Journal of Infection and Public Health 14 (2021) 1701–1707

Contents lists available at ScienceDirect

Journal of Infection and Public Health

journal homepage: http://www.elsevier.com/locate/jiph

Original Articles

High viral load positively correlates with thrombocytopenia and

elevated haematocrit in dengue infected paediatric patients
Bharti Pathak a , Aparna Chakravarty b , Anuja Krishnan a,∗
a
Department of Molecular Medicine, School of Interdisciplinary Sciences & Technology, Jamia Hamdard, New Delhi 110062, India
b
Department of Paediatrics, Hamdard Institute of Medical Sciences and Research, Jamia Hamdard, New Delhi, India

a r t i c l e i n f o a b s t r a c t

Article history: Background: Dengue fever is one of the major viral diseases worldwide transmitted by mosquitoes.
Received 16 June 2021 Depending on the severity of disease it can range from mild fever to severe fatal cases. Rapid decline of
Received in revised form platelet levels is one of indicators of clinical worsening. The role of viral factors in dengue pathogenesis
27 September 2021
and correlation with clinical and laboratory parameters remain unclear.
Accepted 3 October 2021
Methods: Between September 2017 to December 2018, 102 dengue confirmed paediatric cases were
analysed for various viral and host parameters. Based on symptoms, they were classified into dengue
Keywords:
without warning signs (DOS), dengue with warning signs (DWS) and severe dengue (SD) as per 2009 WHO
Dengue
Viral load classification. Quantitative analysis of NS1, IgM and IgG in were done by ELISA. IgM/IgG ratio revealed
NS1 primary or secondary dengue infection. Serotyping of virus in serum was done by nested multiplex RT-
Platelets PCR. Viral load (VL) was determined by quantitative real time polymerase chain reaction. Association
Haematocrit between VL and NS1 in patient sera with clinical and laboratory parameters was statistically analysed.
Biomarker Results: It was found that disease severity (as per 2009 WHO classification) significantly associated with
secondary dengue infection. DENV3 was found to be the only serotype detected. The present study reports
neither NS1 nor VL significantly associated with disease severity or type of infection (primary or sec-
ondary). However, VL positively correlated with haematocrit (p < 0.05). Viral load above 106 copies/mL
was found in 61% of patients. Further, high viral load (>106 copies/mL) negatively correlated with platelet
levels (p < 0.05).
Conclusion: Thus, viral load could be an important predictive parameter in dengue related severe symp-
toms like thrombocytopenia and elevated hematocrit when it goes above a certain threshold (>106 copies/
mL).
© 2021 Published by Elsevier Ltd on behalf of King Saud Bin Abdulaziz University for Health Sciences.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).

Introduction
Dengue fever is a mosquito (species of Aedes) transmitted dis-
ease with a dramatic increase in global incidence in recent decades.
It has been estimated that close to 390 million people get infected
per year out of which around 90 million show clinical manifesta-
tions and about 30% of global infections are contributed by India [1].
Clinical manifestations range from mild febrile illness, to haem-
orrhagic condition to fatal shock syndrome. Of the fatal cases,
majority occur in children under 15 years of age [2,3]. Dengue virus
(DENV) belonging to Flaviviridae family consists of single stranded
positive sense RNA genome of around 10.9 kb. The viral polypro-
∗ Corresponding author.
E-mail address: Anuja.krishnan@jamiahamdard.ac.in (A. Krishnan).
tein is processed into 3 structural proteins (C, pRM and E) followed
by 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B,
NS5) [4]. Dengue illness can be caused by any of the four anti-
genically distinct DENV (DENV-1-4) serotypes which vary up to
40% at amino acid level. Each serotype further comprises of mul-
tiple genotypes [5]. Clinical symptoms include sudden onset of
fever, myalgia, arthralgia with some having rashes, cough, vom-
iting and abdominal pain. Minor haemorrhagic manifestations like
petechiae, mucosal membrane bleeding and epistaxis are observed
in some patients. Depending on symptoms, World Health Organiza-
tion (WHO) in 2009 classified DENV infected patients into dengue
without warning signs (DOS), dengue with warning signs (DWS)
and severe dengue (SD). According to WHO, rapid decline in platelet
count is one of the indicators of clinical worsening [6]. It is still not
clear why some patients have improving signs and others dete-
riorate resulting in severe condition. Interplay of several factors,

