Food &

Function
View Article Online
PAPER View Journal

Comparative study of the effects of

Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.

Cite this: DOI: 10.1039/c7fo01342f

phosphatidylcholine rich in DHA and EPA on
Alzheimer’s disease and the possible mechanisms
in CHO-APP/PS1 cells and SAMP8 mice
Hongxia Che,a Miaomiao Zhou,a Tiantian Zhang, a Lingyu Zhang,a Lin Ding,a
Teruyoshi Yanagita,b Jie Xu,a Changhu Xue*a,c and Yuming Wang *a,c

Received 29th August 2017,
Accepted 2nd December 2017
DOI: 10.1039/c7fo01342f
rsc.li/food-function
Metabolic stress induced by a high-fat (HF) diet leads to cognitive dysfunction and aging. In the present
study, Chinese hamster ovary cells stably transfected with amyloid precursor protein (APP) and presenilin
1 (PS1) (CHO-APP/PS1 cells) and SAMP8 mice fed with an HF diet were used to study the effects of doco-
sahexaenoic acid (DHA)-enriched phosphatidylcholine (DHA-PC) and eicosapentaenoic acid (EPA)-
enriched phosphatidylcholine (EPA-PC) on Alzheimer’s disease (AD) and the possible mechanisms
involved in these effects. Behavior test results indicated that DHA-PC exerted better effects than EPA-PC
on improving memory and cognitive deficiency. Further analysis showed that DHA-PC and EPA-PC could
significantly decrease β-amyloid (Aβ) concentrations in CHO-APP/PS1 cells and SAMP8 mice by inhibiting
APP, PS1, and BACE1 expression. Moreover, both DHA-PC and EPA-PC can increase the activities of the
antioxidant index, including SOD, T-AOC, GSH, and GSH-PX, and inhibit levels of MDA, NO, and NOS. In
addition, the expressions of inflammatory factors (TNF-α, IL-1β) and apoptosis were significantly sup-
pressed via improving the ratio of Bcl-2/Bax and decreasing the expression of pro-apoptosis factors.
Interestingly, only DHA-PC could improve the expression of neurotrophic factors, including BDNF, synap-
tophysin, and growth associated protein 43. DHA-PC and EPA-PC could ameliorate memory and cogni-
tive function of HF diet-fed SAMP8 mice via inhibiting Aβ generation, suppressing oxidative stress and
apoptosis, down-regulating inflammatory response, and improving neurotrophic activity. Therefore,
DHA-PC and EPA-PC may be applied as food supplements and/or functional ingredients to relieve neuro-
degenerative disease.

1. Introduction stances, a small amount of APP is processed via the amyloido-

Alzheimer’s disease (AD) is a progressive, age-related, neurode-
generative disorder characterized by memory loss and
impaired cognitive function. β-Amyloid (Aβ) peptides play a key
role in synaptic damage and memory deficits in the early
pathogenesis of AD.1 Aβ is produced by the proteolytic proces-
sing of amyloid precursor protein (APP). An important way to
process APP is the nonamyloidogenic pathway, in which
α-secretase cleaves the Aβ domain in APP, thereby precluding
the formation of intact Aβ. However, under normal circum-
a
College of Food Science and Engineering, Ocean University of China, Qingdao,
266003 Shandong, China. E-mail: wangyuming@ouc.edu.cn, xuech@ouc.edu.cn;
Fax: +86532 82032468; Tel: +86 532 82032597
b
Department of Health and Nutrition Science, Nishikyushu University, Kanzaki,
Japan
c
Qingdao National Laboratory for Marine Science and Technology, Laboratory of
Marine Drugs & Biological products, Qingdao 266237, China
genic pathway, in which Aβ is released from APP by β- and
γ-secretases.2 Various studies have linked Aβ accumulation
either directly or indirectly to synaptic loss and neuronal apop-
tosis, which subsequently cause oxidative stress, neuro-inflam-
mation, mitochondrial dysfunction, and apoptosis.3,4
Environmental and lifestyle factors such as stress, diet and
physical activity have been shown to affect cognition and can
also increase the risk of late onset AD (LOAD).5 Previous
studies suggested that a high fat/high cholesterol diet (HFD)
can modify the risk of LOAD.6 Experimental studies employing
mouse models of AD revealed that HFD affected amyloid path-
ology and cognitive function in adult mice. HFD also caused
profoundly disordered lipid metabolism and lipid composition
in the brain.1,7 The clinical drugs used for the treatment of AD
generally involve side effects. For example, administration of
bexarotene is usually accompanied by elevation of plasma tri-
glycerides. Therefore, it is necessary to explore functional
foods or supplements to prevent neurodegenerative disease.

This journal is © The Royal Society of Chemistry 2017 Food Funct.


