HUMAN MUTATION Mutation and Polymorphism Report #38 (1998) Online

Mutation and Polymorphism Report

Title : Novel single base polymorphisms and rare sequence variants in the laminin a2- chain
coding region detected by RNA/SSCP analysis
Authors: Shirly G. Panicker#, Joshua T. Mendell#, Lei Chen#, Bo Feng$, Zarife Sahenk#,
George A. Marzluf$*, Anthony A. Amato@, Jerry R. Mendell#
Affiliations: $Department of Biochemistry, *Department of Molecular Genetics,
#Neuromuscular Disease Center, Department of Neurology, Ohio State University, 1654
Upham Drive, Columbus, Ohio 43210, U.S.A.
@Division of Neurology, University of Texas, San Antanio, Texas, U.S.A.
Species: Human

Gene/Locus
Name: Laminin alpha 2- chain gene
Symbol: LAMA2
HUGO-approved when available
Genbank accession number: U66743 (Exon 11)
U66744 (Exon 12)
U66751 (Exon 19)
U66787 (Exon 55)

OMIM accession number: 156225

Locus specific database: none
web address when available
Chromosomal location: 6q22-q23
e.g., 12q24.1
Inheritance: unknown
Mutation / polymorphism name:
To follow nomenclature guide.
Nucleotide change–Systematic name: 1. c1683T>A (exon 11)
Sequential no. in genomic or 2. c1905G>A (exon 12)
cDNAsequence. e.g., c1227c->T 3. c2805G>T (exon 19)
4. c7805T>C (exon 55)
5. c7879C>G (exon 55)
6. c7889G>A (exon 55)
Amino acid change–Trivial name: 1. L545Q
Codon number and change. e.g., R108W 2. R619H
3. R919L
4. Y2586H
5. V2610V
6. E2614K
Mutation / polymorphism type: 1. missense
Missense, deletion, splice, etc. 2. missense
3. missense
4. missense
5. neutral
6. missense
Polymorphism frequency:
e.g., 40/60 C/T
Detection method: RNA/SSCP and direct sequencing
DGGE, etc.

Detection conditions
 HUMAN MUTATION Mutation and Polymorphism Report #38 (1998) Online

sequence of primers: Exon 11 primer F (5’-3’)

TTATCCAAGGCCATGCCAGCCATG ; primer R (5’-3’)
GATCTGCTGAGGTGAGTCCAAGT
Exon 12 primer F(5’-3’)
CTGGTATCTGACTGACCTTCCTG ; primer R (5’-3’)
CTGGTGGGCACTGACACACTTCTA
Exon 19 primer F (5’-3’)
AGGATCATGTCAGCCATGCCAATG ; primer R (5’-3’)
CATCGCCCAGTCTTTGGGTCACAAT
Exon 55 primer F (5’-3’)
CCAACGCTGAGAAACTTGAGTAT ; primer R (5’-3’)
CTGAGTGGGGAAGGTTGAAATTC
PCR conditions: (94 deg C-30"/72 deg C-30")x35 cycles
electrophoresis: (Exon 11) MDE 0.5x/TBE 0.6x/6W/40C/14hrs
(Exon 12) MDE 0.5x/ 5% glycerol/TBE 0.6x/6W/4 deg
C/20hrs
(Exon 19) MDE 0.5x/TBE 0.6x/6W/4 deg C/14hrs
(Exon 55) MDE 0.5x/5% glycerol/TBE 0.6x/6W/4 deg
C/20hrs

Diagnosis method developed: (Exon 11) PCR followed by Alu I digestion

ASO, etc. (Exon 12) PCR followed by Hsp92 II digestion
(Exon 19) PCR followed by Hha I digestion
(Exon 55) PCR followed by direct sequencing

Evidence for existence and effect (mutation) or lack of effect (polymorphism):

Yes No Don’t know
1. Mutation found on repeat PCR sample
2. Mutation segregates or appears with trait
3. Mutation affects conserved residue
4. Expression analysis supports hypothesis
5. Mutation not found in 50 normal subjects
6. Polymorphism
 HUMAN MUTATION Mutation and Polymorphism Report #38 (1998) Online