https://doi.org/10.1016/j.jiph.2021.10.002
1876-0341/© 2021 Published by Elsevier Ltd on behalf of King Saud Bin Abdulaziz University for Health Sciences. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
B. Pathak et al.
including virulence of circulating strain, host genetics, secondary
infection and co-morbidities seem to be responsible for the devel-
opment of the severe disease. Epidemiological studies show that
primary infection with a particular DENV serotype provides protec-
tion on re-infection to that particular serotype. However, disease
severity is hypothesised to be enhanced on subsequent heterotypic
DENV infection by a phenomenon known as antibody dependent
enhancement (ADE) which leads to higher virus progeny leading
to severe dengue [7,8]. NS1 is the only protein secreted on infec-
tion and is used primarily in diagnosis of dengue disease. Viral load
and secreted NS1 in serum have been shown in many reports to
be associated with severity of disease [9,10] though there are also
reports which contradict this [11,12]. Recent reports suggest role of
NS1 in vascular leakage and endothelial hyperpermeability by dis-
rupting the endothelial glycocalyx [13,14]. The mechanism of DENV
induced thrombocytopenia is under investigation and recent stud-
ies suggest that DENV may impair PI3K/AKT/mTOR axis involved in
development of megakaryocytes [15].
Many infectious diseases display similar clinical manifestations,
immune response and laboratory parameters which are used in
early identification of dengue infection. In this study we used
comprehensive dataset of clinical and laboratory parameters and
evaluated its correlation with viral parameters, like NS1 and viral
load in dengue infected paediatric patients.
Material and methods
Patients and sample collection
Children between the age of 6 months to 15 years admitted
to the paediatric ward of a tertiary-level teaching hospital (HAHC,
Jamia Hamdard) located in the southern part of Delhi, India, with
suspected dengue were included in this study. The study was
approved by Institutional Ethics Committee and has been carried
out in accordance with The Code of Ethics of the World Medical
Association (Declaration of Helsinki). Written informed consent for
the study was taken from parent/guardian to collect blood sam-
ple. Patients were screened for NS1(less than 5 day of illness)
or IgM (greater than 5 days of illness) presence by ELISA (Pan
Bio Dengue IgM ELISA). Routine clinical tests including platelet
count, liver function tests including aspartate aminotransferase
(AST) and alanine transaminase (ALT), albumin and hematocrit
(Hct) were performed. Patients’ demographic and clinical features
were recorded on the day of admission in a pre-designed format and
the laboratory data were collected from medical records. They were
classified into three grades, Dengue without warning sign (DOS),
Dengue with warning sign (DWS), and severe dengue (SD) as per
2009 WHO guidelines [6]. Around 3 mL of whole blood was drawn
on the day of admission and collected in EDTA containing vials and
the serum was stored at −80 ◦ C until further use.
NS1, IgM and IgG ELISA
NS1 ELISA was again done with all samples in the laboratory
with Dengue NS1 Ag Microlisakit (J. Mitra & Co. Ltd, New Delhi)
according to manufacturer’s instructions and titres were repre-
sented as NS1 units. To define immune status, IgM and IgG capture
ELISA was performed for all samples (MAC-ELISA and GAC-ELISA,
J. Mitra & Co. Ltd, New Delhi) as per manufacturer’s instructions.
Based on the WHO criteria, Dengue infections were defined pri-
mary when they did not show any detectable levels of serum IgM
and IgG (seronegative) and those that had IgM > IgG by a ratio ≥1.2
[6]. Secondary dengue infection was defined as samples that had
IgG only or IgG/IgM ≥ 1.2.
1702
Journal of Infection and Public Health 14 (2021) 1701–1707
Viral RNA extraction and serotyping
Viral RNA was isolated from the patient’s serum through the
QIAamp Viral RNA kit (QIAGEN, GERMANY) as per manufacturers’
instructions. RT-PCR was done using the NEB RT-PCR kit (RevertAid
H Minus M-MuLV Reverse Transcriptase) as per manufacturer’s
instructions. The consensus primer D1 and D2 (conserved region of
the C-prM region) were used for PCR amplification as per Lanciotti
et al. [16]. The products were visualized for 511 bp by ethidium bro-
mide agarose gel staining. For DENV serotyping, semi- nested PCR
was performed using serotype-specific oligonucleotides (TS1, TS2,
TS3 and TS4) which results in amplicons of different sizes specific
to each serotype (485 bp, 119 bp, 290 bp and 392 bp for DENV 1-4,
respectively) [16].
Viral load determination
Virus RNA of serum samples were reverse-transcribed into
cDNA as described before and used in subsequent quantitative
real time PCR in a ABI 7500 machine (Applied Biosystems, Foster
City, CA). A recombinant plasmid harbouring DENV NS5 region of
187 bp was generated (NS5 F- ACAAGTCGAACAACTGGTCCAT; NS5
R – GCCGCACCATTGGTCTTCTC) using pGEMTeasy vector systems
(Promega). Linearized recombinant plasmid was serially diluted
into known concentrations and used as genome copy number stan-
dard. The qPCR was carried out with 5 ␮L of 2x master mix, (KAPA
SYBR fast qPCR master mix, Biosystems), 1 ␮L forward primer (NS5
F) (20 pmol/␮L), 1 ␮L reverse primer (NS5 R) (20 pmol/L), 1.8 ␮L
DEPC-treated water, 0.2 ␮L ROX and 1 ␮L of cDNA (20 ng) in the
final volume of 10 ␮L. The amplification conditions were, hold stage
95 ◦ C for 20 s, PCR stage 95 ◦ C for 1 s, 60 ◦ C for 20 s followed by 40
cycles and melt curve stage 95 ◦ C for 15 s, 60 ◦ C for 1 min, 95 ◦ C for 15
s. Cycle threshold (Ct) values obtained were plotted against the log
dilutions of the known concentration of standard. The concentra-
tion of virus load in serum samples was calculated by intersection
points on the standard curve.
Statistics analysis
Data were checked for the normality and the appropriate appli-
cation of Kruskal–Wallis (non-parametric) and ANOVA (parametric
test) were carried out on the variables with more than two fac-
tors. Mann–Whitney U test (non-parametric test) and student-t
(parametric) were computed for the variables with two factors.
Categorical variables were analyzed using chi-square and Fisher’s
exact test. The coefficient of determination (r-square) was calcu-
lated to know the variation in the dependent variable due to the
independent in the relationship. The Pearson correlation for con-
tinuous variables and Spearman correlation for categorical have
been used for the purpose the data analysis. P value <0.05 were
considered significant. All calculations were performed using SPSS
(version 26.0, SPSS Inc. Illinois).
Results
Clinical and laboratory features of dengue infected patients
A total of 182 serum samples were collected from dengue sus-
pected cases between September 2017 to December 2018. Out of
these 182, only 102 were confirmed for dengue infection by NS1 or
IgM ELISA.
Based on WHO 2009 guidelines, 44 patients were categorized as
dengue without warning signs (DOS), 52 with dengue with warning
signs (DWS) and 6 with severe dengue (SD). The clinical features
and laboratory data of the 102 dengue confirmed patients at the
B. Pathak et al. Journal of Infection and Public Health 14 (2021) 1701–1707