Paper
Fish oil, an important source of n-3 long-chain polyun-
saturated fatty acids (n-3 LCPUFA) containing both eicosapen-
taenoic acid (EPA) and docosahexaenoic acid (DHA), has been
verified to benefit brain health.8 Clinical trials have demon-
strated that fish oil can reduce AD-associated pathology
through alleviating cognitive deficits and protecting against
synaptic degeneration.3 The bioactivities of DHA and EPA
depend on their chemical forms. DHA has been proven to be
essential to pre- and postnatal brain development, whereas
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
EPA appears to be more influential on behavior and mood.
Marine foods, such as fish roe and krill oil, are rich in n-3
LCPUFA-phospholipids (n-3 PUFA-PLs), in which DHA and
EPA are usually linked at the sn-2 position of the glycerol back-
bone; it is likely that the majority of marine n-3 LCPUFA-PLs
are found in a mixture. Notably, most n-3 LCPUFAs in fish oil
exist in the form of triacylglycerols (TG), while more than 40%
of n-3 PUFAs in krill oil consist of phospholipids (PL). Krill oil
was found to activate cognitive function more effectively than
fish oil in the elderly. Previous studies also reported that n-3
LCPUFA-PLs exhibit a more significant influence on cognitive
function than n-3 PUFA-TGs.2,9 Phospholipids enriched with
DHA (DHA-PL) were also found to improve Aβ-induced cogni-
tive deficiency in AD rat models; the effects of phospholipids
enriched with EPA (EPA-PL) were similar to those of
DHA-PL.6,10
It has been verified that n-3 LCPUFA-PLs can improve cog-
nitive deficiency in vitro and in vivo. However, most studies
have focused on their therapeutic effects; few studies have con-
centrated on disease prevention involving Aβ generation.
Hence, it is necessary to illuminate the different effects of
DHA-PC and EPA-PC on Aβ generation. In the present study,
CHO-APP/PS1 cells and high fat (HF) diet-fed SAMP8 mice (a
spontaneous Alzheimer’s disease mouse) were used to
compare the effects of DHA-PC and EPA-PC on AD.
Subsequently, the underlying mechanisms involving Aβ gene-
ration, oxidative stress, neuro-inflammation, apoptosis and
neurotrophic effects were also investigated.
2. Materials and methods
2.1 Preparation of DHA-PC and EPA-PC
EPA-PL was extracted from Cucumaria frondosa (Nanshan
Aquatic Market, Qingdao, China). DHA-PL was extracted from
squid roe (Boow Foods Co., Ltd, Weihai, China). Briefly, lipids
were extracted according to a modified method of Folch et al.11
Squid roe and Cucumaria frondosa were ground into powder
after vacuum freeze-drying. Then, the powder was extracted
with a 20-fold volume of chloroform–methanol solution (2 : 1,
v/v) overnight. The extracted solution was mixed with a one-
fourth volume of water after filtration. The mixture was placed
into a separating funnel and maintained for 24 h; then, the
chloroform layer containing the total lipids was collected and
evaporated to dryness under vacuum. Then, EPA-PL and
DHA-PL were separated from the total lipids by silica-gel
column chromatography using chloroform, acetone, chloro-
Food Funct.
View Article Online
Food & Function
form–methanol (9 : 1, v/v), chloroform–methanol (2 : 1, v/v)
and methanol sequentially as eluents. The chloroform–metha-
nol (2 : 1, v/v) eluent and methanol eluent were collected; then,
EPA-PL and DHA-PL were obtained after removal of the
organic solvents under vacuum. EPA-PC and DHA-PC were pur-
ified from EPA-PL and DHA-PL respectively by silica-gel
column chromatography.
The fatty acid composition of PL was determined using an
Agilent 6890 Gas Chromatograph with a flame-ionization
detector. The column was a HPINNOW-AX capillary column
(30 m × 0.32 mm × 0.25 m). The temperature of the detector
and injector were kept constant at 250 °C and 240 °C, respect-
ively, and the oven temperature was increased from 170 °C to
240 °C at 3 °C min−1 and maintained at 240 °C for 15 min.
Nitrogen was used as the carrier gas at a flow rate of 1.2 mL
min−1. The DHA-PC contained 32.2% DHA and 9.59% EPA,
and the EPA-PC contained 52.99% EPA and 0.67% DHA.
2.2 Cell Culture
Chinese hamster ovary cells stably transfected with APP751
and PS1 (M146L) (CHO-APP/PS1 cells) were a gift from the
College of Pharmacy (Ocean University of China). The cells
were grown in DMEM supplemented with 10% FBS (Gibco,
Grand Island, NY, USA), 200 mg mL−1 G418 (Solarbio Life
Science, Beijing), and 25 mg mL−1 puromycin (Solarbio Life
Science, Beijing) in a humidified atmosphere of 95% air and
5% CO2 at 37 °C. CHO-APP/PS1 cells after 3 to 10 passages
were used for further experiments. Before treatment, the cells
were seeded at an appropriate density on cell culture plates.
Once adhered, appropriate concentrations of DHA-PC and
EPA-PC were added to the plates, which were incubated for
48 h.
2.3 Measurement of cell viability
The cell viability was determined using the MTT assay.
CHO-APP/PS1 cells were plated at a density of 100 000 cells per
mL in 96-well plates. Following phospholipid treatment, the
medium was removed, and the cells were washed with PBS;
then, MTT (St Louis, MO, USA) dissolved in DMEM was added
to each well for an additional 4 h at 37 °C in a CO2 incubator.
The formazan was dissolved in 200 μL acidated dimethyl-
carbinol after removing the medium. The absorbance at
570 nm was measured using a microplate reader (Model 680,
Bio-Rad, Tokyo, Japan). Cell viability was expressed as a per-
centage of the control value.
2.4 Animals
Male SAMP8 mice, 6 months old, were purchased from
Nanjing Qingzilan Technology Co., Ltd. All the mice were
housed under a 12 h/12 h light/dark cycle at 22 °C with 60 ±
10% humidity. At 10 months of age, the SAMP8 mice were ran-
domly divided into four groups (8 animals per group): low fat
(LF) diet group, HF diet group, DHA-PC group and EPA-PC
group. The mice were fed with either a LF diet (OpenSource
diets #D12450), or a HF diet (OpenSource diets #D12492). The
DHA-PC and EPA-PC groups were fed with the HF diet contain-
This journal is © The Royal Society of Chemistry 2017
 View Article Online

Food & Function Paper

Table 1 Compositions of experimental diets (g kg−1) 2.6 Preparation of hippocampus and brains
All the mice were decapitated after completing the behavioral
LF HF DHA-PC EPA-PC
Ingredient group group group group studies. The brains were separated and divided into cortex,
hippocampi and white matter on ice. All the tissues were
Casein 140 140 140 140
Potato starch 617.7 430.7 430.7 430.7 frozen with liquid nitrogen and stored at −80 °C until use.
Sucrose 100 100 100 100
Corn oil 23.9 46 46 46 2.7 Determination of Aβ concentration by ELISA
Lard 19.1 184 174 174
Mineral mix 35 35 35 35 CHO-APP/PS1 cells were plated in six-well plates at a density of
Vitamin mix 10 10 10 10 200 000 cells per well. Following phospholipid treatment, the
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.

