570 nm using a micro­
plate reader (BioRad, Model 680, USA). All experiments were conducted
in triplicate. % cell viability (%CV) was calculated using the following
equation:
%CV = (ODtest/ ODcontrol) X 100
3
Journal of Ethnopharmacology 324 (2024) 117763
2.5 Ex vivo scratch wound healing assay
The assay was conducted according to Grada et al. (2017). Briefly,
human dermal fibroblasts were cultured in 6 well plates (Corning, USA)
at a seeding density of 2 × 105 cells per well and incubated at 37 ◦ C in a
CO2 incubator until the culture reached 90% confluency to achieve a
uniform fibroblast monolayer. Next, a straight edged cell free zone was
created in each well using a sterile 200 μL micro pipette tip (scratch
width; 0.6 ± 0.06 mm, length; 2.5 ± 0.01 mm). Cells were treated in
triplicate with a series of ADVM concentrations of 5%, 1%, 0.5%, 0.25%,
0.125%, and 0.0625%, and 1% bFGF as the positive control. Cells were
incubated at 37 ◦ C in a CO2 incubator and observations were recorded
after 12 h. The temporal effect on wound closure was evaluated by
obtaining measurements 6 hourly for 48 h. ImageJ software package
(ImageJ 1.52a/Fiji®) was used to analyze the area between the edges of
the scratch. Data was analyzed by calculating % wound closure using the
following formula (Suarez-Arnedo et al., 2020):
% wound closure = ([At = 0h - At = Δh] /At = 0h) x 100 where, At=0 is the initial
wound area, At = Δt is the wound area after n hours of the initial scratch (in
μm2).
The rate of wound closure was calculated by fitting temporal data
into a linear regression model.
2.6 Assessment of cytogenotoxicity of ADVM
2.6.1 Comet assay
Comet assay was carried out using dermal fibroblast cells following a
modified protocol based on Tice et al. (2000). Basic steps of the comet
assay involved, preparation of microscope slides layered with cells in
agarose, lysis of cells to liberate DNA, DNA unwinding by exposure to
alkali (pH = 13) to obtain single-stranded DNA, and to express
alkali-labile sites (ALS) as single strand breaks (SSB), electrophoresis
under alkaline conditions (pH = 13), neutralization of alkali, DNA
staining, comet visualization, and scoring of the comets (head: tail
ratio).
Cells were plated at a seeding density of 104 cells/well in a 24 well
plate and were grown to 80% confluency. Cells were treated for 24 h
with appropriate percentage of ADVM in triplicate. Hydrogen peroxide
(H2O2) was used as the positive control while distilled water served as
the normal control.
2.6.2 Neutral red assay
Human keratinocyte cultures serve as a valuable model for investi­
gating toxicity and irritancy in skin. Cytotoxic effects of ADVM were
evaluated on dermal keratinocytes using the Neutral Red assay with
modifications (Repetto et al., 2008; Rezk et al., 2015). Briefly, human
dermal keratinocytes were plated in a 96 well plate (Corning, USA) at a
seeding density of 5 × 103 cells/well and incubated at 37 ◦ C in a CO2
incubator for 24 h in keratinocyte culture medium. Cells were treated
with a series of ADVM concentrations (8%, 4%, 2%, 1%, 0.5%, 0.25%,
0.125%, 0.0625%, 0.03125%) at 100 μL/well for 24 h in triplicate,
while untreated cells served as the control. Freshly prepared neutral red
solution (100 μL/well at 40 μg/ml) was dispensed into each well and
incubated for 4 h at 37 ◦ C in a CO2 incubator. Wells were washed with
100 μL PBS after aspirating the neutral red solution. De-stain solution
(EtOH: H2O: acetic acid at 50:49:1) at 100 μL/well was added and the
plate was left on a shaker for 10 min for rapid shaking until neutral red
was extracted from the cells and had formed a homogeneous solution.
Optical density (OD) values were determined spectrophotometrically at
540 nm using a microplate reader (BioRad, Model 680, USA).
% cell viability (% CV) was calculated using the following equation:
% CV = (ODtest/ ODcontrol) X 100
P. Ratnayake et al.
2.7. Gas chromatography-mass spectrometry (GC-MS) analysis
ADVM aqueous distillate was freeze dried and dissolved in the
appropriate volume of methanol to obtain a concentration of 0.001 g/
ml. The solution was filtered three times using an activated charcoal
filter for the removal of chlorophyll. Next the sample was treated with
anhydrous Na2SO4 powder for desiccation.
The phytochemical constituents were identified using gas chroma­
tography (GC) following Khan et al. (2021) with slight modification in
capillary column and the flow rate. GC-MS analysis was carried out on a
GC clarus 500 PerkinElmer system comprising a AOC-20i auto sampler
and gas chromatograph interfaced to a mass spectrometer (GC-MS) in­
strument using the following conditions: column Elite-1 fused silica
capillary column (30 × 0.25 mm ID × 1 EM df, composed of 100%
Dimethyl poly siloxane), operating in electron impact mode at 70 eV;
helium (99.999%) was used as carrier gas at a constant flow of 1 ml/min
and an injection volume of 0.5 EI was used (split ratio of 10:1), at an
injector temperature of 250 ◦ C and ion-source temperature at 280 ◦ C.
The oven temperature was programmed from 110 ◦ C (isothermal for 2
min), with an increase of 10–200 ◦ C/min, then 5–280 ◦ C/min, ending
with a 9 min isothermal at 280 ◦ C. Mass spectra were recorded at 70 eV,
at a scan interval of 0.5 s and fragments were recorded from 40 to 550
Da.
The database of the National Institute of Standards and Technology
(NIST) with more than 62,000 patterns were used to interpret the ob­
tained GC-MS mass spectrum.
2.8. Quantitative real time PCR (qRT PCR)
Real-time PCR gene expression analysis of four wound healing
associated genes (MMP3 [Matrix metallopeptidases 3 gene], COL3A1
[Collagen type III alpha 1 chain gene], TGFB1 [Transforming growth
factor beta 1 gene], and FGF2 [Fibroblast growth factor 2 gene]) was
designed and performed according to MIQE guidelines (Bustin et al.,
2009). Briefly, dermal fibroblasts were treated for 24 h in triplicate with
0.25% of ADVM. RNA was extracted from both test and control samples
using an RNA extraction kit (RNeasy mini kit, Qiagen, Germany). The
quality and concentration of the extracted RNA was determined
(NanoDrop OneC, Thermo Scientific). Total RNA was reverse tran­
scribed to first-strand cDNA using the SuperScript® IV Reverse Tran­
scriptase cDNA synthesis kit (Life technologies, USA) according to the
manufacturer’s instructions, using random oligodeoxynucleotide
primers (Table 1).
RT-PCR amplification was performed on BioRad CFX 96 Real-time
PCR system (BioRad, USA) using SYBR® Select Master Mix (Life tech­
nologies, USA). The relative differences in gene expression were calcu­
lated using threshold cycle (CT) values that were first normalized to the
GAPDH house-keeping gene (Tarzemany et al., 2015). Analysis was
performed using the CFX Maestro software package (V 2.3, BioRad
Table 1
Primers used for real-time PCR.
Gene Orientation Primer sequence
MMP3 Forward ATGATGAACAATGGACAAAGGA
Reverse GAGTGAAAGAGACCCAGGGA
COL3A1 Forward CTCCTGGGATTAATGGTAGT
Reverse CCAGGAGCTCCAGGAAT
TGFB1 Forward CAACGAAATCTATGACAAGTTCAA
GCAG
Reverse CTTCTCGGAGCTCTGATGTG
FGF2 Forward AGTTGGTATGTGGCACTGAA
Reverse GTATAGCTTTCTGCCCAGGTC
GAPDH Forward CTTTGTCAAGCTCATTTCCTGGTA
Reverse GGCCATGAGGTCCACCA
4
Journal of Ethnopharmacology 324 (2024) 117763
laboratories).
2.9. Statistical analyses
Statistical analyses were performed using SPSS 29.0 (IBM, USA). All
ex vivo experiments were performed in triplicate and presented as mean
± SD. Results were generated from three independent experiments.
Linear and nonlinear curve fitting was performed for calculating pro­
liferation rate and IC50 values, respectively. For comparisons of multiple
groups, one-way ANOVA was used. Independent sample T test was used
to compare % cell proliferation. The significance level was set at p ≤
0.05.
3. Results
3.1. Establishment and characterization of primary human dermal
fibroblasts
The presence of positive surface markers of human mesenchymal
stem cells (CD 90, CD 73) on dermal fibroblasts were established by
flowcytometry (Fig. 1A–C). Further, fibroblasts differentiated into pre-
adipocytes, osteocytes and chondrocytes confirming their trilineage
differentiation potential (Fig. 1D–F).
3.2. Effects of ADVM on cell viability
ADVM concentrations above 1.5% showed cytotoxicity to dermal
fibroblasts compared to lower concentrations, and to the positive con­
trol, human beta fibroblast growth factor (bFGF) (p < 0.05). ADVM
concentrations of 1% did not significantly differ from the positive con­
trol, with % cell viability (% CV) of 95.38% (p > 0.05). Conversely,
ADVM concentration of 0.5%, 0.25% and 0.125% with % CV of 242.1%,
304.3% and 273.23%, respectively, exhibited approximately 1.4, 1.7
and 1.5-folds higher % CV than the positive control (Fig. 2) (p < 0.01).
3.3. Effects of ADVM on skin fibroblast migration and wound healing
At 12 h post treatment, bFGF used as the positive control (at 1%)
manifested a significant increment of % wound closure (%WC)
compared to the control (47.74%: p < 0.05). Compared to the control,
ADVM concentrations of 1%, 0.5% and 0.0625% displayed significant
increment of %WC of 55.90%; 47.14%; 50.69%, respectively (p < 0.05).
Nevertheless, ADVM at concentrations of 0.25% and 0.125% displayed
highly significant %WC (80.11% and 69.13%, respectively) compared to
both the control, and the positive control (p < 0.001) (Fig. 3 A & B).
3.4. Temporal effect of ADVM on wound closure (WC)
Linear regression analysis demonstrated a significantly higher rate of
%WC of 0.25% ADVM treated sample (3.456 %WC/h; R2: 0.9707)
compared to the positive control (3.251%WC/h; R2: 0.9920) and the
Amplicon (bp) GeneBank
91 NM_001166308
70 NM_000090
76 NM_000660
75 NM_002006
70 NM_002046
P. Ratnayake et al. Journal of Ethnopharmacology 324 (2024) 117763

