HUMAN MUTATION Mutation and Polymorphism Report #43 (1999) Online

Mutation and Polymorphism Report

Corrigendum
==========================================
The Human Mutation Mutation and Polymorphism Report (MPR) titled "Novel
single base polymorphisms and rare sequence variants in the laminin α2-chain coding
region detected by RNA/SSCP analysis" by Panicker et al., which is published online
(MPR #38, 1998), was presented in incomplete form. This was due to a
miscommunication between the Editorial Office and the authors. Please consider the new
version indicated here (MPR #43, 1999) as the complete published manuscript. This
version, in addition to completing some information originally requested in review, also
corrects a typographical error regarding the electrophoresis conditions; viz., the gel runs
were performed at 4 °C (page 2, MPR #38, 1998).

Authors and readers should note that, because of our need to maintain the same
archival integrity of our on-line journal articles afforded our print journal articles, no on-
line manuscripts can be pulled off-line, corrected, and subsequently uploaded. However,
we are able to publish on-line errata and corrigenda, at the discretion of the Editors.

To facilitate the prompt dissemination of accurate scientific data, we will

electronically link the original on-line articles and related corrigenda/errata as appropriate.
We cannot be held responsible, however, for instigating similar links between errata or
corrigenda within Medline/PubMed or other literary indexing services.

Mark H. Paalman, Ph.D.

Managing Editor, Human Mutation
John Wiley & Sons, Inc., New York
 HUMAN MUTATION Mutation and Polymorphism Report #43 (1999) Online

Mutation and Polymorphism Report

Title : Novel single base polymorphisms and rare sequence variants in the laminin alpha 2-
chain coding region detected by RNA/SSCP analysis
Authors: Shirly G. Panicker#, Joshua T. Mendell#, Lei Chen#, Bo Feng$, Zarife Sahenk#,
George A. Marzluf$*, Anthony A. Amato@, Jerry R. Mendell#
Affiliations: $Department of Biochemistry, *Department of Molecular Genetics,
#Neuromuscular Disease Center, Department of Neurology, Ohio State University, 1654
Upham Drive, Columbus, Ohio 43210, U.S.A.
@Division of Neurology, University of Texas, San Antanio, Texas, U.S.A.
Species: Human

Gene/Locus
Name: Laminin alpha 2- chain gene
Symbol: LAMA2
HUGO-approved when available
Genbank accession number: U66743 (Exon 11)
U66744 (Exon 12)
U66751 (Exon 19)
U66787 (Exon 55)

OMIM accession number: 156225

Locus specific database: none

web address when available
Chromosomal location: 6q22-q23
e.g., 12q24.1
Inheritance: 1. germline ( exon 11 )
2. germline ( exon 12 )
3. germline ( exon 19 )
4-6. unknown ( exon 55 )
Mutation / polymorphism name:
To follow nomenclature guide.
Nucleotide change–Systematic name: 1. c1683T>A (exon 11)
Sequential no. in genomic or 2. c1905G>A (exon 12)
cDNAsequence. e.g., c1227c->T 3. c2805G>T (exon 19)
4. c7805T>C (exon 55)
5. c7879C>G (exon 55)
6. c7889G>A (exon 55)

Amino acid change–Trivial name: 1. L545Q

Codon number and change. e.g., R108W 2. R619H
3. R919L
4. Y2586H
5. V2610V
6. E2614K

Mutation / polymorphism type: 1. missense

Missense, deletion, splice, etc. 2. missense
3. missense
4. missense
5. neutral
 HUMAN MUTATION Mutation and Polymorphism Report #43 (1999) Online

6. missense

Polymorphism frequency: 1. 1/117 T/A ( exon 11 )

e.g., 40/60 C/T 2. 3/117 A/A; 27/117 G/A; 87/117 G/G ( exon 12 )
3. 2/107 G/T ( exon 19 )
4-6. not done ( exon 55 )

Detection method: RNA/SSCP and direct sequencing

DGGE, etc.