Cellulose 50 50 50
L-Cysteine 2.5 2.5 2.5
Choline bitartrate 1.8 1.8 1.8
DHA-PC n.d. n.d. 10
EPA-PC n.d. n.d. n.d.
n.d. = not detected.
ing 1% DHA-PC and 1% EPA-PC, respectively, for 2 months.
The compositions of the experimental diets are shown in
Table 1. The animal study protocol was approved by the
Animal Ethics Committee of the College of Food Science and
Engineering of the Ocean University of China. All the animals
were housed at the Laboratory Animal Facility at the Ocean
University of China. The research was conducted in accordance
with the Guide for the Care and Use of Laboratory Animals
(8th edition, Institute of Laboratory Animal Resources on Life
Sciences, National Research Council, National Academy of
Sciences, Washington DC).
2.5 Behavior test
Briefly, a circular stainless steel pool (130 cm in diameter and
50 cm in height) was divided into four quadrants which were
marked with a triangle, square, diamond, and circle, respect-
ively. The pool was filled with ink-stained water to distinguish
the mice from the background. The water temperature was
controlled at 21 °C to 23 °C. A circular black escape platform
(9 cm in diameter and 29 cm high) was located 1.5 cm beneath
the surface of the water in the center of one quadrant. The
mice were trained to find the platform with three trials on the
first day; then, their ability to find the hidden platform was
tested for six consecutive days. The time to find the platform
was recorded as latency. If the animal was unable to reach the
hidden platform within 60 s, the latency was recorded as 60
s. Regardless of whether the platform was found, the mouse
was placed on it for 15 s. The swim paths, distances, and
latencies taken to swim to the platform were monitored with a
video camera linked to a computer system. Probe tests were
performed on the seventh day to evaluate spatial memory
retention after the platform was removed. The mice were
placed in a position opposite the location of the platform and
allowed to swim for 60 s. The number of times the mice
crossed over the previous position of the platform and the
time spent in the target quadrant were recorded as measures
of spatial memory.
50
2.5 medium was recovered for quantitative determination of the
1.8 Aβ42 concentration. The cells were lysed through ultrasonic
n.d. treatment for 1 minute and centrifuged at 4500g for 10 min at
10
4 °C. The supernatant was collected for quantitative determi-
nation of the intracellular Aβ42 level. The protein concen-
trations were determined using a BCA protein assay kit
(Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).
The intracellular and extracellular Aβ42 levels of CHO-APP/PS1
cells were measured using ELISA kits.
The right hippocampus was homogenized in 10 volumes of
TBS ( pH 8.0) containing protease inhibitors (20 g ml−1 each
pepstatin A, aprotinin, phosphoramidon, and leupeptin,
0.5 mM PMSF, and 1 mM EGTA). Samples were sonicated
briefly (two times for 10 s) and centrifuged at 100 000g for
20 min at 4 °C. The soluble fraction (supernatant) was stored
for quantitative determination of the soluble Aβ40 and Aβ42
concentrations, whereas the TBS-insoluble pellet was first soni-
cated in 10 volumes of 2% SDS. The SDS-soluble fraction was
used for BACE1 detection. To analyze the insoluble Aβ level,
the SDS-insoluble pellet was dissolved and sonicated in 70%
formic acid. The extract was neutralized with 0.5 M tris con-
taining 30% acetonitrile and 5 M NaOH before loading on the
ELISA plate. The soluble/insoluble Aβ40 and Aβ42 contents in
the hippocampus were measured by ELISA kits. The concen-
tration of BACE1 in the hippocampus was measured using
ELISA kits (Wuhan USCN Business Co., Ltd, Wuhan, China)
according to the manufacturer’s instructions.
2.8 Measurement of oxidative stress parameters
The white matter was prepared as a 10% (w/v) tissue homogen-
ate in 0.9% saline solution. Then, the homogenate was centri-
fuged and the supernatant was collected. The protein concen-
trations were determined using a BCA protein assay kit. The
concentrations of nitric oxide (NO) and malonaldehyde (MDA)
and the activities of superoxide dismutase (SOD), inducible
nitric oxide synthase (NOS), glutathione peroxidase (GSH-PX),
glutathione (GSH) and total antioxidant capacity (T-AOC) were
detected with corresponding assay kits (Nanjing Jiancheng
Bioengineering Institute, Jiangsu, China).
2.9 Protein and RNA extraction
CHO-APP/PS1 cells were homogenized in RIPA lysis buffer con-
taining protease inhibitor to extract the protein. The total
protein and RNA of the left hippocampus were extracted using
a total-DNA-RNA-Protein Kit, following the appropriate operat-
ing instructions (Omega Bio-Tek, Inc. San Francisco CA, USA).

This journal is © The Royal Society of Chemistry 2017 Food Funct.


Paper
Table 2 Sequences of the primers used in quantitative RT-PCR
Gene Forward primer
APP GCCGTGGCATTCTTTTGGGGC
PS1 CATCATGATCAGTGTCATTGTTGT
BACE1 GGCGGGAGTGGTATTATGAAGTGA
GFAP GAAACCAACCTGAGGCTGG
IL-1β CTTCAGGCAGGCAGTATCACTCAT
Bax TGCAGAGGATGATTGCTGAC
Bcl-2 CGGGAGAACAGGGTATGATA
BDNF CGGGACGGTCACAGTCCTA
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
Synaptophysin CATTCAGGCTGCACCAAGTG
β-Actin GCAGATGTGGATCAGCAAGC
2.10 Real-time PCR assay
The concentration of total RNA was assessed using a
NanoDrop 2000 spectrophotometer (Thermo Scientific, USA).
The total RNA (2 μg) from each sample was reverse transcribed
to cDNA using random primers and Moloney murine leukemia
virus (MMLV) reverse transcriptase (Madison, WI). Selected
genes were amplified using SYBR Green I Master Mix (Roche
Applied Science, Mannheim, Germany) in an iQ5 real-time
detection system (Bio-Rad Laboratories, Hercules, CA, USA)
with 0.3 μM of both the forward and reverse primers. The PCR
conditions were as follows: 1 cycle of 95 °C for 10 min, 45
cycles of 95 °C for 15 s, 55 °C to 60 °C for 20 s and 72 °C for
30 s. The purities of the PCR products were assessed by melt
curve analysis. The primers were synthesized by Shanghai
Sangon Gene Company (Shanghai. China), and the sequences
are shown in Table 2. Relative gene expression was quantified
using the standard curve method. Results were expressed as
the relative values after normalization to β-actin RNA.
2.11 Western blot analysis
Protein concentration was determined by the BCA method.
Equal amounts of protein were separated on 5% to 12%
SDS-PAGE gels and transferred to poly (vinylidene fluoride)
membranes. The membranes were incubated with antibodies
against APP, PS1, BACE1, Bax, Bcl-2, Caspase 3, Caspase 9,
TNF-α, IL-1β, synaptophysin (SYN), growth associated protein-
43 (GAP-43) ( purchased from Abcam Inc.), and brain derived
neurotrophic factor (BDNF) ( purchased from Cell Signal
Technology Co.) overnight at 4 °C. After this, the membranes
were incubated with goat anti-rabbit IgG for 2 h at room tem-
perature, and the blots were detected with chemiluminescent
horseradish peroxidase substrate.
2.12 Statistical analysis
The data have normal distributions and are expressed as mean ±
standard deviation (SD). One-way analysis of variance
(ANOVA) followed by Duncan’s test were performed using SPSS
version 10.0 software (SPSS Institute, Inc., Chicago, IL, USA).
P < 0.01 and P < 0.05 were considered statistically significant.
The graphs were generated using Prism 5 software (Graph-Pad
Software, Inc., San Diego, CA, USA). Different letters indicate
significant differences between each group.
Food Funct.
View Article Online
Food & Function
Reverse primer
GTGGTCAGTCCTCGGTCGGC
TGCATTATACTTGGAATTTTTGGA
GAAGGATGGTGATGCGGAAGG
GGATCTCCTCCTCCAGCGA
TCTAATGGGAACGTCACACACCAG
GATCAGCTCGGGCACTTTAG
CCACCGAACTCAAAGAAGG
GGGATTACACTTGGTCTCGTAGAAATAC
TGGTAGTGCCCCCTTTAACG
GTCAAAGAAAGGGTGTAAAACG
3 Results
3.1 Effects of Phospholipids on cell viability and Aβ
generation in CHO-APP/PS1 Cells
The cell viabilities of DHA-PC and EPA-PC on CHO-APP/PS1
cells were determined by MTT assay, and the results are shown
as relative cell viability in reference to the control (equal to
100%). As shown in Fig. 1A, DHA-PC and EPA-PC with concen-
trations of 0 to 60 μg mL−1 had no detectable toxic effects on
the growth of CHO-APP/PS1 cells within 48 h; therefore, con-
centrations of 20 and 40 μg mL−1 were selected for further
experiments.
The effects of PL on extracellular and intracellular Aβ gene-
ration are shown in Fig. 1B and C. Both DHA-PC and EPA-PC
could significantly decrease the extracellular and intracellular
Aβ42 levels in a dose-dependent manner. There was no statisti-
cal difference between EPA-PC and DHA-PC in decreasing
extracellular Aβ42 concentrations with the same concentration.
Interestingly, EPA-PC at the concentration of 40 μg mL−1
exhibited a lower intracellular Aβ42 level than DHA-PC at the
same concentration, whereas no statistical difference was
observed between EPA-PC and DHA-PC at the concentration of
20 μg mL−1.
The western blot technique was used to study the possible
mechanisms involved in these effects, and the results are
shown in Fig. 1D–F. There was no significant difference in APP
protein level between the model group and the EPA-PC group,
and the APP protein level of the DHA-PC group significantly
increased compared with that of the model group. Notably,
pretreatment of DHA-PC and EPA-PC markedly decreased PS1
and BACE1 expression, and no statistical difference was
observed between the two groups.
3.2 Effects of DHA-PC and EPA-PC on cognitive deficiency in
behavioral tests
Spatial learning and memory tests were performed on the
mice using the Morris water maze, and the results are shown
in Fig. 2. In the training session, the SAMP8 mice fed with a
LF diet rapidly learned the location of the platform, whereas
the HF group had longer escape latency than the LF group.
Supplementation of DHA-PC and EPA-PC improved the learn-
ing performance of SAMP8 mice in the acquisition phase of
training (day 1 to 3 of training) and in the consolidation phase
This journal is © The Royal Society of Chemistry 2017
 View Article Online

