4 MOLECULAR BASIS

OF INHERITANCE
4.1 INTRODUCTION

• The molecular basis of inheritance refers to the way in which genetic information is encoded in
the structure and function of molecules, and how this information is transmitted from one
generation to the next .

• The central molecule involved in the molecular basis of inheritance is deoxyribonucleic acid or
DNA.

• DNA is a long, double-stranded molecule that contains the instructions for the development and
function of an organism.

• In order for an organism to pass on its genetic information to the next generation, the DNA must
be replicated or copied, before the organism reproduces.

• This process is called DNA replication, and it occurs during the cell cycle. During replication,
the two strands of the DNA molecule unwind and serve as templates for the synthesis of new
strands. The result is two identical DNA molecules, each with one original and one new strand.
• Another essential process in the molecular basis of inheritance is the expression of genetic
information.
• This is the process by which the instructions in DNA are used to produce the proteins and
other molecules that carry out the functions of an organism.
• The first step in the expression of genetic information is the transcription of DNA into a
molecule called ribonucleic acid, or RNA.
• RNA is similar to DNA but single-stranded and has a slightly different structure.
• During transcription, RNA polymerase reads the DNA sequence and synthesizes a
complementary RNA molecule.
• The RNA molecule is then translated into a protein, which is a long chain of amino acids.
• A protein's sequence of amino acids determines its unique three-dimensional structure and
function.
• Throughout the chapter, we will try to understand each and every phenomenon mentioned
above.

116
4.2 THE DNA
DNA, or deoxyribonucleic acid, is a long, double-stranded molecule that contains the genetic
instructions for the development and function of living organisms.
It is found in the nucleus of cells in almost all living organisms, as well as in some viruses.
DNA length is calculated by the number of nucleotides present in it.
DNA length is characteristic of an organism, the following are some examples.
❖ Φ×174 bacteriophage - 5386 nucleotides
❖ λ bacteriophage - 48502 base pairs (bp)
❖ Escherichia coli - 4.6 × 106 bp
❖ Haploid content of human DNA - 3.3 × 109 bp

4.2.1 STRUCTURE OF THE POLYNUCLEOTIDE CHAIN

• A polynucleotide chain is a long chain of nucleotides that are linked together by covalent bonds.
• Nucleotides are the building blocks of polynucleotide chains, and they are made up of three
parts: a sugar molecule, a phosphate group, and a nitrogenous base.
• The sugar molecule in a nucleotide is usually deoxyribose in DNA or ribose in RNA. The
phosphate group is attached to the sugar molecule at the 5' (five prime) position, and the
nitrogenous base is attached to the sugar molecule at the 1' (one prime) position.
• There are four types of nitrogenous bases in DNA: adenine (A) & guanine (G) [purine],
cytosine (C), & thymine (T) [pyrimidine]. In RNA, there is an additional type of nitrogenous
base called uracil (U).
• In a polynucleotide chain, the Phosphate group is linked to OH of 5’C of a nucleoside through
phosphodiester linkage. Two nucleotides are linked through 3’-5’ phosphodiester linkage to
form a dinucleotide.
• This creates a chain of alternating sugar and phosphate groups, with the nitrogenous bases
sticking out from the chain. The sequence of nitrogenous bases in a polynucleotide chain carries
the genetic information that determines the characteristics and traits of an organism.
• In RNA, every nucleotide residue has an additional –OH group present at the 2' -position in the
ribose. Also, in RNA the uracil is found in the place of thymine (5-methyl uracil, another
chemical name for thymine).

The difference in the structures of Uracil and Thymine

117
5’ end of polynucleotide chain - free phosphate moiety
3’ end of polynucleotide chain - free OH group
In RNA, every nucleotide residue has an additional -OH group present at the 2’ position in the
ribose.

Figure 1 : The figure shows how sugar moiety is linked to the phosphate group through
phosphodiester bonds.

Figure 2 : Hierarchical organization of polynucleotide chain in a double helix DNA.

118
4.3 HISTORY OF DNA
The structure of DNA was first described in the 1950s by James Watson and Francis Crick, who
was awarded the Nobel Prize in Physiology or Medicine in 1962 for their work. However, the
story of DNA discovery began long before their groundbreaking discovery .
One of the key figures in the early history of DNA research was Johann Friedrich Miescher, a
Swiss scientist who first isolated DNA in the 1870s. Miescher extracted a substance he called
"nuclein" from the nuclei of white blood cells, and he observed that this substance contained
high levels of phosphorus and nitrogen .
In the years that followed, other scientists made significant contributions to the study of DNA. In
the 1920s, for example, Frederick Griffith showed that genetic information could be transferred
between bacteria through a process he called "transformation.“
In the 1940s, Avery, MacLeod, and McCarty demonstrated that DNA was the substance responsible
for this transformation, and proposed that DNA was the genetic material.
Watson and Crick's discovery of the structure of DNA in 1953 was the culmination of this line of
research and marked a major turning point in the field of genetics.
Their work showed that DNA has a double-helix structure, with two strands of nucleotides twisted
around each other.
This structure explained the proposition of Chargaff that for a double-stranded DNA, the ratios
between Adenine and Thymine and Guanine and Cytosine are constant and equal.

4.3.1 DOUBLE HELIX MODEL OF DNA

STRUCTURE
Salient features of the double helix DNA are as
follows
A. Backbone made of sugar-phosphate
B. Antiparallel polarity means if one chain has
the polarity 5' to 3', the other has 3 to 5’.
C. The bases in the two strands are paired
through hydrogen bonds (H-bonds), forming
base pairs (bp)
D. Coiled in a right-handed fashion
E. Pitch of the helix: 3.4 nm
F. Distance between a base pair in a helix: 0.34 Figure 3 : Double helix DNA with
nm correct nucleotide base pairing.

4.3.2 PACKAGING OF DNA HELIX

The length of the DNA of a typical mammalian cell is 2.2 m, which is far greater than the
dimensions of a typical nucleus. Then can you imagine the level of packaging it takes to
119
accommodate it? What are the proteins involved in this process and how is it exactly done? Well,
we will address these questions in this section.

❖ DNA SUPERCOILING IN PROKARYOTES

• In prokaryotes, Although they do not have a defined nucleus, DNA is not scattered throughout
the cell.
• Negatively charged DNA is held with positively charged proteins in a region termed ‘nucleoid.’
• Most prokaryotes lack histones, but eukaryotes wrap their DNA around these proteins to help
pack the DNA into more compact areas. Thus, supercoiling is one method by which prokaryotes
squeeze their DNA into more restricted areas. Put a rubber band in a twisting motion to make
tiny coils.
• Twist it once more until the initial coils are folded over one another to form a ball. Supercoiling
occurs when this kind of twisting takes place in a bacterial genome.
• Positively supercoiled genomes have the DNA twisted in the same way as the double helix,
while negatively supercoiled genomes have the DNA twisted in the opposite direction.
• In prokaryotes, HU protein with an enzyme called topoisomerase 1 promotes the supercoiling
of DNA.

