THE JOURNAL OF BIOLOGICAL CHEMISTRY
26893–26897, 2001
© 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of the Substrate Specificity-conferring Amino Acid
Residues of 4-Coumarate:Coenzyme A Ligase Allows the Rational
Design of Mutant Enzymes with New Catalytic Properties*
Received for publication, January 16, 2001, and in revised form, March 21, 2001
Published, JBC Papers in Press, April 25, 2001, DOI 10.1074/jbc.M100355200
Hans-Peter Stuible‡ and Erich Kombrink§
From the Max-Planck-Institut für Züchtungsforschung, Abteilung Biochemie, 50829 Köln, Germany
4-Coumarate:coenzyme A ligases (4CLs) generally use,
in addition to coumarate, caffeate and ferulate as their
main substrates. However, the recently cloned Arabi-
dopsis thaliana isoform At4CL2 is exceptional because
it has no appreciable activity with ferulate. On the basis
of information obtained from the crystal structure of the
phenylalanine-activating domain of gramicidin S-syn-
thetase, 10 amino acid residues were identified that may
form the substrate binding pocket of 4CL. Among these
amino acids, representing the putative “substrate spec-
ificity motif,” only one residue, Met293, was not con-
served in At4CL2, compared with At4CL1 and At4CL3,
two isoforms using ferulate. Substitution of Met293 or
Lys320, another residue of the putative substrate speci-
ficity motif, which in the predicted three-dimensional
structure is located in close proximity to Met293, by
smaller amino acids converted At4CL2 to an enzyme
capable of using ferulate. The activity with caffeate was
not or only moderately affected. Conversely, substitu-
tion of Met293 by bulky aromatic amino acids increased
the apparent affinity (Km) for caffeate up to 10-fold,
whereas single substitutions of Val294 did not affect sub-
strate use. The results support our structural assump-
tions and suggest that the amino acid residues 293 and
320 of At4CL2 directly interact with the 3-methoxy
group of the phenolic substrate and therefore allow a
first insight into the structural principles determining
substrate specificity of 4CL.
4-Coumarate:coenzyme A ligase (4CL,1 EC 6.2.1.12) is an
essential enzyme of the phenylpropanoid biosynthetic path-
way, catalyzing the activation of various hydroxylated and
methoxylated cinnamic acid derivatives to the corresponding
thiol esters in a two-step reaction. During the first step, cou-
maric acid and ATP form a coumaroyl-adenylate intermediate
with the simultaneous release of pyrophosphate. In the second
step, the coumaroyl group is transferred to the sulfhydryl
group of CoA, and AMP is released (1, 2). Despite their low
overall sequence identity, one highly conserved peptide motif is
* The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
‡ Recipient of Deutsche Forschungsgemeinschaft Postdoctoral Fel-
lowship Stu251/1-2.
§ To whom correspondence should be addressed: Max-Planck-Institut
für Züchtungsforschung, Abteilung Biochemie, Carl-von-Linné-Weg 10,
50829 Köln, Germany. Tel.: 49-221-5062-320; Fax: 49-221-5062-313;
E-mail: kombrink@mpiz-koeln.mpg.de.
1
The abbreviations used are: 4CL, 4-Coumarate:coenzyme A ligase;
PheA, phenylalanine-activating domain; At4CL, Arabidopsis thaliana
4CL; Pt4CL, Populus tremuloides 4CL.
This paper is available on line at http://www.jbc.org
Vol. 276, No. 29, Issue of July 20, pp.
Printed in U.S.A.
common to 4CLs, luciferases, fatty acyl-CoA synthetases,
acetyl-CoA synthetases, and specialized domains within pep-
tide synthetase multienzymes. This conserved, putative AMP
binding domain has been used as the most important criterion
to group the above-listed proteins in one superfamily of adeny-
late-forming enzymes (3). In good agreement with this theoret-
ical classification and prediction of functional similarity, the
mutational analysis of At4CL2 from Arabidopsis thaliana ex-
perimentally corroborated such a close functional relationship
between 4CL and the adenylation and substrate recognition
domains of nonribosomal peptide synthetases (4). Considerable
progress has been made in determining the structural basis of
substrate specificity in the peptide synthetase system (5–7).