Food & Function Paper

Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.

Fig. 1 (A) Effects of DHA-PC and EPA-PC on cell viability in CHO-APP/PS1 cells. Levels of (B) extracellular Aβ42 and (C) intracellular Aβ42 were
measured by ELISA. Representative western blots (D) and densitometry of APP (E), PS1 (F) and BACE1 (G). Data are presented as mean ± SD (n = 8);
different letters indicate significant differences between the groups.

Fig. 2 Effects of DHA-PC and EPA-PC on spatial learning and memory deficiency: (A) time needed to reach the hidden platform in the Morris maze.
The number of platform crossings (B) and the time spent in the target quadrant (C) were measured for analysis of spatial memory function. Data are
presented as mean ± SD (n = 8); *P < 0.05, **P < 0.01 were considered statistically significant. Different letters indicate significant differences
between the groups.

(day 4 to 5 of training) (Fig. 2A). Interestingly, DHA-PC pro-
vided a more significant therapeutic benefit than EPA-PC in
alleviating spatial deficits of SAMP8 mice.
A probe trial was carried out to evaluate the memory of
SAMP8 mice after completing the 6-day training. The results
showed that the HF diet could significantly decrease the
number of platform crossings and the time spent in the
target quadrant compared to the LH diet (Fig. 2B and C).
Interestingly, DHA-PC and EPA-PC could notably improve
the time spent in the target quadrant and the number of
platform crossings; there was no statistical difference
between these two groups.

This journal is © The Royal Society of Chemistry 2017 Food Funct.

 View Article Online

Paper Food & Function

3.3 Effects of DHA-PC and EPA-PC on Aβ generation
The effects of DHA/EPA-PC on the concentration of soluble/in-
soluble Aβ40 and Aβ42 in the hippocampus are shown in
Fig. 3. The HF diet significantly increased soluble and in-
soluble Aβ40 and Aβ42 levels compared with the LF diet.
Supplementation of DHA-PC and EPA-PC produced a signifi-
cant reduction of soluble and insoluble Aβ40 and Aβ42 levels;
there was no significant difference between DHA-PC and
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
Moreover, western blot analysis showed that DHA-PC was
superior to EPA-PC in decreasing the protein expression of
APP. Interestingly, EPA-PC exerted a more significant effect
than DHA-PC in decreasing BACE1 level.
3.4 Effects of DHA-PC and EPA-PC on oxidative stress in the
brain
Parameters of oxidative stress, such as SOD, MDA, NOS, NO,

EPA-PC in inhibiting insoluble Aβ40 generation. Notably,
DHA-PC was superior to EPA-PC in decreasing soluble Aβ40
and soluble/insoluble Aβ42 levels.
Aβ is a cleaved fragment of APP via BACE1 and γ-secretase.
Both the mRNA level and protein expression of APP and
BACE1 were measured, and the results are shown in Fig. 3E–I.
Compared with the LF group, the HF group had significantly
increased mRNA levels and protein expression of APP and
BACE1. Supplementation of DHA-PC and EPA-PC obviously
decreased the mRNA and protein levels of APP and BACE1.
GSH, GSH-PX and T-AOC, were detected; the results are shown
in Fig. 4. Compared with the LF group, the HF group had sig-
nificantly decreased SOD, GSH, GSH-PX and T-AOC activities,
increased levels of MDA and NO, and increased NOS activity.
Importantly, DHA-PC and EPA-PC treatment significantly
recovered the activities of SOD, GSH, GSH-PX and T-AOC.
DHA-PC and EPA-PC treatment also obviously decreased the
MDA concentration, NOS activity and NO level. No statistical
difference was observed between these two groups in regulat-
ing the parameters of oxidative stress.

