Kendriya Vidyalaya Kolkata Region

1st Pre Board (2020-21)

Class XII
Biology

Time: 3 hours M M:70

General Instructions:

(i) All questions are compulsory.

(ii) The question paper has four sections: Section A, Section B, Section C and
Section D. There are 33 questions in the question paper.

(iii) Section A has 14 questions of 1 mark each and 2 case based questions,
Section B has 9 questions of 2 marks each, Section C has 5 questions of 3
marks each and Section D has 3 questions of 5 marks each.

(iv)There is no overall choice. However, internal choice have been provided in

some questions. A student has to attempt only one of the alternatives in such
questions.

(v) Whenever necessary, neat and properly labelled diagram should be drawn.

Section A
Q Question Marks
No.
1 How many chromosomes do drones of honeybee possess? Name 1
the type of cell division involved in the production of sperms by
them.
2 Why organ transplant patients are given Cyclosporin A? Name the 1
source organism for this bioactive molecule.
3 Which part of human embryo gets attached to the endometrium 1
during implantation?
4 Name two physiological barriers that provide innate immunity. 1
5 Why hnRNA is required to undergo splicing? 1
6 What is perisperm? 1
7 What lead to the extinction of over 200 species of cichlid fish from 1
lake Victoria?
8 What were the two components of the first recombinant DNA 1
molecule constructed by Cohen and Boyer?
9 How does CAM pathway help desert plants to minimize water loss 1
through transpiration?
10 Which Bt toxin gene was incorporated into maize to protect it from 1
corn borer?
11 Assertion: Swiss cheese has large holes. 1
Reason: Saccharomyces cerevisiae produces CO2 during
fermentation.
a. Both assertion and reason are true and reason is the correct
explanation of assertion.
b. Both assertion and reason are true, but reason is not the correct
explanation of assertion.
c. Assertion is true but reason is false.
d. Both assertion and reason are false.

12 Assertion: Replication in one strand of DNA is continuous while 1

replication of the other strand is discontinuous.
Reason: DNA dependent DNA polymerase catalyze polymerization
only in one direction that is 5’ → 3’.
a. Both assertion and reason are true and reason is the correct
explanation of assertion.
b. Both assertion and reason are true, but reason is not the correct
explanation of assertion.
 c. Assertion is true but reason is false.
d. Both assertion and reason are false.

13 Assertion: The per cent cover or biomass is a more meaningful 1

measure of the population size than total number.
Reason: For certain ecological investigations, there is no need to
know the absolute population density.
a. Both assertion and reason are true and reason is the correct
explanation of assertion.
b. Both assertion and reason are true, but reason is not the correct
explanation of assertion.
c. Assertion is true but reason is false.
d. Both assertion and reason are false.

OR

Assertion: Small sized animals are rarely found in polar regions.

Reason: Small sized animals have larger surface area relative to
their volume and lose body heat very fast when it’s cold outside.
a. Both assertion and reason are true and reason is the correct
explanation of assertion.
b. Both assertion and reason are true, but reason is not the correct
explanation of assertion.
c. Assertion is true but reason is false.
d. Both assertion and reason are false.

14 Assertion: Turner’s syndrome is caused due to the presence of an 1

additional copy of X chromosome.
Reason: Failure of cytokinesis after telophase stage of cell division
results in in the gain or loss of a chromosome.
 a. Both assertion and reason are true and reason is the correct
explanation of assertion.
b. Both assertion and reason are true, but reason is not the correct
explanation of assertion.
c. Assertion is true but reason is false.
d. Both assertion and reason are false.

15 Read the following and answer any four questions from 15 (i) to 15 4
(v) given below.

Sacred groves of India

The existence of sacred groves in India most likely dates back to
an ancient pre-agrarian hunter-gathering era. Believing trees to be
the abode of gods, many communities set aside sanctified areas of
forest and established rules to ensure their protection. These rules
included prohibited the felling of trees, the collection of any material
from the forest floor, and the killing of animals. As a result of these
protective restrictions, preserved over countless years, sacred groves
are now important reservoirs of biodiversity and harbor many rare
species of plants and animals.
Sacred groves are often the last refuge for endemic and endangered
plant and animal species. They are storehouses of medicinal plants
and they contain wild relatives of crop species that can help to
improve cultivated varieties. Many sacred groves contain water
resources such as ponds and streams, and the vegetative mass that
covers the floor of a grove can absorb water during rainy seasons
and release it during times of drought. Trees also improve soil
stability, prevent topsoil erosion and provide irrigation for agriculture
in drier climates.
 In Karnataka these are most commonly
called devarakadus or devarkans. In Kerala, sacred groves are
called kavus and many are dedicated to snakes, which protect
agricultural crops by controlling insect and rodent populations.

The Bishnoi tribes manage sacred groves called orans in the arid
and desert regions of Rajasthan. Despite sparse vegetation and
limited water resources, the area reportedly supports a higher
density of human and animal populations than any other desert
region in the world. The group has a set of abiding laws including
ban on killing animals and on felling trees, especially the most
sacred khejadi tree, which has numerous life-sustaining properties.
Its leaves can be used for fodder, its branches for fuel and its fruit
for food. Khejadi trees stabilize sand dunes and they are said to
increase yields of crops that grow close by. The orans also provide
a protective habitat for the Indian gazelle and blackbuck.

I Sacred groves are called orans in

a) Kerala
b) Rajasthan
c) Karnataka
d) Maharashtra
ii Many Kavus protect
a) Gazelle
b) Snakes
c) Rodents
d) Blackbuck
iii Which one of the following activities are allowed in sacred groves?
a) Killing of animals
b) Felling of trees
 c) Worship of nature
d) Collection of materials from forest floor
iv Sacred groves can help to improve cultivated varieties of crop
because they
a) contain wild relatives of crop plants
b) contain medicinal plant
c) prevent top soil erosion
d) contain water resources like pond
v Which one of the following is not a life sustaining property of
Khejadi tree?
a) its fruits can be used as food
b) its leaves can be used as fodder
c) It stabilizes sand dunes
d) It is a source of timber

16 Read the following and answer any four questions from 16 (i) to 16 4
(v) given below.

Integrated Pest Management

Integrated pest management (IPM) is an ecologically-friendly
method to increase crop production and lower the damages
caused by pests. This is achieved by means of various
management methods which reduces the use of chemical
pesticides. The Food and Agriculture Organization of the United
Nations (FAO) emphasizes the healthy growth of crops with the
minimal usage of pesticides and encourages the use of biological
pest control methods
 IPM focuses on the long term application of ecologically-friendly
biological methods such as natural predators, resistant plant
strains, sterile male technique, and so on. The main reason that
the FAO has started implementing the IPM in several regions was
largely due to the hazardous impact of the certain chemicals
contained in commercial pesticides.
Other advantages of IPM are –
IPM reduces the risk of development of resistance to pesticides in
pests due to repeated use of chemical pesticides as the methods
adopted by IPM are natural.
IPM eradicates pests and not the non-target organisms and
therefore maintain the balance of the ecosystem.
The reduced usage of pesticides is more cost effective in the long
term.
Disadvantages of IPM include:
Individual farmers and all those involved in IPM have to be
educated about their options in the Application of IPM takes time
and has to be closely monitored, as the practice of IPM has many
different methods integrated in order to provide the most effective
pest control methods. Different pests have different control
methods, and it is necessary to monitor which methods are the
best for specific pests.
i The main objective of IPM is to –
a) minimize use of chemical pesticide
b) reduce cost of agricultural production
c) improve crop yield
d) help rich farmers
ii Which one of the following is not a method used under IPM?
a) sterile male technique
b) natural predators
 c) high yielding plants
d) resistant plant strains
iii Pests develop resistance to pesticide mainly due to
a) mishandling of pesticides by farmers
b) repeated exposure to chemical pesticides
c) faulty cultivation method
d) the organic nature of the chemicals
iv IPM maintains balance of ecosystem by
a) Killing non-target organisms
b) killing only target organism
c) killing both target and non -target organisms
d) allowing all organisms to thrive
v Application of IPM takes time because
a) It integrates different methods
b) Farmers need to be educated about the methods
c) It needs to be monitored to find out the most effective method for
a particular pest
d) All of the above
Section B
17 a) A person shows strong unusual hypersensitive reactions when 2
exposed to certain
substance present in air. Identify the condition. Name the cells
responsible for such
reactions.
b) What will provide quick relief in such condition?
18 Study the figures below and answer the questions that follow. 2
 a) Which of these two crosses will result in higher recombinant
types? Why?
b) How did Sturtevant use frequency of recombination in mapping
genes on chromosome?