❖ DNA PACKING IN EUKARYOTES

• We have enough DNA to travel back and forth from the sun 300 times. How is this than
packed in such a small nucleus?
• The solution to this issue is provided by the fact that certain proteins pack chromosomal DNA
into the eukaryotic nucleus' tiny interior. The resulting DNA-protein combination is known as
chromatin, and these proteins are known as histones.
• It may seem counterintuitive that DNA is made more compact by the addition of proteins. But
if you've ever tried to store a garden hose, you know that starting by coiling the hose makes
the process much simpler.
• Coiling obviously needs work, and work demands energy. Histones thus give DNA folding
within the nucleus the energy it needs (mostly in the form of electrostatic interactions).
• Therefore, chromatin can fit into much smaller spaces than just DNA.
• Histones are a group of fundamental, positively charged proteins. Depending on how many
amino acid residues have charged side chains, a protein can become charged. The basic amino
acid residues lysine and arginine are prevalent in histones. Positive charges are present in the
side chains of both amino acid residues. Histone octamers, which are made up of eight
molecules, are how histones are arranged.
• A structure known as a nucleosome is formed when negatively charged DNA is encircled by
positively charged histone octamers.
• The DNA helix in a typical nucleosome is 200 bp long.
• The repeating unit of chromatin, the threadlike stained (colored) entities visible in the
nucleus, is a structure made up of nucleosomes.
120
• Under an electron microscope, the nucleosomes in chromatin appear as "beads-on-string"
structures.
• During metaphase, condensation is quite thick. The fiber length is reduced by a factor of around
seven when DNA is packaged into nucleosomes.
• In other words, a meter-long stretch of DNA will be transformed into a chromatin fiber that is
only 14 centimeters (about 6 inches) long.
• A half-foot of chromatin is still far too lengthy to fit within the nucleus, which is only 10 to 20
microns in diameter, despite this reduction.
• In order to achieve this, chromatin is further coiled into a shorter, thicker fiber that is known as
the "30-nanometer fiber" because of its around 30 nanometer diameter.
• Thus packaging of chromatin at a higher level requires an additional set of proteins that
collectively are referred to as Non-histone chromosomal (NHC) proteins.
Based on the density of condensation chromatins are of the following two types.
1. Euchromatin: Loosely packed, lightly stained, transcriptionally active
2. Heterochromatin: Densely packed, dark stained, transcriptionally inactive
3. The Search for Genetic Material: Scientific Inquiry

T.H Morgan’s Group- showed that genes exist as parts of chromosomes. DNA and Protein-
leading candidates for genetic material. Until the 1940s- the case for proteins seemed stronger,
because biochemists identified proteins as a class of biomacromolecules with significant
heterogeneity and specificity of function-essential requirements for hereditary material.

121
Little was known about nucleic acids- physical and chemical properties seemed too uniform. This
view was changed gradually as the role of heredity was worked out in studies of bacteria and
viruses that infect them.

4.4 TRANSFORMING PRINCIPLE:

• Fred Griffith dealt with mice-lethal Streptococcus pneumonia, a pathogenic microbe.
• However, not all of the bacteria's varieties are deadly; type R is non-lethal, whereas type S is.
There are also strains of the bacteria of types II and III. These can all either be R or S.
• Therefore, a Type IIIS strain is lethal but a Type IIR strain is not. Griffith was able to
demonstrate that when a Type IIIS strain was heated to death and then put into a mouse, the
mouse survived. However, the mouse would perish if the heat-killed type IIIS material was
combined with live type IIR bacteria.
• The mouse acquired the Type IIIS strain of the virus, according to the autopsy results.
• These indicated that the Type IIR strain had absorbed some material from the Type IIIS strain,
turning it into the Type IIIS strain.
• The substance is what Griffith called the "transforming principle."

Figure 4 : Pictorial representation of Griffith transformation experiment

The research of Griffith was expanded by Avery, MacLeod, and McCarty. They used his system,
but they only looked at the bacterial phenotypes in relation to the dead type IIIS material, not the
mice. They carried out very rigorous examinations and established that the genetic material was
DNA, not protein or RNA. Avery, MacLeod, and McCarty employed the phenotypic of
Streptococcus pneumonia cells expressed on blood agar rather than working with animals. They
also precipitated those cells out of culture using an antibody to the type IIR cells to confirm that a
few possibly viable cells did not survive the heat treatment. Finally, they subjected the material
from the heat-killed cells to enzyme treatment. Each of these enzymes dissolved either DNA, or
122
RNA, or proteins (protease) (DNase).
The three primary parts of the heat-killed cells are as follows.

Figure 5 : The above figure represents how Macleod, Mccarthy, and Avery verified the results of the
Griffith transformation experiment.

As you can see above, DNase was the only treatment that stopped the type IIR cells from
becoming type IIIS. This proved unequivocally that DNA was the changing principle and life's
heritable chemical.
The virus depends on a host for reproduction because it lacks its own mechanism. Their genetic
material is conveyed to the host cell once they adhere. Bacteria serve as the bacteriophage's host in
this instance.
Bacteriophages influence the infected bacteria in such a way that bacterial cells begin to copy the
viral genetic material. To determine whether protein or DNA served as the genetic material that
entered the bacteria, Hershey and Chase undertook an experiment.

123
EXPERIMENT:
• The experiment started with the cultivation of viruses in two different types of media. A certain
set of viruses (set A) was cultured in a radioactive phosphorus-based medium, while another set
(set B) was cultured in a radioactive sulfur-based media.
• They noted that radioactive DNA, but not radioactive proteins, made up the first group of
viruses (A).
• This is so because protein does not contain phosphorus, whereas DNA does. Instead of
radioactive DNA, the latter group of viruses (B) contained radioactive protein.
• The bacteria E. coli was the infection's host. By eliminating the viral coverings using a number
of blending and centrifugation processes, the viruses were given the opportunity to infect
bacteria.

OBSERVATION:
The radioactive DNA viruses that infected the E. coli bacteria (A) made them radioactive, but
the radioactive protein viruses that infected the E. coli bacteria (B) made them non-radioactive.

Figure 5 : Step-by-step representation of Hershey and chase experiment.

124
CONCLUSION:
The difference between the resulting radioactive and non-radioactive bacteria suggests that
whereas viruses with radioactive DNA passed their DNA to the bacterium, viruses with radioactive
protein did not.
DNA, not proteins, is therefore the genetic substance.