Detection conditions
sequence of primers: Exon 11
primer F (5'-3') TTATCCAAGGCCATGCCAGCCATG ;
primer R (5'-3') GATCTGCTGAGGTGAGTCCAAGT

Exon 12
primer F(5'-3') CTGGTATCTGACTGACCTTCCTG ;
primer R (5'-3') CTGGTGGGCACTGACACACTTCTA

Exon 19
primer F (5'-3') AGGATCATGTCAGCCATGCCAATG ;
primer R (5'-3') CATCGCCCAGTCTTTGGGTCACAAT

Exon 55
primer F (5'-3') CCAACGCTGAGAAACTTGAGTAT ;
primer R (5'-3') CTGAGTGGGGAAGGTTGAAATTC

PCR conditions: (94 deg C-30"/65 deg C-30"/72 deg C-30")x34 cycles
followed by 72 deg C-10 min extension

electrophoresis: (Exon 11) MDE 0.5x/TBE 0.6x/6W/4 deg C/14hrs

(Exon 12) MDE 0.5x/ 5% glycerol/TBE 0.6x/6W/

4 deg C/20hrs

(Exon 19) MDE 0.5x/TBE 0.6x/6W/4 deg C/14hrs

(Exon 55) MDE 0.5x/5% glycerol/TBE 0.6x/6W/

4 deg C/20hrs

Diagnosis method developed: (Exon 11) PCR followed by Alu I digestion

ASO, etc. (Exon 12) PCR followed by Hsp92 II digestion
(Exon 19) PCR followed by Hha I digestion
(Exon 55) PCR followed by direct sequencing

Evidence for existence and effect (mutation) or lack of effect (polymorphism):

Yes No Don’t know
1. Mutation found on repeat PCR sample
2. Mutation segregates or appears with trait
3. Mutation affects conserved residue
4. Expression analysis supports hypothesis
5. Mutation not found in 50 normal subjects
6. Polymorphism
 HUMAN MUTATION Mutation and Polymorphism Report #43 (1999) Online

Ancillary data
1. Haplotype association : unexplored
2. Population association : unexplored
3. Geographic association : unexplored
4. Clinical phenotype of proband : Autosomal recessive congenital muscular dystrophy
5. Homologous allele (if recessive trait):
6. Frequency: 1. Exon 11: 1/234 (117 unrelated individuals) p=0.004
2. Exon 12: 3/234 (117 unrelated individuals) p=0.013
3. Exon 19: 2/214 (107 unrelated individuals) p=0.009
4. – 6. Exon 55: Not Done
7. PIC: not done
8. Ethnic background: Caucasian
9. Other:
10. Present in HGMD listing: Yes No
(http://www.cf.ac.uk/uwcm/mg/hgmd0.html)
Comments
Laminin α2 (merosin), an extracellular matrix protein encoded by laminin α2 chain (LAMA2) gene, is
deficient in patients with classical congenital muscular dystrophy (CMD). So far, only a handful of
mutations and polymorphisms are reported in this gene (Helbling - Leclerc et al.,1995, Pegoraro et
al.,1996, Nissinen et al.,1996, Allamand et al., 1997, Guicheney et al., 1997 & 1998, Mendell et al., 1997
& 1998,). Since the LAMA2 gene is very large (260,000 bp), it greatly complicates the molecular
analysis, and hence the knowledge of the intragenic polymorphisms will be helpful in mutation analysis.
In this study, we report the identification of novel polymorphisms and rare sequence variants in the
coding region of laminin α2, which result in codon change, but do not cause any alteration in the
phenotype. These sequence variations are found in exons 11, 12, 19 and 55 of laminin α2 chain gene.
Some of these polymorphisms reported here result in gain or loss of restriction sites. The G→A
polymorphism at position 1905 in exon 12 (Guicheney et al., 1998 have also reported the same
polymorphism in a different ethinic population) result in gain as well as loss of restriction sites, Hsp92 II
and Mae II respectively. A neutral polymorphism V2610V in exon 55 also results in a gain of restriction
site Sau3A I. Since three separate base substitutions in different codons of exon 55 were observed in a
control individual we believe all these are polymorphisms.. So far, a total of five sequence variations are
noticed in exon 55 (Pegararo et al., 1996, Guicheney et al.,1998) over a stretch of 90 nucleotides (cDNA
position 7805 - 7894). Multiple sequence variations in exon 55 indicate that it is a ‘hot spot’ for mutation.