The crystal structure of the N-terminal adenylation subunit
(phenylalanine-activating domain (PheA)) of gramicidin S-syn-
thetase 1 obtained in the presence of AMP and L-phenylala-
nine, a substrate structurally related to coumaric acid, allowed
both the localization of catalytic important positions and the
identification of 10 amino acids lining the phenylalanine bind-
ing pocket (5). All substrate binding pocket constituents of
PheA (except Lys517, which functions as the active site in
adenylate formation and is therefore obviously not involved in
substrate discrimination) could be identified within a 100-
amino acid residue-comprising region, which is flanked by the
conserved core motifs A3 and A6 of peptide synthetases (6)
exhibiting high sequence identity with the Box I (LPFSSGTT-
GLPKG) and Box II (GEICIRG) sequences of 4CLs, respec-
tively. Using different sequence alignment strategies, the sub-
strate specificity conferring amino acids corresponding to the
residues identified in PheA have also been localized in other
peptide synthetases (6, 8). The importance of several of these
positions for substrate recognition and specificity has been
verified by site-directed mutagenesis (6). On the basis of these
data, the concept of a substrate binding pocket with a limited
number of contact residues being involved in substrate speci-
ficity determination has been established for several peptide
synthetases (6, 8, 9).
The position of 4CL at a metabolic branch point connecting
general phenylpropanoid metabolism with different end prod-
uct-specific pathways makes 4CL a promising target for bio-
technological manipulation. The suitability of 4CL for product
or pathway engineering is not only suggested by its position
within the plant secondary metabolism but is additionally sup-
ported by recent studies that indicate that 4CL isoforms by
virtue of their different substrate specificities and expression
patterns channel phenolic precursors either to the lignin or the
flavonoid biosynthetic pathway (10, 11). We recently cloned
and biochemically characterized three 4CL isoforms from A.
thaliana (11). Although showing differences in detail, all three
4CLs were able to activate their typical substrates, coumarate
and caffeate. Unexpected, however, was the observation that
26893
26894 Substrate Specificity of 4-Coumarate:Coenzyme A Ligase
TABLE I
Sequences of PCR primers used for the construction of At4CL2 mutant proteins
Primer sequencea
GGTGTAAAGTCACGGTGGCTCCAGTCGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTGCCGTCGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTATGATGGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTATGCTCGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTTTCGTCGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTTACGTCGTGCCACCGATCGTTTTAGC
GGTGTAAAGTCACGGTGGCTTGGGTCGTGCCACCGATCGTTTTAGC
CTGAGCTCGGTTAGGATGGTTCTGTCTGGAGCAGCTCCTCTTGG
CTGAGCTCGGTTAGGATGGTTGCGTCTGGAGCAGCTCCTCTTGG
a
Modified codons are underlined.
only the isoforms At4CL1 and At4CL3 were able to convert
ferulate to the corresponding thiol ester, whereas At4CL2 was
not (11). Both the minor structural differences existing be-
tween caffeate (3,4-dihydroxy cinnamic acid) and ferulate (3-
methoxy-4-hydroxy cinnamic acid) and the high sequence iden-
tity found between the three At4CL isoforms suggested that
only a limited number of amino acid residues are responsible
for the inability of At4CL2 to convert ferulate to its thiol ester.
Therefore, we decided to study the molecular mechanism pre-
venting ferulate activation by At4CL2 in detail to unravel the
principle rules of substrate specificity determination in the
4CL system.
EXPERIMENTAL PROCEDURES
Bacterial Strains, Plasmids, Primer Sequences, and DNA Manipula-
tion Techniques—Standard DNA techniques were performed as de-
scribed elsewhere (12). For plasmid amplification, the Escherichia coli
strain DH5␣ (Life Technologies, Inc.) was used. Protein expression was
performed using the E. coli strain M15(pRP4). The pQE30-based
At4CL2 expression plasmid used for mutagenesis experiments has pre-
viously been described (11). Point mutations were introduced into
At4CL2 by polymerase chain reaction amplification of the entire
At4CL2 expression plasmid by using two mutated oligonucleotide prim-
ers, each complementary to opposite strands of the vector. Double
mutants were created by polymerase chain reaction amplification of
already existing At4CL2 mutant plasmids using a new pair of mutated
oligonucleotide primers. Conditions for polymerase chain reaction-
based mutagenesis were as follows: 1 cycle at 94 °C (1 min), 16 cycles at
94 °C (1 min), 59 °C (1 min), and 68 °C (14 min), and 1 final polymeri-
zation step at 68 °C (14 min). All components necessary for this mu-
tagenesis procedure were included in the commercial QuikChange kit
(Stratagene). One primer sequence of each pair of complementary mu-
tagenesis primers is listed in Table I.
