Received: 29 January 2019

| Revised: 1 August 2019

| Accepted: 15 August 2019

DOI: 10.1111/ejn.14556

RESEARCH REPORT

Chlorogenic acid ameliorates memory loss and hippocampal cell

death after transient global ischemia

Ery Hermawati1,2 | Nur Arfian3 | Mustofa Mustofa4 | Ginus Partadiredja5

1
Doctoral Program, Faculty of Medicine,
Public Health and Nursing, Universitas
Abstract
Gadjah Mada, Yogyakarta, Indonesia Chlorogenic acid (CGA) is known to have antioxidant potentials, yet the effect of
2
Department of Physiology, Faculty CGA on brain ischemia has not been sufficiently understood. Brain ischemia such as
of Medicine, Tanjungpura University,
transient global ischemia disrupts many areas of the brain of rats, including the hip-
Pontianak, West Kalimantan, Indonesia
3 pocampus. Male Wistar rats were randomly assigned into five groups, that is, sham‐
Department of Anatomy, Faculty
of Medicine, Public Health and operated (SO), bilateral common carotid occlusion (BCCO), and BCCO+ 15, 30,
Nursing, Universitas Gadjah Mada, and 60 mg/kg bw CGA groups (CGA15, CGA30, and CGA60, respectively). Brain
Yogyakarta, Indonesia
4
ischemia was induced in Wistar rats with BCCO for 20 min followed by intraperito-
Department of Pharmacology and Therapy,
Faculty of Medicine, Public Health and neal injection of CGA. The rats were examined for the spatial memory in a Morris
Nursing, Universitas Gadjah Mada, water maze test on the 3rd day and were euthanized on the 10th day after BCCO. The
Yogyakarta, Indonesia
total number of pyramidal cells was estimated, and the mRNA expressions of Bcl2,
5
Department of Physiology, Faculty
Bax, caspase‐3, SOD2, SOD1, GPx, ET‐1, eNOS, CD31, and VEGF‐A were meas-
of Medicine, Public Health and
Nursing, Universitas Gadjah Mada, ured. The BCCO group spent less time and distance in the target quadrant than any
Yogyakarta, Indonesia other group in the spatial memory retention test. The CA1 pyramidal cell numbers in
Correspondence
the BCCO and CGA15 groups were lower than in the CGA30 and CGA60 groups.
Ginus Partadiredja, Department of Physiology, The mRNA expressions of Bcl2, SOD2, and CD31 in the BCCO group were lower
Faculty of Medicine, Public Health and than in the CGA15, CGA30, and CGA60 groups. The ET‐1 expression was higher
Nursing, Universitas Gadjah Mada,
Yogyakarta, Indonesia. in the BCCO and CGA15 groups than in the SO, CGA30, and CGA60 groups. CGA
Emails: gpartadiredja@yahoo.com and improves the spatial memory and prevents the CA1 pyramidal cell death after BCCO
gpartadiredja@ugm.ac.id
by increasing Bcl2, SOD2, and CD31 expressions and decreasing ET‐1 expression.
Funding information
Ministry of Research, Technology, and KEYWORDS
Higher Education, Indonesia, Grant/Award chlorogenic acid, hippocampal pyramidal cells, spatial memory, stereology, transient global ischemia
Number: 0299/E3/2016
The peer review history for this article is
available at https​://publo​ns.com/
publo​n/10.1111/EJN.14556​

Abbreviations: AIF, apoptosis‐inducing factor; BCCO, bilateral common carotid occlusion; CA1, cornu ammonis area 1; CA2, cornu ammonis area 2;
CA3, cornu ammonis area 3; CE, coefficient of error; CGA, chlorogenic acid; CVbiol, biological coefficient of variation; CV, coefficient of variation;
eNOS, endothelial nitric oxide synthase; ET‐1, endothelin‐1; FOV, field of view; GPx, glutathione peroxidase; IR injury, ischemia/reperfusion injury;
MWM, Morris water maze; PBS, phosphate‐buffered saline; ROS, reactive oxygen species; RSEM, rabbit small clot embolic stroke model; SOD, superoxide
dismutase; SO, sham‐operated; TGI, transient global ischemia; VEGF‐A, vascular endothelial growth factor‐A.

Edited by Eilis Dowd.

Eur J Neurosci. 2019;00:1–19. wileyonlinelibrary.com/journal/ejn © 2019 Federation of European Neuroscience Societies | 1

and John Wiley & Sons Ltd
2
|    HERMAWATI et al.
1 | IN TRO D U C T ION
One of the most vulnerable areas of the brain toward isch-
emia is the hippocampus (Sanderson, Reynolds, Kumar,
Przyklenk, & Huttemann, 2013). A brain ischemia condi-
tion such as transient global ischemia (TGI) may lead to
hippocampal pyramidal cell death, especially in the CA1
region. Such a detrimental consequence has been known as
delayed neuronal death (Inagaki & Etgen, 2013; Movassaghi
et al., 2012; Quintard et al., 2011). Hippocampal neuronal
death also impairs the spatial memory function (Andersen,
Morris, Amaral, Bliss, & O'Keefe, 2007; Bear, Connors, &
Paradiso, 2007; Kandel, Schwartz, & Jessel, 2000; Purves
et al., 2004).
The underlying culprit of neuronal damage in ischemic
conditions is oxidative stress (Movassaghi et al., 2012;
Selakovic, Korenic, & Radenovic, 2011), which is due to the
increased production of free radicals (Buch, Patel, Ranpariya,
Sheth, & Parmar, 2012). The increased level of free radicals
activates antioxidant enzymes including superoxide dis-
mutase (SOD) and glutathione peroxidase (GPx) (Mehta,
Manhas, & Raghubir, 2007). At one stage, an imbalance be-
tween oxidant and antioxidant levels may occur and lead to
the cellular apoptosis accompanied by a reduction of anti‐
apoptotic signaling, such as the BCL‐2 family in the mito-
chondria (Sasi, Hwang, Jaboin, Csiki, & Lu, 2009).
Brain ischemia may also lead to vascular reactions in the
form of vascular remodeling (Gibbons & Dzau, 1994). The
vascular reaction depends on vasodilators, such as endothelial
nitric oxide synthase (eNOS; Sawada & Liao, 2009), and vaso-
constrictors, such as endothelin‐1 (ET‐1; Yeung, Shen, Chung,
& Chung, 2013). ET‐1 is a potent vasoconstrictor that causes
ischemia injury and functional deficits in learning and mem-
ory (Sheng et al., 2015). In the chronic phase after an ischemia/
reperfusion injury, there will be a recovery period involving
eNOS (Sawada & Liao, 2009) and vascular endothelial growth
factor‐A (VEGF‐A; Wang et al., 2005; Greenberg & Jin, 2013).
Polyphenols are known to exert neuroprotective effects
by lowering apoptotic markers (Panickar & Anderson, 2011).
Chlorogenic acid (CGA) is the main phenol compound pres-
ent in coffee and known to have a very beneficial antioxi-
dant effect (Ito, Sun, Watanabe, Okamoto, & Hatano, 2008;
Lafay, Morand, Manach, Besson, & Scalbert, 2006; Marinova,
Toneva, & Yanishlieva, 2009; Olthof, Hollman, & Katan,
2001; Vauzour, 2012). It has been reported to have neuro-
protective effects, and it may improve memory functions in
mice with scopolamine‐induced amnesia (Kwon et al., 2010).
Ahn et al. (2011) reported that CGA alone or in combination
with the ribosomal protein PEP‐1‐rpS3 might have protec-
tive effects on the CA1 pyramidal cells of the hippocampus
of gerbils undergoing brain ischemia as expressed by relative
cell density. However, this study did not conduct quantitative
examination on the hippocampal pyramidal cells (Ahn et al.,
2011). The present study aimed at investigating the possible
beneficial effects of CGA on treating the impairment of spatial
memory function as well as deficits of hippocampal neurons
and vascular responses following transient global ischemia.
2 | M ATERIAL S AND M ETHOD S
2.1 | Animals, BCCO model, and CGA
treatment
The animal handling and experimental procedures were ap-
proved by the Ethical Committee of the Faculty of Medicine,
Public Health and Nursing, Universitas Gadjah Mada (ap-
proval number: KE/FK/1239/EC/2015). Fifty‐five male
Wistar rats, aged 3–5 months and weighing 200–350 g, were
obtained from the Animal House (LPPT) and the Department
of Pharmacology and Therapy, Faculty of Medicine, Public
Health and Nursing, Universitas Gadjah Mada. The rats were
housed in cages under the natural light–dark cycle of 12:12 hr.
The rats were allowed to access food pellets and water ad libi-
tum during the experiment. The room temperature and humid-
ity were at ranges of 26–31°C and 70%–90%, respectively.
The animals were randomly divided into five groups,
that is, SO group, which was the sham‐operated group;
BCCO group, which was the group undergoing bilateral
common carotid occlusion (BCCO); and CGA15, CGA30,
and CGA60 groups, which were the groups undergoing
BCCO as well as being given intraperitoneal (ip) injec-
tion of 15, 30, and 60 mg/kg bw of CGA, respectively.
Four to five animals of the same group were placed in the
same cage. Transient global ischemia (TGI) model was
performed using the bilateral common carotid occlusion
(BCCO) method based on the protocol of previous stud-
ies (Hatakeyama, Matsumoto, Brengman, & Yanagihara,
1988; Martinez, Musumeci, Loreto, & Carnazza, 2007;
Sharifi et al., 2012; Yu et al., 2012; Zhao, Zhang, Guo,
& Zhang, 2013; Zheng, Liu, Wang, & Xu, 2007). The
rats were anesthetized using intramuscular injection of
100 mg/kg bw of ketamine (PT Guardian Pharmatama,
Jakarta, Indonesia). The anterior neck skin was opened,
blunt dissection of salivary gland and muscle was con-
ducted to visualize trachea and both common carotid
arteries, and the vagal nerves were separated from the
arteries. The carotid arteries were clamped using non‐
traumatic vascular clamps (Dieffenbach; World Precision
Instruments, USA). Both arteries were occluded for
20 min. The same procedure was performed on rats of the
SO group except the occlusion of the common carotid ar-
teries. CGA (Sigma‐Aldrich, USA, Cat. #C3878‐1G) was
administered 30 min after the BCCO procedure. The CGA
was dissolved in phosphate‐buffered saline (PBS) solu-
tion (every 10 mg CGA was dissolved in 1 ml PBS). The
control groups (the SO and BCCO groups) received PBS
HERMAWATI et al.
injection to ensure that any parameter changes observed
in the CGA treatment groups during the experiment were
solely due to the effects of CGA and not the solvent.
The animals were kept in the recovery phase for 2 days
before being tested for the spatial memory. Four to five rats of
the same group undergoing recovery were placed in one cage.
During the recovery phase, the rats did not get any medica-
tion, except antiseptic on the site of surgery. Careful observa-
tion on the site of surgery was performed regularly to detect
any early signs of infection.
2.2 | Morris water maze (MWM) test
The device for the test consisted of a white‐painted rounded
pool (1.5 m in diameter and 0.4 m in height). The pool was di-
vided into four virtual quadrants titled A, B, C, and D. There
was a rounded white‐painted platform (13 cm in diameter and
16.5 cm in height) located in the middle of a randomly cho-
sen quadrant and kept in the same location throughout the
experiment for each rat. Eight starting points were marked
on the outside of the tank wall. Several colored pictures were
placed on the curtain around the pool. These pictures served
as distal cues for the rats to find the platform. The tank was
filled with water and added with milk (1.5–2.5 cm above the
platform) until the platform was barely visible.
The spatial memory test, which consisted of an escape
acquisition phase and a memory retention phase, was per-
formed 3 days after BCCO using the protocol of Bouet et al.
(2010). The escape acquisition or learning phase began with
placing a randomly chosen rat at a randomly selected starting
point with its head facing the pool wall. The starting point
was randomly determined between numbers 1 and 8 for each
test. The platform was placed in the middle of a randomly se-
lected quadrant, and this platform was kept at the same place
for any given rat during all trials of the escape acquisition
phase. The rat was expected to accidentally find the platform
and climb on to it. This marked the end of the trial. The time
from the start to the end of the trial was recorded as an escape
latency. The rat was left on the platform for 20 s before it was
taken, dried, and returned to the holding cage for 60 s be-
fore the next trial. If the rat failed to find the platform within
60 s, the rat was taken from the pool and placed on top of
the platform for 20 s. In this case, the escape latency was re-
corded as 60 s. All trials were recorded with a video camera
placed above the pool and connected to a personal computer.
The path length was measured indirectly on the screen of the
computer using a curvimeter (Comcurve 10; Koizumi Sokki
Mfg, Nagaoka‐shi, Niigata, Japan). Each rat underwent four
trials per day for four consecutive days.
The retention phase was conducted 24 hr after the last trial
of the learning phase. The platform was removed from the pool
during the test. The test was performed only once for 60 s. The
total time spent and path length in the target quadrant were
  