19 How do ‘flocs’ and activated sludge help in sewage treatment? 2

20 a) What is spermiogenesis? In which part of testis does this process 2
occur?
b) Which pituitary hormone helps in this process?
21 2

a) Which restriction nuclease recognizes the above palindromic

nucleotide sequence?
Where will it cut the strands of DNA?
b) Name the resultant structure formed by such a cut. Why they are
so named?
OR
a) How is mature, functional insulin different from its pro-hormone?
b) How did Eli Lily overcome the challenge of getting insulin
assembled into its
mature form?
22 Following is the sequence of coding strand in a segment of DNA. 2
Write down the corresponding template strand and mRNA that can
be formed along with their polarity.
5’ TACGTACGTACGTACGTACG 3’
23 a) In 40% of angiosperms, pollen grains are shed at the three 2
celled stage. What are the three cells?
b) Why pollen grains lose viability when tapetum is malfunctioning?
24 What type of interaction exists between an orchid and its host 2
plant? How is this different from the interaction between Cuscuta
and its host plant?
OR
What does Gause’s competitive exclusion principle state?
Suggest a mechanism by which species competing for the same
resource can avoid elimination.
25 Although a prokaryotic cell has no defined nucleus, its DNA is not 2
scattered throughout the cell. Explain.
Section C
26 The graph given below is a representation of response of 3
organisms
response to abiotic factors in the environment.

a) What do ‘a’ and ‘b’ represent?

 b) How do these two categories of organisms differ from each other
with reference to homeostasis?
c) Which one of these two categories of organisms are more in
number and why?
OR
‘India has a greater biodiversity than Norway.” Do you agree with
this statement?
Give reason in support of your answer.

27 Given below is a schematic representation of lac operon. 3

a) Identify i and p.
b) Name the product formed by i. What is its function?
c) Name the inducer for this operon.
28 3

a) Identify ‘A’, ‘B’, ‘C’ and ‘D’ in the E.coli cloning vector shown in
the diagram.
b) Mention the role played by ‘C’ and ‘D’.
29 a) What is apomixis? 3
b) What is its significance?
c) When do farmers prefer to use apomictic seeds?
30 a) Name the causative agents of pneumonia and common cold. 3
 b) How can you distinguish between these two diseases on the
basis of symptoms?
Section D
31 a) Which nematode causes root knot of tobacco plant? 5
b) What strategy was adopted to prevent such infection?
c) Explain the role of Agrobacterium in the process. How does it
protect tobacco plant from nematode infestation?
OR

a) Name the process shown in the diagram. What is its use?

b) Name the process ‘a’.
c) What is ‘b’? Name the process it is involved in.
d) What is the significance of ‘c’?
32 Inheritance pattern of flower colour in garden pea plant and 5
snapdragon differs. Why is this difference observed? Explain
showing the crosses up to F2 generation.
OR
Answer the following questions based on Meselson and Stahl’s
experiment.
15 14
a) Why did they use NH4Cl and NH4Cl as sources of nitrogen in
the culture media for growing E.coli?
b) How did they distinguish between heavy DNA and normal DNA?
 c) What did they observe in samples taken at the end of 20 mins
and 40 mins?
What was the reason behind taking DNA samples at definite
time intervals?
d) What did they conclude from this experiment?

33 a) Draw a labelled diagram of a fertilized embryo sac of an 5

angiosperm.
b) Describe the stages in embryo development in dicot plant.
OR
a) Mention their source and the function of the following hormones
in human female.
hCG, LH, FSH, Relaxin
b) Describe the two principal procedures adopted for test tube baby
programme.
 KENDRIYA VIDYALAYA SANGATHAN REGIONAL OFFICE KOLKATA
PRE-BOARD EXAMINATION (SESSION: 2020-21)
CLASS XII SUBJECT: CHEMISTRY (CODE:043)
Time: 3 Hours MM: 70

General Instructions. Read the following instructions carefully.

(a) There are 33 questions in this question paper. All questions are compulsory.
(b) Section A: Q. No. 1 to 2 are case – based questions having four MCQs or Reason
Assertion type based on given passage each carrying 1 mark.
(c) Section A: Q. No. 3 to 16 are MCQs and Reason Assertion type questions carrying 1
mark each.
(d) Section B: Q. No. 17 to 25 are short answer questions and carry 2 mark each.
(e) Section C: Q. No. 26 to 30 are short answer questions carrying 3 mark each.
(f) Section D: Q. No. 31 to 33 are long answer questions carrying 5 marks each.
(g) There are no overall choice. However, internal choices have been provided.
(h) Use of calculators and log table is not permitted.

SECTION A (OBJECTIVE TYPE)

Q.1) Read the passage given below and answer the following questions:
Phenols are less acidic than carboxylic acid and phenols do not decompose NaHCO 3 evolving
CO2. However, some phenols which are stronger acids than carboxylic acids and decompose
NaHCO3. The presence of electron withdrawing groups in benzene ring increases the acid
strength while that of electron-donating group decreases the acid strength of phenols. The
relative acids strength of o-, m- and p- substituted phenols, however depends upon a
combination of inductive effect and resonance effect of the substitute.
(i) Increasing pKa values of o-, m-, and p- cresols is _____
(a) o < p < m (b) m < p < o (c) m < o < p (d) p < m < o.
(ii) Which of the following compounds decomposes NaHCO3 solutions?
(a) p- methoxy toluene (b) 2- nitrophenol (c) 2- methoxy phenol (d) 2,4,6 trinitrophenol.
OR
Mark the correct order of decreasing acid strength of the following compounds
 (a) V > IV > II > I > III (b) II > IV > I > III >V
(c) IV > V > III > II > I (d) V > IV > III > II > I
(iii) Choose the correct acidic strength of the following phenols:
(a) p-nitrophenol > p- chlorophenol > p- cresol > phenol.
(b) p-nitrophenol > p- cresol > p-chlorophenol > phenol.
(c) p-nitrophenol > p-chlorophenol > phenol > p-cresol.
(d) Phenol > p-nitrophenol > p-chlorophenol > p-cresol.
(iv) The major product obtained on interaction of phenol with sodium hydroxide solution and
carbon dioxide is
a) benzaldehyde (b) salicylaldehyde (c) salicylic acid (d) benzoic acid.
Q.2) Read the passage given below and answer the following reasoning-assertion type
questions:-
Broadly speaking, the various colloids are classified into three types namely multimolecular,
macromolecular and associated colloids. These may be lyophilic or lyophobic. Lyophilic sols
can be prepared directly whereas lyophobic sols can be prepared either by disintegration
methods or by aggregation methods. The particles in any colloidal sol carry a particular charge
and can be coagulated by adding suitable electrolytes. Lyophobic sols are generally less stable
but can be protected by lyophilic colloids called protective colloids. Colloidal sol is purified by
dialysis, electrodialysis, ultra-filtration, ultra-centrifugation etc.
In the following questions, a statement of assertion followed by a statement of reason is
given. Choose the correct answer out of the following choices.
(a) Assertion & reason both are correct statements and reason is correct explanation for
assertion.
(b) Assertion & reason both are correct statements and reason is NOT correct explanation
for assertion.
(c) Assertion is correct statement but reason is wrong statement.
(d) Assertion is wrong statement but reason is correct statement.