Table 1
Clinical and laboratory data in paediatric patients diagnosed with DOS, DWS and SD

DOS (n = 44) DWS (n = 52) SD (n = 6) p-value Test

Gender
Male 24 (55.8) 40 (76.9) 3 (50) 0.065
Female 19 (44.2) 12 (23.1) 3 (50)
Age
0−4 y 20 (45.5) 6 (11.5) 3 (50)
4−7 y 4 (9) 15 (28.8) 2 (33.3) 0.01*
>7 y 20 (45.5) 31 (59.6) 1 (16.7)
Days of illness (DOI)
0−5 y 36 (81.8) 41 (78.8) 4 (66.7)
0.683
>5 y 8 (18.2) 11 (18.2) 2 (33.3)
Clinical manifestation
Chi-square
Fever 15 (60) 35 (70) 4 (66.7) 0.687
Vomiting 10 (27.8) 35 (68.6) 5 (83.1) 0*
Abdominal pain 8 (22.2) 44 (86.3) 3 (50) 0*
Rash 5 (14.3) 10 (19.6) 2 (50) 0.125
Body pain 4 (15.4) 19 (39.6) 1 (16.7) 0.072
Lethargy 7 (28) 35 (70) 6 (100) 0*
Cough 8 (22) 4 (8) 1 (16) 0.172
Headache 6 (16.7) 8 (15.7) 0 (0) 0.415
Anorexia 3 (11) 11 (22) 2 (33) 0.362
Pleural effusion and ascites 2 (5.6) 23 (45.1) 5 (83.3) 0*
Laboratory parameter
ALT (U/L) 134.1 ± 250.8 89.2 ± 76.5 373.5 ± 31.8 0.048* Kruskal Wallis
AST (U/L) 152.9 ± 257.6 197.3 ± 192.5 1159.5 ± 471.6 0.014* Kruskal Wallis
Hct (%) 36.1 ± 5.1 36.7 ± 6.7 33.7 ± 8.7 0.536 F-test
Albumin (g/dL) 3.2 ± 0.6 3 ± 0.6 2.7 ± 0.7 0.294 F-test
Platelets (/␮L) 154093.8 ± 120458.4 75857.1 ± 58405.2 55333.3 ± 27868.7 0.007* Kruskal Wallis