| 3
recorded. The target quadrant was the quadrant where the plat-
form was previously located in the learning phase. The time
spent was presented as the percentage of total time spent in the
target quadrant to 60 s, whereas the path length was presented
as the percentage of total trajectory in the target quadrant to
the total distance traveled within 60 s.
An additional test, which was a visual testing (visible plat-
form) or sensorimotor test, was performed 1 day after the re-
tention phase test. This test assesses the sensory, motor, and
motivational factors of the rats upon performing the memory
task. In this procedure, the platform was made visible by at-
taching a color flag on top of the platform. This test consisted
of three trials in 1 day with the duration of 60 s for each trial.
It was expected that all rats had an equal sensorimotor ca-
pability, and thus, any differences between the rats’ perfor-
mance during the memory test arose from the differences in
the spatial memory capability.
2.3 | Tissue preparation
Ten days after BCCO, the rats were euthanized by cervical
dislocation and decapitation under deep anesthesia of chloro-
form (Merck, Germany, Cat. #1024451000). The cerebrums
of the rats were dissected out from the skulls, and the two cer-
ebral hemispheres were separated from each other. The right
hippocampus was isolated from the right hemisphere and
stored in RNAlater® Stabilization Solution (Thermo Fisher
Scientific, USA, Cat. #AM7021).
The left hemisphere was soaked in 10% formaldehyde in
phosphate buffer solution (PBS) for 24 hr. On the next day,
the left hippocampus was isolated from the hemisphere and
immersed in 70% ethanol solution before being dehydrated
in ascending concentrations of ethanol, cleared with toluene,
infiltrated, and finally embedded in a paraffin block.
2.4 | Stereological analyses
Six paraffin blocks containing hippocampal tissues from
each group were randomly taken and processed further for
stereological analyses. As most tissues usually shrink dur-
ing histological processing (Partadiredja, Miller, & Oorschot,
2003), the correction for shrinkage is important in the estima-
tion of volume. In order to calculate the shrinkage of the hip-
pocampus, each hippocampus was photographed twice using
a Deskcam camera (PT. Miconos, Indonesia), that is, shortly
after being isolated from the cerebrum and after being dehy-
drated. A virtual grid made using ImageJ software program
(NIH Image; National Institutes of Health, Bethesda, MD)
was superimposed on these photographs and used to count the
number of points falling on the photographs of hippocampus.
This number of points was entered into the following formula
to calculate the volume shrinkage factor (Nyengaard, 1999;
Pulungan, Sofro, & Partadiredja, 2018):
4
|    HERMAWATI et al.
Volume shrinkage = 1−
(Σpoints after dehydration∕Σpoints before dehydration)1.5
The average volume shrinkage was 36.58%, with the maxi-
mum and minimum values of 64.64% and 14.61%, respectively.
All paraffin blocks containing hippocampal tissues were
sectioned at 3 μm thickness using a Leica RM2235 micro-
tome (Leica Biosystems, Wetzlar, Germany). The first sec-
tion showing the hippocampal tissue was considered as the
first section, and the next sections were numbered sequen-
tially. For each rat, a number between 1 and 150 was ran-
domly chosen to determine the first section to be taken as
a sample. A pair of consecutive sections was taken, and the
following 148 sections were removed before another pair of
sections was taken. This procedure was repeated until the
entire hippocampus was thoroughly sectioned (Howard &
Reed, 2005). This procedure yielded between 7 and 10 pairs
of sampled sections showing the CA1 region with an aver-
age of eight pairs of sections and between six and nine pairs
of sections showing the CA2–CA3 region with an average
of eight pairs of sections. All sampled sections were stained
with 1% toluidine blue solution.
The total number of pyramidal cells of hippocampus
was estimated using the Nv × Vref method (West, 2012a), in
which Nv is the number of cells per unit volume and Vref
is the reference volume, or the hippocampal pyramidal cell
layer volume. The hippocampal volume was estimated using
the Cavalieri principle (Gundersen & Jensen, 1987; Michel
& Cruz‐Orive, 1988; Miki, Harris, Wilce, Takeuchi, & Bedi,
2000, 2004; Partadiredja & Bedi, 2010). One section from
each pair of sampled sections was taken for the estimation.
Pictures of hippocampus from these sections were viewed
under an Olympus CX21FS1 (Olympus, Singapore PTE
Ltd) light microscope at 40× magnification and captured
using a digital camera (Optilab; PT. Miconos, Indonesia).
The photographs of hippocampal parts were merged using
Microstepper (PT. Miconos, Indonesia) to display the whole
area of the hippocampus. A virtual grid consisting of reg-
ularly spaced array of points at a distance of 10 mm be-
tween points was made using ImageJ software (NIH Image;
National Institutes of Health, Bethesda, MD). This grid was
superimposed on the picture of the hippocampus (Figure 1).
Using a slide micrometer (Ted Pella, Inc., USA), a final
magnification of the picture was calculated to be 350×, and
at this magnification, the area per point was 816,326 μm2.
The total number of points (ΣP) falling on the hippocampal
area was counted. The total number of points counted for the
CA1 region was between 211 and 841 points with an aver-
age of 561 points, while that for the CA2–CA3 region was
between 314 and 1058 points with an average of 732 points.
The volume of hippocampus was calculated using the for-
mula (Howard & Reed, 2005; Pulungan et al., 2018; West,
2012a):
F I G U R E 1 A photograph showing the whole area of
hippocampus superimposed by a virtual grid
Vref = T.ΣP.(a∕p)(1 + volume shrinkage)
where “Vref” is volume of the hippocampus, “T” is the distance
between the sampled sections, “(a/p)” is the area represented
by each point of the grid, “ΣP” is total number of points, and
“volume shrinkage” is the shrinkage of the tissue which had
been calculated before under the presumption that the shrinkage
occurred at the same rate for the three axes (x, y, and z).
The numerical density (Nv) of pyramidal cells of hip-
pocampus was calculated using the physical disector probe
as described in previous studies (Hermawati, Sari, &
Partadiredja, 2015; Partadiredja & Bedi, 2010; Sterio, 1984).
A pair of consecutive sections were designated as a test sec-
tion and lookup section. The fields of view (FOVs) of each
hippocampal test section to be examined were randomly and
systematically selected in a raster fashion of every 5 FOVs
for the CA1 region and every 3 FOVs for the CA2–CA3 re-
gion. The selected FOVs were viewed under the Olympus
CX21FS1 (Olympus, Singapore PTE Ltd) light microscope
and captured using a digital camera (Optilab; PT. Miconos,
Indonesia). The analogue of these FOVs at the lookup sec-
tions was also captured. This strategy yielded between 12 and
22 pairs of sampled FOVs of the CA1 region with an average
of 17 pairs of FOVs and between 18 and 43 pairs of FOVs of
the CA2–CA3 region with an average of 31 pairs of FOVs.
An image of a rectangular counting frame slightly smaller
than an FOV, which was 50 × 50 mm, was placed over the
picture of the examined area. The final magnification of this
frame was calculated using the slide micrometer and found
to be 850×. At this magnification, the area of the counting
frame (“a”) was calculated to be 3,460.20 μm2. This count-
ing frame consisted of two adjacent solid lines designated as
exclusion lines and two adjacent interrupted lines designated
as inclusion lines. The pyramidal cell nucleus was used as the
counting unit. Following the forbidden line rule (Gundersen,
1977), any nuclear profile appearing in the counting frame
HERMAWATI et al.   
| 5

of the test section but not in that of the lookup section pro-
vided that this profile did not touch the exclusion lines or
their extensions, was counted (Figure 2). In order to increase
the efficiency in the counting, the test section was afterward
used as the lookup section and vice versa (Gundersen, 1986).
The hippocampal tissue slides examined were coded, and
therefore, the experimenter was not aware of which experi-
mental group any slide belonged. The total number of nuclear
profiles (ΣQ−) was between 111 and 281 profiles with an av-
erage of 218 profiles in the CA1 region, whereas that in the
CA2–CA3 region was between 119 and 296 profiles with an
average of 207 profiles.
The numerical density of pyramidal cells in hippocampus
was calculated using the following formula (Howard & Reed,
2005; Pulungan et al., 2018; Sterio, 1984; West, 2013):
−
Nv = (ΣQ ∕a.h.ΣP).(1∕(1 + vol.shrinkage)),
where “ΣQ−” is the total number of nuclear profiles, “a” is the
area of counting frame, “h” is the section thickness (3 μm),
“ΣP” is the total number of counting frames, and “vol.shrink-
age” is the shrinkage correction. The total number of pyramidal
cells of hippocampus was calculated by multiplying Vref and Nv
(Hermawati et al., 2015; Partadiredja & Bedi, 2010; Pulungan
et al., 2018).
The precision estimate of the stereological procedure was
calculated using the formula:
CV2total = CV2biol + CE2
where CV is coefficient of variation, CVbiol is biological co-
efficient of variation which reflects individually biological
variations, and CE is coefficient of error that reflects sampling
error (Boyce, Dorph‐Petersen, Lyck, & Gundersen, 2010;
West, 2012b). The sampling strategy is considered to be op-
timal if CE2/CV2 is between 0.2 and 0.5 (Agustina, Sofro, &
Partadiredja, 2019; Partadiredja, Karima, Utami, Agustiningsih,
& Sofro, 2019).
2.5 | RNA extraction and real‐time
quantitative PCR
Six samples from each group were randomly taken and pro-
cessed for RNA extraction. The right hippocampus was cut
into half and homogenized for RNA extraction in RNAiso
PLUS (Takara Bio, Tokyo, Japan, Cat. #9108/9109). The
RNA of the hippocampal tissue was extracted using RNAiso
PLUS (Takara Bio, Tokyo, Japan, Cat. #9108/9109).
RNA quantification was determined using NanoDrop.

(a)

(b)

F I G U R E 2 Micrographs showing
a pair of sections (3 μm thickness) with
physical disector probes of the CA1
region (a) and CA2–CA3 region (b) of the
hippocampus. Any nuclear profiles observed
in the counting frame of the test sections but
not in the lookup sections were counted (x)
6
|    HERMAWATI et al.

Subsequently, cDNA was made using 1,000 ng of RNA
according to the manufacturer's instructions (ReverTra
Ace Kit; TOYOBO Co., Japan, Cat. #TRT‐101) in a 20 μl
mixture reaction with random primer. The cycling condi-
tions were 30°C for 10 min, 42°C for 60 min, and 99°C for
5 min. The cDNA was then stored in a −20°C freezer.
Real‐time quantitative PCR was performed using KAPA
SYBR® FAST Master Mix (2×) Universal (Kapa Biosystems,
KK4600, Massachusetts, USA) in a real‐time PCR machine
(CFX96; Bio‐Rad, USA). The cDNA was diluted four times
prior to the PCR. The PCR condition of the denaturation stage
was 94°C for 2 min. The primers, number of cycles, annealing
temperatures, and time were adjusted for each gene examined
(Table 1), followed by an elongation stage with a temperature
of 72°C for 10 min. The relative quantification of target genes’
mRNA expression was calculated using the △△CT method.
2.6 | Statistical analyses
Prior to data analyses, normality and homogeneity tests were
performed using the Shapiro–Wilk or Kolmogorov–Smirnov
tests and the Levene tests. The data were transformed into
log10 whenever necessary. When normally distributed and
homogenous, the data were analyzed using one‐way ANOVA
procedure. Otherwise, Kruskal–Wallis tests were conducted.
The analyses were followed by LSD or Mann–Whitney post
hoc tests where needed. The statistical significance was set at
probability value of p < .05. All statistical analyses were per-
formed using SPSS software version 20 (IBM Corp., USA).
3 | RESULTS
3.1 | CGA prevents spatial memory
deterioration
The results of escape latency (Figure 3a) and path length
(Figure 3b) displayed the same pattern. Beginning with the
third trial, all groups demonstrated a decrease in the escape la-
tency and began to travel at a shorter path length. After the 14th
trial, the graph showed a stable pattern of escape latency and
path length for all groups. These indicated that on the fourth
day, the rats of all groups have learned the escape procedure.
The BCCO group required the longest latency to find the plat-
form compared to any other groups in most trials except for
trials 1, 9, 10, and 15. The BCCO group also traveled at the far-
thest distance in most trials except for trials 1, 3, 7, and 8. In the
last trial, the BCCO group took the longest escape latency and
path length to reach the platform compared to all other groups
of rats.