(i) Assertion: For adsorption ΔG, ΔS and ΔH all have negative values.
Reason: Adsorption is a spontaneous process accompanied by decrease in randomness.
(ii) Assertion: Fe3+ reacts can be used for coagulation of As2S3 sol.
Reason: Fe3+ reacts with As2S3 to give Fe2S3.
(iii) Assertion: On prolonged dialysis, a colloidal sol becomes unstable and starts
coagulating.
Reason: Colloidal particles start losing their charge on prolonged dialysis
(iv) Assertion: Colloidal solution show colligative properties.
Reason: Colloidal particles are larger in size.
OR
Assertion: Colloidal solutions do not show Brownian motion.
Reason: Brownian motion is responsible for stability of sols.
Following questions (No. 3 to 11 are multiple choice questions carrying 1 mark each.
Q.3) Which of the following oxidation state is common for all lanthanoids?
(a) +2 (b) +3 (c) +4 (d) +5
Q.4) Which of the following reactions of glucose can be explained only by its cyclic
structure?
(a) Glucose forms n hexane with HI on heating.
(b) Glucose is oxidised by nitric acid to gluconic acid.
(c) Glucose reacts with hydroxylamine to form an oxime.
(d) Pentaacetate of glucose does not react with hydroxyl amine.
Q.5) Three iron sheets have been coated separately with three metals (A, B, C) whose
standard electrode potentials are given below:-
Metal A B C Iron (Fe)
E°red - 0.46 V - 0.66 V - 0.22 V - 0.44 V
When coating is damaged, the rusting of iron will take place faster in
(a) Metal A (b) Metal B (c) Metal C (d) Unpredicted, as data is insufficient.
Q.6) The unit of ebullioscopic constant is
(a) K kg mol-1 (b) mol kg K-1 (c) kg mol-1 K-1 (d) K mol kg-1.
OR
An aqueous solution freezes at – 0.186°C (Kf = 1.86 & Kb = 0.512). What is the elevation in
boiling point?
(a) 0.0512 °C (b) 0.512 °C (c) 0.86 °C (d) 0.186 °C
Q.7) The IUPAC name of [Pt(NH3)2Cl(NO2)] is
(a) platinum(II)diaminechlorido nitrite (b) chloridonitrito-N-ammineplatinum (II)
(c) diamminechloridonitito-N-platinum (II) (d) diamminechloridonitrito-N-platinate (II).
OR
Which of the following complex has zero magnetic moment (spin only)?
(a) [Ni(NH3)6]Cl2 (b) Na3[FeF6] (c) [Cr(H2O)6]SO4 (d) K4[Fe(CN)6]
Q.8) The element showing most stable +8 oxidation state in its compound is
(a) Re (b) Os (c) Mn (d) Ru
Q.9) The correct arrangement of the following alkyl bromides (I) 1-bromopentane,
(II) 1-bromo-2-methylbutane, (III) 1-bromo-3-methylbutane, (IV) 2-bromo-2-methylbutane, in
order of decreasing SN2 reactivity is
(a) IV > II > III > I (b) I > IV > II > III (c) I > III > II > IV (d) II > III > IV > I
OR
Isopropyl alcohol is heated with a suspension of bleaching powder (CaOCl 2) in water. The
products are
(a) ethene and propyne (b) isopropyl chloride
(c) chloroform and calcium acetate (d) carbon tetrachloride
Q.10) The best reagent for converting 2-phenylpropanamide into I-phenylethanamine is ___
(a) excess H2/Pt (b) NaOH/Br2 (c) NaBH4/methanol (d) LiAlH4/ether.
Q.11) Which of the following statement is not true about the hexagonal close packing?
(a) The coordination number is 12.
(b) HCP crystals have 74% packing efficiency.
(c) Tetrahedral voids of the second layer are covered by the spheres of the third layer.
(d) In HCP arrangement, spheres of the fourth layer are exactly aligned with those of
the first layer.
In the following questions (Q. No.12 to 16) a statement of assertion followed by a statement
of reason is given. Choose the correct answer out of the following choices.
(a) Assertion & reason both are correct statements and reason is correct explanation for
assertion.
(b) Assertion & reason both are correct statements and reason is NOT correct explanation
for assertion.
(c) Assertion is correct statement but reason is wrong statement.
(d) Assertion is wrong statement but reason is correct statement.

Q.12) Assertion: When NaCl is added to water, a depression in freezing point is observed.
Reason: The lowering of vapour pressure of a solution causes depression in freezing
point.
Q.13) Assertion: Conc. HNO3 makes iron passive.
Reason: HNO3 forms a protective layer of ferric nitrate on the surface of iron.
Q.14) Assertion: Addition reaction of water to but-1-ene in acidic medium yields butan-1-ol.
Reason: Addition of water in acidic medium proceeds through the formation of stable
carbocation.
OR
Assertion: Phenols give o- and p- nitrophenol on nitration with conc. HNO3 & conc.
 H2SO4 mixture.
Reason: -OH group in phenol is ortho & para directing group.
Q.15) Assertion: Aromatic aldehydes and formaldehyde undergo Cannizzaro reaction.
Reason: Aromatic aldehydes are almost as reactive as formaldehyde.
Q.16) Assertion: All naturally occurring 𝛼 −aminoacids except glycine are optically active.
Reason: Most naturally occurring amino acids have L - configuration.

SECTION-B
The following questions, Q.No.17 to 25 are short answer type and carry 2 marks each.
Q.17) Give reasons: (1+1)
(a) Chlorobenzene does not undergo nucleophilic substitutions reactions readily. Why?
(b) Why is dry acetone is used in a reaction between R-X and NaI ? (X = Cl, Br)

OR
Convert: (a) Benzene to biphenyl
(b) But-1-ene to but-2-ene. (1+1)
Q.18) 200 cm3 of an aqueous solution of a protein contains 1.25 g of the protein. The
osmotic pressure of such a solution at 27℃ is found to be 2.5 x 10-3 bar. Calculate
the molar mass of the protein. (R = 0.083 L bar mol-1 K-1) (2)
Q.19) (a) Write the formula for the following coordination compound:
Iron(III) hexacyanoferrate(II).
(b) Draw the geometrical isomer of [CoCl2(en)2] which is optically active. (1+1)
OR
(a) Predict the geometrical structure and magnetic behaviour of [Fe(CN)6]4- and write
the electronic configuration of central metal ion in the above complex according to
crystal field theory. (1+1)
Q.20) A reaction is first order in A and second order in B.
(i) Write the differential rate equation for the reaction.
(ii) How is the rate affected when the concentrations of both A and B are doubled?
(1+1)
OR
Show that in a first order reaction, time required for completion of 99.9% is 10 times
of half-life (t½) of the reaction. (2)
Q.21) (a) Under which condition the reaction,
𝐻+
C12H22O11 + H2O → C6H12O6 (Glucose) + C6H12O6 (Fructose) becomes a pseudo first
 order reaction?
(b) Give an example of a zero order reaction. (1+1)
Q.22) Write the mechanism of reaction of HI with methoxyethane. (2)
Q.23) Write the balanced equation for the following:
(i) NaCl is heated with sulphuric acid in presence of MnO2.
(ii) Ammonium dichromate crystals are heated. (1+1)
Q.24) (i) Among the isomers of C5H12, identify the one that on photochemical chlorination
yields three isomeric monochlorides.
𝑀𝑔/𝑑𝑟𝑦 𝑒𝑡ℎ𝑒𝑟 𝐻2 𝑂
(ii) Identify A and B: CH3CH2-Br → A → B. (1+1)
Q.25) Analysis shows that nickel oxide has formula Ni0.98 O1.00. What fractions of the nickel
exist as Ni2+ and Ni3+ in the solid. (2)

SECTION – C
Q. No. 26 to 30 are Short Answer Type II carrying 3 mark each.
Q.26) Give reasons for the following:
(i) When Cu2+ ion is treated with KI solution, a white precipitate is formed.
(ii) The transition elements exhibit higher enthalpies of atomisation.
(iii) Cr2+ is a stronger reducing agent than Fe2+ in solution.
OR
Give example and suggest reasons for the following features of transition metal chemistry:
(i) The lowest oxide of transition metal is basic, the highest is amphoteric or acidic.
(ii) A transition metal exhibits highest oxidation state in oxides and fluorides.
(iii) The highest oxidation state is exhibited in oxo-anions of a metal. (1+1+1)
Q.27) (i) Give one chemical test to distinguish between the following pairs of compounds
(a) Aniline and benzyl amine (b) Ethylamine and dimethylamine.
(ii) Convert Aniline to p-bromoaniline. (2+1)
OR
(i) Give plausible explanation for each of the following:
(a) Aniline is sparingly soluble in water but completely soluble in aqueous HCl.
(b) Aromatic primary amines can not be prepared by Gabriel phthalimide synthesis.
(ii) Convert: Ethanoic acid into methylamine. (2+1)
Q.28) (a) What are the positions of tetrahedral voids in a face centred cubic crystal.
(b) An element crystallizes in a f.c.c. lattice with cell edge of 200 pm. Calculate its
density if 100 g of this element contains 2.0 x 1024 atoms. (1+2)
Q.29) (i) What is the effect of denaturation on the structure of proteins?
 (ii) Draw the structure of α–D–(+)–Glucopyranose.
(iii) The two strands in DNA are not identical but complementary. Explain. (1+1+1)
∆
Q.30) (i) Complete the equation: Pb(NO3)2 → ?