Clinical manifestation are presented as number and %. Laboratory parameter values are presented as median value and SD-standard deviation. * p <0.05

time of enrolment based on disease severity (2009 WHO classifica-

tion) are presented in Table 1.
We compared rate of disease severity based on patient age
groups, 0−4 y, 4−7 y and >7 y. We found significantly higher
detection of SD cases in children in 0−4 y age group. A signifi-
cant increase in frequency of DWS detection with age, from about
11.5% cases among 0−4 y age group to 59.6% among >7-year-old
age group was observed (p < 0.05). Among clinical features, vom-
iting, abdominal pain, lethargy and pleural effusion and ascites
was found to be significantly associated with the disease sever-
ity, with more cases in DWS/SD as compared to DOS (p < 0.001).
Children with SD had significantly higher levels of liver enzymes- Fig. 1. Association of dengue disease severity with primary and secondary dengue
aspartate aminotransferase (AST) and alanine aminotransferase infection. Number of cases of DOS, DWS and SD in primary and secondary dengue
(ALT) compared to less severe groups (p < 0.05). Platelet levels infection.

were significantly lower in SD and DWS compared to DOS cases

(p < 0.05).
Dengue viral load and NS1 do not correlate with disease severity
or type of infection

We next assessed whether VL associated with disease severity

Disease severity in primary and secondary infections
Based on IgM/IgG ratio, 42 were classified as primary infection
and 59 as secondary infection. When we compared clinical man-
ifestations based on primary and secondary infection, we found
only anorexia significantly associated with secondary infection (p
< 0.05) compared to primary infection (Table 2). Analysis of labo-
ratory parameters revealed that platelet counts were significantly
lower in secondary infections as compared to primary infection (p
= 0.012).
Next, we sought to determine whether disease severity is asso-
ciated with primary and secondary infections. Overall, significantly
higher number of DWS cases (73%) were found in secondary infec-
tion (Fig. 1). However, there were DOS cases which had secondary
infection and primary infections in DWS category thus implying
that mechanisms other than ADE also play role in disease severity.
or type of infection (primary and secondary). Overall, we did not
find any significant difference in the viral load based on disease
severity classification. Further, there was no significant difference
in viral genome levels in primary and secondary cases, irrespective
of disease outcome (Fig. 2). Moreover, NS1 levels in serum also did
not associate with either disease severity (DOS, DWS and SD) or
type of infection (primary and secondary).
Viral load positively correlated with hematocrit
We next evaluated correlation of viral factors (VL and NS1) with
laboratory parameters already available in the medical records. We
found that viral load positively correlated with hematocrit (p =
0.04) in dengue infected patients irrespective of severity and type
of infection (Fig. 3).

1703
B. Pathak et al. Journal of Infection and Public Health 14 (2021) 1701–1707

Table 2
Frequency of symptoms and laboratory data in paediatric patients diagnosed with primary and secondary infection.

Parameter Primary (n = 42) Secondary (n = 59) p-value Test

Gender
Male 24 (57.1) 43 (72.9) 0.099
Female 18 (42.9) 16 (27.1)
Age
0−4 y 15 (35.7) 13 (22) 0.293
4−7 y 7 (16.7) 14 (23.7)
>7 y 20 (47.6) 32 (54.2)
Days of illness (DOI)
0−5 y 30 (71.4) 50 (84.7) 0.104
>5 y 12 (28.6) 9 (15.3)
Clinical manifestation Chi-square
Fever 22 (66.7) 32 (66,7) 1
Vomiting 19 (50) 31 (56.4) 0.545
Abdominal pain 19 (50) 36 (65.5) 0.136
Rash 10 (26) 8 (14.8) 0.171
Body pain 6 (18.2) 18 (38.3) .053
Pleural effusion and ascites 10 (26) 20 (36) 0.308
Headache 7 (20.6) 7 (14.6) 0.476
Anorexia 3 (8.8) 13 (27.3) 0.036*
Lethargy 16 (50) 32 (65) 0.171
Cough 8 (21) 5 (9) 0.11
Laboratory parameter
ALT (U/L) 154.4 ± 238.8 88.8 ± 86 0.965 Mann–Whitney U
AST (U/L) 233.4 ± 318.7 203.8 ± 274.3 0.214 Mann–Whitney U
Hct (%) 35.5 ± 6.3 36.8 ± 6.3 0.33 t-test
Albumin (g/dL) 3.1 ± 0.6 3 ± 0.7 0.925 t-test
Platelets (/␮L) 135459.5 ± 114227.7 79,360 ± 66094.2 0.012* Mann–Whitney U