TABLE 1 Primer list and PCR conditions

No. Gene Forward Reverse PCR condition

1. GAPDH GGCACAGTCAAGGCTGAGAATG TCTCGCTCCTGGAAGATGGTGA 94°C 10 s, 57°C 20 s
72°C 1 min, 35 cycles
2. SOD2 ATGTTGTGTCGGGCGGCGTGCAGC GCGCCTCGTGGTACTTCTCCTCGGTG 94°C 10 s, 65°C 1 min
72°C 1 min, 35 cycles
3. SOD1 GCGGTGAACCAGTTGTGGTG AGCCACATTGCCCAGGTCTC 94°C 10 s, 60°C 20 s
72°C 1 min, 40 cycles
4. GPx CTCT CGCGGTGGCACAGT CCACCACCGGGTCGGACATA C 94°C 10 s, 62°C 20 s
72°C 1 min, 35 cycles
5. Bcl2 TTGTGGCCTTCTTTGAGTTCG TACTGCTTTAGTGAACCTTTTT 95°C 15 s, 60°C 1 min
72°C 1 min, 40 cycles
6. BAX AGACAGGGGCCTTTTTGTTAC GAGGACTCCAGCCACAAAGAT 95°C 15 s, 60°C 1 min
72°C 1 min, 40 cycles
7. Caspase-3 CCG ACT TCC TGT ATG CTT ACT C CGT ACA GTT TCA GCA TGG C 94°C 10 s, 56°C 1 min
72°C 1 min, 35 cycles
8. ET-1 GCTCCTGCTCCTCCTTGATG CTCGCTCTATGTAAGTCATGG 94°C 10 s, 55°C 20 s
72°C 1 min, 35 cycles
9. eNOS CCGGCGCTACGAAGAATG AGTGCCACGGATGGAAATT 94°C 10 s, 54°C 20 s
72°C 1 min, 35 cycles
10. CD31 CCCAGTGACATTCACAGACA ACCTTGACCCTCAGGATCTC 94°C 10 s, 54°C 20 s
72°C 1 min, 35 cycles
11. VEGF‐A ACCTCCACCATGCCAAGT TTGGTCTGCATTCACATCTG 94°C 10 s, 65°C 1 min
72°C 1 min, 35 cycles
HERMAWATI et al.   
| 7

F I G U R E 3 Spatial memory test using Morris water maze. (a) Means ± SEM of escape latency in the escape acquisition phase of the Morris
water maze test (*p < .05, BCCO compared to CGA15, CGA30, and CGA60). (b) Means ± SEM of path length in the escape acquisition phase of
the Morris water maze test (*p < .05, SO compared to CGA30 and CGA60, and BCCO compared to CGA30 in trial 1; SO and BCCO compared to
CGA15, CGA30, and CGA60 in trial 2). (c) The percentages of time in the target quadrant during the retention phase of the Morris water maze test
(*p < .05, BCCO compared to SO, CGA15, CGA30, and CGA60). (d) The percentages of path length in the target quadrant during the retention
phase of the Morris water maze test (*p < .05, BCCO compared to SO, CGA15, CGA30, and CGA60)

The Kruskal–Wallis test revealed that the BCCO group
spent a significantly longer escape latency than the CGA15,
CGA30, and CGA60 groups (p = .018) in trial 2. The one‐way
ANOVA showed significant differences between groups in the
path length in trial 1 (p = .043; df = 4, 50; F = 2.662) and trial
2 (p = .006; df = 4, 50; F = 4.110). The LSD post hoc test
showed that the SO group traveled at a longer swimming trajec-
tory than the CGA30 (p = .008) and CGA60 groups (p = .044),
while the BCCO group had a longer swimming trajectory than
the CGA30 group (p = .019) in trial 1. In addition, the SO and
BCCO groups followed a longer swimming trajectory than the
CGA15, CGA30, and CGA60 groups (p = .06) in trial 2. There
were no significant differences between groups in the escape
latency and path length in any other trials.
One‐way ANOVA of the memory retention phase data
demonstrated significant differences between groups in the
percentages of latency (p = .003; df = 4, 50; F = 4.505) and
path length (p = .002; df = 4, 50; F = 4.830). The percentages
of latency and path length in the target quadrant of the BCCO
group were lower than those of other groups as shown by LSD
post hoc test (Figure 3c and d). It was concluded that CGA
improves memory retention function in the TGI model at all
doses. The sensorimotor test with a visible platform showed no
significant differences between groups in all trials. Therefore,
the results of the Morris water maze test might truly represent
the spatial memory function (Hermawati, 2018).
3.2 | CGA inhibits neuronal loss of CA1
pyramidal cells of hippocampus
The estimated volume, numerical density, and total number
of pyramidal cells in the CA1 area of the hippocampus of
rats are presented in Table 2. The one‐way ANOVA proce-
dure of these data revealed that the estimated total number
8
|    HERMAWATI et al.

of pyramidal cells in the CA1 area of the BCCO and CGA15

groups was significantly lower than that of the CGA30 and

CE2tot ∕CV2tot = 0.221

CGA60 groups (p = .026; df = 4, 25; F = 3.316).

CEtot = 0.122
CE (cells) Table 3 shows the estimated volume, numerical density,

BCCO, bilateral common carotid occlusion; CGA, chlorogenic acid; CGA15, BCCO + CGA15 mg/kg bw ip; CGA30, BCCO + CGA 30 mg/kg bw ip; CGA60, BCCO + CGA 60 mg/kg bw ip; SO, sham‐operated.
0.128 and total number of pyramidal cells in the CA2–CA3 area of
0.129
0.126
0.103
0.122
the hippocampus of rats. The one‐way ANOVA procedure
of these data showed no significant main effect of groups
(p = .522; df = 4, 25; F = 0.825). It was concluded that CGA

CVbiol = 0.052
CVtot = 0.259
inhibits CA1 pyramidal cell death in the hippocampus at
CV (cells)

moderate and high doses.

As can be seen from Tables 2 and 3, the sampling strategy
0.213
0.283
0.390
0.171
0.170

of the stereological procedure was considered optimal since

the CE2total ∕CV2total was 0.221 and 0.292 for the estimation of
Total pyramidal cells

the number of pyramidal cells in the CA1 and CA2–CA3 re-

One‐way ANOVA
a

gions, respectively (Hermawati, 2018).

104.460 ± 16.644
146.522 ± 10.256
125.449 ± 10.916

145.591 ± 10.126
99.568 ± 11.515
Estimated volume, numerical density, and total pyramidal cell number (mean ± SEM) in the CA1 area of the hippocampus of rats

F = 3.316

3.3 | CGA increases Bcl2 expression

df = 4,25

p = .026

The effects of CGA on apoptotic regulators were assessed

by measuring the mRNA expressions of Bcl2, Bax, and cas-
395.953 ± 26.358
482.113 ± 30.077
431.423 ± 13.096
387.991 ± 39.198

553.963 ± 19.095

pase‐3 proteins (Figure 4). One‐way ANOVA of the log10‐

transformed data of mRNA expression of Bcl2 demonstrated
a significant main effect of groups (p = .021; df = 4, 11;
Nv (mm3)

F = 4.506). The LSD post hoc test showed that the mRNA
expression of Bcl2 of the BCCO group was lower than that
of the CGA15 (p = .013), CGA30 (p = .032), and CGA60
CE2tot ∕CV2tot = 0.111

groups (p = .004). The CGA60 group had a higher Bcl2 ex-

CEtot = 0.095

pression than the SO group (p = .018). The Kruskal–Wallis

test showed that there was no significant difference between
CE (vol)

0.080
0.083
0.097
0.116

0.095

groups in Bax mRNA expression (p = .200). However, the

Bax expression tended to be higher in the BCCO group than
in all other groups. There was also no significant difference
between groups in the caspase‐3 expression in one‐way
CVbiol = 0.072
CVtot = 0.286

ANOVA (p = .156; df = 4, 13; F = 1.988). Therefore, CGA

CV (vol)

may affect apoptotic process by increasing Bcl2 expression

0.434
0.187
0.193
0.298

0.244

(Hermawati, 2018).
p < .05 compared to the BCCO and CGA15 groups.

3.4 | CGA increases SOD2 expression

Volume (mm3)

0.268 ± 0.047
0.308 ± 0.023
0.290 ± 0.022
0.265 ± 0.032

0.266 ± 0.026

The effects of CGA on antioxidant enzymes were inves-

tigated by measuring the mRNA expressions of SOD2,
SOD1, and GPx proteins (Figure 5). One‐way ANOVA
of these data showed significant differences between
groups in mRNA expression of SOD2 (p = .003; df = 4,
11; F = 8.227). The LSD post hoc test revealed that
mRNA expression of SOD2 of the SO group was lower
than that of the CGA30 (p = .042) and CGA60 groups
n

6
6
6
6

(p = .045), and that of the BCCO group was lower than

that of the SO (p = .042), CGA15 (p = .001), CGA30
(p = .001), and CGA60 (p = .001) groups. The mRNA
TABLE 2

expressions of SOD1 (p = .844 in Kruskal–Wallis test)

CGA15
CGA30
CGA60
Group

BCCO

and GPx (p = .053; df = 4, 14; F = 3.049 in one‐way

SO

ANOVA) did not differ between groups. Nevertheless,

HERMAWATI et al.   
| 9

there was a tendency of lower GPx expression in the

CE2tot ∕CV2tot = 0.292

BCCO group compared to the SO, CGA15, CGA30,

CEtot = 0.114
and CGA60 groups. Thus, CGA may increase SOD2
CE (cells)
expression without affecting other antioxidant enzymes

BCCO, bilateral common carotid occlusion; CGA, chlorogenic acid; CGA15, BCCO + CGA15 mg/kg bw ip; CGA30, BCCO + CGA 30 mg/kg bw ip; CGA60, BCCO + CGA 60 mg/kg bw ip; SO, sham‐operated.
(Hermawati, 2018).
0.127
0.116
0.112
0.109
0.105
3.5 | CGA affects vascular responses by
decreasing ET-1 expression and increasing

CVbiol = 0.031
CVtot = 0.212
CD31 expression
CV (cells)
0.261
0.158
0.290
0.159
0.146
Figure 6 presents the mRNA expression of ET‐1, eNOS, CD31,
and VEGF‐A. One‐way ANOVA of the log10‐transformed data
of mRNA expression of ET‐1 demonstrated that the mRNA ex-
Total pyramidal cells

pression of ET‐1 was higher in the BCCO and CGA15 groups

Estimated volume, numerical density, and total pyramidal cell number (mean ± SEM) in the CA2–CA3 area of the hippocampus of rats

One‐way ANOVA

than in the SO, CGA30, and CGA60 groups (p = .002; df = 4,

94.081 ± 10.054
81.699 ± 5.281
80.870 ± 9.587
94.463 ± 6.169
83.011 ± 4.978

19; F = 5.773). There was no significant difference between

F = 0.825

groups in the mRNA expression of eNOS (p = .265; df = 4,

df = 4.25

p = .522

15; F = 1.456). However, there was a tendency that the BCCO

group had lower eNOS mRNA expression than the CGA15,
CGA30, and CGA60 groups. CGA may affect vascular remod-
236.923 ± 14.678

226.361 ± 25.054
246.659 ± 14.687

eling in the TGI model by decreasing ET‐1 expression.