Analysis of DNA and Protein Sequences—The entire DNA sequences
of all mutated reading frames were determined on ABI Prism 377 DNA
sequencers (Applied Biosystems, Forster City, CA). To identify the
putative substrate pocket-lining amino acids of 4CL, sequence align-
ments were generated with the PILEUP program of the Genetics Com-
puter Group program package, version 10.0, with the gap weight and
gap length weight set to 2 and 8, respectively (13), using the following
sequences (with GenBank accession numbers given in parentheses
brackets): A. thaliana At4CL2 (AAD47193), At4CL1 (AAD47191),
At4CL3 (AAD47194), Brevibacillus brevis gramicidin S-synthetase 1
(PheA; CAA33603), and other 4CL sequences as listed previously (11).
Purification of At4CL2 Proteins and Enzyme Assays—Expression
and purification of At4CL2 proteins were performed as recently de-
scribed (4). 4CL activity was determined with the spectrophotometric
assay previously described, using caffeic acid and ferulic acid as phe-
nolic substrates (11, 14). The change of absorbance during CoA ester
formation was monitored at 363 nm for caffeoyl-CoA and at 345 nm for
feruloyl-CoA (15). The Km and Vmax values for caffeate and ferulate
were estimated at fixed concentrations of ATP (5.5 mM) and CoA (0.3
mM) by linear regression of v/s against s (Hanes plot). Since Km and Vmax
values could not be determined for all mutant enzymes because of their
low activity, specific activity was determined in addition at standard
conditions (0.2 mM phenolic substrate, 5.5 mM ATP, 0.3 mM CoA) for all
4CL variants. Protein concentrations were determined according to
Bradford (16) with bovine serum albumin as standard.
Mutation
M293P
M293A
V294M
V294L
M293F
M293Y
M293W
K320L
K320A
RESULTS
Identification of the Putative Substrate Pocket-lining Constit-
uents of 4CL—To identify the substrate binding pocket-lining
amino acids within the At4CL2 primary sequence, different
multiple sequence alignments of the three 4CL isoforms of A.
thaliana were performed with several adenylation domains of
peptide synthetases, including PheA, luciferases, as well as all
other available 4CL sequences (for details, see “Experimental
Procedures”). We assumed that the functional relatedness be-
tween these three groups of enzymes is also reflected at the
structural level, as recently described for PheA and firefly
luciferase (5, 17). In good agreement with this presumption, the
reduced sequence alignment shown in Fig. 1 reveals such struc-
tural similarity by the colinear organization of the two highly
conserved sequence motifs common to 4CLs (Box I and Box II)
and PheA (core motifs A3 and A6) and the length and sequence
of the intervening region. Because in PheA all substrate bind-
ing pocket constituents are known to be located between the
peptide motifs A3 and A6, we predicted that the substrate
specificity conferring amino acids of 4CL are located between
the putative AMP binding domain (Box I) and the so-called
GEICIRG domain (Box II). Furthermore, the unusual features
of At4CL2, which activates 3,4-dihydroxy cinnamic acid (caf-
feate) as its preferred substrate but is incapable of converting
3-methoxy-4-hydroxy cinnamic acid (ferulate) to the corre-
sponding thiol ester, should be reflected in the constituents of
the substrate binding pocket in comparison with the ferulate-
using enzymes At4CL1 and At4CL3. By extraction of the nine
putative substrate binding pocket-forming residues of At4CL1,
At4CL2, and At4CL3 from the alignment with PheA, we iden-
tified two differences among the three Arabidopsis 4CL “sub-
strate specificity motifs” (Fig. 1). First, the bulky methionine
residue at position 293 in At4CL2 is substituted by proline and
alanine residues in At4CL1 and At4CL3, respectively (Fig. 1).
Because At4CL1 and At4CL3, in contrast to At4CL2, are able
to activate ferulate, the observed difference suggested that
ferulate use could be regulated by a size exclusion mechanism
mediated by the bulkiness of the amino acid at position 293.