Ancillary data
1. Haplotype association : unexplored
2. Population association : unexplored
3. Geographic association : unexplored
4. Clinical phenotype of proband : Autosomal recessive congenital muscular dystrophy
5. Homologous allele (if recessive trait):
6. Frequency: 1. Exon 11: 1/234 (117 unrelated individuals) p=0.004
2. Exon 12: 3/234 (117 unrelated individuals) p=0.013
3. Exon 19: 2/214 (107 unrelated individuals) p=0.009
4. – 6. Exon 55: Not Done
7. PIC: not done
8. Ethnic background: Caucasian
9. Other:
10. Present in HGMD listing: Yes No
(http://www.cf.ac.uk/uwcm/mg/hgmd0.html)
Comments
Laminin α2 (merosin), an extracellular matrix protein encoded by laminin α2 chain
(LAMA2) gene, is deficient in patients with classical congenital muscular dystrophy
(CMD). So far, only a handful of mutations and polymorphisms are reported in this gene
(Helbling-Leclerc et al.,1995, Pegoraro et al.,1996, Nissinen et al.,1996, Allamand et al.,
1997, Mendell et al., 1997, Guicheney et al., 1997 & 1998). Since the LAMA2 gene is
very large (260,000 bp), it greatly complicates the molecular analysis, and hence the
knowledge of the intragenic polymorphisms will be helpful in mutation analysis. In this
study, we report the identification of novel polymorphisms and rare sequence variants in
the coding region of laminin α2, which result in codon change, but do not cause any
alteration in the phenotype. These sequence variations are found in exons 11, 12, 19 and
55 of laminin α2 chain gene. Some of these polymorphisms reported here result in gain or
loss of restriction sites. The G→A polymorphism at position 1905 in exon 12 (Guicheney
et al., 1998 have also reported the same polymorphism in a different ethinic population)
result in gain as well as loss of restriction sites, Hsp92II and MaeII respectively. A neutral
polymorphism V2610V in exon 55 also results in a gain of restriction site Sau3AI. Since
three separate base substitutions in different codons of exon 55 were observed in a control
individual we believe all these are polymorphisms.. So far, a total of five sequence
variations are noticed in exon 55 (Pegararo et al., 1996, Guicheney et al.,1998) over a
stretch of 90 nucleotides (cDNA position 7805-7894). Multiple sequence variations in
exon 55 indicate that it is a ‘hot spot’ for mutation.

In the present study we have also identified rare novel sequence variants in exon 11 and
exon 19 with low allele frequencies of 0.4% and 0.9% respectively. To our knowledge,
L545Q is the first DNA variation reported and characterized in exon11 of LAMA2 gene.
The rare sequence variants reported here will prevent its misidentification as possible
disease-causing mutations. Though the DNA variations reported here do not have
clinical relevance, neverthless it is very informative in the mutation analysis of this large
gene, causing this disabling disease .
Acknowledgments
Support by Muscular Dystrophy Association is gratefully acknowledged.
 HUMAN MUTATION Mutation and Polymorphism Report #38 (1998) Online

References
Allamand V, Sunada Y, Salih MAM, Straub V, Ozo CO, Al-Turaiki MHS, Akbar M,
Kolo T, Colognato H, Zhang X, Sorokin LM, Yurchenco PD, Tryggvason K,
Campbell KP (1997) Mild congenital muscular dystrophy in two patients with an
internally deleted laminin α2 -chain. Hum Mol Genet 6: 747-752 MUID: 97301771
Guicheney P, Vignier N, Helbling-Leclerc A, et al, (1997). Genetics of laminin α2 chain
(or merosin) efficient congenital muscular dystrophy: from identification of mutation
to prenatal diagnosis. Neuromusc Disord 7: 187-90 MUID: 97328667
Guicheney P, Vignier N, Zhang X, et al, (1998). PCR based mutation screening of the
laminin α2 chain gene ( LAMA2): application to prenatal diagnosis and search for
founder effects in congenital muscular dystrophy. J Med Genet 35 : 211-217
Helbling-Leclerc A, Zhang X, Topaloglu H, Cruaud C, Tesson F, Weissenbach J, Tomé
FMS, Schwartz K, Fardeau M, Tryggvason K, Guicheney P (1995) Mutations in the
laminin α2- chain gene (LAMA2) cause merosin - deficient congenital muscular
dystrophy. Nat Genet 11: 216-218 MUID: 96024663
Mendell JT, Panicker SG, Tsao CY , Bo Feng, Sahenk Z, Marzluf GA, Mendell JR (1997)
Novel compound heterozygous laminin α2 - chain gene (LAMA2) mutations in
congenital muscular dystrophy. Hum Mut . Mutation in brief #159 On-line
Nissinen M,Helbling - Leclerc A, Zhang X, Evangelista T, Topaloglu H, Cruaud C,
Weissenbach J, Fardeau M, Tomé FMS, Schwartz K, Tryggvason K, Guicheney P
(1996) Substitution of a conserved cystein-996 in a cystein -rich motif of the laminin
α2- chain in congenital muscular dystrophy with partial deficiency of the protein.
Am.J.Hum.Gnet.58: 1177-1184 MUID: 96213752
Pegoraro E, Mancias P, Swerdlow SH, Raikow RB, Garcia C, Marks H, Crawford T,
Carver V, Cianno BD, Hoffman EP (1996). Congenital muscular dystrophy with
primary laminin α2 (Merosin) deficiency presenting as inflammatory myopathy. Ann.
Neurol 40: 782-791 MUID: 97115901
Keywords
Congenital muscular dystrophy, laminin ∝2- chain (LAMA2) gene polymorphisms [ {
c1905G → A ( R619H ) exon 12 }; { c7805T → C ( Y2586H );
c7879C → G ( V2610V ); c7889G → A ( E2614K ) exon 55 } ) ], rare sequence variants
[ c1683T → A ( L545Q ) exon 11 }; { c2805G → T ( R919L ) exon 19 } ], mutational
‘hot spot’, single strand conformational polymorphism.
Corresponding Author Information (address, phone, fax, e-mail)
Mendell.1@osu.edu

Tel: 614-293-4962
Fax: 614-293-4688