227.439 ± 8.620

270.390 ± 7.858

In addition to vasodilatory and vasoconstrictive re-

Nv (mm3)

sponses, this study also assessed CD31 as an endothelial

marker (Figure 6). One‐way ANOVA of the log10‐trans-
formed data of mRNA expression of CD31 demonstrated
significant differences between groups (p = .031; df = 4, 15;
CE2tot ∕CV2tot = 0.131

F = 3.563). The mRNA expression of CD31 in the BCCO

CEtot = 0.081

group was lower than that in the CGA15 (p = .003), CGA30

CE (vol)

(p = .025), and CGA60 groups (p = .049). Additionally, the

0.087
0.053
0.085
0.108
0.061

LSD post hoc test showed that the CD31 expression in the
SO group was lower than in the CGA15 group (p = .036).
It was assumed that CGA protected endothelial cells in the
TGI model, and this might be shown by the increase in CD31
CVbiol = 0.043
CVtot = 0.225

expression.
CV (vol)

The one‐way ANOVA procedure demonstrated that there

0.201
0.136
0.357
0.165
0.196

was no significant difference between groups in the mRNA

expression of VEGF‐A (p = .203; df = 4, 14; F = 1.714).
Nevertheless, there was a tendency of higher VEGF‐A ex-
Volume (mm3)

pression in the CGA15, CGA30, and CGA60 groups than the

0.395 ± 0.032
0.359 ± 0.020
0.376 ± 0.048
0.386 ± 0.026
0.309 ± 0.024

BCCO group (Hermawati, 2018).

4 | DISCUSSION

To the best of our knowledge, our research is the first study

that has investigated the effects of CGA on the spatial mem-
ory and the number of hippocampal pyramidal cells in the
n
6
6
6
6
6

TGI model of rats. It has been found that the spatial memory
retention was decreased in TGI‐treated rats (BCCO group)
but not in any other treated group. Accordingly, the num-
TABLE 3

ber of hippocampal pyramidal cells in the CA1 region of the

CGA15
CGA30
CGA60
Group

BCCO

BCCO and CGA15 groups was lower than that of the CGA30
SO

and CGA60 groups. It might be that CGA protects pyramidal

10
|    HERMAWATI et al.
cells by increasing the mRNA expressions of the apoptotic
regulator Bcl2, the antioxidant enzyme SOD2, and the en-
dothelial marker CD31, as well as by decreasing the mRNA
expression of the vasoconstrictor ET‐1.
The present study lends support to previous studies (Auer,
Jensen, & Whishaw, 1989; Bendel et al., 2005; Hartman,
Lee, Zipfel, & Wozniak, 2005; Quintard et al., 2011; Soares,
Schiavon, Milani, & de Oliveira, 2013) which have demon-
strated that BCCO‐induced TGI model disrupts the spatial
memory. CGA reversed this deficit in the spatial memory
retention as shown in the better performance of the CGA15,
CGA30, and CGA60 groups compared to the BCCO group.
This finding is in agreement with previous studies which
showed that CGA improved the spatial memory of scopol-
amine (Kwon et al., 2010)‐ and artificial‐aging (senescence
accelerated mouse; Han, Miyamae, Shigemori, & Isoda,
2010)‐induced memory deterioration in rodents. The im-
provement of the spatial memory might be partly contrib-
uted by the possible protective effects of CGA on the CA1
hippocampal pyramidal cells from cell death initiated by
the ischemia/reperfusion injury. Other studies reported that
CGA protected neuronal cells in cell culture from gluta-
mate (Mikami, Kakizawa, & Yamazawa, 2016; Mikami &
Yamazawa, 2015), H2O2 (Cho et al., 2009; Mikami et al.,
2016), methyl mercury (Mikami et al., 2016), and aluminum
(Wang et al., 2017) toxicity.
Although there was a study on the effect of CGA on the
hippocampal tissue of focal ischemic model mice (Miao,
Cao, Li, Fang, & Miao, 2017), it seems that up to the pres-
ent, there is no study that quantitatively assesses the hip-
pocampal pyramidal cell number of rats treated with CGA
F I G U R E 4 mRNA expressions
of Bcl2 (a), Bax (b), and caspase-3 (c)
(means ± SEM); *p < .05, CGA15 and
CGA30 compared to the BCCO group, and
CGA60 compared to the SO and BCCO
groups
following artificial brain ischemia. The unbiased stereology
procedure was used in this study to estimate the number
of hippocampal pyramidal cells. The present study found
that the number of pyramidal cells in the CA1 area of the
SO group was 125,449. This figure was close to that ob-
served in another study using the same procedure, which
was 152,700 pyramidal cells in the CA1 region of 30‐day‐
old male Wistar rats (Miki et al., 2005). The present study
showed that there was no difference between groups in the
number of pyramidal cells of the CA2–CA3 region, whereas
there were differences between groups in that of the CA1
region. The groups with moderate and high doses of CGA
had more pyramidal cell counts than the low‐dose CGA and
BCCO groups. The number of pyramidal cells in the SO
group was not significantly different from that in the me-
dium‐ and high‐dose CGA groups. This finding is consistent
with studies suggesting that the hippocampal CA1 region
is more susceptible to ischemia than the CA2–CA3 region
(Auer et al., 1989; Bendel et al., 2005; Bernaudin, Nouvelot,
MacKenzie, & Petit, 1998; Hwang et al., 2005).
The vulnerability of the hippocampal CA1 area is due to
several factors. In this area, the NMDA glutamate receptor
density is higher than that in the CA3 area (Butler et al., 2010).
The NMDA receptors in the CA1 area are more responsive
to oxygen–glucose deprivation than those in the CA3 area.
The NMDA receptors in the CA1 area activate tyrosine kinase
pathways, while those in the CA3 area activate tyrosine phos-
phatase pathways. Tyrosine phosphatase activity prevents the
NMDA receptor upregulation in CA3 cells (Gee et al., 2006).
An induction of NMDA receptors in the CA1 area leads to a
greater increase in Ca2+ levels than that in the CA3 area. This
HERMAWATI et al.   
| 11

F I G U R E 5 mRNA expressions
of SOD2 (a), SOD1 (b), and GPx (c)
antioxidant enzymes (means ± SEM).
*p < .05, BCCO compared to the SO,
CGA15, CGA30, and CGA60 groups, and
SO compared to the CGA30 and CGA60
groups

F I G U R E 6 mRNA expressions of
ET-1 (a) (*p < .05, BCCO and CGA15
compared to the SO, CGA15, CGA30,
and CGA60 groups), eNOS (b), CD31 (c)
(*p < .05, SO compared to CGA15, and
BCCO compared to CGA15, CGA30, and
CGA60), and VEGF‐A (d) (means ± SEM)

intracellular Ca2+ increase may cause an intracellular accumu-
lation that will result in mitochondrial damage and induce cel-
lular apoptosis (Li et al., 2000; Stanika, Winters, Pivovarova,
& Andrews, 2010). It has also been found that mitochondria
isolated from cells of the CA1 region release more ROS than
those of the CA3 region (Wang & Michaelis, 2010). This po-
tentially causes greater oxidative damage in the CA1 region
than in the CA3 region. In hypoxic conditions, neurons in the
CA1 region express JunB, p53, and Bax more than those in the
CA3 region. In contrast, neurons in the CA3 region and the
dentate gyrus express Bcl2 and Bcl‐XL more than those in the
CA1 region (Banasiak, Xia, & Haddad, 2000).
Chlorogenic acid is a class of the polyphenol group that
has antioxidant properties (Bonita, Mandarano, Shuta, &
12
|    HERMAWATI et al.
Vinson, 2007; Esquivel & Jiménez, 2012). It reaches its blood
level peak within 15 min after intravenous administration
(Wan et al., 2010), whereas its maximum level in plasma is
13.33 min with the half‐life of 59.1 min following ip injection
(Yuan, Qiao, Xu, Wang, & Li, 2006). The bioavailability of
CGA after oral administration is poor due to the first pass
metabolism by the liver and the degradation by normal flora
in the digestive tract (Gonthier, Verny, Besson, Remesy, &
Scalbert, 2003). An ip dose of 30 mg/kg bw of CGA was re-
ported to exert positive effects on brain damage due to focal
ischemia as indicated by the improvement in the infarct vol-
ume and behavioral score (Lee et al., 2012). CGA improved
the behavioral function if administered within 5 min up to 1 h
after the onset of brain ischemia in the rabbit small clot em-
bolic stroke model (RSEM; Lapchak, 2007). Referring to all
of the above‐mentioned findings, the present study used pure
compound of CGA administered intraperitoneally, 30 min
after BCCO surgery, at a mid‐dose of 30 mg/kg bw. Multilevel
doses of 15, 30, and 60 mg/kg bw were determined for this
study in order to observe the dose–effect relationship.
The BCCO operation induces ischemia/reperfusion injury
(IR injury; Auer et al., 1989; Bendel et al., 2005; Quintard
et al., 2011; Soares et al., 2013), which consists of acute and
chronic phases (Fagan, Hess, Hohnadel, Pollock, & Ergul,
2004). The acute phase is characterized by the release of
apoptotic mediators (Eltzschig & Collard, 2004; Eltzschig &
Eckle, 2011). Our study demonstrated that the CGA‐treated
groups had higher mRNA expression of Bcl2, an anti‐apop-
totic protein, than the BCCO group. Furthermore, the mRNA
expression of Bcl2 was higher in the CGA60 than the SO
group. The alterations in this apoptosis regulator may inhibit
delayed neuronal death.
Delayed neuronal death usually occurs several days after
IR injury (Inagaki & Etgen, 2013; Movassaghi et al., 2012;
Quintard et al., 2011). Anticipating the occurrence of this cell
death, the present study performed hippocampal pyramidal
cell counting on the 10th day after BCCO procedure. In addi-
tion, it took several days for the rats to recover from the sur-
gery and another 6 days to perform the spatial memory test.
A previous study in our laboratory has also found that on the
10th day following BCCO operation, changes in the mRNA
expressions of SOD2, Bcl2, eNOS, ET‐1, and CD31 were still
detected (Hermawati, Arfian, Mustofa, & Partadiredja, 2018).
Pathological processes emerging in blood vessels follow-
ing IR injury can be divided into two phases, that is, acute
and chronic phases. In the acute phase, which occurs within
a few hours, ET‐1 and VEGF are released and affect the
blood–brain barrier permeability and vascular tone. During
the chronic phase, which starts within several days after IR
injury, apoptosis and angiogenesis occur (Fagan et al., 2004).
In the acute phase of IR injury, vascular tone is affected
by factors including ET‐1, NO, VEGF, and angiopoietin‐1.
ET‐1, one of these factors, is a vasoconstrictor (Fagan et al.,
2004). It has been reported that damaged endothelial cells
express ET‐1 higher than normal (Schaller, 2006). In the
present study, the BCCO group, which had low CD31 expres-
sion, demonstrated a high ET‐1 expression (Figure 6). High
ET‐1 levels also induce endothelial cell damage by affecting
NO metabolic pathways, thus increasing the oxidative stress
(Amiri et al., 2004; Davenport et al., 2016). ET‐1 secreted by
endothelium induces the growth of vascular smooth muscle
cells and the deposition of extracellular matrix, which in turn
results in vascular remodeling. The ET‐1 change in vascular
structure is shown by an increase in the wall and lumen ratio
of resistance arteries (Amiri et al., 2004).
Within hours of the acute phase, many inflammatory me-
diators are released to the ischemic tissue as sterile inflam-
matory responses to hypoxia (Shichita, Sakaguchi, Suzuki,
& Yoshimura, 2012). As a consequence of the reperfusion
phase, the level of free radicals increases and causes oxida-
tive stress due to the imbalance between the levels of free
radicals and antioxidant enzymes (Lakhan, Kirchgessner, &
Hofer, 2009; Mehta et al., 2007; Nakajima et al., 2012).
Oxidative stress may also play an important role in the
cell death following the brain ischemia (Lakhan et al., 2009;
Nakajima et al., 2012). An inability of the antioxidant system
to overcome free radicals may result in the damage of cellu-
lar proteins, DNA, and lipids (Mehta et al., 2007). Most of
these free radicals are present in the mitochondria as a con-
sequence of the electron transport chain. The first‐line de-
fense of antioxidant systems in the mitochondria is MnSOD
(SOD2), whereas that in the cytosol is SOD1 (Cu‐Zn SOD;
Ruszkiewicz & Albrecht, 2015).
Chlorogenic acid may inhibit oxidative stress‐induced cell
death by capturing free radicals. The phenol ring of CGA do-
nates hydrogen atoms to the free radicals and hence neutral-
izes them (Karthikesan, Pari, & Menon, 2010; Leopoldini,
Russo, & Toscano, 2011; Zang, Cosma, Gardner, Castranova,
& Vallyathan, 2003). CGA may also increase the expression
of antioxidant enzymes. Indeed, in this study, CGA increased
the mRNA expression of SOD2. There was no significant dif-
ference between groups in the GPx enzyme expression, but
there was a tendency that CGA increased the mRNA expres-
sion of GPx. These results corroborate the findings of other
studies on neuronal and mesenchymal stem cell culture that
CGA increased the expressions of SOD2 (Li et al., 2012) and
GPx (Li et al., 2008; Wang et al., 2017). However, the ad-
ministration of CGA did not affect the mRNA expression of
SOD1. This might be understood in light of the fact that most
of the emerging free radicals following ischemia are found
in mitochondria, where SOD2 is the first‐line defense of the
antioxidant enzymes (Ruszkiewicz & Albrecht, 2015). This
study revealed that the administration of CGA at the three
dose levels increased the mRNA expression of SOD2 enzyme
in the CGA‐treated groups as compared to the BCCO group.
Furthermore, CGA at doses of 30 and 60 mg/kg bw brought
HERMAWATI et al.
about the mRNA expression of SOD2 higher in the CGA30
and CGA60 groups than the SO group.
Cell deaths induced by ischemia/reperfusion injury occur
through apoptosis, autophagy, or necrosis (Puyal, Ginet, &
Clarke, 2013). The present study examined cell death path-
ways through the mRNA expressions of Bcl2, Bax, and
caspase‐3. It has been found that CGA protected hippocam-
pal pyramidal cells by increasing mRNA expression of Bcl2.
Other studies on neurons, mesenchymal stem cells, and liver
tissue cultures also demonstrated an increase in Bcl2 follow-
ing the administration of CGA (Ali et al., 2017; Fang et al.,
2016; Kim et al., 2012; Li et al., 2012; Shi et al., 2009). Bcl2
plays a role in protecting cells by inhibiting mitochondrial
permeability transition, forming bonds with pro‐apoptotic
proteins, inhibiting free radical formation, inhibiting Ca2+ in-
flux, and regulating intracellular pH (Banasiak et al., 2000).
Another regulator that influences cell death is Bax. Our
study found that there was no significant difference between
groups in the mRNA expression of Bax, but there was a
tendency that Bax expressions in the CGA15, CGA30, and
CGA60 groups were decreased. Under normal conditions,
Bax is present in the cytosol. Under stressful conditions, Bax
moves to the mitochondria and alters the stability of mito-
chondrial membranes and causes mitochondrial membrane
potential changes (Banasiak et al., 2000). Bax opens mito-
chondrial permeability transition pore (mPTP) located be-
tween the inner and the outer membrane of the mitochondria.
Further damage to the outer membrane of the mitochondria
brings about the release of various apoptotic factors, such as
cytochrome c, to the cytosol. This will induce cellular apop-
tosis whether it is caspase‐dependent or caspase‐free apopto-
sis (Lipton, 1999; Puyal et al., 2013).
There was no significant difference between groups
in the mRNA expression of caspase‐3. Caspase is known
to play a role in both intrinsic and extrinsic pathways of
apoptosis. However, there are also apoptotic pathways that
are caspase‐independent. The caspase‐independent apop-
tosis is triggered by the release of apoptosis‐inducing fac-
tor (AIF) and endonuclease G (endoG). These factors are
released from the mitochondria to the nucleus where they
trigger DNA damage (Puyal et al., 2013). Under cerebral
ischemia conditions, AIF is released by the activation of
PARP1 (Culmsee et al., 2005). In turn, AIF induces cell
death (Culmsee et al., 2005; Zhu et al., 2003, 2006). AIF
release occurs earlier than the release of cytochrome c
(Zhu et al., 2003). This might be the reason for the ab-
sence of the differences between groups in the mRNA
expression of caspase‐3. It is plausible that the neuronal
death occurred through a caspase‐independent pathway,
as has been reported that neurons in the hippocampal CA1
region suffered from cell death via a caspase‐independent
pathway following a global ischemia injury (Hua et al.,
2007).
  