Fig. 1. Characterization of the primary human dermal fibroblast cell line by immunophenotyping, and trilineage differentiation. Flowcytometric analysis for the
presence of mesenchymal stem cell markers (A) CD90 and (B) CD73, and (C) absence of CD105. Fibroblasts differentiated into chondrocytes, pre-osteocytes and
preadipocytes; (D) Chondrogenic aggregates in chondrocytes stained with Alician blue (X100), (E) calcium deposits in osteocytes stained with Alizarin Red S staining
(X100), while (F) the oil droplets in pre adipocytes stained red with Oil-red-O (400X). (For interpretation of the references to colour in this figure legend, the reader is
referred to the Web version of this article.)

status in 42 h and 48 h, respectively.

3.5. Cytogenotoxicity of ADVM

3.5.1. Genotoxicity assay

The positive control, H2O2, exhibited a significant comet tail on the
comet assay, while none of the ADVM treated dermal fibroblasts showed
signs of comet tail formation (p < 0.001). Fig. 5 presents the fluores­
cence images obtained during visualization of the comet formation.
Mean comet scores calculated for control, positive control (H2O2), 1%
ADVM, 0.25% ADVM, and 0.0625% ADVM were 0.049, 1.506, 0.099,
0.03, 0.069, respectively.

3.5.2. Cytotoxicity assay

Fig. 2. Effect of aqueous distillate of Vernonia/Mallotus (ADVM) on the
viability of human fibroblasts. ADVM concentrations lower than 1% exhibited a
higher % cellular viability (% CV) while 0.25% showed a significant 1.7-fold
increment of % CV compared to the positive control (synthetic human β
fibroblast growth factor at 1%) (p < 0.05). Data shown as mean ± SD. (*p <
0.05, **p < 0.01, ***p < 0.001).
untreated control (2.525%WC/h; R2: 0.9645) (p < 0.05) (Fig. 4). ADVM
treated cells achieved 100% wound closure at 30 h post treatment while
the positive control and the untreated control samples achieved this
Lack of cytotoxicity was observed by the working range of ADVM
concentrations (1%–0.0125%) on keratinocytes on the neutral red assay
(Fig. 6). A decrease in cell viability was detected at higher concentra­
tions of ADVM which was not significant (p > 0.05). Highest cell
viability of 200% was observed in the 0.5% ADVM treated group indi­
cating a twofold multiplication of keratinocytes. The lowest viability of
48.3% was observed with 8% ADVM treatment. IC50 and IC90 values
calculated for ADVM were 7.8% and 12.98%, respectively, implying that
the working concentration of 0.25% ADVM will be nontoxic in topical
applications.
3.6. Gas chromatography-mass spectrometry (GC-MS) analysis
Four major peaks were identified in the GC-MS profile of ADVM. By
comparing the mass spectra of the constituents with the NIST library,
these 4 peaks were characterized and identified (Fig. 7 & Table 2).
Accordingly, the four peaks corresponded to Dodecanoic acid methyl
ester, Methyl tetra decanoate, Hexadecenoic acid methyl ester and 9

5
P. Ratnayake et al. Journal of Ethnopharmacology 324 (2024) 117763

Fig. 3. Ex vivo wound healing potential of aqueous distillate of Vernonia/Mallotus (ADVM) on human fibroblast stem cells. (A) The distillate at 0.25% demonstrated a
twofold higher wound healing potential than of the positive control (human β fibroblast growth factor at 1%) and B) Comparison of percentage wound closure (%WC)
of 0.25% aqueous distillate of Vernonia/Mallotus (ADVM) treated human fibroblast stem cells with the control, and the positive control (1% βFGF), at 0- and 12 hours
post treatment on the scratch would healing test. Data shown as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001.