4.5 PROPERTIES OF GENETIC MATERIAL (DNA VERSUS RNA)

The Hershey-Chase experiment unequivocally resolved the debate between proteins and DNA as
genetic material. Subsequently, it became clear that RNA is the genetic material in some viruses,
e.g., Tobacco Mosaic Virus and QB bacteriophage.
But what makes DNA and RNA molecules so unique that they can function as genetic material?
They must fulfill the following criteria:
1. Generating replica possible
2. Chemically and structurally stable
3. There should be scope for slow changes (mutation) that are required for evolution
4. Able to express itself in the form of ‘Mendelian Characters’.

Q. Why is DNA a better genetic material for storing genetic information than RNA?
1. The two strands of DNA being complementary if separated, by heating come together
when appropriate conditions are provided.

Figure 6 : Nucleobases of DNA and RNA

125
1. 2’-OH group present at every nucleotide in RNA is a reactive group and makes RNA
labile and easily degradable
2. RNA is also known to be catalytic, hence reactive. DNA chemically is less reactive and
structurally more stable as compared to RNA
3. The presence of thymine at the place of uracil also confers additional stability to the DNA
4. RNA being unstable mutates at a faster rate
5. RNA can directly code for the synthesis of proteins and hence can easily express the
characters. DNA is, however, dependent on RNA for the synthesis of proteins
6. The protein synthesizing machinery has evolved around RNA

4.6 RNA: THE FIRST GENETIC MATERIAL

According to the RNA world theory, the earliest genetic material and the source of all genetic
information was ribonucleic acid, which gave rise to the first form of life. It is a molecule that
reproduces itself. Simply said, RNA is the predecessor to every living thing on the planet today.
Every vital function that occurs in living beings is thought to have evolved around RNA, which is
thought to have arisen from ancient cells. The scientific community mostly accepted the RNA
world idea. Additionally, RNAs were thought to operate as a stimulant for specific metabolic
processes in early cells. They were more reactive and thus an appropriate biocatalyst since they
had a 2-OH group. They were unstable due to their labile tendency to degradation brought on by
their reactive character. This instability created the broad range of mutations needed for
evolution. However, as a hereditary substance, it ought to have been both chemically and
structurally stable. These erratic molecules were eventually replaced by hereditary molecules,
which are more stable. DNA and protein molecules entered the scene at this point in evolution.
They took over RNA's function as a structural and genetic component. RNA is not entirely
removed, though. Some organisms still use them as genetic material.
Semiconservative DNA Replication
According to the Watson and Crick model, the two DNA strands would split apart and serve as a
template for the synthesis of new complementary strands. Each DNA molecule would have one
parental and one newly synthesized strand when replication was finished.
Semi-conservative DNA replication is the word used to describe this plan.
Three possible models for DNA replication.
1. Semi-conservative replication: In this scenario, the two DNA strands unwind from one
another and use each other as templates to create new, complementary strands. Two DNA
molecules are produced as a result, each with one original and one new strand.
2. Conservative replication: In this model, DNA replication produces two new DNA molecules,
one of which is identical to the original DNA molecule and consists of the original DNA's two
strands (with exactly the same sequences as the original molecule).
3. Dispersive replication: The dispersive replication model describes how DNA replication
produces two DNA molecules that are "hybrids"—mixtures—of daughter and parental DNA.
Each individual strand in this model is made up of both old and fresh DNA.
126
Figure 7 : Suggested models of DNA replication (a) Conservative (b) Dispersive (c) Semi- conservative .

4.7 EXPERIMENTAL PROOF FOR SEMI-CONSERVATIVE MODEL

It has been proved that DNA replicates semi-conservatively. First shown in Escherichia coli and
subsequently in higher organisms, such as plants and human cells

Meselson and Stahl’s experiment (1958):

1. They grew E. coli in a medium containing 15NH4Cl (15N is the heavy isotope of nitrogen)
as the only nitrogen source for several generations
2. Then they transferred the cells into a medium with normal 14NH4Cl, took samples at various
definite time intervals as the cells multiplied, and extracted the DNA that remained double-
stranded helices.
3. The DNA extracted from the culture one generation after the transfer from 15N to 14N medium
[that is, after 20 minutes; E. coli divides in 20 minutes] had a hybrid or intermediate density.

127
DNA extracted from the culture after another generation [that is 40 minutes, II generations] was
composed of equal amounts of this hybrid DNA and ‘light’ DNA
TAYLOR ⇒ performed a similar experiment on Vicia faba in 1958 and proved that DNA in
chromosomes also replicates semi conservatively

4.8 THE MACHINERY FOR DNA REPLICATION

DNA-dependent-DNA Polymerase:
This enzyme uses a DNA template to catalyze the polymerization of deoxynucleotides. It is highly
efficient, as they have to catalyze the polymerization of a large number of nucleotides in a concise
amount of time. E. coli that has only 4.6×106 bp (compare it with a human whose diploid content is
6.6×109 bp), and completes the process of replication within 18 minutes; that means the average
rate of polymerization has to be 2000 bp per second.
Deoxyribonucleotide phosphates serve dual purposes:
1. Act as substrates
2. Provide energy for polymerization reaction (the two terminal phosphates are high-
energy phosphates, same as in the case of ATP)

4.8.1 REPLICATION FORK:

1. For long DNA molecules, since the two strands of DNA cannot be separated in their entire
length (due to very high energy requirement), the replication occurs within a small opening of
the DNA helix, referred to as the replication fork
2. The DNA-dependent DNA Polymerases catalyze polymerization only in one direction, that
is 5’→3.’
3. On one strand (the template with polarity
3’→5’), the replication is continuous, while
on the other (the template with polarity
5’→3’), it is discontinuous

The enzyme DNA ligase later joins the

discontinuously synthesized fragments.
Replication of chromosomal DNA begins at
particular sites called origins of replication. E.
coli chromosome- circular, has a single origin
Prokaryotic DNA Replication ( as in E. coli):

1. Proteins that initiate DNA replication recog-

- nize origin sequence and attach to DNA
Figure 8 : Pictorial depiction of DNA replication
2. The two strands get separated. fork

128
3. The separation strands form replication ‘bubbles.’
4. Replication proceeds in both directions until the entire molecule gets copied.

Figure 8 : Diagram illustration of Replication ‘bubble’ in Prokaryotic DNA Replication

4.8.2 EUKARYOTIC DNA REPLICATION:

1. It may have hundreds or even a few thousand replication origins
2. Multiple replication bubbles form and eventually fuse, thus speeding up the copying of the
very long DNA molecules

Figure 9 : Diagram illustration of Replication ‘bubbles’ in Eukaryotic DNA Replication

129
● At the end of each replication bubble is a replication fork
● Helicases- Enzymes that untwist the double helix at the replication forks, separating the two
parental strands and making them available as template strands
● After the parental strands separate, single-stranded binding proteins bind to the unpaired
DNA strands, keeping them from repairing.
● Topoisomerase- helps relieve the strain caused by untwisting of the double helix by
breaking, swiveling, and rejoining DNA strands.