In the present study we have also identified rare novel sequence variants in exon 11 and exon 19 with low
allele frequencies of 0.4 % and 0.9 % respectively. To our knowledge, L545Q is the first DNA variation
reported and characterized in exon 11 of LAMA2 gene. The rare sequence variants reported here will
prevent its misidentification as possible disease - causing mutations. Though the DNA variations reported
here do not have clinical relevance, neverthless it is very informative in the mutation analysis of this large
gene, causing this disabling disease .
Acknowledgments
Support by Muscular Dystrophy Association is gratefully acknowledged.
References
Allamand V, Sunada Y, Salih MAM, Straub V, Ozo CO, Al-Turaiki MHS, Akbar M, Kolo T, Colognato
H, Zhang X, Sorokin LM, Yurchenco PD, Tryggvason K, Campbell KP (1997) Mild congenital
muscular dystrophy in two patients with an internally deleted laminin α2 -chain. Hum Mol Genet 6:
747-752 MUID: 97301771
Guicheney P, Vignier N, Helbling-Leclerc A, et al, (1997). Genetics of laminin α2 chain (or merosin)
deficient congenital muscular dystrophy: from identification of mutation to prenatal diagnosis.
Neuromusc Disord 7: 187-90 MUID: 97328667
 HUMAN MUTATION Mutation and Polymorphism Report #43 (1999) Online

Guicheney P, Vignier N, Zhang X, et al, (1998). PCR based mutation screening of the laminin α2 chain
gene ( LAMA2): application to prenatal diagnosis and search for founder effects in congenital
muscular dystrophy. J Med Genet 35 : 211-217
Helbling-Leclerc A, Zhang X, Topaloglu H, Cruaud C, Tesson F, Weissenbach J, Tomé FMS, Schwartz
K, Fardeau M, Tryggvason K, Guicheney P (1995) Mutations in the laminin α2- chain gene
(LAMA2) cause merosin - deficient congenital muscular dystrophy. Nat Genet 11: 216-218 MUID:
96024663
Mendell JT, Panicker SG, Tsao CY, Bo Feng, Sahenk Z, Marzluf GA, Mendell JR(1998)
Novel compound heterozygous laminin α2-chain gene (LAMA2) mutations in congenital muscular
dystrophy. Hum Mut 12:135. Mutations in brief #159 (1997) On-line
Nissinen M, Helbling - Leclerc A, Zhang X, Evangelista T, Topaloglu H, Cruaud C, Weissenbach J,
Fardeau M, Tomé FMS, Schwartz K, Tryggvason K, Guicheney P (1996) Substitution of a conserved
cystein-996 in a cystein -rich motif of the laminin α2- chain in congenital muscular dystrophy with
partial deficiency of the protein.
Am J Hum Genet 58: 1177-1184 MUID: 96213752
Pegoraro E, Mancias P, Swerdlow SH, Raikow RB, Garcia C, Marks H, Crawford T, Carver V, Cianno
BD, Hoffman EP (1996). Congenital muscular dystrophy with primary laminin α2 (Merosin)
deficiency presenting as inflammatory myopathy.
Ann Neurol 40: 782-791 MUID: 97115901
Keywords
Congenital muscular dystrophy, laminin ∝2 chain (LAMA2) polymorphism, mutational ‘hot spot’, SSCP
Corresponding Author Information (address, phone, fax, e-mail)
Jerry R. Mendell, M.D.
Neuromuscular Disease Center
Department of Neurology,Ohio State University
1654 Upham Drive, Columbus, Ohio 43210, USA.
Tel: 614-293-4962
Fax: 614-293-4688
Mendell.1@osu.edu