Clinical manifestation are presented as number and %.Laboratory parameter values are presented as median value and SD-standard deviation. * p <0.05

However, we did not find any significant association of NS1
levels with any clinical feature or laboratory parameters available
(data not shown).
High viral load correlates with thrombocytopenia
Thrombocytopenia is a clinical indicator of severe dengue dis-
ease. Platelet counts were significantly lower in DWS and SD as
compared to DOS (p = 0.007) (Fig. 4A). Also, secondary infection
had lower platelet levels (p = 0.012) (Fig. 4B). The viral load in
serum samples ranged from 103 –1010 copies/ mL. We categorised
them into low VL group -<106 copies/mL and high VL group->106
copies/mL. Overall VL did not correlate with NS1 levels in serum (p
= 0.403, data not shown). Interestingly, high VL group showed neg-
ative correlation with platelets and positive correlation with NS1
(Fig. 4C & D), whereas no correlation was observed in low viral load
group (data not shown).
Increased vascular permeability leads to rising heamtocrit and
serous effusion leading to profound shock. We assessed correlation
of elevated Hct (Hct > 40%) with any clinical symptoms using Spear-
mann correlation analysis. We found that elevated Hct correlated
with thrombocytopenia (p = 0.007). In addition, elevated Hct sig-
nificantly correlated with pleural effusion and ascites (p = 0.011)
and body pain (p = 0.003) (Suppl Fig. 1).
Discussion
A rapid fall in platelet count associated with increase in Hct
above baseline is one of the warning signs of plasma leakage.
Viral parameters, viral load and NS1 antigenemia have often been
associated with severity of disease; however there has been no
comprehensive and detailed analysis of viral factors with clinical
symptoms and laboratory parameters. Though similar study has
been performed previously, analysis of results was complicated due
to infection with more than 1 DENV serotype [11,17–19]. In our
study, samples collected during the year 2017–2018 showed only
DENV3 serotype as has been reported by other study conducted
in Delhi [20], thus simplifying our analysis. Rate of DWS increased
with age of children. This is consistent with other studies [21]. It is
believed that with age, cross protection from maternal DENV anti-
bodies wanes out thus making children prone to severe infection.
Also, with increased age there is a possibility of secondary DENV
infection. We did not find any significant association of plasma
viral load or NS1 levels with disease severity. There have been con-
tradictory reports regarding this, with some showing significant
association of viral factors with disease severity [18,19] and others
showing no association at all [11]. The probable reason could be that
plasma viremia might not completely represent dengue viral load
and DENV could be sequestered in other tissues like, liver, spleen,
kidneys etc. Also difference in time of sampling and infecting DENV
serotype may be responsible for conflicting results. The other rea-
son could be inconsistency of DENV classification adopted based on
disease severity, that is, WHO 1997 vs 2009 case classification. The
World Health Organization (WHO) 1997 dengue guideline empha-
sized the role of plasma leakage in the pathophysiology of dengue
hemorrhagic fever (DHF) and dengue shock syndrome (DSS). The
WHO 2009 guideline uses a broader range of symptoms to identify
probable dengue cases [6,22]. Also, dengue disease shows a range
of symptoms which are dynamic and intervention can modify dis-
ease manifestation, thus could mask underlying disease severity.
Nunes et al. had compared NS1 and VL levels in fatal and non-fatal
cases and reported that NS1 and VL were higher in fatal cases [23].
In our study we had only 3 fatal cases so it was difficult to do similar
comparison. RT-PCR measures both infectious and non-infectious
genome copies and assessment of viral titers using plaque assay
should give a better assessment of infectious viral burden. We did
not find any significant association of viral factors (VL and NS1)
with most of clinical symptoms as has been reported in few studies
[24,25]. However, viral load positively correlated with haematocrit
in dengue infected patients. This is significant because it’s known
that increased Hct is a sign of hemoconcentration an indicator of
plasma leakage and precedes shock. We found that high VL cate-
gory (>106 copies/mL) correlated with platelet levels in a negative
manner implying that beyond a certain threshold DENV can directly