| 13
An alternative of caspase‐independent pathway of cell
death is a necrosis pathway. During cerebral ischemia, many
free radicals are produced, and hence, Ca2+ ions easily enter
the neurons. Ischemic conditions lead to energy deficits,
which bring about the failure of the Ca‐ATPase pump to
drive Ca2+ ions out of the cells. This results in the accumu-
lation of Ca2+ ions in the cells. In turn, increased levels of
Ca2+ ions in the cells activate proteases, protein kinases, or
phospholipases. One of the proteases that is activated in the
cytosol is calpain (Hayashi & Abe, 2004; Ostwald, Hagberg,
Andine, & Karlsson, 1993). Subsequently, proteolysis oc-
curs, cytoskeletons degrade (Hayashi & Abe, 2004; Yokota
et al., 2003), and the neurons eventually die. It has been re-
ported that the proteolysis occurred within 15 min after the
ischemia in the putamen, parietal cortex, and hippocampal
CA1 region. On the seventh day after ischemia, only the
hippocampus still showed the proteolytic signs. This sug-
gests that the proteolysis in the hippocampal CA1 region oc-
curs slowly (Yokota et al., 2003), and this might explain the
phenomenon of delayed neuronal death in the hippocampus
after the brain ischemia. The present study found that such
neuronal death of CA1 pyramidal cells of the hippocampus
occurred 10 days after BCCO surgery as had been predicted
beforehand.
Other cells than neurons that are also susceptible to
ischemia are glial and endothelial cells (Chen et al., 2011;
Hayashi & Abe, 2004; Shichita et al., 2012). Our study found
that the expression of CD31, which is an endothelial cell
marker (Burger & Touyz, 2012), of the CGA15, CGA30,
and CGA60 groups was higher than that of the BCCO group.
Thus, CGA may protect blood vessels’ endothelium from the
deleterious effect of ischemia.
On the 7th day after ischemia, an angiogenesis pro-
cess involving angiopoietin‐1 and VEGF begins (Arai, Jin,
Navaratna, & Lo, 2009; Shen et al., 2014). In the acute phase,
VEGF increases the permeability of the blood–brain barrier.
In the later phase, VEGF triggers the endothelial response to
angiogenesis (Fagan et al., 2004). Considering this pattern
of VEGF actions on angiogenesis, this study measured the
mRNA expression of VEGF‐A on the 10th day.
VEGF‐A is considered to play a very important role in an-
giogenesis, which also occurs in ischemia/reperfusion injury
(Arai et al., 2009). VEGF induces the migration and prolif-
eration of endothelial cells and increases the vascular per-
meability during the tissue repair (Bagdas et al., 2014). No
significant difference between groups in the VEGF‐A expres-
sion was found in the present study. However, there was a ten-
dency of higher VEGF‐A expression in the CGA15, CGA30,
and CGA60 groups than in the BCCO group. Apparently
CGA exerts paradoxical effects on physiological and patho-
logical conditions (Bagdas et al., 2014; Park, Hwang, Park,
& Lee, 2015) In pathological conditions such as diabetic ret-
inopathy (Zhou et al., 2016) or adenocarcinoma cell culture
14
|    HERMAWATI et al.
(Park et al., 2015), CGA inhibits VEGF expression. On
the other hand, in physiological conditions, for example, in
wound repair or postischemia, CGA stimulates VEGF ex-
pression (Bagdas et al., 2014; Fagan et al., 2004).
In ischemic stroke, however, VEGF shows a biphasic
feature. In the acute phase, VEGF increases the blood–brain
barrier permeability. In the subacute and chronic phases, that
is, after a few days postischemia, VEGF is protective. It in-
duces re‐endothelialization of blood vessels. VEGF develops
normal endothelial functions and suppresses endothelial cell
damage via the phosphatidylinositol 3‐kinase pathway. VEGF
also stimulates neovascularization (Fagan et al., 2004). Our
study may lend support to this notion, since at 10 days after
the global ischemia of the brain, there was a slight increase in
VEGF expression following CGA administration. This may
signify an active angiogenesis process.
The chronic or recovery phase when angiogenesis occurs
involves the vasodilator eNOS, which plays a role in the pro-
liferation and differentiation of vascular smooth muscle cells
(Sawada & Liao, 2009). This leads to a vascular remodeling
response. This is also largely determined by ET‐1 as a vaso-
constrictor, the level of which increases with ischemia (Hung
et al., 2015; Leung, Ho, Lo, Chung, & Chung, 2004). In addi-
tion, eNOS as a vasodilator restores the blood flow after the
ischemia (Sawada & Liao, 2009). Ischemia/reperfusion injury
causes the vascular remodeling in the form of increased ET‐1
expression and decreased eNOS expression. This results in
an imbalance between vasoconstrictor and vasodilator levels,
as evidenced in the kidneys (Arfian et al., 2012). The present
study revealed that CGA lowered the ET‐1 expression, but
not the eNOS expression. Possibly, CGA affects the vascular
response through the vasoconstrictor ET‐1, but not through
the vasodilator eNOS.
Chlorogenic acid may prevent the spatial memory reten-
tion capability and the hippocampal CA1 pyramidal cells
from degeneration‐induced transient global ischemia. CGA
may exert these beneficial effects by increasing Bcl2 and
SOD2 expressions. Furthermore, CGA may affect the vas-
cular response in the global ischemia model by repairing
endothelial cell damage by increasing CD31 expression
and decreasing ET‐1 expression. It is acknowledged that
no comparison between CGA and drugs of standard ther-
apy for brain ischemia (e.g., tissue plasminogen activator,
piracetam, citicoline) was made in this study. Therefore,
another study may be directed toward such comparison.
Future studies on the effect of CGA on other mechanisms
of pyramidal cell death such as necrotic and caspase‐inde-
pendent pathways may also worth investigating.
ACKNOWLEDGEMENTS
This study was a part of Ery Hermawati's doctoral thesis.
The present study was funded by the Penelitian Unggulan
Perguruan Tinggi scheme of the Ministry of Research,
Technology and Higher Education (Grant Number 0299/
E3/2016). We would like to thank Suparno (Department
of Physiology, Faculty of Medicine, UGM), Suhardi
(Department of Histology and Cellular Biology, Faculty of
Medicine, UGM) and Wiwit Ananda, M.Sc (Department of
Anatomy, Faculty of Medicine, Public Health and Nursing,
UGM), for their technical assistances as well as Erik C.
Hookom for language editing.
CONFLICT OF INTEREST
The authors do not have conflicts of interest.
AUTHOR CONTRIBUTIONS
Ery Hermawati designed the experiment, conducted the
experiment, collected and analyzed data, as well as wrote
the manuscript. Nur Arfian designed the experiment and
analyzed and interpreted the data. Mustofa designed the ex-
periment and checked the interpretation of the data. Ginus
Partadiredja designed the experiment, interpreted the data,
wrote the manuscript and was responsible for final approval
of the version to be published.
DATA AVAILABILIT Y STATEMENT
Original data have been deposited in Figshare.
ORCID
Ery Hermawati https://orcid.org/0000-0002-4814-6178
Nur Arfian https://orcid.org/0000-0003-1694-2054
Mustofa Mustofa https://orcid.org/0000-0002-0522-8413
Ginus Partadiredja https://orcid.
org/0000-0003-0395-4240
R E F E R E NC E S
Agustina, F., Sofro, Z. M., & Partadiredja, G. (2019). Subchronic ad-
ministration of high‐dose sodium fluoride causes deficits in cere-
bellar Purkinje cells but not motor coordination of rats. Biological
Trace Element Research, 188, 424–433. https​ ://doi.org/10.1007/
s12011-018-1420-0
Ahn, E. H., Kim, D. W., Shin, M. J., Kwon, S. W., Kim, Y. N., Kim, D.
S., … Choi, S. Y. (2011). Chlorogenic acid improves neuroprotec-
tive effect of PEP‐1‐ribosomal protein S3 against ischemic insult.
Experimental Neurobiology, 20, 169–175. https​://doi.org/10.5607/
en.2011.20.4.169
Ali, N., Rashid, S., Nafees, S., Hasan, S. K., Shahid, A., Majed, F., &
Sultana, S. (2017). Protective effect of Chlorogenic acid against meth-
otrexate induced oxidative stress, inflammation and apoptosis in rat
liver: An experimental approach. Chemico‐Biological Interactions,
272, 80–91. https​://doi.org/10.1016/j.cbi.2017.05.002
HERMAWATI et al.
Amiri, F., Virdis, A., Neves, M. F., Iglarz, M., Seidah, N. G., Touyz,
R. M., … Schiffrin, E. L. (2004). Endothelium‐restricted overex-
pression of human endothelin‐1 causes vascular remodeling and
endothelial dysfunction. Circulation, 110, 2233–2240. https​://doi.
org/10.1161/01.CIR.00001​44462.08345.B9
Andersen, P., Morris, R., Amaral, D., Bliss, T., & O'Keefe, J. (Eds.)
(2007). The hippocampus book. New York, NY: Oxford University
Press.
Arai, K., Jin, G., Navaratna, D., & Lo, E. H. (2009). Brain angiogenesis
in developmental and pathological processes: Neurovascular injury
and angiogenic recovery after stroke. The FEBS Journal, 276, 4644–
4652. https​://doi.org/10.1111/j.1742-4658.2009.07176.x
Arfian, N., Emoto, N., Vignon‐Zellweger, N., Nakayama, K., Yagi, K.,
& Hirata, K. (2012). ET‐1 deletion from endothelial cells protects
the kidney during the extension phase of ischemia/reperfusion in-
jury. Biochemical and Biophysical Research Communications, 425,
443–449. https​://doi.org/10.1016/j.bbrc.2012.07.121
Auer, R. N., Jensen, M. L., & Whishaw, I. Q. (1989). Neurobehavioral
deficit due to ischemic brain damage limited to half of the CA1 sec-
tor of the hippocampus. The Journal of Neuroscience, 9, 1641–1647.
https​://doi.org/10.1523/JNEUR​OSCI.09-05-01641.1989
Bagdas, D., Cam Etoz, B., Inan Ozturkoglu, S., Cinkilic, N., Ozyigit,
M. O., Gul, Z., … Gurun, M. S. (2014). Effects of systemic chlo-
rogenic acid on random‐pattern dorsal skin flap survival in diabetic
rats. Biological & Pharmaceutical Bulletin, 37, 361–370. https​://
doi.org/10.1248/bpb.b13-00635​
Banasiak, K. J., Xia, Y., & Haddad, G. G. (2000). Mechanisms underly-
ing hypoxia‐induced neuronal apoptosis. Progress in Neurobiology,
62, 215–249. https​://doi.org/10.1016/S0301-0082(00)00011-3
Bear, M., Connors, B., & Paradiso, M. (2007). Neuroscience exploring
the brain. Philadelphia, PA: Lippincott Williams & Wilkins.
Bendel, O., Bueters, T., von Euler, M., Ove Ogren, S., Sandin, J., &
von Euler, G. (2005). Reappearance of hippocampal CA1 neurons
after ischemia is associated with recovery of learning and memory.
Journal of Cerebral Blood Flow and Metabolism, 25, 1586–1595.
https​://doi.org/10.1038/sj.jcbfm.9600153
Bernaudin, M., Nouvelot, A., MacKenzie, E. T., & Petit, E. (1998).
Selective neuronal vulnerability and specific glial reactions in hip-
pocampal and neocortical organotypic cultures submitted to isch-
emia. Experimental Neurology, 150, 30–39. https​://doi.org/10.1006/
exnr.1997.6728
Bonita, J. S., Mandarano, M., Shuta, D., & Vinson, J. (2007). Coffee and
cardiovascular disease: In vitro, cellular, animal, and human studies.
Pharmacological Research, 55, 187–198. https​://doi.org/10.1016/j.
phrs.2007.01.006
Bouet, V., Freret, T., Ankri, S., Bezault, M., Renolleau, S., Boulouard,
M., … Schumann‐Bard, P. (2010). Predicting sensorimotor and
memory deficits after neonatal ischemic stroke with reperfusion
in the rat. Behavioural Brain Research, 212, 56–63. https​://doi.
org/10.1016/j.bbr.2010.03.043
Boyce, R. W., Dorph‐Petersen, K. A., Lyck, L., & Gundersen, H. J.
(2010). Design‐based stereology: Introduction to basic concepts
and practical approaches for estimation of cell number. Toxicologic
Pathology, 38, 1011–1025. https​://doi.org/10.1177/01926​23310​
385140
Buch, P., Patel, V., Ranpariya, V., Sheth, N., & Parmar, S. (2012).
Neuroprotective activity of Cymbopogon martinii against cere-
bral ischemia/reperfusion‐induced oxidative stress in rats. Journal
of Ethnopharmacology, 142, 35–40. https​ ://doi.org/10.1016/j.
jep.2012.04.007
  