Fig. 4. Temporal effect of aqueous distillate of Vernonia/Mallotus (ADVM) on

rate of % wound closure. 100% wound closure was achieved by ADVM, positive
control and untreated control post treatment at 30, 42 and 48 h, respectively.
(PC - Positive control [human β Fibroblast Growth Factor]; C - un­
treated control).
Octadecanoic acid (Z)- Methyl ester.
3.7. Gene expression profile of wound healing
Fig. 5. Effects of the aqueous distillate of Vernonia/Mallotus (ADVM) treated
dermal fibroblasts compared to the untreated control and the H2O2 treated
positive control on the comet assay. Fluorescence images of untreated control,
positive control (treated with H2O2) and ADVM treated fibroblasts are shown in
the inset. Comets were observed only in the positive control. (400× magnifi­
cation). ***p < 0.001.

Compared to the untreated control, ADVM treated dermal fibroblasts
recorded a significant increment in the expression of all four wound
healing associated genes tested (p < 0.001). In comparison to FGF2
expression that had increased 12.9-fold normalized to GAPDH house­
keeping gene, lower gene expression levels of 9.4-fold, 8.7-fold, 8.1-fold,
respectively were recorded for TGFB1, MMP3, and COL3A1. Relative
normalized expression of these four wound healing associated genes,
and the clustergram are presented in Fig. 8.
4. Discussion
Due to the complexity of diseases, individual variability among
humans, and side effects of western medicine, novel research avenues
continuously search for alternative treatment modalities. Research into
drug discovery and development based on natural products is a boon to
the pharmaceutical industry. In this regard, traditional medicine, which
focuses on prevention and wellness with a personalized medicine
approach, provides invaluable time-tested cues for novel drug leads.
These phyto-preparations are currently identified as botanical drugs by
the US-FDA. In this study, we scientifically validated the safety and ef­
ficacy of an aqueous distillate of Vernonia zeylanica/Mallotus repandus
mature leaves (ADVM) as a rapid wound healing stimulant, targeting
dermal fibroblast proliferation and migration.
Fibroblasts play a major role in restoring the epidermal barrier
structure and function, producing the wound matrix with fibronectin
and hyaluronan at initial wound closure, and subsequently fill the
wound by producing the collagen matrix and scar tissue at the re-
modelling phase (Bainbridge, 2013). Hence, fibroblast migration effi­
ciency is as important as the fibroblast proliferation rate in skin regen­
eration. The scratch wound healing assay is an excellent model that

6
P. Ratnayake et al.
Fig. 6. Cell viability of keratinocytes treated with the aqueous distillate of
Vernonia/Mallotus (ADVM) on the neutral red test. A doubling dilution series of
ADVM (8%, 4%, 2%, 1%, 0.5%, 0.25%, 0.125%, 0.0625% and 0.03125%) was
used, and cellular viability was calculated at 24 h post treatment. Calculated
IC50 and IC90 values were 7.8% and 12.98%, respectively. Effective ADVM
concentration range (1%–0.125%) exhibited significantly higher cell viability
compared to high concentrations tested. *p < 0.05, **p < 0.01,***p < 0.001).
Fig. 7. GC-MS profile of the aqueous distillate of Vernonia/Mallotus (ADVM).
The four peaks with retention times of 8.571, 10.885, 13.204 and 15.499 min,
corresponded to Dodecanoic acid methyl ester (35.97%), Methyl tetradecanoate
(33.92%), Hexadecenoic acid methyl ester (0.74%) and 9 Octadecanoic acid
(Z)- Methyl ester (0.39%), respectively.
simulates and examines the critical mechanisms involved in migration of
cells under controlled in vitro conditions (Grada et al., 2017). This in vitro
test is specifically inexpensive and easy to perform while test conditions
can be altered according to the purpose. More importantly, observations
and analysis can be performed manually as well as using high
throughput screening platforms. Treatment of in-house established
7
Journal of Ethnopharmacology 324 (2024) 117763
primary human dermal fibroblasts with 0.25% ADVM on the scratch
wound healing assay demonstrated significant proliferative and wound
closure capacities ex vivo compared to bFGF, the synthetic stimulant.
Cell migration capacity of ADVM renders it an ideal candidate for skin
regeneration therapy. Conversely, mechanism(s) of cytotoxicity of
higher concentrations of ADVM (2% and 4%) observed on human
dermal fibroblasts is speculative and may be due to common cytotoxic
mechanism(s) such as mitochondrial dysfunction, oxidative stress
and/or DNA damage (Zhang, 2018).
In vitro and in vivo evaluation of cytogenotoxicity is mandatory when
screening a potential drug lead. With topical treatment, evaluation of
cytotoxic and genotoxic effects on the cells of the intended treatment
area is crucial. Methanol extract of M. repandus did not manifest any
signs of toxicity on oral gavage of mice at a high concentration of 4g per
kg confirming the absence of any systemic toxicity (Hasan et al., 2018).
Yet, significant cytotoxicity was observed of chemicals isolated from
leaves and bark of this plant on tumor cells (Kawashima et al., 1975). A
sesquiterpene lactone isolated from V. zeylanica exhibited significant
cytotoxicity on breast cancer cell lines MCF-7, MDA-MB-231 and
SKBR-3 (Mendis et al., 2018). Acute toxicity was absent in V. zeylanica
aqueous stem extract fed rats, while demonstrating antinociceptive
properties of the plant (Ratnasooriya et al., 2007). Neither of the two
plant species had records of possible cytotoxicity nor genotoxicity
observed in the literature.
The absence of cytotoxic effects of the ADVM at the effective con­
centration (0.25%) was established. However, the suitability of ADVM
as a dermal stem cell stimulant with potential as a skin regenerative
botanical drug candidate for topical application for wound healing re­
quires mandatory testing for acute dermal irritation (OECD guidelines
for the testing of chemicals, test no. 404). Genotoxicity testing may be
affirmed by the standard in vitro mammalian cell micronucleus test
(OECD guideline TG487). As the testing platform for effects of ADVM in
our study was primary human dermal fibroblasts, the ex vivo comet assay
on fibroblasts was carried out, as an alternative to the in vivo comet assay
(Toyoizumi et al., 2011). A clinical trial is anticipated to investigate the
safety and efficacy of ADVM with the clinical trials registry under the
Unit of Research and Development of Natural Products, Faculty of
Indigenous Medicine, University of Colombo, Sri Lanka.2
Freeze dried water extract of V. zeylanica stem bark indicated the
presence of alkaloids, flavonoids, steroids, triterpenoids, polyphenols,
and saponins (Ratnasooriya et al., 2007). The methanol extract of
V. zeylanica leaves indicated the presence of starch, sugar, phe­
nol/tannins, saponins, glycosides, steroids, terpenoids and alkaloids
(Wickramasinghe et al., 2018). Similarly the methanol extract of M.
repandus reported the presence of alkaloids, glycosides, steroids flavo­
noids, tannins, terpenoids and saponins (Hasan et al., 2014). Sesqui­
terpene lactone (vernolactone) was extracted by chromatographic
isolation of the mixture of ethyl acetate and chloroform extract of
V. zeylanica (Mendis et al., 2018). The endemic variety of V. zeylanica
has not been comprehensively analyzed yet for its phytochemical pro­
file. Also, none of the reported phytochemicals of the GC-MS profile of
ADVM matched existing phytochemical databases of the genus Vernonia
(Toyang and Verpoorte, 2013).
Fatty acids are an important factor that regulate a number of
biochemical reactions essential for wound healing. Omega-6- fatty acids
are reported to modulate cell migration and proliferation formation of
extracellular matrix, angiogenesis, and inflammation related to wound
healing (Silva et al., 2018). Fatty acids are immunologically important
to maintain the barrier function as well as for structural integrity of skin
(Silva et al., 2018). Besides, plant extracts contain fatty acid derivatives,
and methyl esterified fatty acids exhibit potential of augmenting pro­
liferation of epithelial cells (Yonezawa et al., 2008). The phytochemical
profile of Neolamarckia cadamba, traditionally used for wound healing
2
https://fim.cmb.ac.lk/urdnp/.
P. Ratnayake et al. Journal of Ethnopharmacology 324 (2024) 117763