Second, in At4CL3, position 320 (At4CL2 numbering) is occu-
pied by a leucine, whereas At4CL1 and At4CL2 both carry a
lysine in this position (Fig. 1). Although the different amino
acid residues at position 320 allowed no obvious explanation of
the available biochemical data on substrate use, in particular
the missing ferulate activation by At4CL2, we assumed that
this position could also be important for determining substrate
specificity, because it should be located in close proximity to the
other variable amino acid (Met293) if the enzyme has a three-
dimensional structure similar to that of PheA.
Analysis of At4CL2 Mutant Enzymes with Altered Substrate
Binding Constituents—To test whether the bulky methionine
residue at position 293 in At4CL2 is responsible for the lack of
capacity of the enzyme to activate ferulate, Met293 was re-
 Substrate Specificity of 4-Coumarate:Coenzyme A Ligase
FIG. 1. Alignment of the deduced amino acid sequences of
three 4CL isoforms from Arabidopsis thaliana with the pheny-
lalanine-activating domain (PheA) of gramicidin S-synthetase 1
from B. brevis. The presentation is reduced to the region flanked by
the conserved peptide motifs Box I and Box II of 4CLs (boxed), corre-
sponding to the core motifs A3 and A6 of PheA (6). Amino acids identical
in all four sequences are shaded. The nine substrate pocket-lining
amino acids of PheA and the corresponding residues of 4CLs are
marked with an asterisk and a box. Open circles mark those amino acid
residues located between Box I and Box II that are unique to At4CL2 in
comparison with At4CL1 and At4CL3.
placed by proline or alanine as suggested from the primary
sequences of At4CL1 and At4CL3, respectively (Fig. 1). Both
mutant enzymes, M293P and M293A, retained their activity
with caffeate, and the Km and Vmax values for this substrate
were comparable with those of the wild-type enzyme (Table II).
However, as a novel catalytic activity, both mutant enzymes
were able to activate ferulate, exhibiting Km values fairly sim-
ilar to those reported for At4CL1 (199 ␮M) and At4CL3 (166 ␮M;
Ref. 11). Although the specific activities of these new At4CL2
variants with ferulate were ⬃50-fold higher than the residual
activity displayed by the wild-type enzyme (2.3 picokatals/mg),
caffeate was still the preferred substrate because of the signif-
icantly lower Km value (Table II). This is clearly illustrated by
calculation of the Vmax:Km ratios, which for both mutants var-
ied from 8.2 to 8.6 for caffeate and 0.5 to 1.1 for ferulate.
To test the specificity of the observed mutant phenotype after
alteration of amino acid residue 293, we generated a second set
of mutants at the neighboring position 294 that is also variable
among the Arabidopsis 4CLs (Fig. 1). Again, the newly intro-
duced amino acids were selected according to the sequences of
At4CL1 and At4CL3. The hereby generated At4CL2 variants,
V294M and V294L, exhibited slightly reduced Vmax values and
specific activities with caffeate, whereas no significant activity
was observed with ferulate. Thus, despite its close proximity to
Met293, the valine at position 294 is apparently not involved in
determining substrate specificity in 4CL. However, the results
obtained with the double mutants M293P/V294M and M293A/
V294L demonstrate that substitutions of Val294 have a modu-
lating influence on ferulate activation when combined with a
second mutation, leading to a 2–3-fold decrease of the Km
values in comparison with the single mutants M293P and
M293A (Table II).
Because a size reduction of the amino acid residue at position
293 seemed to be essential for the acceptance of ferulate as a
substrate by At4CL2, we postulated that the introduction of
bulky aromatic amino acids at this position should not only
prevent ferulate (4-hydroxy-3-methoxy cinnamate) activation
but should also reduce the efficiency of caffeate (3,4-dihydroxy
cinnamate) activation. Therefore, it was no surprise that none
26895
of the three At4CL2 mutant enzymes, M293F, M293Y, and
M293W, exhibited any significant enzymatic activity with feru-
late (Table II). Substitution of Met293 by the smallest aromatic
amino acid, phenylalanine, also did not appreciably affect the
Km (only 2-fold) and Vmax values for caffeate, whereas the
bulkier amino acids tyrosine and tryptophan had significant
effects. The M293Y substitution resulted in a 10-fold increase
in the Km value without affecting Vmax, whereas by the M293W
substitution, both parameters were affected, leading to a dras-
tically reduced enzymatic capacity of the mutant enzyme (Ta-
ble II). Collectively, these results support the model that the
bulkiness of the amino acids lining the substrate binding
pocket is an important factor determining substrate specificity
in the 4CL system.