| 15
Burger, D., & Touyz, R. M. (2012). Cellular biomarkers of endothelial
health: Microparticles, endothelial progenitor cells, and circulating
endothelial cells. Journal of the American Society of Hypertension,
6, 85–99. https​://doi.org/10.1016/j.jash.2011.11.003
Butler, T. R., Self, R. L., Smith, K. J., Sharrett‐Field, L. J., Berry,
J. N., Littleton, J. M., … Prendergast, M. A. (2010). Selective
vulnerability of hippocampal cornu ammonis 1 pyramidal cells
to excitotoxic insult is associated with the expression of poly-
amine‐sensitive N‐methyl‐D‐asparate‐type glutamate receptors.
Neuroscience, 165, 525–534. https​://doi.org/10.1016/j.neuro​scien​
ce.2009.10.018
Chen, H., Yoshioka, H., Kim, G. S., Jung, J. E., Okami, N., Sakata, H.,
… Chan, P. H. (2011). Oxidative stress in ischemic brain damage:
Mechanisms of cell death and potential molecular targets for neuro-
protection. Antioxidants & Redox Signaling, 14, 1505–1517. https​://
doi.org/10.1089/ars.2010.3576
Cho, E. S., Jang, Y. J., Hwang, M. K., Kang, N. J., Lee, K. W., & Lee,
H. J. (2009). Attenuation of oxidative neuronal cell death by coffee
phenolic phytochemicals. Mutation Research, 661, 18–24. https​://
doi.org/10.1016/j.mrfmmm.2008.10.021
Culmsee, C., Zhu, C., Landshamer, S., Becattini, B., Wagner, E.,
Pellecchia, M., … Plesnila, N. (2005). Apoptosis‐inducing factor
triggered by poly(ADP‐ribose) polymerase and Bid mediates neu-
ronal cell death after oxygen‐glucose deprivation and focal cerebral
ischemia. The Journal of Neuroscience, 25, 10262–10272. https​://
doi.org/10.1523/JNEUR​OSCI.2818-05.2005
Davenport, A. P., Hyndman, K. A., Dhaun, N., Southan, C., Kohan, D. E.,
Pollock, J. S., … Maguire, J. J. (2016). Endothelin. Pharmacological
Reviews, 68, 357–418. https​://doi.org/10.1124/pr.115.011833
Eltzschig, H. K., & Collard, C. D. (2004). Vascular ischaemia and
reperfusion injury. British Medical Bulletin, 70, 71–86. https​://doi.
org/10.1093/bmb/ldh025
Eltzschig, H. K., & Eckle, T. (2011). Ischemia and reperfusion–from
mechanism to translation. Nature Medicine, 17, 1391–1401. https​://
doi.org/10.1038/nm.2507
Esquivel, P., & Jiménez, V. M. (2012). Functional properties of coffee
and coffee by‐products. Food Research International, 46, 488–495.
https​://doi.org/10.1016/j.foodr​es.2011.05.028
Fagan, S. C., Hess, D. C., Hohnadel, E. J., Pollock, D. M., & Ergul, A. (2004).
Targets for vascular protection after acute ischemic stroke. Stroke, 35,
2220–2225. https​://doi.org/10.1161/01.STR.00001​38023.60272.9e
Fang, S. Q., Wang, Y. T., Wei, J. X., Shu, Y. H., Xiao, L., & Lu, X. M.
(2016). Beneficial effects of chlorogenic acid on alcohol‐induced
damage in PC12 cells. Biomedicine & Pharmacotherapy, 79, 254–
262. https​://doi.org/10.1016/j.biopha.2016.02.018
Gee, C. E., Benquet, P., Raineteau, O., Rietschin, L., Kirbach,
S. W., & Gerber, U. (2006). NMDA receptors and the differ-
ential ischemic vulnerability of hippocampal neurons. The
European Journal of Neuroscience, 23, 2595–2603. https​ ://doi.
org/10.1111/j.1460-9568.2006.04786.x
Gibbons, G. H., & Dzau, V. J. (1994). The emerging concept of vas-
cular remodeling. The New England Journal of Medicine, 330,
1431–1438.
Gonthier, M. P., Verny, M. A., Besson, C., Remesy, C., & Scalbert, A.
(2003). Chlorogenic acid bioavailability largely depends on its me-
tabolism by the gut microflora in rats. The Journal of Nutrition, 133,
1853–1859. https​://doi.org/10.1093/jn/133.6.1853
Greenberg, D. A., & Jin, K. (2013). Vascular endothelial growth fac-
tors (VEGFs) and stroke. Cellular and Molecular Life Sciences, 70,
1753–1761. https​://doi.org/10.1007/s00018-013-1282-8
16
|    HERMAWATI et al.
Gundersen, H. J. G. (1977). Notes on the estimation of the numerical
density of arbitrary profiles: The edge effect. Journal of Microscopy,
111, 219–223. https​://doi.org/10.1111/j.1365-2818.1977.tb000​62.x
Gundersen, H. J. (1986). Stereology of arbitrary particles. A review
of unbiased number and size estimators and the presentation of
some new ones, in memory of William R. Thompson. Journal of
Microscopy, 143, 3–45. https​://doi.org/10.1111/j.1365-2818.1986.
tb027​64.x
Gundersen, H. J., & Jensen, E. B. (1987). The efficiency of systematic
sampling in stereology and its prediction. Journal of Microscopy,
147, 229–263. https​://doi.org/10.1111/j.1365-2818.1987.tb028​37.x
Hartman, R. E., Lee, J. M., Zipfel, G. J., & Wozniak, D. F. (2005).
Characterizing learning deficits and hippocampal neuron loss fol-
lowing transient global cerebral ischemia in rats. Brain Research,
1043, 48–56. https​://doi.org/10.1016/j.neuro​scien​ce.2010.05.049
Han, J., Miyamae, Y., Shigemori, H., & Isoda, H. (2010). Neuroprotective
effect of 3,5‐di‐O‐caffeoylquinic acid on SH‐SY5Y cells and senes-
cence‐accelerated‐prone mice 8 through the up‐regulation of phos-
phoglycerate kinase‐1. Neuroscience, 169, 1039–1045. https​://doi.
org/10.1016/j.neuro​scien​ce.2010.05.049
Hatakeyama, T., Matsumoto, M., Brengman, J. M., & Yanagihara,
T. (1988). Immunohistochemical investigation of ischemic
and postischemic damage after bilateral carotid occlusion in
gerbils. Stroke, 19, 1526–1534. https​ ://doi.org/10.1161/01.
STR.19.12.1526
Hayashi, T., & Abe, K. (2004). Ischemic neuronal cell death and or-
ganellae damage. Neurological Research, 26, 827–834. https​://doi.
org/10.1179/01616​4104X​3770
Hermawati, E. (2018). Pengaruh Asam Klorogenat Terhadap Struktur
dan Fungsi Hippocampus pada Tikus Model Iskemia Global
Transien (Kajian terhadap Fungsi Memori Spasial, Jumlah Sel
Piramidal dan Respon Vaskuler). Indonesia: Universitas Gadjah
Mada.
Hermawati, E., Arfian, N., Mustofa, & Partadiredja, G. (2018). Spatial
memory disturbance following transient brain ischemia is associated
with vascular remodeling in hippocampus. Kobe Journal of Medical
Sciences, 64(3), E93–E106.
Hermawati, E., Sari, D. C., & Partadiredja, G. (2015). The effects of
black garlic ethanol extract on the spatial memory and estimated
total number of pyramidal cells of the hippocampus of monoso-
dium glutamate‐exposed adolescent male Wistar rats. Anatomical
Science International, 90, 275–286. https​ ://doi.org/10.1007/
s12565-014-0262-x
Howard, C., & Reed, M. (2005). Unbiased stereology three‐dimen-
sional measurement in microscopy. New York, NY: BIOS Scientific
Publishers.
Hua, F., Ma, J., Ha, T., Xia, Y., Kelley, J., Williams, D. L., … Li, C.
(2007). Activation of Toll‐like receptor 4 signaling contributes to
hippocampal neuronal death following global cerebral ischemia/
reperfusion. Journal of Neuroimmunology, 190, 101–111. https​://
doi.org/10.1016/j.jneur​oim.2007.08.014
Hung, V. K., Yeung, P. K., Lai, A. K., Ho, M. C., Lo, A. C., Chan, K.
C., … Chung, S. K. (2015). Selective astrocytic endothelin‐1 over-
expression contributes to dementia associated with ischemic stroke
by exaggerating astrocyte‐derived amyloid secretion. Journal of
Cerebral Blood Flow and Metabolism, 35, 1687–1696. https​://doi.
org/10.1038/jcbfm.2015.109
Hwang, I. K., Kim, D. W., Yoo, K. Y., Jung, B. K., Song, J. H., Jung,