1704
B. Pathak et al. Journal of Infection and Public Health 14 (2021) 1701–1707

Fig. 2. Association of viral load and NS1 with disease severity and type of infection. A) VL association with DOS, DWS and SD B) VL with primary and secondary infection C)
NS1 association with DOS, DWS and SD D) NS1 with primary and secondary infection. Scatter plot shows median value, p values were calculated using Mann–Whitney test.
p < 0.05 was considered significant. ns denotes, not significant.

affect platelets. Similar results of association of high viral load with

platelet levels were found in recent reports [11,26,27]. Thrombo-
cytopenia was significantly associated with secondary infection in
our study. It is hypothesised that there is an increased dengue
virus infection in secondary infection due to antibody dependent
enhancement phenomenon (ADE). In a secondary infection, sub-
neutralizing antibodies from previous infection bind to heterotypic
DENV but is unable to neutralise it. These immune complexes bind
to Fc gamma receptor (FcϒR) via Fc portion of immunoglobulin.
This interaction leads to increased uptake and also suppression
of immune response leading to elevated DENV infection in cells
[28,29]. It is believed in secondary infection, there are platelet asso-
ciated antibodies which may induce thrombocytopenia [30]. Many
Fig. 3. Correlation analysis between Viral load and Hct (%) in all dengue confirmed
anti-DENV antibodies are found to cross-react with human proteins patients. R2 represents coefficient of the determination. p < 0.05 is considered sig-
like, platelets, coagulation factors and endothelial cells resulting in nificant.
thrombocytopenia, abnormal coagulation and endothelial damage
[31]. Increase in dengue virus secretion may directly infect platelet
leading to platelet activation. Reports from dengue patient sam- nia [33]. However, we did not find correlation of NS1 with disease
ples show that platelets from patients with dengue present signs severity. Watanabe et al., using mouse infection model showed
of activation, mitochondrial dysfunction, and activation of apo- that soluble NS1 level did not correlate with viremia or severity
ptosis caspase cascade, which may contribute to the genesis of [34]. NS1 antibodies also have been implicated in the DENV patho-
thrombocytopenia [32]. NS1 has been implicated in dengue patho- genesis, so it is possible that actual levels of NS1 maybe deflected
genesis. A very recent study has suggested that DENV NS1 could with NS1 antibody levels [35]. One limitation of this study was that
be responsible for platelet activation leading to thrombocytope- sequential samples were not available from individual patients.
Studies also show that apart from platelets, other haematological