Fig. 3 Effects of DHA-PC and EPA-PC on the regulation of Aβ accumulation. Levels of (A) soluble Aβ40, (B) insoluble Aβ40, (C) soluble Aβ42 and
(D) insoluble Aβ42 were measured by ELISA. Relative mRNA levels of APP (E) and BACE1 (F). Representative western blots (G) and densitometry of
APP (H). The level of BACE1 was assessed by ELISA (I). Data are presented as mean ± SD (n = 8); *P < 0.05, **P < 0.01 were considered statistically
significant. Different letters indicate significant differences between the groups.

Food Funct. This journal is © The Royal Society of Chemistry 2017

 View Article Online

Food & Function Paper

Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.

Fig. 4 Effects of DHA-PC and EPA-PC on SOD activity (A), MDA concentration (B), NOS activity (C), NO concentration (D), GHS activity (E), GSH-PX
(F), T-AOC activity (G) in mouse white matter. Data are expressed as mean ± SD (n = 8); *P < 0.05, **P < 0.01 were considered statistically significant.
Different letters indicate significant differences between the groups.

3.5 Effects of DHA-PC and EPA-PC on inflammatory
cytokines
RT-PCR analysis demonstrated that the mRNA levels of the
inflammatory markers GFAP and IL-1β were significantly elev-
ated in the HF group compared to the LF group.
Comparatively, the administration of DHA-PC and EPA-PC
resulted in a clear reduction in the mRNA levels of these
inflammatory markers (Fig. 5A and B). Further supporting this
data, western blot analysis demonstrated that the expression
levels of TNF-α and IL-1β in the HF group were obviously
increased (Fig. 5C–E) compared with those of the LF group.
Supplementation of DHA-PC and EPA-PC obviously decreased
the expressions of TNF-α and IL-1β. Interestingly, DHA-PC
exerted a more significant effect than EPA-PC in decreasing
the IL-1β level; there was no statistical difference between the
two groups in inhibiting the protein expression of TNF-α.
3.6 Effects of DHA-PC and EPA-PC on apoptosis in mouse
brain hippocampus
As shown in Fig. 6, the mRNA level of Bax was increased in the
HF group and markedly decreased in the DHA-PC and EPA-PC
groups, whereas no statistical difference was observed between

This journal is © The Royal Society of Chemistry 2017 Food Funct.

 View Article Online

Paper Food & Function

Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.

Fig. 5 Effects of DHA-PC and EPA-PC on inflammatory activity. (A) Relative mRNA levels of GFAP and IL-1β (B), western blot analysis of TNF-α and
IL-1β (C), protein expression of IL-1β (D) and TNF-α (E). Values are indicated as mean ± SD (n = 8); *P < 0.05, **P < 0.01 were considered statistically
significant. Different letters indicate significant differences between the groups.

Fig. 6 Effects of DHA-PC and EPA-PC on apoptotic genes and protein. (A) Bax mRNA level, (B) Bcl-2 mRNA level, and expression of Bcl-2, Bax,
Caspase 3 and Caspase 9 were measured by western blot (C). Relative protein expression of Bcl-2/Bax (D), Caspase 3 (E), Caspase 9 (F). *P < 0.05,
**P < 0.01 were considered statistically significant. Different letters indicate significant differences between the groups.

Food Funct. This journal is © The Royal Society of Chemistry 2017

 View Article Online

Food & Function Paper

the DHA-PC and EPA-PC groups. DHA-PC and EPA-PC
obviously up-regulated both the mRNA level and protein level
of Bcl-2, and DHA-PC exerted a more significant effect than
EPA-PC on increasing the Bcl-2 level. Western blot analysis
demonstrated the protein expression of crucial apoptosis
factors, including Bcl-2, Bax, Caspase 3 and Caspase 9 (Fig. 6).
The relative density of Bcl-2/Bax in the HF group significantly
decreased compared to that of the LF group (Fig. 6D). Dietary
supplementation of DHA-PC and EPA-PC significantly
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
exhibited a more significant improvement than DHA-PC in
suppressing the expression of Caspase 9.
3.7 Effects of DHA-PC and EPA-PC on neurotrophic factors
Neurotrophic factors are related to synaptic plasticity; thus,
BDNF, SYN and GAP-43 were investigated to illustrate the
benefits of DHA-PC and EPA-PC on synaptic transmission.
According to the results shown in Fig. 7, the HF diet significantly
decreased the mRNA levels of BDNF and SYN. There were no stat-

increased the Bcl-2/Bax ratio, and DHA-PC was superior to
EPA-PC. The results for Caspase 3 and Caspase 9 showed that
the HF diet apparently increased the expression levels of these
two pro-apoptosis factors compared to the LF diet. DHA-PC
and EPA-PC depressed the protein levels of Caspase 3 and
Caspase 9; no statistical difference was observed for the
decrease in expression of Caspase 3. Interestingly, EPA-PC
istical differences in BDNF and SYN levels between the EPA-PC
and HF groups. Interestingly, DHA-PC could significantly improve
the BDNF and synapse levels, suggesting that DHA-PC was
superior to EPA-PC in improving the BDNF and SYN levels.
Moreover, western blot analysis was used to further support the
above results. The results showed that dietary supplementation of
DHA-PC obviously increased the protein expressions of BDNF, SYN

Fig. 7 Effects of DHA-PC and EPA-PC on neurotrophic factors. Representative mRNA levels of BDNF (A) and SYN (B). The expression of BDNF, SYN
and GAP-43 were measured by western blot (C). Relative protein expression of BDNF (D), SYN (E), GAP-43 (F). Data are presented as mean ± SD (n = 8);
*P < 0.05 was considered statistically significant. Different letters indicate significant differences between the groups.

This journal is © The Royal Society of Chemistry 2017 Food Funct.