(ii) When HCl reacts with finely powered iron, it forms ferrous chloride and not ferric
chloride. Why?
(iii) How is the presence of SO2 detected ? (1+1+1)

SECTION D
Q. No. 31 to 33 are long answer type questions carrying 5 marks each.
Q.31) (i) Write the Nernst equation for a cell: Al(s) / Al3+ (M1) // Cu2+ (M2) / Cu(s) at 298K.
(ii) What is the effect of decrease in concentration on conductivity & molar conductivity
of an aqueous solution of weak electrolyte?
(iii) Why is alternating current used for measuring resistance of an electrolytic solution?
(2+2+1)
OR
(i) Limiting molar conductivities, Λm° for NaCl, HCl and NaAc are 126.0, 426.0 & 91.0
S cm2 mol-1 respectively. Calculate the Λm° for HAc.
(ii) Standard electrode potential of an electrochemical cell is 2.5 V at 298K. Calculate
the standard Gibbs energy for the cell: Mg(s) / Mg2+ // Ag+ / Ag(s). (1F = 96500C)
(iii) State Faraday’s second law of electrolysis. (2+2+1)
Q.32) (i) Draw the structure of XeF4 & write its shape.
(ii) Arrange (a) H2S, H2O, H2Te & H2Se in decreasing acidic strength.
(b) HF, HCl, HBr, & HI in decreasing boiling point.
(iii) A colourless gas ‘A’ when exposed to air turns into a reddish brown gas ‘B’ which
on cooling again turns colourless gas ‘C’. Identify A, B, C & write the chemical reactions
involved. (1+2+2)
OR
(i) Complete the equations:
𝑃𝑡−𝑅ℎ, 500𝐾, 9𝑏𝑎𝑟
(a) NH3 + O2 → ?
ℎ𝑒𝑎𝑡
(b) Cl2 + NaOH (Conc.) → ?
(ii) Give reason:
(a) Chlorine water is a bleaching agent.
(b) Ozone acts as an oxidising agent.
(c) Ammonia is a good complexing agent.
Q.33) (i) Draw structures of the following derivatives:
(a) The 2,4-dinitrophenlyhydrazone of benzaldehyde
(b) Cyclopropanone oxime
(ii) Give plausible explanation for each of the following:
(a) Formaldehyde is more reactive than acetone.
(b) Although phenoxide ion has more number of resonating structures than
carboxylate ion, carboxylic acid is more acidic than phenol.
(c) Benzaldehyde does not undergo Aldol condensation reaction. (2+3)
OR
(i) Convert in not more than two steps
(a) Benzaldehyde to benzophenone
(b) Ethanol to 3-hydroxybutanal
(ii) An organic compound ‘A’ with molecular formula C5H10O does not reduce Tollen’s
reagent but forms addition compound with NaHSO3 and give positive iodoform test. On
vigorous oxidation, it gives ethanoic acid and propanoic acid. Write the possible
structure of the compound ‘A’ with proper explanation. (2+3)
 KVS RO KOLKATA
CLASS XII PRE-BOARD (2020-21)
COMPUTER SCIENCE (083)
Maximum Marks : 70 Time Allowed : 3 hours

General Instructions:

1. Part-A has 2 sections:

a. Section –I (Attempt any 15 questions from Q1 to Q21) is short answer questions, to be
answered in one word or one line; consisting of 1 marks each.
b. Section – II has two case studies questions (Q22 & Q23). Each case study has 4 case-based
sub-parts; consisting 4 marks for each questions.
2. Part – B is Descriptive Paper.
3. Part – B has three sections
a. Section – I (Q 24 to Q33) is short answer questions of 2 marks each; all are compulsory.
b. Section – II (Q 34 to Q 37) is long answer questions of 3 marks each; all are compulsory.
c. Section – III (Q 38 to Q 40) is very long answer questions of 5 marks; all are compulsory.

All programming questions are to be answered using Python Language only

QNo. Part – A; Section - I Marks

allocated
Select the most appropriate options given for each question. Attempt any 15 questions
from question no 1 to 21.
Q1 Which of the following is not a keyword ? 1
(a) eval (b)assert (c) nonlocal (d) pass

Q2 If a is (1,2,3). What is the difference (if any) between a*3 and (a,a,a) ? 1

Q3 Which python libraries /modules need to be imported to use following functions ? 1

(i) float (ii) randint

Q4 Write the full form of CSV. 1

Q5 What would be the data type of variable data in following ststements ? 1

(a) data = f . readline ( )
(b) data = f . readlines ( )

Q6 What is the value of the following expression ? 1

21//4+6/3-2

Q7 Write a statement in Python to declare a dictionary whose keys are 1,2,3 and values are 1
Wednesday, Thursday, and Friday respectively.

Q8 Name the built-in mathematical function/method that is used to return an absolute value of 1
a number.

Q9 All computers connected to the internet and wanting to use it for sending/receiving data 1
must follow a common set of rules for communication called __________.

Q 10 Stealing someone else intellectual work and representing it as own, is called _________. 1
(a) Intellectual steal (b) Pluckism (c) Plagiarism (d) Pickism

Q 11 In SQL, name the clause that is used to display the column values after removing the 1
duplicate values from the result of the query.

Page 1 of 8
Q 12 What is wrong with the following statement? 1
SELECT * FROM Employee
WHERE grade = NULL;
Write the corrected form of above SQL statements.

Q 13 Consider the following query: 1

SELECT name, instructor_name, course ______ Identity
FROM INSTRUCTOR;
To display the field having course with a different heading “Identity”, which keyword must
be used here to rename the field name?
(a) from (b)rename (c) as (d) join

Q 14 Which of the following is DDL command? 1

(a) SELECT (b) ALTER (c) INSERT (d) UPDATE

Q 15 Name the transmission media best suitable for connecting to hilly areas. 1

Q 16 What is the output of the following ? 1

d = {0 : ‘a’, 1 : ‘b’, 2 : ‘c’}
for x in d . keys ( ):
print (d[x], end = ‘ ‘)

Q 17 What is the output produced by the following code snippet? 1

aLst = [1,2,3,4,5,6,7,8,9]
print (aLst [ : : 3])

Q 18 In SQL, write the query to display the description/structure of tables stored in a databases. 1

Q 19 Write the expanded form of UTP used in transmission media. 1

Q 20 Define Constraint in SQL. Name any two constraint of SQL. 1

Q 21 Which is a device that connects a Local Area Network (LAN) to another Local Area 1
Network that uses same protocol?
(a) Repeater (b) Hub (c) Switch (d) Bridge

Part – A ; Section – II

Both the Case study based questions are compulsory. Attempt any 4 sub parts from each question. Each
question carries 1 mark
Q 22 A sports store VarietySports is considering to maintain their inventory using SQL to store
the data. As a database administer, Supriya has decided that :
• Name of the database – VarietySports
• Name of the table – ITEMS
• The attribute of ITEMS are as follows:
ItemNo – VARCHAR of size 6
ItemName – character of size 20
Manufacturer – character of size 10
Quantity – numeric