1705
B. Pathak et al.
Fig. 4. A) Association of platelet levels with disease severity B) Association of platelet level in primary and secondary infection C) Correlation analysis of NS1 levels and viral
load in high VL group (>106 copies/mL) and D) Association of platelet count and VL in high VL group. Box-whisker plot shows median value, p values were calculated using
Mann-Whitney test. Pearson correlation analysis was performed, R2 represents coefficient of the determination. p < 0.05 is considered significant.
parameters like, lymphocyte-neutrophil ratio, atypical lympho-
cytes should be assessed as early predictors for dengue disease
[36,37]. Further studies are underway exploring the correlation of
antibody avidity with circulating DENV, cytokine levels, viral pro-
tein specific antibodies (NS1, pRM and E antibodies) with disease
severity. A detailed analysis of maximum parameters including
humoral immunity and cytokine profile could help develop a uni-
versal guide in early diagnosis of progression of dengue disease in
an endemic setting.
Conclusion
Dengue disease is multifactorial and complex interaction of
multiple viral and host components can complicate the analysis. In
this study we tried to determine correlation between viral factors
and laboratory parameters which are usually available in endemic
setting. We found positive correlation of viral load with hematocrit
and high VL correlated with thrombocytopenia. These findings can
be validated in large sample size and be taken forward for devel-
opment of mathematical models with the variables for prediction
of disease dynamics.
Conflict of interest
The author(s) declare(s) that there is no conflict of interest.
Acknowledgement
BP acknowledges fellowship from DST-PURSE. AK acknowledges
funding from SERB (EMR/2017/001374).
Appendix A. Supplementary data
Supplementary material related to this article can be found,
in the online version, at doi:https://doi.org/10.1016/j.jiph.2021.10.
002.
References
[1] Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global
distribution and burden of dengue. Nature 2013;496(Apr (7446)):504–7.
[2] Wilder-Smith A, Ooi EE, Horstick O, Wills B. Dengue. Lancet 2019;393(Jan
(10169)):350–63.
1706
Journal of Infection and Public Health 14 (2021) 1701–1707
[3] Halstead SB, Dans LF. Dengue infection and advances in dengue vaccines for
children. Lancet Child Adolesc Health 2019;3(Oct (10)):734–41.
[4] Lindenbach BD, Thiel H-J, Rice CM. Flaviviridae: the viruses and their replica-
tion, field’s virology. 5th ed Raven: Lippincott; 2007.
[5] Twiddy SS, Holmes EC, Rambaut A. Inferring the rate and time-scale of dengue
virus evolution. Mol Biol Evol 2003;20(Jan (1)):122–9.
[6] World Health Organization. Dengue haemorrhagic fever: diagnosis, treatment,
prevention and control. World Health Organization; 1997.
[7] Halstead SB, Mahalingam S, Marovich MA, Ubol S, Mosser DM. Intrinsic
antibody-dependent enhancement of microbial infection in macrophages:
disease regulation by immune complexes. Lancet Infect Dis 2010;10(Oct
(10)):712–22.
[8] Katzelnick LC, Gresh L, Halloran ME, Mercado JC, Kuan G, Gordon A, et al.
Antibody-dependent enhancement of severe dengue disease in humans. Sci-
ence 2017;358(Nov (6365)):929–32.
[9] Arya SC, Nirmala A. Apropos “viral load in patients infected with dengue
is modulated by the presence of anti-dengue IgM antibodies”. J Clin Virol
2013;2(58):497.
[10] Sergio I, Flores-Aguilar H, González-Mateos S, López-Martinez I, Alpuche-
Aranda C, Ludert JE, et al. Determination of viremia and concentration of
circulating nonstructural protein 1 in patients infected with dengue virus in
Mexico. Am J Trop Med Hyg 2013;88(3):446.
[11] Singla M, Kar M, Sethi T, Kabra SK, Lodha R, Chandele A, et al. Immune response
to dengue virus infection in pediatric patients in New Delhi, India—association
of viremia, inflammatory mediators and monocytes with disease severity. PLoS
Negl Trop Dis 2016;10(3):e0004497.
[12] Libraty DH, Acosta LP, Tallo V, Segubre-Mercado E, Bautista A, Potts JA, et al.
A prospective nested case-control study of Dengue in infants: rethinking
and refining the antibody-dependent enhancement dengue hemorrhagic fever
model. PLoS Med 2009;6(Oct (10)):e1000171.
[13] Beatty PR, Puerta-Guardo H, Killingbeck SS, Glasner DR, Hopkins K, Har-
ris E. Dengue virus NS1 triggers endothelial permeability and vascular leak
that is prevented by NS1 vaccination. Sci Transl Med 2015;7(Sep (304)):
304ra141.
[14] Puerta-Guardo H, Glasner DR, Harris E. Dengue virus NS1 disrupts the
endothelial glycocalyx, leading to hyperpermeability. PLoS Pathog 2016;12(Jul
(7)):e1005738.
[15] Lahon A, Arya RP, Banerjea AC. Dengue virus dysregulates master transcription
factors and PI3K/AKT/mTOR signaling pathway in megakaryocytes. Front Cell
Infect Microbiol 2021;11.