Paper
and GAP-43 compared with those of the HF group. However, no
statistical differences were observed between the HF group and the
LF group in BDNF, SYN and GAP-43 expression. Unfortunately,
EPA-PC significantly decreased these three neurotrophic factors.
4 Discussion
PLs have been reported to provide beneficial effects against
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
neurodegenerative disorders, including dementia, AD,
Parkinson’s disease and age-related cognitive decline.12
Marine foods, such as fish roe and krill, are rich in n-3
LCPUFA-PLs, in which DHA and EPA are usually linked at the
sn-2 position of the glycerol backbone. However, the beneficial
effects of n-3 LCPUFA on neural function have been largely
linked to the actions of DHA, an elongated/desaturated
product of EPA. This is likely due to brain lipid content,
wherein DHA, not EPA, constitutes the major PUFA brain lipid.
Accordingly, DHA constitutes 35% to 40% of total poly-
unsaturated fatty acids, and this fatty acid is mainly located
among the phospholipids forming the neuronal membranes
and the retina, whereas EPA, a precursor of DHA, constitutes a
relatively smaller percentage.13,14 A previous study verified that
DHA-PL can improve Aβ-induced cognitive deficiency in a rat
model of AD.15 In the present study, we found that both
DHA-PC and EPA-PC could inhibit Aβ generation and amelio-
rate memory and cognitive function.
Aβ deposition is a key factor implicated in neuronal
damage and cognitive dysfunction in AD.16 Aβ is formed by
the sequential proteolysis of APP. β-Secretase enzyme, widely
known as β-site amyloid precursor protein cleaving enzyme
1 (BACE1), firstly cleaves APP to yield a membrane-bound
C-terminal fragment called C99. A second enzyme named
γ secretase then cuts C99 to liberate Aβ. γ-Secretase is a mem-
brane-embedded, multicomponent proteolytic enzyme consist-
ing of four transmembrane proteins, namely presenilin
1 (PS1), nicastrin, Pen2, and Aph1.2,17 CHO-APP/PS1 cells are
widely used as an AD model in vitro.18 The results showed that
DHA-PC and EPA-PC could significantly decrease the intra-
cellular and extracellular Aβ42 concentrations through inhibit-
ing the functions of β-secretase and γ-secretase.
To further study the effects of DHA-PC and EPA-PC on AD
and investigate the underlying mechanisms, SAMP8 mice were
used to investigate the protective effects of DHA-PC and
EPA-PC. SAMP8 mice are a model of spontaneously accelerated
aging; they exhibit neuropathological abnormalities and cogni-
tive and behavioral alterations observed in AD patients, such
as deficits in learning and memory, oxidative stress, and Aβ
deposition.19 The Morris water maze results indicated that the
HF diet aggravated the cognitive deficiency of SAMP8 mice.
DHA-PC and EPA-PC treatments showed a shorter escape
latency, and DHA-PC exerted a more significant function,
which indicated that DHA-PC was superior to EPA-PC in ameli-
orating learning deficits. Moreover, DHA-PC and EPA-PC treat-
ment could increase the number of platform crossings and the
time spent in the target phase, suggesting that DHA-PC and
Food Funct.
View Article Online
Food & Function
EPA-PC can improve memory deficits. Our previous studies
proved that dietary supplementation of EPA-PLs for 12 weeks
prevented the impairment of learning and memory in
SAMP8 mice, and DHA-PC improved learning and memory in
Aβ-induced cognitive deficiency in an AD rat model, which is
consistent with our results.10,17,20
APP is cleaved by BACE1 and γ-secretases to produce Aβ40
and Aβ42. Aβ42 is more hydrophobic than Aβ40 and presents a
higher potential for aggregation.21 Aβ is produced as a
monomer; however, it readily aggregates to form multimeric
complexes. These complexes range from low molecular weight
dimers and trimers to high molecular weight protofibrils,
which are soluble Aβ. Fibrillary Aβ, known as amyloid plaques,
is insoluble Aβ.22 Therefore, we measured the soluble and in-
soluble Aβ40 and Aβ42 levels in the hippocampus. The results
showed that DHA-PC and EPA-PC clearly inhibited the gene-
ration of Aβ, and DHA-PC exerted more significant effects than
EPA-PC in decreasing soluble Aβ40, soluble Aβ42, and in-
soluble Aβ42. Next, we explored the possible mechanism
associated with Aβ generation. The results showed that
DHA-PC and EPA-PC obviously decreased both the mRNA and
protein levels of APP and BACE1. Notably, DHA-PC was
superior to EPA-PC in decreasing Aβ generation.
Recent studies have demonstrated that dietary DHA-PC and
EPA-PL can alleviate brain lipid peroxidation in Aβ-induced
cognitive deficiency of aged rats.7,10 Moreover, EPA-PL can
protect PC12 cells from oxidative stress.17 The present study
suggests that DHA-PC and EPA-PC can reverse the decrease of
SOD, T-AOC, GSH, GSH-PX activities and reduce MDA pro-
duction in white brain matter. These results indicate that
DHA-PC and EPA-PC can improve cognitive impairment and
inhibit the production of Aβ in the brain of SAMP8 mice by
preventing oxidative stress. Oxidative stress has been shown to
affect Aβ generation.18,23 Meanwhile, other researchers have
suggested that Aβ affects oxidative stress through neuronal
lipid peroxidation, protein oxidation, and DNA oxidation.
Soluble, aggregated Aβ is postulated to insert into neuronal
membranes and induce the formation of ROS and increased
neurotoxicity.24 A previous report suggested that n-3 LCPUFAs
are an agonist of PPARα, which plays a crucial role in main-
taining and restoring redox balance altered by oxidative stress
mechanisms. We speculate that DHA-PC and EPA-PC can
prevent oxidative stress via activating PPARα.25
Aβ production and deposition can trigger microglia and
astrocyte activation, leading to the production of pro-inflam-
matory cytokines and neurotoxic molecules such as TNF-α,
nitric oxide, IL-1β, and ROS, which produce toxic effects on
neural tissue.22,26 Moreover, inflammatory cytokines can
trigger the production of β-amyloid peptides.27 Previous
studies have demonstrated that DHA-PC and EPA-PL can
reduce the production of inflammatory factors.6,10 We investi-
gated the mRNA level of GFAP, a predominant marker of glial
activation. A detectable increase in GFAP mRNA level was
observed, indicating the activation of astrocytes in the brain of
SAMP8 mice fed with a high fat diet. We then examined the
levels of pro-inflammatory factors, including IL-1β and TNF-α,
This journal is © The Royal Society of Chemistry 2017