Table : ITEMS

Page 2 of 8
 ItemNo ItemName Manufacturer Quantity
PC01 Personal Computer ABC 60
LC05 Laptop ABC 50
PC03 Personal Computer XYZ 150
PC06 Personal Computer COMP 110
LC03 Laptop PQR 180
MK01 Pen Drive LMN 220

(a) Identify the attribute best suitable to be declared as Primary Key. 1

(b) Write the degree and cardinality of the table ITEMS. 1
(c) Insert the following data into the attributes ItemNo, ItemName, and Quantity 1
respectively in the given table ITEMS.
ItemNo = CD02, ItemName = Compact Disc, and Quantity = 150
Write the SQL query for inserting the above values.
(d) Supriya wants to know itemwise quantity of each itemname,what query she should 1
write for that?
(e) Supriya wants to remove a row from table ITEMS having ItemNo LC03. Write 1
SQL command for it.
Q 23 Mitaali of class 12 is writing a program to create a CSV file “user.csv” which will contain
user name and password for some entries. She has written the following code. As a
programmer, help her to successfully execute the given task.

import _____________ # Line 1

def addCsvFile (UserName, PassWord): # to write / add data into the CSV file
f = open (‘user.csv’, ‘____________’) # Line 2
newFileWriter = csv . writer ( f )
newFileWriter . writerow ( [ UserName, PassWord])
f . close ( )

# csv file reading code

def readCsvFile ( ):
with open (‘user.csv’, ‘r’) as newFile:
newFileReader = csv . ____________ (newFile) #Line3
for row in newFileReader :
print (row[0], row [1])
newFile . _________________ # Line 4

addCsvFile (“Biplab”, “123@456”)

addCsvFile (“Arunima”, “aru@nima”)
addCsvFile (“Poonam”, myname@FRD”)
readCsvFile ( ) # Line 5

(a) Name the module she should import in Line 1. 1

(b) In which mode, Mitaali should open the file to add data into the file. 1
(c) Fill in the blank in Line 3 to read the data from a csv file. 1
(d) Fill in the balnk in Line 4 to close the file. 1
(e) Write the output of Line 5 1

Part – B ; Section - I
Q 24 Evaluate the following expressions: 2
(a) 3*1**3
Page 3 of 8
 (b) 12 < 15 and 34 > 14 and not 16 > 12
Q 25 In computer network, give the usage of following protocol: 2
(a) IMAP
(b) SMTP
OR
What do you mean by cookies?What are the different types of cookies?
Q 26 Expand the following terms :- 2
(a) POP (b) NFC (c) WiFi (d) FTP

Q 27 Explain the use of global keyword used in a function with the help of suitable example. 2

OR
What do you mean by default parameter in function?Give one example.
Q 28 Rewrite the following code in Python after removing all syntax error(s). Underline each 2
correction done by you in the given code:
30 = To
for k in range (0, To)
IF k % 4 = = 0:
print (k * 4)
ELSE :
print (k + 3)

Q 29 What are the possible output(s) executed from the following code? Also specify the 2
maximum and minimum values that can be assigned to variable PICK.

import random
PICK= random.randint (0, 3 )
CITY= [ “DELHI”, “MUMBAI”,”CHENNAI”, “KOLKATA” ]
for I in CITY:
for J in range ( 1, PICK ):
print (I, end = “ “)
print ( )

(i) DELHIDELHI
MUMBAIMUMBAI
CHENNAICHENNAI
KOLKATAKOLKATA

(ii) DELHI
DELHIMUMBAI
DELHIMUMBAICHENNAI

(iii) DELHI
MUMBAI
CHENNAI
KOLKATA

(iv) DELHI
MUMBAIMUMBAI
KOLKATAKOLKATAKOLKATA

Q 30 What do you understand by Altrnate key in a table ? Give suitable example of Alternate 2
key from a table containing same meaningful data .
Q 31 Find the output of the following code : 2

Page 4 of 8
 c=0
for x in range (5) :
for y in range (4) :
c+=1
print (c )
Q 32 Write the full form of DDL and DML . Write any two commands of DML in SQL. 2
Q 33 Find the output of the following Python program: 2
def output (str):
m = “”
for i in range (0, len(str)):
if str[i].isupper( ):
m = m + str[i].lower( )
elif str[i].islower ( ):
m = m + str[i].upper( )
else:
if i % 2 = = 0:
m = m + str[i – 1]
else:
m = m + “#”
print (m)

output (‘Pre@Board2020Exam’)

Part – B ; Section – II

Q 34 Write a function Maximum (Arr1, Arr2) in Python, which accept two list Arrr1 and Arr2 of 3
numbers and display the largest elements of both the list combined, along with its index in
its list.
Suppose two given list are:
Arr1 = [11, 45, 66, 23, 2, 87, 34]
Arr2 = [44, 56, 33, 25, 57, 60, 39, 11, 93, 45]
Output will be:
Largest value among both list is in Arr2 at index no 8 and the value is 93

Q 35 Write a function named “display” in python that open a file “DIARY.TXT” and display 3
those lines which start with the alphabet ‘p’ or ‘P’.
If the DIARY.TXT contents are as follows:
Hello how are you.
Picture is good.
Do your Pre-Board exam honestly.
printing of text is understandable.
Polish notation is the application of STACK.

The output of the function should be:

Picture is good.
printing of text is understandable.
Polish notation is the application of STACK.
OR

Write a function in Python that counts the number of “Me” or “My” words present in a
text file “STORY.TXT”.
If the “STORY.TXT” contents are as follows: “My first book was Me and My Family. It
gave me chance to be Known to the world. "
The output of the function should be: Count of Me/My in file: 4

Page 5 of 8
Q 36 Write the outputs of the SQL queries (i) to (iii) based on SENDER and RECIPIENT given 3
below:

Table : SENDER
SenderID SenderName SenderAddress SenderCity
ND01 R Jain 2, ABC Appts New Delhi
MU02 H Sinha 12, Newtown Mumbai
MU15 S Jha 27/A, Park Street Mumbai
ND50 T Prasad 122-K, SDA New Delhi

Table : RECIPIENT
RecID SenderID RecName RecAddress RecCity
KO05 ND01 R Bajpayee 5, Central Avenue Kolkata
ND08 MU02 S Mahajan 116, A Vihar New Delhi
MU19 ND01 H Singh 2A, Andheri East Mumbai
MU32 MU15 P K Swamy B5, C S Terminus Mumbai
ND48 ND50 S Tripathi 13, B1 D, Mayur Vihar New Delhi

(i). SELECT RecName, RecAddress FROM RECIPIENT

WHERE RecCity NOT IN (‘Mumbai’, ‘Kolkata’);
(ii) SELECT SenderCity, count (*) FROM SENDER GOUP BY (SenderCity);
(iii) SELECT A.SenderName, B.RecName FROM SENDER A, RECIPIENT B
WHERE A.SenderID = B.SenderID AND B.RecCity = ‘Mumbai’;

Q 37 Write a function in Python PUSH (Arr), where Arr is a list of numbers. From this list push 3
all the numbers divisible by 5 into a stack implemented by using a list. Display the stack if
it has at least one element, otherwise display appropriate error message.

OR

Write a function in Python POP(Arr), where Arr is a stack implemented by a list of

numbers. The function returns the value deleted from the stack.