J. Y., … Won, M. H. (2005). Ischemia‐induced changes of platelet
endothelial cell adhesion molecule‐1 in the hippocampal CA1 region
in gerbils. Brain Research, 1048, 251–257. https​://doi.org/10.1016/j.
brain​res.2005.04.049
Inagaki, T., & Etgen, A. M. (2013). Neuroprotective action of acute
estrogens: Animal models of brain ischemia and clinical impli-
cations. Steroids, 78, 597–606. https​ ://doi.org/10.1016/j.stero​
ids.2012.12.015
Ito, H., Sun, X. L., Watanabe, M., Okamoto, M., & Hatano, T. (2008).
Chlorogenic acid and its metabolite m‐coumaric acid evoke neurite
outgrowth in hippocampal neuronal cells. Bioscience, Biotechnology,
and Biochemistry, 72, 885–888. https​://doi.org/10.1271/bbb.70670​
Kandel, E., Schwartz, J., & Jessel, T. (2000). Principles of neural sci-
ence. New York, NY: McGraw‐Hill.
Karthikesan, K., Pari, L., & Menon, V. P. (2010). Protective effect
of tetrahydrocurcumin and chlorogenic acid against streptozo-
tocin–nicotinamide generated oxidative stress induced diabetes.
Journal of Functional Foods, 2, 134–142. https​://doi.org/10.1016/j.
jff.2010.04.001
Kim, J., Lee, S., Shim, J., Kim, H. W., Kim, J., Jang, Y. J., … Lee,
H. J. (2012). Caffeinated coffee, decaffeinated coffee, and the phe-
nolic phytochemical chlorogenic acid up‐regulate NQO1 expres-
sion and prevent H(2)O(2)‐induced apoptosis in primary cortical
neurons. Neurochemistry International, 60, 466–474. https​://doi.
org/10.1016/j.neuint.2012.02.004
Kwon, S. H., Lee, H. K., Kim, J. A., Hong, S. I., Kim, H. C., Jo, T. H., …
Jang, C. G. (2010). Neuroprotective effects of chlorogenic acid on
scopolamine‐induced amnesia via anti‐acetylcholinesterase and anti‐
oxidative activities in mice. European Journal of Pharmacology,
649, 210–217. https​://doi.org/10.1016/j.ejphar.2010.09.001
Lafay, S., Morand, C., Manach, C., Besson, C., & Scalbert, A. (2006).
Absorption and metabolism of caffeic acid and chlorogenic acid
in the small intestine of rats. The British Journal of Nutrition, 96,
39–46. https​://doi.org/10.1079/BJN20​061714
Lakhan, S. E., Kirchgessner, A., & Hofer, M. (2009). Inflammatory
mechanisms in ischemic stroke: Therapeutic approaches. Journal of
Translational Medicine, 7, 1–11.
Lapchak, P. A. (2007). The phenylpropanoid micronutrient chlorogenic
acid improves clinical rating scores in rabbits following multiple in-
farct ischemic strokes: synergism with tissue plasminogen activator.
Experimental Neurology, 205, 407–413.
Lee, K., Lee, J. S., Jang, H. J., Kim, S. M., Chang, M. S., Park, S. H.,
… Bu, Y. (2012). Chlorogenic acid ameliorates brain damage and
edema by inhibiting matrix metalloproteinase-2 and 9 in a rat model
of focal cerebral ischemia. European Journal of Pharmacology,
689, 89–95.
Leopoldini, M., Russo, N., & Toscano, M. (2011). The molecular
basis of working mechanism of natural polyphenolic antioxidants.
Food Chemistry, 125, 288–306. https​ ://doi.org/10.1016/j.foodc​
hem.2010.08.012
Leung, J. W., Ho, M. C., Lo, A. C., Chung, S. S., & Chung, S. K. (2004).
Endothelial cell‐specific over‐expression of endothelin‐1 leads to
more severe cerebral damage following transient middle cerebral ar-
tery occlusion. Journal of Cardiovascular Pharmacology, 44(Suppl
1), S293–S300. https​://doi.org/10.1097/01.fjc.00001​66277.70538.b0
Li, S., Bian, H., Liu, Z., Wang, Y., Dai, J., He, W., … Luo, J. (2012).
Chlorogenic acid protects MSCs against oxidative stress by alter-
ing FOXO family genes and activating intrinsic pathway. European
Journal of Pharmacology, 674, 65–72. https​ ://doi.org/10.1016/j.
ejphar.2011.06.033
HERMAWATI et al.
Li, H., Colbourne, F., Sun, P., Zhao, Z., Buchan, A. M., & Iadecola,
C. (2000). Caspase inhibitors reduce neuronal injury after focal but
not global cerebral ischemia in rats. Stroke, 31, 176–182. https​://doi.
org/10.1161/01.STR.31.1.176
Li, Y., Shi, W., Li, Y., Zhou, Y., Hu, X., Song, C., … Li, Y. (2008).
Neuroprotective effects of chlorogenic acid against apopto-
sis of PC12 cells induced by methylmercury. Environmental
Toxicology and Pharmacology, 26, 13–21. https​://doi.org/10.1016/j.
etap.2007.12.008
Lipton, P. (1999). Ischemic cell death in brain neurons. Physiological
Reviews, 79, 1431–1568. https​
://doi.org/10.1152/physr​
ev.1999.79.4.1431
Marinova, E. M., Toneva, A., & Yanishlieva, N. (2009). Comparison
of the antioxidative properties of caffeic and chlorogenic acids.
Food Chemistry, 114, 1498–1502. https​://doi.org/10.1016/j.foodc​
hem.2008.11.045
Martinez, G., Musumeci, G., Loreto, C., & Carnazza, M. L. (2007).
Immunohistochemical changes in vulnerable rat brain regions after
reversible global brain ischaemia. Journal of Molecular Histology,
38, 295–302. https​://doi.org/10.1007/s10735-007-9102-9
Mehta, S. L., Manhas, N., & Raghubir, R. (2007). Molecular targets
in cerebral ischemia for developing novel therapeutics. Brain
Research Reviews, 54, 34–66. https​ ://doi.org/10.1016/j.brain​
resrev.2006.11.003
Miao, M., Cao, L., Li, R., Fang, X., & Miao, Y. (2017). Protective effect
of chlorogenic acid on the focal cerebral ischemia reperfusion rat
models. Saudi Pharmaceutical Journal, 25, 556–563. https​://doi.
org/10.1016/j.jsps.2017.04.023
Michel, R. P., & Cruz‐Orive, L. M. (1988). Application of the Cavalieri
principle and vertical sections method to lung: Estimation of vol-
ume and pleural surface area. Journal of Microscopy, 150, 117–136.
https​://doi.org/10.1111/j.1365-2818.1988.tb046​03.x
Mikami, Y., Kakizawa, S., & Yamazawa, T. (2016). Essential roles of
natural products and gaseous mediators on neuronal cell death or
survival. International Journal of Molecular Sciences, 17, E1652.
https​://doi.org/10.3390/ijms1​7101652
Mikami, Y., & Yamazawa, T. (2015). Chlorogenic acid, a polyphenol
in coffee, protects neurons against glutamate neurotoxicity. Life
Sciences, 139, 69–74. https​://doi.org/10.1016/j.lfs.2015.08.005
Miki, T., Harris, S. J., Wilce, P., Takeuchi, Y., & Bedi, K. S. (2000).
Neurons in the hilus region of the rat hippocampus are de-
pleted in number by exposure to alcohol during early postna-
tal life. Hippocampus, 10, 284–295. https​ ://doi.org/10.1002/
(ISSN)1098-1063
Miki, T., Harris, S. J., Wilce, P. A., Takeuchi, Y., & Bedi, K. S.
(2004). Effects of age and alcohol exposure during early life on
pyramidal cell numbers in the CA1‐CA3 region of the rat hippo-
campus. Hippocampus, 14, 124–134. https​ ://doi.org/10.1002/
(ISSN)1098-1063
Miki, T., Satriotomo, I., Li, H. P., Matsumoto, Y., Gu, H., Yokoyama, T.,
… Takeuchi, Y. (2005). Application of the physical disector to the cen- Quintard, H., Borsotto, M., Veyssiere, J., Gandin, C., Labbal, F.,
tral nervous system: Estimation of the total number of neurons in sub-
divisions of the rat hippocampus. Anatomical Science International,
80, 153–162. https​://doi.org/10.1111/j.1447-073x.2005.00121.x
Movassaghi, S., Nadia Sharifi, Z., Soleimani, M., Joghataii, M. T.,
Hashemi, M., Shafaroodi, H., & Mehdizadeh, M. (2012). Effect
of Pentoxifylline on Ischemia‐ induced Brain Damage and Spatial
Memory Impairment in Rat. Iranian Journal of Basic Medical
Sciences, 15, 1083–1090.
  