4.9 TRANSCRIPTION
The act of copying information from a strand of DNA into a fresh messenger RNA molecule is
called transcription (mRNA). DNA preserves genetic material as a reference or template safely
and permanently in the cell nuclei.
The transcription process is governed by the complementarity principle, with the exception that
adenosine complements now form base pairs with uracil rather than thymine. But unlike the
replication process, which once it starts, duplicates all of an organism's DNA, transcription merely
copies a portion of DNA and only one of its strands into RNA. But then a question arises why are
both strands not copied during transcription? The answer to this question is that
1. If both strands act as a template, they will code for RNA molecules with different sequences
(Remember, complementarity does not mean identical)
2. The two RNA molecules, if produced simultaneously, would be complementary to each other,
hence would form a double-stranded RNA

4.9.1 TRANSCRIPTION UNIT

It is frequently helpful to distinguish between the two strands of DNA since the complementary
sequence of the mRNA is found on the strand that is translated into mRNA, while the base
sequence of the other strand immediately matches the codons in the mRNA. The terms "template
strand," "sense strand," and "coding strand" are frequently used to refer to one of the two strands of
DNA; however, the nomenclature is somewhat ambiguous because different authors have used
these terms to refer to both strands.
For example, one school contends that the strand copied into mRNA should be considered the
template strand, while the other school contends that the opposite strand, which reflects the
sequence in the mRNA, should be considered.
The first definition is used in the image below, although it is crucial to define the concepts
carefully to prevent misunderstandings when using terms like "template," "sense," or "code."
These concepts are best defined as follows.
The DNA sequence that is duplicated when mRNA is produced is referred to as a template strand.
Because the sequence matches the codons that are translated into protein, the opposite strand—the
one with a base sequence directly corresponding to the mRNA sequence—is known as the coding
strand or the mRNA-like strand.
130
By convention, we depict the DNA sequence and regulatory signals on the strand that looks like
"mRNA," even though RNA polymerase must detect sequences on the template strand.

Figure 10 : Schematic structure of transcriptionl unit

A transcription unit in DNA is defined primarily by the three regions in the DNA:
1. A Promoter
2. The Structural Gene
3. A Terminator
The first definition is used in the images below, although it is crucial to define the concepts
carefully to prevent misunderstandings when using terms like "template," "sense," or "code."
These concepts are, in my opinion, best defined as follows.
The DNA sequence that is duplicated when mRNA is produced is referred to as a template strand.
Because the sequence matches to the codons that are translated into protein, the opposite strand—
the one with a base sequence directly corresponding to the mRNA sequence—is known as the
coding strand or the mRNA-like strand.
By convention, we depict the DNA sequence and regulatory signals on the strand that looks like
"mRNA," even though RNA polymerase must detect sequences on the template strand.
Transcription factors have the following important function.
1. Present in eukaryotes
2. Collection of proteins
3. Help guide the binding of RNA polymerase
4. Initiation of transcription
And Transcription initiation complex is the whole complex of transcription factors and RNA
polymerase II bound to the promoter.

4.9.2 TRANSCRIPTION UNIT AND THE GENE

A gene are also defined by the DNA sequence that codes for the tRNA or rRNA molecule.
The structural gene in a transcription unit, on the other hand, could be described as
131
monocistronic (primarily in eukaryotes) or polycistronic by defining a cistron as a stretch of DNA
coding for a polypeptide (mostly in bacteria or prokaryotes).
The monocistronic structural genes in eukaryotes have interrupted coding sequences because these
organisms have divided genes.
Exons are characterized as expressed or coding sequences. The sequences that can be found in
mature or processed RNA are known as exons. Introns come between the exons. In mature or
processed RNA, introns or intervening regions are absent.
The concept of a gene in terms of a DNA segment is further complicated by the split-gene
arrangement. Introns are non-coding sequences that interrupt exons; do not appear in mature or
processed RNA
Spliceosomes are large complexes made of proteins and small RNAs. Which function as the
removal of introns and binds to several short nucleotide sequences along an intron, including key
sequences at each end.
Exon shuffling is a molecular mechanism for the formation of new genes, where two or more
exons from different genes are recombined between introns, yielding rearranged genes with altered
functions these may facilitate the evolution of new and potentially beneficial proteins due to this
process.

4.9.3 THE TRANSCRIPTION PROCESS

❖ INITIATION:
1. RNA polymerase binds to the promoter and initiates transcription.
2. It uses nucleotide triphosphates as substrate and polymerizes in a template-dependent fashion
following the rule of complementarity
❖ ELONGATION:
1. Initiation facilitates the opening of the helix and continues elongation
2. Transcription progresses at a rate of about 40 nucleotides per second in eukaryotes
❖ TERMINATION:
In bacteria:
✓ Transcription proceeds through a terminator sequence in the DNA
✓ The transcribed terminator (an RNA sequence) functions as the termination signal
✓ DNA polymerase detaches from the DNA and releases the transcription
In eukaryotes:
RNA polymerase II transcribes a sequence on the DNA called the polyadenylation signal
sequence, which specifies a polyadenylation signal in the pre-mRNA
RNA Polymerase is only capable of catalyzing the process of elongation. It associates transiently
with the initiation factor (σ) and termination factor (ρ) to initiate and terminate the transcription.
132
In bacteria, since the mRNA does not require any processing to become active, and since
transcription and translation take place in the same compartment (there is no separation of cytosol
and nucleus in bacteria), the translation can often begin much before the mRNA is fully
transcribed.
As a consequence, transcription, and translation can be coupled in bacteria.Two additional
complexities in eukaryotes are as follows:
1. There are at least three RNA polymerases in the nucleus (in addition to the RNA polymerase
found in the organelles). There is a clear-cut division of labor.
RNA polymerase I transcribe rRNAs (28S, 18S, and 5.8S), whereas RNA polymerase III is
responsible for transcribing tRNA, 5srRNA, and snRNAs (small nuclear RNAs).
RNA polymerase II transcribes the precursor of mRNA, the heterogeneous nuclear RNA
(hnRNA).
2. Primary transcripts contain both the exons and the introns and are non-functional. Hence, it is
subjected to –
Splicing : (removal of introns and joining exons in defined order). hnRNA undergoes capping
and tailing, after which it is called mRNA.
Capping: an unusual nucleotide (methyl guanosine triphosphate) is added to the 5’-end of
hnRNA.
Tailing: adenylate residues (200-300) are added at the 3’-end in a template-independent
manner

Figure 11 : Stages of transcription – are explained

133
4.10 RNA PROCESSING
RNA Processing in the nucleus and the export of mature RNA to the cytoplasm provide
opportunities for regulating gene expression not available in prokaryotes
❖ Alternative RNA splicing:
1. Different mRNA molecules are produced from the same primary transcript, depending on
which RNA segments are treated as exons and which as introns
2. Alternative RNA splicing can significantly expand the repertoire of a eukaryotic genome
3. Proposed as one explanation for the surprisingly low number of human genes counted when
the human genome was sequenced
4. More than 90% of human protein-coding genes likely undergo alternative splicingThe extent
of alternative splicing dramatically multiplies the number of possible human proteins, which
may correlate better with the complexity of form than the number of genes.
5. The extent of alternative splicing dramatically multiplies the number of possible human
proteins, which may correlate better with the complexity of form than the number of genes.