[16] Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV. Rapid detection and
typing of dengue viruses from clinical samples by using reverse transcriptase-
polymerase chain reaction. J Clin Microbiol 1992;30(Mar (3)):545–51.
[17] Reddy MN, Dungdung R, Valliyott L, Pilankatta R. Occurrence of concurrent
infections with multiple serotypes of dengue viruses during 2013–2015 in
northern Kerala, India. PeerJ 2017;5(Mar 14):e2970.
[18] Wang WK, Chao DY, Kao CL, Wu HC, Liu YC, Li CM, et al. High levels of
plasma dengue viral load during defervescence in patients with dengue hem-
orrhagic fever: implications for pathogenesis. Virology 2003;305(Jan (2)):
330–8.
[19] Thomas L, Verlaeten O, Cabié A, Kaidomar S, Moravie V, Martial J, et al. Influ-
ence of the dengue serotype, previous dengue infection, and plasma viral load
on clinical presentation and outcome during a dengue-2 and dengue-4 co-
epidemic. Am J Trop Med Hyg 2008;78(Jun (6)):990–8.
[20] Parveen N, Islam A, Tazeen A, Hisamuddin M, Abdullah M, Naqvi IH, et al. Circu-
lation of single serotype of Dengue Virus (DENV-3) in New Delhi, India during
B. Pathak et al.
2016: a change in the epidemiological trend. J Infect Public Health 2019;12(Jan
(1)):49–56.
[21] Verhagen LM, de Groot R. Dengue in children. J Infect 2014;69(Nov):S77–86.
[22] World Health Organization. Dengue haemorrhagic fever: diagnosis, treatment,
prevention and control. World Health Organization; 1997.
[23] Nunes PC, Nogueira RM, Heringer M, Chouin-Carneiro T, Damasceno dos Santos
Rodrigues C, De Filippis AM, et al. NS1 antigenemia and viraemia load: potential
markers of progression to dengue fatal outcome? Viruses 2018;10(Jun (6)):326.
[24] Pal T, Dutta SK, Mandal S, Saha B, Tripathi A. Differential clinical symp-
toms among acute phase Indian patients revealed significant association with
dengue viral load and serum IFN-gamma level. J Clin Virol 2014;61(Nov
(3)):365–70.
[25] Lam PK, Ngoc TV, Thu Thuy TT, Hong Van NT, Nhu Thuy TT, Hoai Tam DT,
et al. The value of daily platelet counts for predicting dengue shock syndrome:
Results from a prospective observational study of 2301 Vietnamese children
with dengue. PLoS Negl Trop Dis 2017;11(Apr (4)):e0005498.
[26] Murgue B, Roche C, Chungue E, Deparis X. Prospective study of the duration and
magnitude of viraemia in children hospitalised during the 1996–1997 dengue-
2 outbreak in French Polynesia. J Med Virol 2000;60(Apr (4)):432–8.
[27] Sudiro TM, Zivny J, Ishiko H, Green S, Vaughn DW, Kalayanarooj S, et al. Analysis
of plasma viral RNA levels during acute dengue virus infection using quantita-
tive competitor reverse transcription-polymerase chain reaction. J Med Virol
2001;63(Jan (1)):29–34.
[28] John AL, Rathore AP. Adaptive immune responses to primary and secondary
dengue virus infections. Nat Rev Immunol 2019;19(Apr (4)):218–30.
[29] Halstead SB, Mahalingam S, Marovich MA, Ubol S, Mosser DM. Intrinsic
antibody-dependent enhancement of microbial infection in macrophages:
disease regulation by immune complexes. Lancet Infect Dis 2010;10(Oct
(10)):712–22.
1707
Journal of Infection and Public Health 14 (2021) 1701–1707
[30] Saito M, Oishi K, Inoue S, Dimaano EM, Alera MT, Robles AM, et al. Association
of increased platelet-associated immunoglobulins with thrombocytopenia and
the severity of disease in secondary dengue virus infections. Clin Exp Immunol
2004;138(Nov (2)):299–303.
[31] Chen MC, Lin CF, Lei HY, Lin SC, Liu HS, Yeh TM, et al. Deletion of the
C-terminal region of dengue virus nonstructural protein 1 (NS1) abolishes
anti-NS1-mediated platelet dysfunction and bleeding tendency. J Immunol
2009;183:1797–803.
[32] Ojha A, Nandi D, Batra H, Singhal R, Annarapu GK, Bhattacharyya S, et al. Platelet
activation determines the severity of thrombocytopenia in dengue infection.
Sci Rep 2017;7(Jan (1)):41697.
[33] Chao CH, Wu WC, Lai YC, Tsai PJ, Perng GC, Lin YS, et al. Dengue virus non-
structural protein 1 activates platelets via Toll-like receptor 4, leading to
thrombocytopenia and hemorrhage. PLoS Pathog 2019;15(Apr (4)):e1007625.
[34] Watanabe S, Tan KH, Rathore AP, Rozen-Gagnon K, Shuai W, Ruedl C, et al.
The magnitude of dengue virus NS1 protein secretion is strain dependent and
does not correlate with severe pathologies in the mouse infection model. J Virol
2012;86(May (10)):5508–14.
[35] Jayathilaka D, Gomes L, Jeewandara C, Jayarathna GS, Herath D, Perera PA, et al.
Role of NS1 antibodies in the pathogenesis of acute secondary dengue infection.
Nat Commun 2018;9(Dec (1)):1–5.
[36] Abeysuriya V, Choong CS, Thilakawardana BU, de Mel P, Shalindi M, de Mel
C, et al. The atypical lymphocyte count: a novel predictive factor for severe
thrombocytopenia related to dengue. Trans R Soc Trop Med Hyg 2020;114(Jun
(6)):424–32.
[37] Chuansumrit A, Chaiyaratana W. Hemostatic derangement in dengue hemor-
rhagic fever. Thromb Res 2014;133(Jan (1)):10–6.