Food & Function
which can stimulate microglia and astrocyte activation. The
results showed that the HF diet significantly elevated the IL-1β
and TNF-α contents. DHA-PC and EPA-PC effectively reduced
the IL-1β and TNF-α levels, which suppressed neuro-inflam-
mation. These results suggest that DHA-PC and EPA-PC modu-
late the neuro-inflammation cascade. Importantly, we discov-
ered that DHA-PC has a more significant impact on decreasing
the IL-1β level than EPA-PC in the present results. Serhan et al.
reported that lipid mediators derived from DHA and EPA dis-
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
played potent anti-inflammatory and immunoregulatory
actions in vitro and in vivo in murine models of inflammatory
diseases.28 We believe that the anti-inflammatory functions of
DHA-PC and EPA-PC may partly depend on lipid mediators
derived from DHA and EPA.
Mitochondria-dependent apoptosis is known to be involved
in many pathological conditions, including Aβ-induced neuro-
toxicity. Bax, a member of the Bcl-2 family, can initiate apopto-
sis. Bcl-2 is identified as a negative regulator of apoptosis. The
ratio of Bcl-2/Bax is the key indicator of inhibition of mito-
chondria-dependent apoptosis.29 Caspase-9 and Caspase-3 are
the initiator and executioner, respectively. Our findings indi-
cated that DHA-PC and EPA-PC can significantly increase the
ratio of Bcl-2/Bax and inhibit the expression of Caspase 3 and
Caspase 9. DHA-PC has a more significant impact than
EPA-PC on improving the ratio of Bcl-2/Bax. Interestingly,
EPA-PC was superior to DHA-PC in decreasing the expression
of Caspase 9. We speculate that other pathways may be
involved in regulating Caspase 9. A previous study introduced
acidic noncaspase protease-like cathepsins as novel mediators
of apoptosis.30 Cathepsins may be involved in regulating the
expression of Caspase 9.
Many reports have verified that neurotrophins are involved
in neuronal survival, neurogenesis, differentiation and synap-
tic plasticity.31 Brain-derived neurotrophic factor (BDNF) is a
prototypic neurotrophin that regulates diverse developmental
events from the selection of neural progenitors to terminal
dendritic differentiation and connectivity of neurons.32 SYN,
the protein located at the presynaptic vesicle, is known to have
a vital effect on cognitive behavior.33 GAP-43 regulates the
growth state of axon terminals, and deficient expression of
GAP-43 results in weakened neuron regeneration ability after
damage.34 BDNF treatment has been proved to stimulate
protein expression of SYN and GAP-43. Increased BDNF
expression can alleviate damaged synaptogenesis of neurons
in neuronal diseases.35 DHA is the most abundant n-3 LCPUFA
in the central and peripheral nervous system; it plays an
important role in neurogenesis and synaptogenesis. The ben-
eficial effects of n-3 LCPUFAs on neural function have been
largely linked to the action of DHA, an elongated/desaturated
product of EPA.8 Our results showed that DHA-PC significantly
increased the protein levels of BDNF, SYN and GAP-43, which
demonstrates the neuroprotective effects of DHA-PC in synap-
tic plasticity. Also, DHA-PC may increase the expressions of
SYN and GAP-43 by stimulating BDNF expression.
In summary, our study demonstrated that both DHA-PC
and EPA-PC may have beneficial effects on AD. The behavior
This journal is © The Royal Society of Chemistry 2017
View Article Online
Paper
test results indicated that DHA-PC exerts better effects than
EPA-PC on escape latency. The mechanism study showed that
DHA-PC exhibited more significant effects than EPA-PC on
inhibiting the generation of soluble Aβ40/Aβ42 and the IL-1β
level, while promoting the expressions of BDNF, SYN, GAP-43
and the protein ratio of Bcl-2/Bax. Meanwhile, EPA-PC was
superior to DHA-PC in decreasing pro-apoptotic factor Caspase
9 and the inflammatory cytokine TNF-α. Therefore, DHA-PC
and EPA-PC may be applied as food supplements and/or func-
tional ingredients to relieve neurodegenerative disease.
Conflicts of interest
The authors declare that there are no conflicts of interest.
Acknowledgements
This work was supported by grants from the National Natural
Science Foundation of China (No. 31371757), the State Key
Program of National Natural Science of China (No. 31330060)
and the National Natural Science Foundation of China-
Shandong Joint Fund for Marine Science Research Centers
(U1606403).
References
1 A. A. Farooqui, T. Farooqui and L. A. Horrocks, Metabolism
and Functions of Bioactive Ether Lipids in the Brain,
Indian J. Hortic., 2008, 4698, 729–740.
2 N. J. Munn, E. Arnio, D. Liu, R. A. Zoeller and L. Liscum,
Deficiency in ethanolamine plasmalogen leads to altered
cholesterol transport, J. Lipid Res., 2003, 44, 182–192.
3 E. Kraffe, P. Soudant and Y. Marty, Fatty acids of serine,
ethanolamine, and choline plasmalogens in some marine
bivalves, Lipids, 2004, 39, 59–66.
4 A. Naud, R. Cabr, M. Jov, V. Ayala, H. Gonzalo, M. Portero-
Otn, I. Ferrer and R. Pamplona, Lipidomics of human
brain aging and Alzheimer’s disease pathology, Int. Rev.
Neurobiol., 2015, 122, 133–189.
5 A. A. Farooqui, Lipid mediators in the neural cell nucleus:
their metabolism, signaling, and association with neuro-
logical disorders, Neuroscientist, 2009, 15, 392–407.
6 A. M. Luoma, F. Kuo, O. Cakici, M. N. Crowther,
A. R. Denninger, R. L. Avila, P. Brites and D. A. Kirschner,
Plasmalogen phospholipids protect internodal myelin from
oxidative damage, Free Radicals Biol. Med., 2015, 84, 296–310.
7 M. Ifuku, T. Katafuchi, S. Mawatari, M. Noda, K. Miake,
M. Sugiyama and T. Fujino, Anti-inflammatory/anti-amyloi-
dogenic effects of plasmalogens in lipopolysaccharide-
induced neuroinflammation in adult mice,
J. Neuroinflammation, 2012, 9, 1–13.
8 F. Echeverra, R. Valenzuela, H. R. Catalina and
A. Valenzuela, Docosahexaenoic acid (DHA), a fundamental
Food Funct.