Figure 12 : Alternative RNA Splicing

4.11 GENETIC CODE

George Gamow argued that since there are only four bases and if they have to code for 20 amino
acids, the code should constitute a combination of bases.
He suggested that to code for all the 20 amino acids, the code should be made up of three
nucleotides. A very bold proposition since a permutation combination of 43 (4×4×4) would
generate 64 codons, generating many more codons than required.
The chemical method developed by Hargobind Khorana was instrumental in synthesizing RNA
molecules with defined combinations of bases (homopolymers and copolymers).
Marshall Nirenberg’s cell-free system for protein synthesis finally helped the code to be
deciphered.
134
Severo Ochoa enzyme (polynucleotide phosphorylase) was also helpful in polymerizing RNA
with defined sequences in a template-independent manner (enzymatic synthesis of RNA).
The salient features of the genetic code:
1. The codon is a triplet; 61 codons code for amino acids and three codons do not code for any
amino acids; hence they function as stop codons
2. Some amino acids are coded by more than one codon; therefore, the code is degenerate
3. The codon is read in mRNA in a contiguous fashion; there are no punctuations
4. The code is nearly universal; for example, from bacteria to humans, UUU would code for
Phenylalanine (phe). Some exceptions to this rule have been found in mitochondrial codons
and some protozoa.
5. AUG has dual functions. It codes for Methionine (met) and acts as an initiator codon.
6. UAA, UAG, and UGA stops terminator codons

Figure 13 : Codon triplet code

135
4.11.1 MUTATIONS AND GENETIC CODE
A DNA sequence can change permanently as a result of mutation. The amino acid sequence of the
protein that the gene codes for can be altered by changes to the DNA sequence of that gene, a
process known as mutation.
Point Mutations: A single DNA letter can change in a point mutation. They can be divided into
three groups.
1. Missense mutations cause a single amino acid change in the protein.
2. Nonsense mutations make a premature "stop" codon. Any codons after that are not translated,
and the resulting protein is missing amino acids.
3. Silent mutations code for the same amino acid as before.

4.11.2 MUTATIONS WITH INSERTIONS AND DELETIONS

DNA bases can be added or removed in insertion mutations.
Mutations called deletions take one or more DNA bases out. Insertions and deletions change the
reading frame, which is why they are also known as frameshift mutations unless they occur in
multiples of three bases.
All the amino acids after the mutation are impacted by a frameshift because it alters the way
bases are organized into codons.
The stop codon may be read earlier or later than it was in the original sequence, and the cell will
continue reading until it does.

Figure 14 : Different types of mutation

4.12 tRNA - THE ADAPTER MOLECULE

Francis Crick postulated the presence of an adapter molecule that would, on the one hand, read the
code and, on the other hand, would bind to specific amino acids.
The tRNA then called sRNA (soluble RNA), was known before the genetic code was postulated.
Each tRNA molecule enables the translation of a given mRNA codon into a specific amino acid.

136
tRNA molecule consists of a single RNA strand that is only about 80 nucleotides long (compared
to hundreds of molecules for most mRNA molecules).
A tRNA molecule looks like a clover leaf.
The tRNA molecule is a translator in the sense that, in the context of the ribosome, it can read a
nucleic acid word (the mRNA codon) and interpret it as a protein word (the amino acid)
In a eukaryotic cell, tRNA, like mRNA, is made in the nucleus and then travels to the cytoplasm,
where it will participate in the process of translation.
Instances of molecular recognition required for the accurate translation of a genetic message:
1. A tRNA that binds to an mRNA codon specifying a particular amino acid must carry that
amino acid, and no other, to the ribosome
2. The pairing of the tRNA anticodon with the appropriate mRNA codon

3. 2 DIMENSIONAL

3 DIMENSIONAL

Figure 15 : Structure of tRNA

137
4.13 TRANSLATION
Translation refers to the polymerization of amino acids to form a polypeptide. The order and
sequence of amino acids are defined by the sequence of bases in the mRNA. In the first phase,
amino acids are activated in the presence of ATP and linked to their cognate tRNA - a process
called charging of tRNA or aminoacylation of tRNA. When the small subunit of the ribosome
encounters an mRNA, the process of translation of the mRNA to protein begins. The ribosome
also acts as a catalyst (23S rRNA in bacteria is the enzyme - ribozyme) for the formation of the
peptide bonds. An mRNA also has some additional sequences that are not translated and are
referred to as untranslated regions (UTRs). The UTRs are present at 5’-end (before the start codon)
and 3’-end (after the stop codon).They are required for an efficient translation process.
In eukaryotes, the small subunit, with the initiator tRNA already bound, binds to the 5’ cap of the
mRNA and then moves, or scans, downstream along the mRNA until it reaches the AUG start
codon, where the initiator tRNA then hydrogen-bonds. mRNA, initiator tRNA, and small
ribosomal subunit combine to form a Translation initiation complex. Initiation factors are proteins
that are required to bring the components of the translation initiation complex together. A
polypeptide is always synthesized in one direction, from the initial methionine at the amino end,
also called N-terminus, towards the final amino acid at the carboxyl end, also called C-terminus.
Amino acids are added one by one to the previous amino acid at the C-terminus of the growing
chain. Elongation factors are proteins involved in each addition; occur in a three-step cycle.
The elongation of polypeptide takes less than a tenth of a second in bacteria and is repeated as each
amino acid is added until the polypeptide is completed. In the end, a release factor binds to the
stop codon, terminating translation and releasing the complete polypeptide from the ribosome.
Release factor is a protein shaped like an aminoacyl tRNA that binds directly to the stop codon in
the A site and causes the addition of a water molecule instead of an amino acid to the polypeptide
chain leading to the breakdown of the translation assembly which also requires the hydrolysis of
two or more GTP molecules.