| 17
Nakajima, H., Unoda, K., Ito, T., Kitaoka, H., Kimura, F., & Hanafusa,
T. (2012). The Relation of Urinary 8‐OHdG, A Marker of Oxidative
Stress to DNA, and Clinical Outcomes for Ischemic Stroke. The
Open Neurology Journal, 6, 51–57. https​://doi.org/10.2174/18742​
05X01​20601​0051
Nyengaard, J. R. (1999). Stereologic methods and their application in
kidney research. Journal of the American Society of Nephrology,
10, 1100–1123.
Olthof, M. R., Hollman, P. C., & Katan, M. B. (2001). Chlorogenic acid
and caffeic acid are absorbed in humans. The Journal of Nutrition,
131, 66–71. https​://doi.org/10.1093/jn/131.1.66
Ostwald, K., Hagberg, H., Andine, P., & Karlsson, J. O. (1993).
Upregulation of calpain activity in neonatal rat brain after hy-
poxic‐ischemia. Brain Research, 630, 289–294. https​ ://doi.
org/10.1016/0006-8993(93)90668-D
Panickar, K. S., & Anderson, R. A. (2011). Effect of polyphenols on
oxidative stress and mitochondrial dysfunction in neuronal death
and brain edema in cerebral ischemia. International Journal of
Molecular Sciences, 12, 8181–8207. https​://doi.org/10.3390/ijms1​
2118181
Park, J. J., Hwang, S. J., Park, J. H., & Lee, H. J. (2015). Chlorogenic
acid inhibits hypoxia‐induced angiogenesis via down‐regulation of
the HIF‐1alpha/AKT pathway. Cellular Oncology (Dordrecht), 38,
111–118. https​://doi.org/10.1007/s13402-014-0216-2
Partadiredja, G., & Bedi, K. (2010). Undernutrition during gestation and
suckling periods does not cause any loss of pyramidal neurons in the
CA2‐CA3 region of the rat hippocampus. Nutritional Neuroscience,
13, 1–7.
Partadiredja, G., Karima, N., Utami, K. P., Agustiningsih, D., & Sofro,
Z. M. (2019). The Effects of Light and Moderate Intensity Exercise
on the Femoral Bone and Cerebellum of d‐Galactose‐Exposed
Rats. Rejuvenation Research, 22, 20–30. https​://doi.org/10.1089/
rej.2018.2050
Partadiredja, G., Miller, R., & Oorschot, D. E. (2003). The num-
ber, size, and type of axons in rat subcortical white matter on left
and right sides: A stereological, ultrastructural study. Journal
of Neurocytology, 32, 1165–1179. https​ ://doi.org/10.1023/
B:NEUR.00000​21910.65920.41
Pulungan, Z. S. A., Sofro, Z. M., & Partadiredja, G. (2018). Sodium
fluoride does not affect the working memory and number of
pyramidal cells in rat medial prefrontal cortex. Anatomical
Science International, 93, 128–138. https​ ://doi.org/10.1007/
s12565-016-0384-4
Purves, D., Augustine, G., Fitzpatrick, D., Hall, W., LaMantia, A.,
McNamara, J., & Williams, S. (Eds.) (2004). Neuroscience.
Sunderland, MA: Sinauer Associates Inc.
Puyal, J., Ginet, V., & Clarke, P. G. (2013). Multiple interacting cell death
mechanisms in the mediation of excitotoxicity and ischemic brain
damage: A challenge for neuroprotection. Progress in Neurobiology,
105, 24–48. https​://doi.org/10.1016/j.pneur​obio.2013.03.002
Widmann, C., … Heurteaux, C. (2011). MLC901, a traditional
Chinese medicine protects the brain against global ischemia.
Neuropharmacology, 61, 622–631. https​://doi.org/10.1016/j.neuro​
pharm.2011.05.003
Ruszkiewicz, J., & Albrecht, J. (2015). Changes in the mitochondrial
antioxidant systems in neurodegenerative diseases and acute brain
disorders. Neurochemistry International, 88, 66–72. https​ ://doi.
org/10.1016/j.neuint.2014.12.012
18
|    HERMAWATI et al.
Sanderson, T. H., Reynolds, C. A., Kumar, R., Przyklenk, K., &
Huttemann, M. (2013). Molecular mechanisms of ischemia‐reper-
fusion injury in brain: Pivotal role of the mitochondrial mem-
brane potential in reactive oxygen species generation. Molecular
Neurobiology, 47, 9–23. https​://doi.org/10.1007/s12035-012-8344-z
Sasi, N., Hwang, M., Jaboin, J., Csiki, I., & Lu, B. (2009). Regulated cell
death pathways: New twists in modulation of BCL2 family func-
tion. Molecular Cancer Therapeutics, 8, 1421–1429. https​://doi.
org/10.1158/1535-7163.MCT-08-0895
Sawada, N., & Liao, J. K. (2009). Targeting eNOS and beyond: Emerging
heterogeneity of the role of endothelial Rho proteins in stroke pro-
tection. Expert Review of Neurotherapeutics, 9, 1171–1186. https​://
doi.org/10.1586/ern.09.70
Schaller, B. J. (2006). The role of endothelin in stroke: Experimental
data and underlying pathophysiology. Archives of Medical Science,
2, 146–158.
Selakovic, V., Korenic, A., & Radenovic, L. (2011). Spatial and tem-
poral patterns of oxidative stress in the brain of gerbils submitted
to different duration of global cerebral ischemia. International
Journal of Developmental Neuroscience, 29, 645–654. https​://doi.
org/10.1016/j.ijdev​neu.2011.02.009
Sharifi, Z. N., Abolhassani, F., Zarrindast, M. R., Movassaghi, S.,
Rahimian, N., & Hassanzadeh, G. (2012). Effects of FK506 on
Hippocampal CA1 Cells Following Transient Global Ischemia/
Reperfusion in Wistar Rat. Stroke Research and Treatment, 2012,
809417.
Shen, J., Zhu, Y., Yu, H., Fan, Z. X., Xiao, F., Wu, P., … Zhan, R. Y.
(2014). Buyang Huanwu decoction increases angiopoietin‐1 expres-
sion and promotes angiogenesis and functional outcome after focal
cerebral ischemia. Journal of Zhejiang University. Science. B, 15,
272–280. https​://doi.org/10.1631/jzus.B1300166
Sheng, T., Zhang, X., Wang, S., Zhang, J., Lu, W., & Dai, Y. (2015).
Endothelin‐1‐induced mini‐stroke in the dorsal hippocampus or lat-
eral amygdala results in deficits in learning and memory. Journal of
Biomedical Research, 29, 362–369.
Shi, H., Dong, L., Bai, Y., Zhao, J., Zhang, Y., & Zhang, L. (2009).
Chlorogenic acid against carbon tetrachloride‐induced liver fibrosis
in rats. European Journal of Pharmacology, 623, 119–124. https​://
doi.org/10.1016/j.ejphar.2009.09.026
Shichita, T., Sakaguchi, R., Suzuki, M., & Yoshimura, A. (2012). Post‐
ischemic inflammation in the brain. Frontiers in Immunology, 3,
132.
Soares, L. M., Schiavon, A. P., Milani, H., & de Oliveira, R. M. (2013).
Cognitive impairment and persistent anxiety‐related responses
following bilateral common carotid artery occlusion in mice.
Behavioural Brain Research, 249, 28–37. https​://doi.org/10.1016/j.
bbr.2013.04.010
Stanika, R. I., Winters, C. A., Pivovarova, N. B., & Andrews, S. B.
(2010). Differential NMDA receptor‐dependent calcium loading and
mitochondrial dysfunction in CA1 vs. CA3 hippocampal neurons.
Neurobiology of Disease, 37, 403–411. https​://doi.org/10.1016/j.
nbd.2009.10.020
Sterio, D. C. (1984). The unbiased estimation of number and sizes of
arbitrary particles using the disector. Journal of Microscopy, 134,
127–136. https​://doi.org/10.1111/j.1365-2818.1984.tb025​01.x
Vauzour, D. (2012). Dietary polyphenols as modulators of brain func-
tions: Biological actions and molecular mechanisms underpinning
their beneficial effects. Oxidative Medicine and Cellular Longevity,
2012, 1–16. https​://doi.org/10.1155/2012/914273
Wan, C.‐W., Lee, Y.‐K., Kwok, C.‐Y., Chan, R. Y.‐K., Yu, P. H.‐F., &
Chan, S.‐W. (2010). A validated HPLC method with dual wave-
length detection for chlorogenic acid with an internal standard
in plasma and its application in pharmacokinetic studies in rats.
Journal of Liquid Chromatography & Related Technologies, 33,
324–335. https​://doi.org/10.1080/10826​07090​3524084
Wang, X., Fan, X., Yuan, S., Jiao, W., Liu, B., Cao, J., & Jiang, W.
(2017). Chlorogenic acid protects against aluminium‐induced cyto-
toxicity through chelation and antioxidant actions in primary hippo-
campal neuronal cells. Food and Function, 8, 2924–2934. https​://
doi.org/10.1039/C7FO0​0659D​
Wang, Y., Kilic, E., Kilic, U., Weber, B., Bassetti, C. L., Marti, H. H.,
& Hermann, D. M. (2005). VEGF overexpression induces post‐isch-
aemic neuroprotection, but facilitates haemodynamic steal phenom-
ena. Brain: A Journal of Neurology, 128, 52–63.
Wang, X., & Michaelis, E. K. (2010). Selective neuronal vulnerability to
oxidative stress in the brain. Frontiers in Aging Neuroscience, 2, 12.
West, M. J. (2012a). Estimating volume in biological structures. Cold
Spring Harbor Protocols, 2012, 1129–1139.
West, M. J. (2012b). The precision of estimates in stereological analy-
ses. Cold Spring Harbor Protocols, 2012, 937–949.
West, M. J. (2013). Tissue shrinkage and stereological studies. Cold
Spring Harbor Protocols, 2013, 208–209.
Yeung, P. K., Shen, J., Chung, S. S., & Chung, S. K. (2013).
Targeted over‐expression of endothelin‐1 in astrocytes leads
to more severe brain damage and vasospasm after subarach-
noid hemorrhage. BMC Neuroscience, 14, 131–145. https​ ://doi.
org/10.1186/1471-2202-14-131
Yokota, M., Saido, T. C., Kamitani, H., Tabuchi, S., Satokata, I., &
Watanabe, T. (2003). Calpain induces proteolysis of neuronal cy-
toskeleton in ischemic gerbil forebrain. Brain Research, 984, 122–
132. https​://doi.org/10.1016/S0006-8993(03)03121-4
Yu, D. K., Yoo, K. Y., Shin, B. N., Kim, I. H., Park, J. H., Lee, C. H., …
Won, M. H. (2012). Neuronal damage in hippocampal subregions
induced by various durations of transient cerebral ischemia in ger-
bils using Fluoro‐Jade B histofluorescence. Brain Research, 1437,
50–57. https​://doi.org/10.1016/j.brain​res.2011.12.029
Yuan, B., Qiao, M., Xu, H., Wang, L., & Li, F. (2006). Determination of
chlorogenic acid in rat plasma by high performance chromatography
after peritoneal administration of compound Daqingye injection.
Yakugaku zasshi: Journal of the Pharmaceutical Society of Japan,
126, 811–814. https​://doi.org/10.1248/yakus​hi.126.811
Zang, L. Y., Cosma, G., Gardner, H., Castranova, V., & Vallyathan,
V. (2003). Effect of chlorogenic acid on hydroxyl radical.
Molecular and Cellular Biochemistry, 247, 205–210. https​://doi.
org/10.1023/A:10241​03428348
Zhao, X., Zhang, H., Guo, J., & Zhang, Y. (2013). The effects of
bilateral common carotid artery occlusion on expression of pe-
ripherin and choline acetyltransferase activity in C57BL/6 mice.
Brain Research, 1491, 167–175. https​ ://doi.org/10.1016/j.brain​
res.2012.11.012
Zheng, Y. Q., Liu, J. X., Wang, J. N., & Xu, L. (2007). Effects of cro-
cin on reperfusion‐induced oxidative/nitrative injury to cerebral
microvessels after global cerebral ischemia. Brain Research, 1138,
86–94. https​://doi.org/10.1016/j.brain​res.2006.12.064
Zhou, L., Zhang, T., Lu, B., Yu, Z., Mei, X., Abulizi, P., & Ji, L. (2016).
Lonicerae Japonicae Flos attenuates diabetic retinopathy by inhib-
iting retinal angiogenesis. Journal of Ethnopharmacology, 189,
117–125. https​://doi.org/10.1016/j.jep.2016.05.039
HERMAWATI et al.   
| 19

Zhu, C., Qiu, L., Wang, X., Hallin, U., Cande, C., Kroemer, G., …
Blomgren, K. (2003). Involvement of apoptosis‐inducing factor in How to cite this article: Hermawati E, Arfian N,
neuronal death after hypoxia‐ischemia in the neonatal rat brain. Mustofa, M, Partadiredja G. Chlorogenic acid
Journal of Neurochemistry, 86, 306–317. ameliorates memory loss and hippocampal cell death
Zhu, C., Xu, F., Wang, X., Shibata, M., Uchiyama, Y., Blomgren, K., &
after transient global ischemia. Eur J Neurosci.
Hagberg, H. (2006). Different apoptotic mechanisms are activated
2019;00:1–19. https​://doi.org/10.1111/ejn.14556​
in male and female brains after neonatal hypoxia‐ischaemia. Journal
of Neurochemistry, 96, 1016–1027. https​://doi.org/10.1111/j.1471-
4159.2005.03639.x