Table 2
Phytochemical composition of the aqueous distillate of mature leaves of Vernonia zeylanica and Mallotus repandus derived from GC-MS chromatography.
Retention Time Phyto compounds Peak Molecular structure Molecular Previously reported biological properties References
(minutes) area % weight

8.571 Dodecanoic acid, 35.97% 214.3443 Dodecanoic acid differentially induces microsomal Fournel et al. (1987)
methyl ester drug metabolizing enzyme as other hypolipidemic Liu et al. (2021)
agents.
Dodecanoic acid derivatives enhance epithelial
integrity and essential for the dietary regulation of
intestinal homeostasis.
10.885 Methyl tetra- 33.92% 242.3975 Natural anti-cancer agent Ukwubile et al. (2019)
decanoate Contraceptive properties Simbala et al. (2017)
13.204 Hexadecenoic acid 0.74% 270.4507 Anti-fungal and anti-malarial activity Abubacker and
methyl ester Anti-inflammatory properties Deepalakshmi (2013);
Bone marrow stem cell proliferation Ojinnaka et al. (2015);
Potential to inhibit anti-inflammatory and Othman et al. (2015)
antifibrotic outcomes Zhang et al. (2008)
In vitro wound healing potential El-Demerdash (2011)
Wound healing potential in experimentally scaled Muniandy et al. (2018)
rat model Li et al. (2017)
15.499 9 Octadecenoic acid 0.39% 296.4879 in-vitro antioxidant properties Adaeze et al. (2019)
(Z)- Methyl ester Anti-inflammatory properties Othman et al. (2015)

Fig. 8. (A) Expression profile of wound healing associated genes, MMP3, COL3A1, TGFB1 and FGF2 normalized to GAPDH housekeeping gene, after 24h in vitro
treatment with the aqueous distillate of Vernonia/Mallotus (ADVM), and (B) Clustergram of gene expression. ***p < 0.001.

Plate 1. Mature leaves of A) Mallotus repandus and B) Vernonia zeylanica.