Figure 16 : Translation
138
4.14 REGULATION OF GENE EXPRESSION
In eukaryotes, the regulation could be exerted at the following four levels
1. Transcriptional level (formation of primary transcript)
2. Processing level (regulation of splicing)
3. Transport of mRNA from the nucleus to the cytoplasm
4. Translational level
It is the metabolic, physiological, or environmental conditions that regulate the expression of
genes. The development and differentiation of embryos into adult organisms are also a result of the
coordinated regulation of the expression of several sets of genes. In a transcription unit, the activity
of RNA polymerase at a given promoter is regulated by interaction with accessory proteins, which
affect its ability to recognize start sites. These regulated proteins can act both passively
(activators) and negatively (repressors)
The accessibility of promoter regions of prokaryotic DNA is, in many cases, regulated by the
interaction of proteins with sequences termed operators. The operator region is adjacent to the
promoter elements in most operons, and in most cases, the sequences of the operator bind a
repressor protein.

4.14.1 THE LAC OPERON

The elucidation of the lac operon was also a result of a close association between a geneticist,
Francois Jacob, and a biochemist, Jacques Monod. They were the first to elucidate a
transcriptionally regulated system.
Examples of operons: lac operon, trp operon, ara operon, his operon, val operon, etc.
The lac operon consists of one regulatory gene (the i gene) and three structural genes (z, y, and a).
The functions of the genes are as follows
1. The i gene: codes for the repressor of the lac operon
2. The z gene: codes for β-galactosidase (β-gal), which is primarily responsible for the
hydrolysis of the disaccharide lactose into its monomeric subunits, galactose and glucose
3. The y gene: codes for permease, which increases the permeability of the cell to β-
galactosides
4. The gene encodes a transacetylase.
Lactose is the inducer since it is the substrate for the enzyme β-galactosidase and regulates
switching on and off the operon.
In the absence of a preferred carbon source such as glucose, if lactose is provided in the growth
medium of the bacteria, the lactose is transported into the cells through the action of permease.
The repressor protein binds to the operator region of the operon and prevents RNA polymerase
from transcribing the operon. Regulation of lac operon by a repressor is referred to as negative
regulation.

139
 Figure 17 : The Lac- Operon

4.15 HUMAN GENOME PROJECT (HGP)

Human Genome Project (HGP) was launched in 1990 with the establishment of genetic
engineering techniques where it was possible to isolate and clone any piece of DNA and the
availability of simple and fast techniques for determining DNA sequences.
The human genome is said to have approximately 3 × 109 bp, and if the cost of sequencing required
is US $3 per bp (the estimated cost in the beginning), the project's total cost would be
approximately US $9 billion.
If the obtained sequences were to be stored in books, and if each page of the book contained 1000
letters and each book contained 1000 pages, then 3300 such books would be required to keep the
information of DNA sequence from a single human cell.
HGP was closely associated with the rapid development of a new area in biology called
Bioinformatics.
140
The goals of HGP are
1. Identify all the approximately 20,000-25,000 genes in human DNA.
2. Determine the sequences of the 3 billion chemical base pairs that make up human DNA.
3. Store this information in databases.
4. Improve tools for data analysis
5. Transfer related technologies to other sectors, such as industries
6. Address the ethical, legal, and social issues (ELSI) that may arise from the project
The methods involved two major approaches. One approach focused on identifying all the genes
that are expressed as RNA known as Expressed Sequence Tags (ESTs).
The other took the blind approach of simply sequencing the whole set of genomes that contained
all the coding and non-coding sequence, and later assigning different regions in the sequence
with functions, known as Sequence Annotation.
The commonly used hosts were bacteria and yeast, and the vectors were called BAC (bacterial
artificial chromosomes), and YAC (yeast artificial chromosomes).
The fragments were sequenced using automated DNA sequencers that worked on the principle of
a method developed by Frederick Sanger.
Microsatellites are a set of repetitive DNA sequences.

4.15.1 SALIENT FEATURES OF THE HUMAN GENOME PROJECT

1. The human genome contains 3164.7 million nucleotide bases
2. The average gene consists of 3000 bases, but sizes vary greatly, with the largest known
human gene being dystrophin at 2.4 million bases
3. The total number of genes is estimated at 30,000 - much lower than previous estimates of
80,000 to 140,000 genes
4. The functions are unknown for over 50 percent of the discovered genes
5. Less than 2 percent of the genome codes for proteins
6. Repeated sequences make up a substantial portion of the human genome
7. Chromosome 1 has the most genes (2968), and the Y has the fewest (231)
8. Scientists have identified about 1.4 million locations where single-base DNA differences
(SNPs - single nucleotide polymorphism) occur in humans

4.16 DNA FINGERPRINTING

DNA Fingerprinting involves identifying differences in some specific regions in DNA sequences
called repetitive DNA because, in these sequences, a small stretch of DNA is repeated many times.
The bulk DNA forms a major peak, and the other small peaks are referred to as satellite DNA.

141
Depending on the base composition, length of the segment, and the number of repetitive units,
satellite DNA is classified into many categories, such as micro-satellites, mini-satellites, etc.
These sequences typically do not code for any proteins, but they form a large portion of the human
genome.
DNA Polymorphism which is a variation at the genetic level arises due to mutations, as a
consequence of which an inheritable mutation is observed in a population at a high frequency.
Alec Jeffreys initially developed the technique of DNA Fingerprinting. He used satellite DNA as a
probe that shows a very high degree of polymorphism. It was called Variable Number of Tandem
Repeats (VNTR).
The technique involved Southern blot hybridization using radiolabeled VNTR as a probe
Steps of the VNTR technique:
1. Isolation of DNA
2. Digestion of DNA by restriction endonucleases
3. Separation of DNA fragments by electrophoresis
4. Transferring (blotting) of separated DNA fragments to synthetic membranes, such as
nitrocellulose or nylon
5. Hybridization using labeled VNTR probe
6. Detection of hybridized DNA fragments by autoradiography
The VNTR belongs to a class of satellite DNA referred to as mini-satellite. In addition to
application in forensic science, it has much broader applications, such as in determining
population and genetic diversities.
Currently, many different probes are used to generate DNA fingerprints

Figure 18 : Schematic representation of DNA fingerprinting.

142
4.17 USING CRISPR TO EDIT GENES AND CORRECT DISEASE-CAUSING
MUTATIONS

❖ GENE EDITING:
1. Altering genes in a specific, predictable way
2. Aim- to change particular genes in living cells, in part to try to correct genes that cause disease

❖ CRISPR-Cas 9 SYSTEM:
1. A powerful, new technique for gene editing
2. Genetic engineering- the direct manipulation of genes for practical purposes
3. Cas9- a bacterial protein that helps defend bacteria against the viruses that infect them

❖ Cas9:
1. A nuclease that cuts double-stranded DNA molecules
2. Will cut any sequence to which it is directed
3. Directed to its target by a guide RNA molecule that it binds and uses as a homing device,
cutting both strands of any DNA sequence that is complementary to the guide RNA
4. The guide RNA in the complex is engineered to be complementary to the “target” gene.
5. It cuts both strands of the target DNA, and the resulting broken ends of DNA trigger a DNA
repair system.
6. This technique is a highly successful way for researchers to “knock out” (disable) a given gene
to study what the gene does in an organism.