To study a possible contribution of Lys320 on the catalytic
properties of At4CL2, we substituted this residue with leucine,
as suggested from the sequence comparison (Fig. 1), and with
alanine. Compared with the wild-type enzyme, both substitu-
tions, K320L and K320A, resulted in a 2–3-fold increase in the
Km for caffeate use, whereas Vmax was not affected, although a
large, positively charged amino acid was replaced by smaller,
aliphatic amino acids (Table II). In addition, both new mutant
enzymes exhibited remarkable activity with ferulate, similar to
the 4CL variants M293A and M293P (Table II). The properties
of the mutant enzyme with the K320L substitution resembled
those of the ferulate-activating At4CL2 variants carrying sin-
gle point mutations at position 293 (Table II). In contrast, the
K320A substitution led to a 4-fold decrease in the Km value for
ferulate when compared with the K320L mutation, although no
alanine was found at this position in any of the available 4CL
sequences. The low Km value (40 ␮M) in combination with the
moderate Vmax value (135 picokatals/mg) resulted in a rela-
tively high Vmax:Km ratio of 3.4 for ferulate, thereby slightly
exceeding the Vmax:Km ratio of 2.4 for caffeate. The stronger
mutant phenotype obtained with the K320A substitution in
comparison with the K320L exchange again indicates that an
increase of the available space for the substrate binding pocket
allows a higher activity with bulky substrates.
To analyze potential additive effects, two enzyme double
mutants were created, each carrying ferulate specificity-con-
ferring amino acids at both positions identified to be important
(293 and 320). When the K320L/M293P variant and the K320L
single mutant were compared with respect to caffeate use, no
additive effect of the second mutation was apparent (Table II).
However, for ferulate activation, the Km value of the K320L/
M293P variant was 3–5-fold lower than the Km values of the
corresponding enzymes with single mutations, whereas the
Vmax value was not affected (Table II). The combination of low
Km (46 ␮M) and high Vmax (270 picokatals/mg) made ferulate
with a Vmax:Km ratio of 5.9, instead of caffeate with a Vmax:Km
ratio of 2.4, the preferred substrate of this new At4CL2 variant.
In this case, the introduction of a second mutation had an
additive effect and changed the substrate preference of the
enzyme from caffeate to ferulate. A more complex situation was
observed with the K320A/M293P double mutant, which exhib-
ited Km values for ferulate and caffeate fairly similar to those of
the K320A single mutant. In addition, however, the Vmax val-
ues and the specific activities were also clearly reduced for both
substrates, and a positive influence of the second mutation on
ferulate use was not apparent (Table II).
In conclusion, the introduction of small amino acids at either
position, 293 or 320, of the At4CL2 primary sequence promoted
ferulate activation by this enzyme and generated a new sub-
strate use profile. Together with the occurrence of additive
effects of both mutations, as observed with the K320L/M293P
double mutant, these results indicate that both substituted
26896 Substrate Specificity of 4-Coumarate:Coenzyme A Ligase
TABLE II
Kinetic properties of Arabidopsis 4CL2 mutant enzymes
All values are the mean ⫾ S.D. of at least three independent determinations with affinity-purified protein.