8
P. Ratnayake et al.
applications comprise mainly fatty acids (Zayed et al., 2014).
Methyl esterified motifs may promote stem cell proliferation (Zhang
et al., 2008). Of the four methyl esters contained in ADVM, 9 Octade­
cenoic acid (Z)- methyl ester has previously reported antioxidant
(Adaeze et al., 2019) and anti-inflammatory (Othman et al., 2015) ac­
tivities insinuating indirect wound healing potential; conversely, hex­
adecenoic acid methyl ester singularly was previously reported with
wound healing properties, in vitro (Muniandy et al., 2018) and in
experimentally scaled rats (Li et al., 2017). It is of interest to note that
these two compounds comprised 0.39% and 0.74%,respectively, of the
phytochemical constituents of ADVM. Hence, to investigate which of
these four methyl esters, individually or in combination, is/are
responsible for wound healing properties of this aqueous plant distillate,
is strongly warranted in future studies.
By combining Vernonia zeylanica and Mallotus repandus, It may be
presumed that the ADVM formulation may have enhanced wound
healing properties compared to those of either of the plants used singly
in Sri Lankan traditional medicine. However, this presumption cannot
be considered as the current study did not test the effects of the two
individual plant distillates to be compared with the effects of the com­
bined formulation of ADVM.
Wound healing and skin regeneration is a complex process of various
interconnected mechanisms. Tissue injury triggers a complex blend of
inflammatory, fibrogenic, and antifibrogenic mediators. Fibroblasts
recognize these signals through a number of pre-defined signal trans­
duction pathways (Darby et al., 2014). Wound healing and skin regen­
eration related gene expression of FGF2, TGFB1, COL3A1 and MMP3 of
ADVM treated fibroblasts were upregulated at different expression
levels normalized to a house keeping gene. In comparison to the other
three genes tested, markedly enhanced expression of FGF2 in the ADVM
treated test group was evident. FGF2 is a mitogenic factor expressed at
the early stage of wound repair (Hashimoto et al., 2020). FGF2 plays a
major role in accelerating acute wound healing by stimulating prolif­
eration and migration of keratinocytes, fibroblasts and endothelial cells
and thereby facilitate angiogenesis and tissue regeneration in the wound
healing process (Kasuya and Tokura, 2014). In addition, FGF2 improves
connective tissue formation by elevating expression of α-smooth muscle
actin (α-SMA) through its ability to cross talk with other growth factors
and neurotrophins (Bizenjima et al., 2015). More importantly, FGF2
assists early stage re-epithelialization by regulating transforming growth
factor β1 (TGF-β1) release (Penn et al., 2012).
TB1 coding for the transforming growth factor beta 1 is the key
regulator of the expression of extracellular matrix (ECM) proteins,
collagen, fibronectin and integrins in damaged tissue (Frank et al.,
1996). TGFB1 drastically increases wound healing potential by
increasing wound breaking strength and increasing angiogenesis (Nall
et al., 1996). COL3A1 contributes to the regulation of initiation and
synthesize ECM protein, a key stimulant of fibroblasts in the course of
wound healing (Hashimoto et al., 2020). COL3A1 is a major component
of the ECM of regenerating skin tissues by providing tensile strength and
integrity. Interestingly, COL3A1 regulates the basic requirement of
wound contraction. Matrix metalloproteinases 3 (MMP3) possess the
potential of scarless wound healing by remodeling ECM (Kandhwal
et al., 2022). Therefore, notably ADVM has strongly stimulated path­
ways leading to all three of the overlapping phases of the sequential
process of wound healing, establishing its general mechanistic potential
as a rapid wound healing stimulant.
Skin regeneration through cell therapy is a rapidly advancing field
that uses the targeted use of growth factors and small molecules to
harness the regenerative potential of stem cells. This innovative
approach holds immense promise for treating various skin disorders,
wounds, and injuries by guiding stem cells towards specific lineages,
enhancing their survival, and promoting tissue healing. The use of
growth factors and small molecules for skin cell therapy holds immense
potential across various applications (Zou et al., 2021). In chronic
wounds, growth factors and small molecules can expedite wound
9
Journal of Ethnopharmacology 324 (2024) 117763
healing in chronic ulcers by stimulating tissue regeneration,
re-epithelialization, and angiogenesis. These stimulants can enhance the
survival and proliferation of skin grafts, improving engraftment success
and tissue repair outcomes, especially in burn injuries. Scarless wound
healing has improved over time with external stimulants as these are
able to manipulate the behavior of fibroblasts and collagen synthesis
(North et al., 2007). Use of growth factors and small molecules can
potentially restore skin function and appearance in conditions such as
epidermolysis bullosa, where skin integrity is weak. Nevertheless,
challenges remain in optimizing the use of growth factors and small
molecules for skin cell therapy. Achieving controlled differentiation,
ensuring long-term stability of regenerated tissue, and addressing po­
tential side effects are ongoing research areas (Lu and Atala, 2014).
Future directions involve the development of advanced delivery sys­
tems, such as biomaterials and scaffolds, that provide sustained release
of growth factors and small molecules for prolonged therapeutic effects.
In the field of regenerative medicine, the effort to harness the
amazing potential of stem cells for tissue repair and regeneration has led
to the investigation of natural phytochemicals as an alternative to
standard growth factors and small molecules. These plant-derived
bioactive chemicals provide a novel approach to directing stem cell
behavior, increasing tissue healing, and advancing therapeutic out­
comes (Ratnayake et al., 2022; Udalamaththa et al., 2021).
Bioprospecting, based on a sustainable approach with economic and
social benefits, to improve human health will immensely benefit from
the rich knowledge of traditional medicine based on time tested phyto-
extracts. Combining this traditional knowledge in concert with stem cell
platforms to screen for novel drug leads may offer rapid advancement in
the modern drug discovery pipeline.
5. Conclusions
The aqueous distillate of mature leaves of Vernonia zeylanica and