CRISPR technology has the potential to treat or even cure human diseases that have a genetic
basis, such as sickle cell anemia, Alzheimer’s, and Parkinson’s disease, as well as some types of
cancer
Jennifer Doudna- a co-discoverer of CRISPR-Cas9- recognized its incredible potential and the
danger of its misapplication.

Q. What is a Gene? Revisiting the Question

Merely saying a gene codes for a polypeptide is an oversimplification; most eukaryotic genes
contain noncoding segments (such as introns), so that large portions of these genes have no
corresponding segments in polypeptides.
A gene is a region of DNA that can be expressed to produce a final functional product, either a
polypeptide or an RNA molecule.
A given type of cell expresses only a subset of its genes- an essential feature in multicellular
organisms.

143
 EXERCISE-I

IAT BASED PROBLEMS

1. During density gradient centrifugation, the major peaks are formed by

A. Repetitive DNA
B. Genomic DNA
C. Bulk DNA
D. Both B and C

2. An mRNA synthesized by 144 nucleotide can produce a polypeptide chain of

A. 282 amino acids
B. 141 amino acids
C. 47 amino acids
D. 48 amino acids

3. Which of the following is not true for “Snips”?

A. There are 1.4 million locations in the human genome.
B. They shed light on chromosome structures, dynamics, and evolution.
C. It helps to find chromosomal locations for disease related sequences.
D. Where single base difference occurs

4. The enzyme that will be produced if there is a nonsense mutation in the lac Y gene
A. Lactose Permease
B. 𝛽galactosidase
C. Transacetylase
D. Both A and C

5. In rRNA thymine pairs with

A. Uracil
B. Adenine
C. Both A. and B.
D. None Of this

6. Repressor mRNA will be formed

A. Absence Of inducer
B. presence of lac mRNA
C. presence of inducer
D. Both A and C

144
7. Which of the following is not correct?
A. A change in a single base pair of genes results in the change of amino acid in case of sickle cell
anemia.
B. Sickle cell anemia is an example of point mutation.
C. Amino acid residue glutamine is changed to valine.
D. In case of sickle cell anemia, changed amino acid is non polar amino acid.

8. In the polynucleotide chain of DNA, a nitrogenous base is linked to the -OH of

A. 3 C pentose sugar
B. 2 C pentose sugar
C. 5 C pentose sugar
D. 1 C pentose sugar

9. The DNA fingerprinting is same for

A. Monozygotic twins
B. Dizygotic twins
C. Cousins
D. Siblings

10. In chromosome the DNA is associated

1. Negatively Charged Proteins
2. Positively Charged Proteins
3. Neutral Proteins
4. NHC protein
A. 2,4
B. 1,2,3,4
C. 2,3,4
D. 1,2,3

11. Who amongst the following scientists had no contribution in the development of the double
helix model for the structure of DNA ?
A. Rosalind Franklin
B. Maurice Wilkins
C. Erwin Chargaff
D. Meselson and Stahl

12. In some viruses, DNA is synthesized by using RNA as a template. Such a DNA is called
A. A – DNA
B. B – DNA

145
C. cDNA
D. rDNA.

13. If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is: 5’ –
ATGAATG – 3’, the sequence of bases in its RNA transcript would be
A. 5’ – AUG A AUG – 3’
B. 5’ – UACUU AC – 3’
C. 5’ – CAUUCAU – 3’
D. 5’ – GUAAGUA – 3’.

14. In E. colt, the lac operon gets switched on when

A. lactose is present and it binds to the repressor
B. repressor binds to operator
C. RNA polymerase binds to the operator
D. lactose is present and it binds to RNA polymerase.

15. The process of transformation is not affected by which of the following enzymes ?
a) DNase
b) RNase
c) Peptidase
d) Lipase
A. a,b
B. a,b,c,d
C. b,c,d
D. a,b,c

16. Some amino acids are coded by more than one codon, hence the genetic code is
A. overlapping
B. degenerate
C. wobbled
D. unambiguous.

17. The mutations that involve addition, deletion or substitution of a single pair in a gene are
referred to as
A. point mutations
B. lethal mutations
C. silent mutations
D. retrogressive mutations.

18. First experimental proof for semi-conservative DNA replication was shown in
146
A. Streptococcus pneumoniae
B. Escherichia coli
C. Neurospora crassa
D. Rattus rattus.

19. Transcription unit

A. starts with TATA box
B. starts with palindromic regions and ends with the rho factor.
C. starts with promoter region and ends in terminator region
D. starts with CAAT region

20. RNAase is a single polypeptide chain of amino acid residues.

A. 2
B. 350
C. 4
D. 124

21. Teminism is
A. a central dogma reverse
B. a central dogma of molecular biology
C. a circular flow of hereditary material
D. an effect of cytoplasm on functioning of DNA

22. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
A. AUGUUAAUAGACGAGUAGCGACGAUGU
B. AUGAGACGGACUGCAUUCCCAACCUGA
C. AUGCCCAACCGUUAUUCAUGCUAG
D. AUGUCGACAGUCUAAAACAGCGGG

23. Genes which are active all the time synthesizing substances needed by the cell are called
A. Cellular luxury genes
B. metabolic genes
C. housekeeping genes
D. control genes

24. “Father of experimental Genetics”

A. Gregor Mendel
B. T.H.Morgan
C. Hugo deVries
D. Carl Correns
147
25. What determines the expression of the transgene in the target tissue in transgenics?
A. enhancer
B. transgene
C. promoter
D. reporter

26. The Okazaki fragments in DNA chain growth

A. polymerize in the 3’ – to – 5’ direction and form a replication fork
B. prove the semi-conservative nature of DNA replication
C. polymerize in the 5’ – to – 3’ direction and explain 3’ – to – 5’ DNA replication
D. result in transcription.

27. What is a false statement about DNA replication?

A. Okazaki fragments are the initiators of continuous DNA synthesis along the leading strand.
B. Replication forks represent areas of active DNA synthesis on the chromosomes.
C. Error rates for DNA replication are often less than one in every billion base pairings.
D. Ligases and polymerases function in the vicinity of replication forks.

28. For gene expression to occur, chromatin structure must be altered because?
A. condensed chromatin is replicated but not transcribed.
B. condensed chromatin makes most DNA sequences inaccessible to the transcription complex.
C. decondensed chromatin has more nucleosomes per DNA molecule.
D. heterochromatin is actively transcribed and euchromatin is not transcribed.