Caffeate Ferulate
Enzyme
Km Vmax SAa Km Vmax SAa

␮M picokatals/mg picokatals/mg ␮M picokatals/mg picokatals/mg

Wild type 24 ⫾ 1.5 158 ⫾ 9 144 ⫾ 8 NDb ND 2.3 ⫾ 0.9
M293P 25 ⫾ 8 206 ⫾ 38 183 ⫾ 25 224 ⫾ 46 243 ⫾ 9 115 ⫾ 7
M293A 24 ⫾ 7.5 206 ⫾ 46 188 ⫾ 41 558 ⫾ 45 284 ⫾ 36 78 ⫾ 14
M293P/V294M 21 ⫾ 4.6 187 ⫾ 44 168 ⫾ 42 105 ⫾ 27 210 ⫾ 37 140 ⫾ 40
M293A/V294L 24 ⫾ 7 190 ⫾ 40 170 ⫾ 32 162 ⫾ 61 290 ⫾ 34 165 ⫾ 22
V294M 22 ⫾ 4 134 ⫾ 23 120 ⫾ 18 ND ND 4.9 ⫾ 1
V294L 23 ⫾ 4.6 114 ⫾ 11 104 ⫾ 10 ND ND 3.2 ⫾ 0.6
M293F 63 ⫾ 17 177 ⫾ 63 136 ⫾ 41 ND ND ⬍0.3
M293Y 224 ⫾ 53 176 ⫾ 30 88 ⫾ 5 ND ND ⬍0.1
M293W 180 ⫾ 42 44 ⫾ 10 23 ⫾ 6 ND ND 8.6 ⫾ 0.6
K320L 74 ⫾ 13 147 ⫾ 6 107 ⫾ 4 151 ⫾ 50 234 ⫾ 34 140 ⫾ 12
K320A 55 ⫾ 6 130 ⫾ 12 105 ⫾ 8 40 ⫾ 2 135 ⫾ 15 108 ⫾ 7
K320L/M293P 48 ⫾ 6 119 ⫾ 33 97 ⫾ 29 46 ⫾ 7 270 ⫾ 50 263 ⫾ 62
K320A/M293P 84 ⫾ 19 63 ⫾ 6 45 ⫾ 6 58 ⫾ 5 92 ⫾ 8 71 ⫾ 7
a
Specific activity (based on protein), determined under standard conditions with 0.2 mM phenolic substrate.
b
ND, not determined, activity too low.

amino acid residues represent substrate binding pocket constit-
uents, which are located in close proximity to each other in the
three-dimensional structure of the protein and at the same
time contact the 3-methoxy or 3-hydroxy groups of ferulate and
caffeate, respectively.
DISCUSSION
The results presented in this study demonstrate the possi-
bility of rationally designing 4CL activity by site-directed mu-
tagenesis. The generation of new enzymatic specificities using
At4CL2 as a model system represents a first step toward mod-
ification of biosynthetic processes located downstream of the
general phenylpropanoid metabolism. Starting from the crystal
structure of PheA (5), we identified nine amino acid residues in
the At4CL2 primary sequence that may line the binding pocket
for the phenolic substrate. Because the amino acid sequences of
At4CL2 and PheA are only ⬃15% identical in the region of
⬃100 amino acids that harbors all the substrate binding and
specificity-conferring constituents, it has to be emphasized that
the assignment of functionally important amino acids in
At4CL2 on the basis of sequence alignments is not necessarily
correct for each predicted position. The functional relevance
has to be verified experimentally for each position, and it may
well be that other or additional positions than those deduced
from the alignment with PheA are necessary and important for
the determination of substrate specificity in the 4CL system.
Nevertheless, the strong influence on ferulate and caffeate use
exerted by variation of the amino acid residues at positions 293
and 320 in At4CL2 argue strongly in favor of a correct assign-
ment of at least these two positions. The present results
strongly suggest that both residues interact directly with the
3-hydroxy or 3-methoxy groups of the phenolic substrates and
thus represent two of the amino acids lining the substrate
binding pocket.
The At4CL2 residues Met293 and Lys320 are likely to corre-
spond to the PheA amino acids Thr278 and Ile299, respectively.
In PheA, Thr278 and Ile299 are neighboring residues in the
three-dimensional structure, both of which are located at the
same side of the phenylalanine binding pocket (5). By compar-
ing the nine substrate specificity-conferring amino acids of
several peptide synthetases, five highly variable residues were
identified, including Thr278 and Ile299 in PheA. The high vari-
ability of these substrate binding pocket constituents was sug-
gested to reflect their importance for determining substrate
specificity (6). In accordance with this predicted importance,
substitution of Thr278 by the larger methionine residue re-
sulted in a 20-fold decrease in the use of the miscognate and
bulkier substrate tryptophan compared with the cognate sub-
strate phenylalanine. This observation indicated that the re-
duction of the available space within the substrate binding
pocket was responsible for the increase in substrate specificity
(6). The deduced colocalization of At4CL2 Met293 and Lys320 in
the corresponding region of the substrate binding pocket is in
good agreement with our experimental results. Substitution of
either residue by a smaller amino acid renders the At4CL2
substrate binding pocket accessible to ferulate (Table II). Cor-
respondingly, introduction of bulky aromatic amino acids at
position 293 of At4CL2 resulted in a 10-fold increase of the Km
value for caffeate (Table II).