Part-B; Section – III

Q 38 RAVYA consultants are setting up a secured network for their office campus at Faridabad 5
for their day to day office and web-based activities. They are planning to have connectivity
between 3 buildings and the head office situated in Kolkata. Answer the question (i) to (v)
after going through the building positions in the campus and other details, which is given
below:

FARIDABAD Campus
Head Office
Building “KOLKATA” Page 6 of 8
“RAVI”
 Building Building
“GANGA” “JAMUNA”

Distances between various buildings:

Building “RAVI” to Building “JAMUNA” 120 m
Building “RAVI” to Building “GANGA” 50 m
Building “GANGA” to Building “JAMUNA” 65 m
Faridabad Campus to Head Office 1460 KM

Numbers of Computers:
Building “RAVI” 25
Building “JAMUNA” 150
Building “GANGA” 51
HeadOffice 10
(i) Suggest the most suitable place (i.e block) to house the server of this
organization. Also give reason to justify your suggested location.
(ii) What type of network will be formed if all buildings are connected ?
(iii) Suggest the placement of the following devices with justification:
(a) Switch (b) Repeater
(iv) The organization is planning to provide a high speed link with its head office
situated in the KOLKATA using a wired connection. Which of the following
cables will be most suitable for this job?
(a) Optical Fibre (b) Co-axial Cable (c) Ethernet Cable

Q 39 Write SQL commands for the following queries (i) to (v) based on the relations TEACHER 5
and POSTING given below:

Table : TEACHER
T_ID NAME AGE DEPARTMENT DOJ SALARY GEDER
1 Jugal 34 Computer Sc 10/01/2017 12000 M
2 Sharmila 31 History 24/03/2008 20000 F
3 Sandeep 32 Mathematics 12/12/2016 30000 M
4 Sangeeta 35 History 01/07/2015 40000 F
5 Rakesh 42 Mathematics 05/09/2007 25000 M
6 Shyam 50 History 27/06/2008 30000 M
7 Shiv Om 44 Computer Sc 25/02/2017 21000 M
8 Shalakha 33 Mathematics 31/07/2018 20000 F

Table : POSTING
P_ID DEPARTMENT PLACE
1 History Agra
2 Mathematics Raipur
3 Computer Sc Delhi

(i) To display the name of male teachers of History department.

(ii) Increment the salary of the teacher Shiv Om by 5% of his salary.
(iii) To list the name of all teachers with their DOJ (date of joining) in ascending
Page 7 of 8
 order.
(iv) To display the name, age of teachers whose name second last character is ‘e’.
(v) To display name, bonus for each teacher where bonus is 10% of salary.

Q 40. A binary file “Book . dat” has structure [BookNo, Book_Name, Author, Price]. 5
(i) Write a user defined function MakeFile ( ) to input data for a record and add to
Book.dat.
(ii) Write a function Display (Author) in python which accepts the author name as
parameter and count and return number of books by the given author are stored
in the binary file “Book.dat”.

OR

A binary “EMPLOYEE.DAT” has structure (employee_id, Name, Salary). Write a

function Display( ) in python that would read content of the file “EMPLOYEE.DAT” and
display the details of those employees whose SALARY is above 30000. Also display total
number of employees having salary above 30000.

Page 8 of 8
 KENDRIYA VIDYALAYA SANGATHAN KOLKATA REGION

1stPre-Board

Class: XII Session: 2020-21

Subject : Mathematics

Time Allowed: 3 Hours Maximum Marks: 80

General Instructions:
1. This question paper contains two parts A and B.Each part is compulsory. Part A
carries 24 marks and Part B carries 56 marks
2. Part-A has Objective Type Questions and Part -B has Descriptive Type Questions
3. Both Part A and Part B have Choices.
Part-A:
1. It consists of two sections-I and II.
2. Section I comprises of 16 very short answer type questions.
3. Section II contains 2 case studies. Each case study comprises of 4 case-based questions.
Part-B:
1. It consists of three sections- III，IV and V.
2. Section III comprises of 10 questions of 2 marks each.
3. Section IV comprises of 7 questions of 3 marks each.
4. Section V comprises of 3 questions of 5 marks each.
Q PART A MARKS
SECTION I
1. If f(x)=27x3 and g(x)=x3 then find gof(x) . 1
OR
Let f:R→R be yhe function defined by f(x)=x3+5. Then find f-1(x).
2 State the reason why the Relation R = { ( a , b ) : a } on the set R of real numbers 1
is not Reflexive.
3 Show that the relation R in the set {1, 2, 3}given by R = 1
{(1, 2), (2, 1)} is symmetric but neither reflexive nor transitive.
OR
Let A = {1, 2, 3}, B = {4, 5, 6, 7} and let f = {(1, 4), (2,
5), (3, 6)} be a function from
A to B. Show that f is one-one.
4  3 − 2 x x + 1 1
5 If matrix   is a singular matrix then find the value of x
 2 4 
If A is a square matrix of order 3 such that |adj A| = 64, find |A|
OR
Given that A is a square matrix of order 3x3 and IAI=-4. Find Iadj AI

6 Let A= [aij] be a square matrix of order 3x3 and |A|=-7. Find the value of 1
a11A21+a12A22+a13A23, where Aij is the co factor of aij.
7 Evaluate  sin −1 (cos x) dx 1
OR
Evaluate  e (1 − cot x + cos ec x)dx
x 2

8 Find the area bounded by y= x3, the x-axis and the lines x=-1 and x=1 1
9 Determine order and degree(if defined) of differential equation 1

OR
Find what value of n is the following a homogeneous differential equation:
dy x3 − y n
= 2
dx x y − xy 2

10 Find unit vector in the direction of 𝑎⃗ + 𝑏⃗ where 𝑎⃗ = 2 ⏞𝑖 + 𝑗⃗ + 3 ⏞

𝑘 , 𝑏⃗ = ⏞𝑖 + 2 ⏞𝑗 − ⏞
𝑘 1

11 If aˆ = 2iˆ − 3 ˆj and bˆ = 3iˆ + 2 ˆj . Then find the angle between a and b. 1

12 If ( xˆ − aˆ ).( xˆ + aˆ ) = 10 , where â is a unit vector, then find x̂ 1

13 Find the vector whose initial and terminal points are (2,5,0) and (-3,7,4). 1
14 Convert given line into vector form 1
4− x y +3 z +2
= =
2 3 6

15 Compute P(A/B), if P(B)=0.5 and P(A∩ B)=0.32 . 1

16 Find the probability of obtaining an even prime number on each die, when a pair of 1
die is rolled.

Section II
Both the Case study based questions are compulsory. Attempt 4 sub- parts from
each question. Each question carries 1 mark

17

based on the above information answer the following

(i) The probability of selecting any one of the urn is

(a) 1 (b) 1/3 (c) 2⁄3 (d) ½

(ii) The probability of choosing a red ball and a white ball from urn 1 is
(a) 1/3 (b) ½ (c) 1/5 (d) 2/3
(iii) total probability of getting one white and one red ball is

(iv) Probability that these two balls are drawn from urn 1
(a) 55/148 (b) 65/118 (c) 33/118 (d) 36/118
(v) probability that these balls are not drawn from urn 3
(a) 15/59 (b) 44/59 (c) 17/59 (d) 27/59
18 Following is the pictorial description for a page. 1x4

The total area of the page is 150 cm2. The combined width of the margin at the top and
bottom is 3 cm and the side 2 cm.
Using the information given above, answer the following :
(i) The relation between x and y is given by
(a) (x-3)y =150
(b) xy =150
(c) x(y - 2) =150
(d) (x - 2)(y - 3) =150
(ii) The area of page where printing can be done, is given by
(a) xy
(b) (x +3)(y + 2)
(c) (x -3)(y - 2)
(d) (x -3)(y + 2)
(iii) The area of the printable region of the page, in terms of x, is
(a) 156+2x+ (450/x)
(b) 156-2x+ 3(150/x)
(c) 156-2x-(15/ 3x)
(d) 156-2x-(450/x)
(iv) For what value of ‘x’, the printable area of the page is maximum?
(a) 15cm
(b) 10cm
(c) 12 cm
(d) 20 cm

(v) What should be dimension of the page so that it has maximum area to be printed?
(a) Length =20 cm, width = 7.5 cm
(b) Length =15 cm, width =10cm
(c) Length =12 cm, width = 12.5cm
(d) Length =150 cm, width = 1cm
19 2
1 1 2
Prove that tan −1 + tan −1 = tan −1
7 13 9

20 5 2 3 6  2
Find Matrix X and Y , if X + Y =   and X − Y =  
0 9  0 −1
OR
 2 −3  −1
Given A =   , compute A
 −4 7 
21 Find the value of a and b such that the function defined by 2
F(x) = 5, if x  2
ax + b , if 2 < x <10
21, if x  10
If F(x) is continuous function.
22 Find the equation of the normal line to the curve y(x-2)(x-3)-x+7 = 0, at the point where it 2
meets the x-axis.
23 2
Find:-