Mallotus repandus (ADVM) demonstrated great potential as a natural
stimulant of primary human dermal fibroblast cell proliferation and
migration, and tissue remodeling (by ex vivo tests and gene expression
studies), that encompass two of the three sequential overlapping phases
of the wound healing process. Effective wound closure under ex vivo
conditions was also demonstrated. In toto, the claims of effective wound
healing properties of these two plants in Sri Lankan traditional medicine
were reaffirmed by the combined formulation of ADVM. Thus, ADVM
has the potential to be used as an effective natural wound healing
stimulant sans cytotoxicity. The outcome of the study propounds the
establishment of a natural stimulant to facilitate both rapid wound
healing in the form of a cream/a gel/a spray following a clinical trial,
and for ex vivo fibroblast cell expansion to be used in cell therapy.
Funding
This work was supported by the Ministry of Health, Sri Lanka under
the NHRC research grant ETR/E/NHRC-Mts./2017.
CRediT authorship contribution statement
Praneeth Ratnayake: Writing – original draft, Visualization, Vali­
dation, Methodology, Investigation, Formal analysis, Data curation.
Udaya Samaratunga: Supervision, Resources, Methodology. Inoka
Perera: Writing – review & editing, Supervision, Methodology, Inves­
tigation. Jayamini Seneviratne: Writing – review & editing, Supervi­
sion, Resources, Methodology, Funding acquisition. Preethi Udagama:
Writing – review & editing, Supervision, Resources, Project adminis­
tration, Methodology, Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing financial
P. Ratnayake et al.
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Data availability
Data will be made available on request.
Acknowledgements
This work was supported by a grant from the Ministry of Health, Sri
Lanka (ETR/E/NHRC-Mts./2017). The authors declare no competing
financial interests. All authors have read the journal’s authorship
agreement and policy on disclosure of potential conflicts of interest.
References
Abubacker, M.N., Deepalakshmi, T., 2013. In vitro antifungal potentials of bioactive
compound methyl ester of hexadecanoic acid isolated from Annona muricata Linn.
(Annonaceae) leaves. Biosci. Biotechnol. Res. Asia 10, 879–884. https://doi.org/
10.13005/bbra/1211.
Adaeze, B.C.-A., Uchenna, A.P., Kelechi, L., 2019. Bioactive components, protein quality
and in vitro antioxidant properties of leaves of two medicinal Ornamental plants.
Asian J. Pharmaceut. Health Sci. 9, 2035–2045.
Addis, R., Cruciani, S., Santaniello, S., Bellu, E., Sarais, G., Ventura, C., Maioli, M.,
Pintore, G., 2020. Fibroblast proliferation and migration in wound healing by
phytochemicals: evidence for a novel synergic outcome. Int. J. Med. Sci. 17,
1030–1042. https://doi.org/10.7150/ijms.43986.
Adetutu, A., Morgan, W.A., Corcoran, O., 2011. Ethnopharmacological survey and in
vitro evaluation of wound-healing plants used in South-western Nigeria.
J. Ethnopharmacol. 137, 50–56.
Bainbridge, P., 2013. Wound healing and the role of fibroblasts. J. Wound Care 22,
407–412. https://doi.org/10.12968/jowc.2013.22.8.407.
Bellagamba, B.C., Abreu, B.R.R. De, Grivicich, I., Markarian, C.F., Chem, E.,
Camassola, M., Nardil, N.B., Dihl, R.R., 2016. Human mesenchymal stem cells are
resistant to cytotoxic and genotoxic effects of cisplatin in vitro. Genet. Mol. Biol. 39,
129–134. https://doi.org/10.1590/1678-4685-GMB-2015-0057.
Bizenjima, T., Seshima, F., Ishizuka, Y., Takeuchi, T., Kinumatsu, T., Saito, A., 2015.
Fibroblast growth factor-2 promotes healing of surgically created periodontal defects
in rats with early, streptozotocin-induced diabetes via increasing cell proliferation
and regulating angiogenesis. J. Clin. Periodontol. 42, 62–71. https://doi.org/
10.1111/JCPE.12324.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R.,
Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The
MIQE guidelines: minimum information for publication of quantitative real-time
PCR experiments. Clin. Chem. 55, 611–622. https://doi.org/10.1373/
clinchem.2008.112797.
Darby, I.A., Laverdet, B., Bonté, F., Desmoulière, A., 2014. Fibroblasts and
myofibroblasts in wound healing. Clin. Cosmet. Invest. Dermatol. 7, 301–311.
https://doi.org/10.2147/CCID.S50046.
Desjardins-Park, Heather, E., Foster, D.S., Longaker, M.T., 2018. Fibroblasts and wound
healing: an update. Regen. Med. 13, 491–495. https://doi.org/10.2217/rme-2018-
0073.
DesJardins-Park, H.E., Mascharak, S., Chinta, M.S., Wan, D.C., Longaker, M.T., 2019. The
spectrum of scarring in craniofacial wound repair. Front. Physiol. 10, 1–14. https://
doi.org/10.3389/fphys.2019.00322.
Dominici, M., Le Blanc, K., Mueller, I., Slaper-Cortenbach, I., Marini, F.C., Krause, D.S.,
Deans, R.J., Keating, A., Prockop, D.J., Horwitz, E.M., 2006. Minimal criteria for
defining multipotent mesenchymal stromal cells. The International Society for
Cellular Therapy position statement. Cytotherapy 8, 315–317. https://doi.org/
10.1080/14653240600855905.
Dryden, S.V., Shoemaker, W.G., Kim, J.H., 2013. Wound management and nutrition for
optimal wound healing. Atlas Oral Maxillofac. Surg. Clin. North Am. 21, 37–47.
https://doi.org/10.1016/j.cxom.2012.12.008.
El-Demerdash, E., 2011. Anti-inflammatory and antifibrotic effects of methyl palmitate.
Toxicol. Appl. Pharmacol. 254, 238–244. https://doi.org/10.1016/j.
taap.2011.04.016.
Falanga, V., 2005. Wound healing and its impairment in the diabetic foot. Lancet 366,
1736–1743. https://doi.org/10.1016/S0140-6736(05)67700-8.
Fitzpatrick, R.E., 2005. Endogenous growth factors as cosmeceuticals. Dermatol. Surg.
31, 827–831.
Fournel, S., Magdalou, J., Pinon, P., Siest, G., 1987. Differential induction profile of drug-
metabolizing enzymes after treatment with hypolipidaemic agents. Xenobiotica 17,
445–457. https://doi.org/10.3109/00498258709043951.
Frank, S., Madlener, M., Werner, S., 1996. Transforming growth factors β1, β2, and β3
and their receptors are differentially regulated during normal and impaired wound
healing. J. Biol. Chem. 271, 10188–10193. https://doi.org/10.1074/
jbc.271.17.10188.
Ge, Y., Gomez, N.C., Adam, R.C., Nikolova, M., Yang, H., Verma, A., Lu, C.P.J., Polak, L.,
Yuan, S., Elemento, O., Fuchs, E., 2017. Stem cell lineage infidelity drives wound
repair and cancer. Cell 169, 636–650.e14. https://doi.org/10.1016/J.
CELL.2017.03.042.
10
Journal of Ethnopharmacology 324 (2024) 117763
Grada, A., Otero-Vinas, M., Prieto-Castrillo, F., Obagi, Z., Falanga, V., 2017. Research
techniques made simple: analysis of collective cell migration using the wound