Paper
fatty acid for the brain: New dietary sources, Prostag.
Leukotr. Ess., 2017, 124, 1–10.
9 S. Hiratsuka, K. Koizumi, T. Ooba and H. Yokogoshi,
Effects of dietary docosahexaenoic acid connecting phos-
pholipids on the learning ability and fatty acid composition
of the brain, J. Nutr. Sci. Vitaminol., 2009, 55, 374–380.
10 P. L. Wood, A. Khan, R. Mankidy, T. Smith and
D. B. Goodenowe, Plasmalogen deficit: a new and testable
hypothesis for the etiology of Alzheimer’s disease, 2011.
Published on 06 December 2017. Downloaded by University of Reading on 03/01/2018 13:38:40.
11 J. Folch, M. Lees and G. H. Stanley, A Sample Method for
the Isolation and Purification of Total Lipids from Animal
Tissue, J. Biol. Chem., 1957, 226, 497–509.
12 D. Wang, L. Zhang, M. Wen, L. Du, X. Gao, C. Xue, J. Xu
and Y. Wang, Enhanced neuroprotective effect of DHA and
EPA-enriched phospholipids against 1-methyl-4-phenyl-
1,2,3,6-tetrahydropyridine (MPTP) induced oxidative stress
in mice brain, J. Funct. Foods, 2016, 25, 385–396.
13 A. F. Domenichiello, A. P. Kitson, C. T. Chen,
M. O. Trpanier, P. M. Stavro and R. P. Bazinet, The effect of
linoleic acid on the whole body synthesis rates of polyun-
saturated fatty acids from α-linolenic acid and linoleic acid
in free-living rats, J. Nutr. Biochem., 2016, 30, 167–176.
14 A. P. Kitson, A. H. Metherel, C. T. Chen,
A. F. Domenichiello, M. O. Trpanier, A. Berger and
R. P. Bazinet, Effect of dietary docosahexaenoic acid (DHA)
in phospholipids or triglycerides on brain DHA uptake and
accretion, J. Nutr. Biochem., 2016, 33, 91–102.
15 S. Yamashita, M. Hashimoto, A. M. Haque, K. Nakagawa,
M. Kinoshita, O. Shido and T. Miyazawa, Oral
Administration of Ethanolamine Glycerophospholipid
Containing a High Level of Plasmalogen Improves Memory
Impairment in Amyloid β-Infused Rats, Lipids, 2017, 1–11.
16 G. Bitan, M. D. Kirkitadze, A. Lomakin, S. S. Vollers,
G. B. Benedek and D. B. Teplow, Amyloid β-Protein (Aβ)
Assembly: Aβ40 and Aβ42 Oligomerize through Distinct
Pathways, Proc. Natl. Acad. Sci. U. S. A., 2003, 100, 330–335.
17 L. Shi, J. Chen, J. Yang, T. Pan, S. Zhang and Z. Wang,
MiR-21 protected human glioblastoma U87MG cells from
chemotherapeutic drug temozolomide induced apoptosis
by decreasing Bax/Bcl-2 ratio and caspase-3 activity, Brain
Res., 2010, 1352, 255–264.
18 F. G. De Felice, P. T. Velasco, M. P. Lambert, K. Viola,
S. J. Fernandez, S. T. Ferreira and W. L. Klein, Abeta oligo-
mers induce neuronal oxidative stress through an
N-methyl-D-aspartate receptor-dependent mechanism that
is blocked by the Alzheimer drug memantine, J. Biol.
Chem., 2007, 282, 11590–11601.
19 H. Park and M. M. Poo, Neurotrophin regulation of neural
circuit development and function, Nat. Rev. Neurosci., 2013,
14, 7–23.
20 L. O. Hanuš, D. O. Levitsky, I. S. Valery and M. Dembitsky,
Plasmalogens, fatty acids and alkyl glyceryl ethers of
marine and freshwater clams and mussels, Food Chem.,
2009, 116, 491–498.
21 R. Yan and R. Vassar, Targeting the β secretase BACE1 for
Alzheimer’s disease therapy, Lancet Neurol., 2014, 13, 319–329.
Food Funct.
View Article Online
Food & Function
22 L. Tapiaarancibia, E. Aliaga, M. Silhol and S. Arancibia,
New insights into brain BDNF function in normal aging
and Alzheimer disease, Brain Res. Rev., 2008, 59, 201–220.
23 W. Y. Wang, M. S. Tan, J. T. Yu and L. Tan, Role of pro-
inflammatory cytokines released from microglia in
Alzheimer’s disease, Ann. Transl. Med., 2015, 3, 136.
24 H. Misonou, M. Morishima-Kawashima and Y. Ihara,
Oxidative stress induces intracellular accumulation of
amyloid beta-protein (Abeta) in human neuroblastoma
cells, Biochemistry, 2000, 39, 6951–6959.
25 F. Echeverra, M. Ortiz, R. Valenzuela and L. A. Videla,
Long-chain polyunsaturated fatty acids regulation of
PPARs, signaling: Relationship to tissue development and
aging, Prostag. Leukotr. Ess., 2016, 114, 28–34.
26 S. Yamashita, A. Honjo, M. Aruga, K. Nakagawa and
T. Miyazawa, Preparation of marine plasmalogen and selec-
tive identification of molecular species by LC-MS/MS,
J. Oleo Sci., 2014, 63, 423–430.
27 T. T. Zhang, W. Li, G. Meng, P. Wang and W. Liao,
Strategies for transporting nanoparticles across the blood-
brain barrier, Biomater. Sci., 2016, 4, 219.
28 C. N. Serhan, J. Dalli, R. A. Colas, J. W. Winkler and
C. Nan, Protectins and Maresins: New Pro-Resolving
Families of Mediators in Acute Inflammation and
Resolution Bioactive Metabolome, Biochim. Biophys. Acta,
2015, 1851, 397.
29 L. Shi, J. Chen, J. Yang, T. Pan, S. Zhang and Z. Wang,
MiR-21 protected human glioblastoma U87MG cells from
chemotherapeutic drug temozolomide induced apoptosis
by decreasing Bax/Bcl-2 ratio and caspase-3 activity, Brain
Res., 2010, 1352, 255–264.
30 H. M, N. J, J. M, H. C, T. V, W.-M. S, W. M, S.-B. W, T. A,
H. A and S. t. S, Cathepsin D links TNF-induced acid sphin-
gomyelinase to Bid-mediated caspase-9 and -3 activation,
Cell Death Differ., 2004, 11, 550.
31 A. Hedengran, P. B. Szecsi, J. Dyerberg, W. S. Harris and
S. Stender, n-3 PUFA Esterified to Glycerol or as Ethyl
Esters Reduce Non-Fasting Plasma Triacylglycerol in
Subjects with Hypertriglyceridemia: A Randomized Trial,
Lipids, 2015, 50, 165.
32 P. Saravanan, N. C. Davidson, E. B. Schmidt and
P. C. Calder, Cardiovascular effects of marine omega-3 fatty
acids, Lancet, 2010, 376, 540.
33 K. Nagao, K. Nakamitsu, H. Ishida, K. Yoshinaga, T. Nagai,
H. Mizobe, K. Kojima, T. Yanagita, F. Beppu and N. Gotoh,
A comparison of the lipid-lowering effects of four different
n-3 highly unsaturated fatty acids in HepG2 cells, J. Oleo
Sci., 2014, 63, 979–985.
34 J. Kim, S. Lee, B. R. Choi, H. Yang, Y. Hwang, J. H. Park,
F. M. Laferla, J. S. Han, K. W. Lee and J. Kim, Sulforaphane
epigenetically enhances neuronal BDNF expression and
TrkB signaling pathwaysffig, Mol. Nutr. Food Res., 2016, 61,
1–13.
35 J. G. Robinson and N. J. Stone, Antiatherosclerotic and
antithrombotic effects of omega-3 fatty acids,
Am. J. Cardiol., 2006, 98, 39i.
This journal is © The Royal Society of Chemistry 2017