OR
Find

24 Find the area of the region bounded by the curve y2= x and the lines x = 1, x = 4 and the x- 2
axis.
25 Solve the following differential equation 2

dy
x5 = − y5
dx

26 Find the position vector of the mid – point of the vector joining the points P ( 2 , 3 , 4 ) and 2
Q ( 4 , 1 , -2 ).

27 If a line makes angles 𝛼, 𝛽, 𝛾 with coordinate axes then prove that: - 2

𝑠𝑖𝑛2 𝛼 + 𝑠𝑖𝑛2 𝛽 + 𝑠𝑖𝑛2 𝛾 = 2
28 The probabilities of two students A and B coming to the school in time 2
3 5
are and respectively. Assuming that the event , “A coming in time” and “B coming in
7 7
time” are independent, find the probability of only one of them coming to the school in time.
OR
7 9 4 −
Given P(E) = , P(F) = , P (E  F) = . Evaluate P(E/F), and P( E / F )
13 13 13

Section IV
29 Show that the relation R defined in the set A of all triangles as R = {(T1, T2): T1 is 3
similar to T2}, is equivalence relation. Consider three right angle triangles T1 with sides
3, 4, 5,T2 with sides 5, 12, 13 and T3 with sides 6, 8, 10.
 Which triangles among T1, T2 and T3 are related?
30 dy 3
Find x y + y x + x x = a a , find
dx
31 Find the intervals in which the function f(x) = 2x3 – 15x2 + 36x + 1 is strictly increasing 3
or decreasing.
−1
OR
If y = em cos x , prove that (1 − x 2 ) y ''− xy ' = m2 y
32  3
Find the slope of the normal to the curve x = 1−a sin θ, y = b cos2θ at  =
2
33 3
Find:-

34 Find the area of the region bounded by the parabola 𝑦 = 1 + |𝑥 + 1|, 𝑥 = −2, 𝑥 = 3, 𝑦 = 0 3

OR
Find the area of the region bounded by y2= 9x, x = 2, x = 4 and the x-axis in the first
quadrant.

35 Find the general solution of the following differential equation:- 3

( x − y )dx + 2 xydy = 0
2 2

Section – V
36 Solve the following system of equations by matrix method- 5
3x – 2y + 3z =8
2x + y – z = 1
4x – 3y + 2z =4
OR
Using matrix method solve the following system of equations:
1 1 1 2 1 3 1 1 1
− + = 4; + − = 0; + + = 2; x  0, y  0, z  0
x y z x y z x y z

37 Find the shortest distance between the lines whose vector equations are 5
r = (1 − 2t )iˆ + (1 − t ) ˆj + (t )kˆ and
r = (2 + 3s )iˆ + (1 − 5s ) ˆj + (2s − 1)kˆ
OR
Find the coordinates of the foot of the perpendicular and the perpendicular distance of the
point P(3,2,1) from the plane 2x-y+z+1=0. Also find the image of the point in the plane.
38 Reshma wishes to mix two types of food P and Q in such a way that the vitamin contents 5
of the mixture contain at least 8units of vitamin A and 11 units of vitamin B. Food P costs
Rs 60/kg and Food Q costs Rs80/kg .Food P contains3 units /kg of Vitamin A and
5units/kg of vitamin B while food Q contains 4 units /kg of vitamin A and 2 units /kg of
vitamin B. Determine the minimum cost of the mixture
OR
Maximise Z = 3x + 2y Subject to
x+2y ≤10, 3x+y ≤15, x,y≥ 0
 KENDRIYA VIDYALAYA SANGATHAN
REGIONAL OFFICE KOLKATA
SESSION 2020-21
PRE BOARD-I
SUBJECT- PHYSICS
CLASS XII (2020-21) (THEORY)
Time: 3 hrs. Max Marks: 70
General Instructions:
(1) All questions are compulsory. There are 33 questions in all.
(2) This question paper has five sections: Section A, Section B, Section C, Section D and
Section E.
(3) Section A contains ten very short answer questions and four assertion reasoning
MCQs of 1 mark each, Section B has two case based questions of 4 marks each, Section
C contains nine short answer questions of 2 marks each, Section D contains five short
answer questions of 3 marks each and Section E contains three long answer questions of
5 marks each.
(4) There is no overall choice. However internal choice is provided. You have to attempt
only one of the choices in such questions.
(5) Use of calculators is not permitted.
(6) You may use the following values of physical constants wherever
c = 3 × 108ms−1, h = 6.6 × 10−34 Js
e = 1.6 × 10−19 C, μ0 = 4π × 10−7 T m A−1,
Mass of neutron mn = 1.6 ×10−27 kg,
Boltzmann's constant k = 1.38 × 10−23 J K−1,
Avogadro's number NA = 6.023 × 1023 / mole

Sr. Marks
No.
Section – A
All questions are compulsory. In case of internal choices, attempt any
one of them.

1 Name the physical quantity having unit Tm2. 1

2 Name the electromagnetic wave used in purification of water. 1

OR

Give the ratio of velocity of the two light waves of wavelengths 4x10-7m and
7x10-7m travelling in vacuum.

3 A proton with charge +e and mass m travels at a speed v in a plane 1

perpendicular to a magnetic field of magnitude B. The proton follows a
circular path of radius R. In a time ,t ,the proton travels half way around the
circle. What is the amount of work done by the magnetic field?

Page 1of 10
4 A solenoid with N loops of wire tightly wrapped around an iron-core is carrying 1
an electric current I. If the current through this solenoid is increased to double,
then what change would you expect in inductance L of the solenoid.
OR

An alternating voltage of a source is given by V=100sin314t. What is the r.m.s

value of Voltage and frequency of source?

5 In Bohr’s theory of model of a Hydrogen atom, name the physical quantity which
equals to an integral multiple of h/2π? 1

6 Blue light can eject electrons from a photo-sensitive surface while orange light 1
cannot. Will violet and red light eject electrons from the same surface?

7 Name the phenomenon by which the energy is 1

produced in stars.

OR
Why is neutron very effective as a bombarding particle in a nuclear reaction?

8 How does the electric field in depletion region of a p-n junction vary if doping
concentration is increased? 1

OR

In a full wave rectification, what is the output frequency if input frequency is 50

Hz.

9 Give the ratio of the number of holes and number of conduction electrons in an 1
intrinsic semiconductor.

10 Which specially fabricated pn junction diode is used for converting electrical 1

energy in to light energy?

For question numbers 11,12,13 and 14, two statements are given-one
labelled Assertion (A) and the other labelled Reason (R). Select the correct
answer to these questions from the codes (a), (b), (c) and (d) as given
below.

a) Both A and R are true and R is the correct explanation of A

b) Both A and R are true but R is NOT the correct explanation of A
c) A is true but R is false
d) A is false and R is also false

Page 2of 10
11 Assertion(A): 1
In a uniform electric field, a dipole will have only rotational motion.
Reason(R):
In a uniform electric field, a dipole experiences no net force but only
torque.

12 Assertion(A): 1
Electric field is always normal to equipotential surfaces and along the
direction of decreasing order of potential
Reason(R):
Negative gradient of electric potential is electric field.

13 Assertion (A): 1
A convex lens can form real and virtual images both.
Reason (R):
Depending on the position of object from the lens.

14 Assertion(A): 1
Nature of lens can be changed by placing the lens in a medium of
refractive index more than that of the lens.
Reason (R):
Focal length of a lens depends on refractive index of medium in which it
will be immersed

Section – B
Questions 15 and 16 are Case Study based questions and are
compulsory. Attempt any 4 sub parts from each question. Each
question carries 1 mark.

15 Faraday Cage: 4

A Faraday cage or Faraday shield is an enclosure made of a conducting

material. The fields within a conductor cancel out with any external fields,
so the electric field within the enclosure is zero. These Faraday cages act
as big hollow conductors you can put things into shield them from
electrical fields. Any electrical shocks the cage receives ,pass harmlessly
around the outside of the cage.