healing assay. J. Invest. Dermatol. 137, e11–e16. https://doi.org/10.1016/j.
jid.2016.11.020.
Hasan, M.M., Uddin, N., Hasan, M.R., Islam, A.F.M.M., Hossain, M.M., Rahman, A. Bin,
Hossain, M.S., Chowdhury, I.A., Rana, M.S., 2014. Analgesic and anti-inflammatory
activities of leaf extract of mallotus repandus (Willd. Muell. Arg. Biomed Res. Int.
1–7. https://doi.org/10.1155/2014/539807, 2014.
Hasan, M.R., Uddin, N., Sana, T., Hossain, M.M., Mondal, M., Kanta, I.J., Choudhuri, M.
S.K., 2018. Analgesic and anti-inflammatory activities of methanolic extract of
Mallotus repandus stem in animal models. Orient. Pharm. Exp. Med. 18, 139–147.
https://doi.org/10.1007/s13596-018-0312-3.
Hashimoto, T., Kojima, K., Tamada, Y., 2020. Higher gene expression related to wound
healing by fibroblasts on silk fibroin biomaterial than on collagen. Molecules 25.
https://doi.org/10.3390/molecules25081939.
Jayaweera, D.M., 1982. Medicinal Plants (Indigenous and Exotic) Used in Ceylon.
Metland Place, Colombo 07. The National Science Council of Sri Lanka, Sri Lanka.
Kandhwal, M., Behl, T., Singh, S., Sharma, N., Arora, S., Bhatia, S., Al-Harrasi, A.,
Sachdeva, M., Bungau, S., 2022. Role of matrix metalloproteinase in wound healing.
Am. J. Transl. Res. 14, 4391.
Kasuya, A., Tokura, Y., 2014. Attempts to accelerate wound healing. J. Dermatol. Sci. 76,
169–172. https://doi.org/10.1016/J.JDERMSCI.2014.11.001.
Kawashima, T., Ohtama, H., Hirayama, H., 1975. Antitumor AK-3A and AK-3B from
Mallotus Repandus, 74310.
Keeley, S.C., Jones, S.B.J., 2016. Distribution of pollen types in Vernonia (Vernonieae :
Compositae). Am. Soc. Plant Taxon. 4, 195–202.
Khan, F., Magaji, M., Aguye, I., Hussaini, I., Hamza, A., Olorukooba, A., Sani, M.,
Maje, I., 2021. Phytochemical profiling of the bioactive principles of Alysicarpus
glumaceus (Vahl) DC. aerial parts. İstanbul J. Pharm. 51, 228–238. https://doi.org/
10.26650/istanbuljpharm.2020.0071.
Kikowska, M.A., Chmielewska, M., Włodarczyk, A., Studzińska-Sroka, E., Żuchowski, J.,
Stochmal, A., Kotwicka, M., Thiem, B., 2018. Effect of pentacyclic triterpenoids-rich
callus extract of Chaenomeles japonica (Thunb.) Lindl. ex Spach on viability,
morphology, and proliferation of normal human skin fibroblasts. Molecules 23,
3009.
Kouhbananinejad, S.M., Armin, F., Dabiri, S., Derakhshani, A., Iranpour, M.,
Farsinejad, A., 2018. Application and assessment of allogeneic fibroblasts for cell
therapy. Iran. J. Pathol. 13, 454–460.
Leite, S.N., Palhano, G., Almeida, S., Biavatti, M.W., 2002. Wound healing activity and
systemic effects of Vernonia scorpioides extract in Guinea pig. Fitoterapia 73,
496–500.
Li, X.-Q., Kang, R., Huo, J.-C., Xie, Y.-H., Wang, S.-W., Cao, W., 2017. Wound-healing
activity of zanthoxylum bungeanum maxim seed oil on experimentally burned rats.
Phcog. Mag. 13, 71. https://doi.org/10.1093/oxfordjournals.bmb.a071877.
Lin, J.M., Lin, C.C., Chen, M.F., Ujiie, T., Takada, A., 1995. Scavenging effects of Mallotus
repandus on active oxygen species. J. Ethnopharmacol. 46, 175–181. https://doi.
org/10.1016/0378-8741(95)01246-A.
Liu, Z. hua, Xie, W. wen, Zan, G. xiu, Gao, C. qi, Yan, H. chao, Zhou, J. yi, Wang, X. qi,
2021. Lauric acid alleviates deoxynivalenol-induced intestinal stem cell damage by
potentiating the Akt/mTORC1/S6K1 signaling axis. Chem. Biol. Interact. 348
https://doi.org/10.1016/j.cbi.2021.109640.
Lu, B., Atala, A., 2014. Small molecules and small molecule drugs in regenerative
medicine. Drug Discov. Today 19, 801–808. https://doi.org/10.1016/j.
drudis.2013.11.011.
Manjunatha, B.K., Vidya, S.M., Rashmi, K.V., Mankani, K.L., Shilpa, H.J., Singh, S.D.J.,
others, 2005. Evaluation of wound-healing potency of Vernonia arborea Hk. Indian J.
Pharmacol. 37, 223.
Mendis, A.S., Thabrew, I., Ediriweera, M.K., Samarakoon, S.R., Tennekoon, K.H.,
Adhikari, A., de Silva, E.D., 2018. Isolation of a new sesquiterpene lactone from
Vernonia zeylanica (L) less and its anti-proliferative effects in breast cancer cell
lines. Anti Cancer Agents Med. Chem. 19, 410–424. https://doi.org/10.2174/
1871520619666181128163359.
Muniandy, K., Gothai, S., Tan, W.S., Kumar, S.S., Mohd Esa, N., Chandramohan, G.,
Arulselvan, P., 2018. In Vitro Wound Healing Potential of Stem Extract of
Alternanthera Sessilis, 2018. eCAM. https://doi.org/10.1155/2018/3142073. Article
ID 3142073, 13 pages.
Nall, A.V., Brownlee, R.E., Colvin, C.P., Schultz, G., Fein, D., Cassisi, N.J., Nguyen, T.,
Kalra, A., 1996. Transforming growth factor β1 improves wound healing and random
flap survival in normal and irradiated rats. Arch. Otolaryngol. Head Neck Surg. 122,
171–177. https://doi.org/10.1001/ARCHOTOL.1996.01890140057011.
North, T.E., Goessling, W., Walkley, C.R., Lengerke, C., Kopani, K.R., Lord, A.M.,
Weber, G.J., Bowman, T.V., Jang, I.-H., Grosser, T., FitzGerald, G.A., Daley, G.Q.,
Orkin, S.H., Zon, L.I., 2007. Prostaglandin E2 regulates vertebrate haematopoietic
stem cell homeostasis. Nature 447, 1007–1011. https://doi.org/10.1038/
nature05883.
Ojinnaka, C.M., Nwachukwu, K.I., Ezediokpu, M.N., 2015. The chemical constituents and
bioactivity of the seed (fruit) extracts of buchholzia. J. Appl. Sci. Environ. Manag.
19, 795–801.
Othman, A.R., Abdullah, N., Ahmad, S., Ismail, I.S., Zakaria, M.P., 2015. Elucidation of
in-vitro anti-inflammatory bioactive compounds isolated from Jatropha curcas L.
plant root. BMC Compl. Alternative Med. 15, 1–10. https://doi.org/10.1186/
s12906-015-0528-4.
Penn, J.W., Grobbelaar, A.O., Rolfe, K.J., 2012. The role of the TGF-β family in wound
healing, burns and scarring: a review. Int. J. Burns Trauma 2, 18.
P. Ratnayake et al.
Ragunathan, M., Solomon, M., others, 2009. The study of spiritual remedies in orthodox
rural churches and traditional medicinal practice in Gondar Zuria district,
Northwestern Ethiopia. Pharmacogn. J. 1, 178–183.
Rameshk, M., Sharififar, F., Mehrabani, M., Pardakhty, A., Farsinejad, A., 2018. In vitro
proliferation and wound healing effects of Narcissus tazetta L. bulb on primary
human dermal fibroblasts. J Pharm Res Int 20, 1–11.
Ratnasooriya, W.D., Deraniyagala, S.A., Peiris, S.K.J.S., 2007. Antinociceptive potential
of the Sri Lankan endemic plant Vernonia zeylanica. Pharm. Biol. 45, 525–532.
https://doi.org/10.1080/13880200701215042.
Ratnayake, P., Udalamaththa, V., Samaratunga, U., Seneviratne, J., Udagama, P., 2022.
Therapeutic potential of skin stem cells and cells of skin origin: effects of botanical
drugs derived from traditional medicine. Stem Cell Rev. Reports 18, 1986–2001.