The data obtained from the peptide synthetase system indi-
cate that the knowledge of specificity-conferring amino acids
allows more precise predictions of substrate use by newly dis-
covered adenylation domains before their biochemical charac-
terization than would be possible by overall sequence compar-
ison with functionally characterized enzymes (6, 8). Predictions
of substrate use and specificity are also desirable for the 4CL
system, particularly in view of the extensive genome sequences
that are presently becoming available. For example, although
experimental evidence suggests that Arabidopsis contains only
three bona fide 4CLs (11), several new 4CL-like sequences were
recently identified (accession numbers AC011000, AL132967,
AL161502, and AL161549) for which a function has not yet
been assigned. Despite the observed overall sequence similar-
ity, 4CL activity could not be detected for one of these proteins
(AC011000, gene F16P17.9) after heterologous expression in E.
coli.2 Unfortunately, a systematic analysis of the parameters
specifying substrate recognition and use by different 4CL iso-
forms has not yet been possible; in fact, it is impeded by the
limited amount of available data correlating structural infor-
mation with biochemical properties.
The characterization of 4CL activities has been carried out
largely with proteins purified from various plant species and
tissues and revealed the existence of 4CL isoforms with con-
siderable variation in substrate specificity, including the rare
occurrence of activity toward sinapate (3,5-dimethoxy-4-hy-
droxy cinnamate; Refs. 1, 18 –20). However, an unambiguous
correlation of particular and unusual biochemical properties
with a distinct 4CL coding sequence, e.g. by characterization of
proteins expressed in E. coli, has been established only for A.
2
H.-P. Stuible, unpublished results.
 Substrate Specificity of 4-Coumarate:Coenzyme A Ligase
thaliana (present work; Ref. 11) and Populus tremuloides (10).
The Populus protein Pt4CL1 can activate 5-hydroxy ferulate,
whereas the isoform Pt4CL2 cannot. By comparison of the
Pt4CL1 and Pt4CL2 sequences according to the same criteria
as outlined above for the Arabidopsis 4CL system, a total of
three amino acid differences can be identified among the nine
putative substrate binding pocket constituents. However, a
correlation between the bulkiness of these amino acid residues
with the reported substrate preference of the Populus enzymes
is not obvious, indicating that other factors such as hydrogen
bonding, hydrophobicity, or Van der Waals interactions may
also influence substrate recognition and use by 4CLs. Experi-
mental evidence in support of the notion that in addition to size
exclusion, such other mechanisms contribute to substrate spec-
ificity has again been obtained with the peptide synthetase
system by Stachelhaus et al. (6), who were able to alter the
specificity of an adenylation domain from aspartate to aspara-
gine by a single histidine-to-glutamate substitution.
There is considerable interest in manipulation of phenylpro-
panoid metabolism, because phenolic compounds have a wide
range of important functions in plants. They serve as struc-
tural components (lignin and suberin), protectants against bi-
otic and abiotic stresses (phytoalexins, antioxidants, and UV-
absorbing compounds), flower pigments, and signal molecules
(21). More recently, several plant phenolics received consider-
able attention as health-promoting “nutraceuticals” with anti-
oxidant and anticancer activity (22). One approach to alter
phenylpropanoid biosynthesis both quantitatively and qualita-
tively is to increase or reduce the expression of particular genes
in transgenic plants (21). In Arabidopsis, for example, a reduc-
tion in lignin content by 50% was achieved by expression of an
At4CL1 antisense construct (23), and in tobacco a similar ap-
proach resulted in an 80% reduction in lignin content (24). In
both cases the lignin subunit composition was also drastically
altered, which may reflect an eminent disadvantage of the
antisense approach, namely that several members of a gene
family may be affected in a differential and unpredictable man-
ner. In addition, even though specific inhibition of one partic-
ular 4CL isoform may result in a desirable reduction in lignin
content in one particular organ or cell type, it may also affect
other biosynthetic pathways, such as flavonoid formation, in
others, with all the potential detrimental effects. The partial
lack of protective flavonoid derivatives may, for example, en-
hance susceptibility to pathogen infection or to damage by UV
light exposure (25). A more promising approach for manipula-
tion of phenylpropanoid metabolism in a positive manner using
the branch point position of 4CL may require modified struc-
tural genes encoding enzymes with clearly defined substrate
specificities in combination with selectively altered promoter
elements providing organ-, cell type-, and stimulus-specific ex-
26897
pression. Correspondingly, the engineering of 4CL variants
with enhanced capacity to activate the lignin precursor si-
napate or the putative salicylate precursor cinnamic acid would
be of great interest for both scientific as well as practical
purposes.