Page 3of 10
1. Which of the following material can be used to make a Faraday
cage?

a) Plastic
b) Glass
c) Any conducting material
d) Wood

2. Example of a real-world Faraday cage is

a) train
b) plastic box
c) lightning rod
d) metal rod

3. What is the electrical force inside a Faraday cage when it is struck by

lightning?
a) The same as the lightning
b) Half that of the lightning
c) Zero
d) A quarter of the lightning

4. An isolated point charge +2q is placed inside the Faraday cage. Its
surface must have charge equal to-
a) Zero
b) +q
c) –q
d) +2q

5.A point charge of 2C is placed at centre of Faraday cage in the shape of

cube with surface of 9 cm edge. The number of electric field lines
passing through the cube normally will be-

a) 1.9105 Nm2/C entering the surface

b) 1.9105 Nm2/C leaving the surface
c) 2.0105 Nm2/C leaving the surface
d) 2.0105 Nm2/C entering the surface

Page 4of 10
16 Optical fibres: 4
Optical fibres are fabricated with high quality composite glass/quartz fibres
which are used for the transmission of optical signal. Each fibre consists
of a core and cladding. The refractive index of the material of the core is
higher than that of the cladding. As there is difference in the refractive
index of core and denser; core acts as a denser medium and cladding
act as a rarer medium.

(1) The function of core and cladding in optical fiber.

(a)Core behaves as denser medium and cladding behaves as a rarer
medium
(b) Core behave as rarer medium and cladding behave as a denser
medium
(c) both have same refractive index
(d) none of these
(2) On which principle optical fibre works?
(a)Refraction of light
(b) Interference
(c) Diffraction
(d) Total internal reflection
(3) Write the use of optical Fibre.
(a)Transmission of optical signal
(b) transmission of electrical signal
(c) Use to store electrical energy
(d) all of the above
(4) How does the refractive index vary in graded index fibre
(a)Tangentially
(b) radially
(c) Longitudinally
(d) Transversely
(5) The widest use of optical fibre is in
(a) Fibre optic internet
(b) medical Science
(c) M.R.I
(d) electrical energy generation

Page 5of 10
 Section – C
All questions are compulsory. In case of internal choices, attempt
anyone.

17 A straight wire of mass 200 g and length 1.5 m carries a current of 2 A. It is 2

suspended in midair by a uniform horizontal magnetic field. What is the
magnitude of the field?

18 Draw the graph showing intensity distribution of fringes with phase 2

difference or path difference formed due to young’s double slit
experiment.

OR

What should be the width of each slit to obtain n maxima of double slit
pattern within the central maxima of single slit pattern?
19 A parallel plate capacitor is charged toa potential difference, V by DC 2
source. The capacitor is then disconnected from the source. If the distance
between the plates is doubled state with reason how the following will
change?
(i) Electric field between the plates.
(ii) Capacitance
OR

Establish the relation between electric field and electric potential at a

point.
Draw the equipotential surface for an electric field increasing
continuously along +Z direction.
20 With the help of a diagram, show the biasing of a LED. Give its two 2
advantages over conventional incandescent lamp.

Page 6of 10
21 Two identical loops, one of copper and the other of aluminum, are rotated 2
with the same angular speed in the same magnetic field. Compare (i) the
induced emf and (ii) the current produced in the two coils. Justify your
answer.

22 2
In a single-slit diffraction experiment, the width of the slit is made double the
original width. How does this affect the size and intensity of the central
diffraction band?

23 Draw the energy band diagram when intrinsic semiconductor(Si) is doped 2

with impurity atoms of aluminum. Name the extrinsic semiconductor so
obtained and majority charge carriers in it.

24 Define the terms magnetic inclination and horizontal component of earth’s 2

magnetic field at a place. Establish the relationship between the two with
help of a diagram.
OR

Vertical component of earth’s magnetic field at a place is √3 times the

horizontal component. What is the value of dip at that place?

25 A convex lens of focal length 25 cm is placed coaxially in contact with a 2

concave lens of focal length 20 cm. Determine the power of the combination.
Will the system be converging or diverging?

Section -D
All questions are compulsory. In case of internal choices, attempt
anyone.

26 (a) What is the direction of induced currents in metal rings 1 and 2 seen 3
from the top when current I in the wire is increasing steadily?

Page 7of 10
 (b) In a series LCR circuit, the voltage across an inductor, a capacitor and a
resistor are 30volt, 30 volt and 60 volt respectively. What is the phase
difference between the applied voltage and current in the circuit?

27 In the potentiometer circuit shown, the null point is at X. State with reason, where 3
the balance point will be shifted when

(a) Resistance R is increased, keeping all other parameters unchanged;

(b) Resistance S is increased, keeping R constant.

(c)Why is a potentiometer preferred over a voltmeter for measuring the emf

of a cell?

OR

A storage battery is of emf 18V and internal resistance 1.5 ohm is being
charged by d.c supply of 120 V using a resistor of 15.5 ohm

a) Draw the circuit diagram.

b) Calculate the potential difference across the battery.
c) What is the purpose of having series resistance in this circuit?

Page 8of 10
 (a) An electron and an alpha particle have same kinetic energy. Which of these 3
28 particles has the shortest de- Broglie wave length?
(b) Draw a plot showing the variation of photoelectric current with collector plate
potential for two different frequencies, v 1>v 2, of incident radiation having the
same intensity. In which case will the stopping potential be higher?

OR

State the main implications of observations obtained from various photoelectric

experiments. Can these implications be explained by wave nature of light?
Justify your answer.

Given the value of the ground state energy of hydrogen atom as –13·6 eV, find
29 out its kinetic and potential energy in the ground and second excited states. Also 3
find its total energy in 2nd excited state.

Draw a plot of potential energy of a pair of nucleons as a function of their

separations. Mark the regions where the nuclear force is 3
30
(i) attractive and (ii) repulsive.

Write any two characteristic features of nuclear forces

Page 9of 10
 Section – E
All questions are compulsory. In case of internal choices, attempt anyone.

31 (a) State Gauss’ theorem. Using it to obtain an expression for electric field due to 5
a uniformly charged wire ofinfinite length.

(b)S1 and S2are two concentric spheres enclosing charges Q and 2Q respectively
as shown in fig.
(i) What is the ratio of the electric flux through S1 and S2 ?
(ii) How will the electric flux through the sphere S1change,
if a medium of dielectric constant k is introduced in the space
Inside S1 in place of air?

S2 2Q
S1
Q

OR

a) Define an ideal electric dipole. Give an example.

b) Derive an expression for the torque experienced by an electric dipole
in a uniform electric field. What is net force acting on this dipole.
c) An electric dipole of length 2cm is placed with its axis making an angle
of 600 with respect to uniform electric field of105N/C.
If it experiences a torque of 8√3 Nm, calculate the (i) magnitude of charge on the
dipole, and its potential energy.

Page 10of 10
 You are given three circuit elements X, Y and Z. When the element X is 5
32 connected across an a.c. source of a given voltage, the current and the
voltage are in the same phase. When the Element Y is connected in series
with X across the source, voltage is ahead of the current in phase by π/4. But
the current is ahead of the voltage in phase by π/4 when Z is connected in
series with X across the source. Identify the circuit elements X, Y and Z.
When all the three elements are connected in series across the same
source, determine the impedance of the circuit by using phasor diagram. Plot
a graph of the current versus the frequency of the applied source.

OR
Draw a schematic diagram of a step-up transformer. Explain its working
principle. Deduce the expression for the secondary to primary voltage in
terms of the number of turns in the two coils. In an ideal transformer, how is
this ratio related to the currents in the two coils? How is the transformer used
in large scale transmission and distribution of electrical energy over long
distances?

a) Define a wavefront. 5
33 b) What type of wave front will emerge from a i) point source and ii)
distant light source?
c) Verify laws of reflection using Huygens’s principle.

OR

(a) Which two main considerations are kept in mind while

designing the objective of an astronomical telescope?
(b) Draw the ray diagram of astronomical telescope for its normal
adjustment. Obtain the expression for the magnifying power of an
astronomical telescope in normal adjustment position.

(c) State any two advantages of reflecting type telescope over the
refracting type?

Page 11of 10