https://doi.org/10.1007/s12015-022-10388-y.
Repetto, G., del Peso, A., Zurita, J.L., 2008. Neutral red uptake assay for the estimation of
cell viability/cytotoxicity. Nat. Protoc. 3, 1125–1131. https://doi.org/10.1038/
nprot.2008.75.
Rezk, A., Al-Hashimi, A., John, W., Schepker, H., Ullrich, M.S., Brix, K., 2015.
Assessment of cytotoxicity exerted by leaf extracts from plants of the genus
Rhododendron towards epidermal keratinocytes and intestine epithelial cells. BMC
Compl. Alternative Med. 15, 1–18. https://doi.org/10.1186/s12906-015-0860-8.
Saijo, R., Nonaka, G., Nishioka, I., 1989. Tannins and related compounds. LXXXVII.
Isolation and characterization of four new hydrolyzable tannins from the leaves of
Mallotus repandus. Chem. Pharm. Bull. 37, 2624–2630.
Samarasinghe, W.M.P., Ranasinghe, C., Jayawardana, K.H., Somaratne, S.,
Gunaherath, G.M.K.B., 2022. In-vitro cell migration enhancing and pro-angiogenic
active secondary metabolites from Jeffreycia zeylanica (L.) H. Rob., S.C. Keeley &
Skvarla (Asteraceae). Nat. Prod. Res. 37, 3821–3825. https://doi.org/10.1080/
14786419.2022.2149515.
Sharma, P.C., 2000. Ravana: a great scholar and scientist. J. Gampaha Wickramarachchi
Ayurveda Inst. 2, 19–20.
Silva, Jéssica R., Burger, B., Kühl, C.M.C., Candreva, T., dos Anjos, M.B.P., Rodrigues, H.
G., 2018. Wound healing and omega-6 fatty acids: from inflammation to repair, 2018
Mediat. Inflamm., 2503950. https://doi.org/10.1155/2018/2503950.
Simbala, H.E.I., De Queljoe, E., Runtuwene, M.R.J., Tallei, T.E., 2017. Bioactive
compounds in pinang yaki (Areca vestiaria) fruit as potential source of antifertility
agent. Pak. J. Pharm. Sci. 30, 1929–1937.
Suarez-Arnedo, A., Figueroa, F.T., Clavijo, C., Arbeláez, P., Cruz, J.C., Muñoz-
Camargo, C., 2020. An image J plugin for the high throughput image analysis of in
vitro scratch wound healing assays. PLoS One 15, 1–14. https://doi.org/10.1371/
journal.pone.0232565.
Tarzemany, R., Jiang, G., Larjava, H., Häkkinen, L., 2015. Expression and function of
connexin 43 in Human gingival wound healing and fibroblasts. PLoS One 10, 1–31.
https://doi.org/10.1371/journal.pone.0115524.
Teixeira, B.L., Amarante-Silva, D., Visoni, S.B., Garcez, R.C., Trentin, A.G., 2020. FGF2
stimulates the growth and improves the melanocytic commitment of trunk neural
crest cells. Cell. Mol. Neurobiol. 40, 383–393. https://doi.org/10.1007/s10571-019-
00738-9.
Tice, R.R., Agurell, E., Anderson, D., Burlinson, B., Hartmann, A., Kobayashi, H.,
Miyamae, Y., Rojas, E., Ryu, J.C., Sasaki, Y.F., 2000. Single cell gel/comet assay:
guidelines for in vitro and in vivo genetic toxicology testing. Environ. Mol. Mutagen.
35 (3), 206–221. https://doi.org/10.1002/(sici)1098-2280(2000)35:3<206::aid-
em8>3.0.co;2-j. PMID: 10737956.
Toyang, N.J., Verpoorte, R., 2013. A review of the medicinal potentials of plants of the
genus Vernonia (Asteraceae). J. Ethnopharmacol. 146, 681–723. https://doi.org/
10.1016/j.jep.2013.01.040.
11
Journal of Ethnopharmacology 324 (2024) 117763
Toyoizumi, T., Ohta, R., Nakagawa, Y., Tazura, Y.M., Kuwagata, M., Noguchi, S.,
Yamakage, K., 2011. Use of the in vivo skin comet assay to evaluate the DNA-
damaging potential of chemicals applied to the skin. MRGTEM 726 (2), 175–180.
https://doi.org/10.1016/j.mrgentox.2011.09.009.
Udalamaththa, V., Samaratunga, U., Udagama, P., 2021. Cues from Sri Lankan
traditional medicine to the modern drug development pipeline - for a sustainable
future. Univ. Colombo Rev. (Series III) 2, 88–106. https://doi.org/10.4038/ucr.
v2i2.49.
Udalamaththa, V.L., Jayasinghe, C.D., Udagama, P.V., 2016. Potential role of herbal
remedies in stem cell therapy: proliferation and differentiation of human
mesenchymal stromal cells. Stem Cell Res. Ther. 7, 110. https://doi.org/10.1186/
s13287-016-0366-4.
Ukwubile, C.A., Ahmed, A., Katsayal, U.A., Ya’u, J., Mejida, S., 2019. GC–MS analysis of
bioactive compounds from Melastomastrum capitatum (Vahl)Fern. leaf methanol
extract: an anticancer plant. Sci. African 3. https://doi.org/10.1016/J.SCIAF.2019.
E00059.
Vangipuram, M., Ting, D., Kim, S., Diaz, R., Schüle, B., 2013. Skin punch biopsy explant
culture for derivation of primary human fibroblasts. J. Vis. Exp. 9–11. https://doi.
org/10.3791/3779.
Velnar, T., Bailey, T., Smrkolj, V., 2009. The wound healing process: an overview of the
cellular and molecular mechanisms. J. Int. Med. Res. 37, 1528–1542. https://doi.
org/10.1177/147323000903700531.
Venugopal, P., Balasubramanian, S., Majumdar, A., Sen, Ta M., 2011. Isolation,
characterization, and gene expression analysis of Wharton’s jelly-derived
mesenchymal stem cells under xeno-free culture conditions. Stem Cells Cloning 4,
39. https://doi.org/10.2147/SCCAA.S17548.
Wickramasinghe, W.M.C.N.K., Henagamage, A.P., Alakolanga, G.A.W., 2018. Biological
activities of polysaccharides extracted from Vernonia cinerea and Vernonia
zeylanica. In: Proceed Ing of the 2nd International Research Symposium. Uva
Wellassa University, pp. 1–2.
Yonezawa, T., Haga, S., Kobayashi, Y., Katoh, K., Obara, Y., 2008. Unsaturated fatty
acids promote proliferation via ERK1/2 and Akt pathway in bovine mammary
epithelial cells. Biochem. Biophys. Res. Commun. 367, 729–735.
Zayed, M.Z., Ahmad, F.B., Ho, W.S., Pang, S.L., 2014. GC-MS analysis of phytochemical
constituents in leaf extracts of Neolamarckia cadamba (rubiaceae) from Malaysia.
Int. J. Pharm. Pharmaceut. Sci. 6, 123–127.
Zhang, Y., 2018. Cell toxicity mechanism and biomarker. Clin. Transl. Med. 29 (1), 34, 7.
https://doi:10.1186/s40169-018-0212-7.
Zhang, X.C., Zhu, L., Li, X.Y., Liu, L.C., Lai, P.X., 2021. Chemical composition, and
evaluation of antibacterial, antibiofilm and synergistic effects with conventional
antibiotics of essential oil from mallotus repandus. Record Nat. Prod. 15, 324–329.
https://doi.org/10.25135/rnp.217.20.10.1854.
Zhang, Y., Zeng, H., Chen, D., 2008. Effect of fatty acid methyl esters from plastrum
testudinis on proliferation of rat bone mesenchymal stem cells. Front. Chem. China
3, 262–266. https://doi.org/10.1007/s11458-008-0063-7.
Zou, H., Ye, H., Kamaraj, R., Zhang, T., Zhang, J., Pavek, P., 2021. A review on
pharmacological activities and synergistic effect of quercetin with small molecule
agents. Phytomedicine 92, 153736. https://doi.org/10.1016/j.
phymed.2021.153736.
Zuliani, T., Saiagh, S., Knol, A.-C., Esbelin, J., Dréno, B., 2013. Fetal fibroblasts and
keratinocytes with immunosuppressive properties for allogeneic cell-based wound
therapy. PLoS One 8. https://doi.org/10.1371/journal.pone.0070408.