In conclusion, the data obtained in this study substantiate
our prediction that, for its high-level expression, stability as
active enzyme, which retains its structural integrity despite
extensive mutational alterations, and simple functional analy-
sis in an optical enzyme assay, At4CL2 represents a well suited
model system to study the structural basis of substrate speci-
ficity in a subclass of adenylate-forming enzymes (4). To over-
come the still-existing limitations, especially the lack of a
three-dimensional structural model, both the crystallization of
the enzyme and further mutational analyses of At4CL2 have
been initiated.
Acknowledgments—We thank Dr. Imre E. Somssich and Prof. K.
Hahlbrock for critical comments on the manuscript, Prof. K. Hahlbrock
also for continuous support of this work, and Roswitha Lentz for excel-
lent technical assistance.
REFERENCES
1. Knobloch, K.-H., and Hahlbrock, K. (1975) Eur. J. Biochem. 52, 311–320
2. Becker-André, M., Schulze-Lefert, P., and Hahlbrock, K. (1991) J. Biol. Chem.
266, 8551– 8559
3. Fulda, M., Heinz, E., and Wolter, F. P. (1994) Mol. Gen. Genet. 242, 241–249
4. Stuible, H.-P., Büttner, D., Ehlting, J., Hahlbrock, K., and Kombrink, E. (2000)
FEBS Lett. 467, 117–122
5. Conti, E., Stachelhaus, T., Marahiel, M. A., and Brick, P. (1997) EMBO J. 16,
4174 – 4183
6. Stachelhaus, T., Mootz, H. D., and Marahiel, M. A. (1999) Chem. Biol. 6,
493–505
7. Stachelhaus, T., and Marahiel, M. A. (1995) J. Biol. Chem. 270, 6163– 6169
8. Challis, G. L., Ravel, J., and Townsend, C. A. (2000) Chem. Biol. 7, 211–224
9. von Döhren, H., Dieckmann, R., and Pavela-Vrancic, M. (1999) Chem. Biol. 6,
R273–R279
10. Hu, W.-J., Kawaoka, A., Tsai, C.-J., Lung, J., Osakabe, K., Ebinuma, H., and
Chiang, V. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5407–5412
11. Ehlting, J., Büttner, D., Wang, Q., Douglas, C. J., Somssich, I. E., and
Kombrink, E. (1999) Plant J. 19, 9 –20
12. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press,
Plainview, NY
13. Devereux, J., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12,
387–395
14. Knobloch, K.-H., and Hahlbrock, K. (1977) Arch. Biochem. Biophys. 184,
237–248
15. Stöckigt, J., and Zenk, M. H. (1975) Z. Naturforsch. 30c, 352–358
16. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254
17. Conti, E., Franks, N. P., and Brick, P. (1996) Structure 4, 287–298
18. Ranjeva, R., Boudet, A. M., and Faggion, R. (1976) Biochimie 58, 1255–1262
19. Wallis, P. J., and Rhodes, M. J. C. (1977) Phytochemistry 16, 1891–1894
20. Grand, C., Boudet, A., and Boudet, A. M. (1983) Planta 158, 225–229
21. Weisshaar, B., and Jenkins, G. I. (1998) Curr. Opin. Plant Biol. 1, 251–257
22. Dixon, R. A., and Steele, C. L. (1999) Trends Plant Sci. 4, 394 – 400
23. Lee, D., Meyer, K., Chapple, C., and Douglas, C. J. (1997) Plant Cell 9,
1985–1998
24. Kajita, S., Hishiyama, S., Tomimura, Y., Katayama, Y., and Omori, S. (1997)
Plant Physiol. 114, 871– 879
25. Landry, L. G., Chapple, C. C. S., and Last, R. L. (1995) Plant Physiol. 109,
1159 –1166