29. You are asked to help solve a murder. A sample of what they believe to be the killer’s DNA is
brought to you from the crime scene for chemical analysis. Adenine, thymine, ribose, and
uracil were detected in this sample, leading to the conclusion that it is?
A. pure DNA.
B. pure RNA.
C. probably a mixture of DNA and RNA.
D. probably a mixture of rRNA and mRNA.

30. Is transcription of operon still possible if the gene encoding the lac repressor is mutated so that
it no longer binds the operator?
A. Yes, but only when lactose is present.
B. No, because RNA polymerase is needed to transcribe the genes.
C. Yes, because the operator will not be bound by the repressor and RNA polymerase can
transcribe the lac operon.
D. No, because cAMP levels are low when the repressor is nonfunctional.

148
 NEST BASED PROBLEMS:

1 Which Of the following cannot be concluded from the information given in the diagram?

A. VNTRs are hypervariable

B. Smaller chromosomes in human genome have smaller repeats of VNTRs
C. Larger fragments remain near the point of introduction of gel electrophoresis.
D. Crime scene’s DNA matches with the individual B

2. The picture given below shows the result of the Meselson and Stahl experiment. What
theoretically possible mode of DNA replication can be excluded after one round of
replication?

A. Semiconservative
B. Conservative
C. Disruptive
D. Both B and C
149
3. DNA is structurally and chemically more stable than RNA. Which one of the following is not
true for this?
A. Presence of thymine instead of uracil
B. 2 position’s OH is absent in DNA
C. It does not possess catalytic activity
D. It replicates itself based on complementary base pairing

4. What are the key characters of T2 bacteriophage that allowed Hershey and Chase to use it in
their studies of the genetic material?
A. It enters the bacterial cell to cause infection
B. It can undergo either lytic or lysogenic life cycle.
C. It injects its genetic material into a bacterial cell
D. None of the above

5. During translation, activated amino acids get linked to tRNA. This process is commonly called
as
A. charging of tRNA
B. discharging of tRNA
C. aminoacylation of tRNA
D. both (a) and (c )

6. Which of the following life processes evolved around RNA ?

A. Metabolism
B. Translation
C. Splicing
D. All of these
7. In transcription in eukaryotes, heterogenous nuclear RNA (hnRNA) is transcribed by
A. RNA polymerase I
B. RNA polymerase II
C. RNA polymerase II
D. all of these.

8. Human genome consists of approximately

A. 3 × 109 bp
B. 6 × 109 bp
C. 20,000 – 25,000 bp
D. 2.2 × 104 bp.
9. What happens when the small subunit of the ribosome encounters an mRNA?
A. Separation of the small and the larger subunit of the ribosome
150
B. Translation of the central dogma of DNA
C. Joining of the small and the larger subunit of the ribosome
D. Transcription of the central dogma of DNA

10. Which of the following initiation factor when bound to the 30S subunit blocks the A site, so
that only the P site is available for the initiator tRNA to bind to?
A. IF-4
B. IF-2
C. IF-3
D. IF-1

11. Which of the following antibiotics acts by competitively inhibiting the peptidyl transferase
activity of prokaryotic ribosomes?
A. Puromycin
B. Vancomycin
C. Tetracycline
D. Chloramphenicol

12. What combination of radio labelling is correct in the case of Hershey and Chase’s
demonstration of DNA as genetic material in T2 bacteriophage?
A. 31P, 35S
B. 31P, 32S
C. 31P, 14C
D. 31P, 12C

13. What is the nature of the strands of the DNA duplex?

A. Antiparallel and complementary
B. Identical and complementary
C. Anti=parallel and non-complementary
D. Dissimilar and non-complementary

14. Read the statements given below and identify the incorrect statement.
A. The human genome contains 3164.7 million nucleotide bases.
B. The average gene consists of 30,000 bp
C. The total number of genes is estimated at 30,000.
D. Chromosome Y has 231 genes

15. Arrange the following events in the order of synthesis of a protein

i) A peptide bond forms
ii) A tRNA matches its anticodon to the codon in the A- site
iii) The movement of second tRNA complex from A-site to P-site
151
iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the P-site
v) A small subunit binds to the mRNA
vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA
A. iv, v, iii, ii, i, vi
B. iv, vi, v, ii, I, iii
C. v, iv, iii, ii, vi, i
D. v, vi, iv, ii, i, iii

16. Match the entries in column I with those of column II and choose the correct answer.
Column I Column II
A. Alkali treatment M. Seperation of DNA fragments on gel slab
B. Southern blotting N. Split DNA fragments into single strands
C. Electrophoresis O. DNA transferred to nitrocellulose sheet
D. PCR P. X-Ray photography
E. Autoradiography Q. Produce fragments of different sizes
F. DNA treated with REN R. DNA amplification
A. A - N, B- Q, C- P, D- R, E- M, F - O
B. A - P, B - R, C - M, D -O, E - N, F - Q
C. A - Q, B - O, C - M, D - R, E - P, F – N
D. A - N, B - O, C - M, D - R, E - P, F - Q

17. Match the following

Column I Column II
A. Helicase (M) activation of amino acid
B. Peptidyl transferase (N) joins DNA fragments
C. DNA polymerase (O) unwinds DNA helix
D. DNA ligase (P) peptide bonds between amino acids
E. Aminoacyl synthetase enzyme (Q) DNA synthesis
F. RNA primase (R) synthesis of RNA primer

A. A-O, B-P, C-Q, D-N, E-M, F-R

B. A-R, B-M, C-N, D-Q, E-P, F-O
C. A-M, B-R, C-P, D-Q, E-N, F-O
D. A-R, B- Q, C- A, D- M, E-P, F-N

18. What would happen if the second codon of a polypeptide, UGC, was changed to UAG by a
mutation in DNA?
A. Nothing. The ribosome would skip that codon and translation would continue.
B. Translation would continue, but the reading frame of the ribosome would be shifted.
C. Translation would stop at the second codon and no functional protein would be made.
D. Translation would continue, but the second amino acid in the protein would be different.
152
19. It appears that a lagging daughter strand of DNA is synthesized in the “wrong” direction.
How is this synthesis accomplished?
A. ligating (connecting) short Okazaki fragments that are synthesized in short spurts in the “right”
direction.
B. primase.
C. using multiple primers and DNA polymerase I.
D. Both (a) and (b)

20. Satellite DNA

A. is classified into many categories such as micro-satellites, minisatellites, etc. based on the base
composition length of segments and the number of repetitive units.
B. normally does not code for any protein.
C. shows polymorphism.
D. forms the basis of DNA fingerprinting.

21. If we plot the optical density of DNA as a function of

temperature, we will observe that the increase in
absorption occurs abruptly over a relatively narrow
temperature range (shows below plot) and the midpoint
of this transition is called melting point (Tm). Like ice
DNA also melts and it shows in the curve. In the curve P
and Q indicating probable two types of DNAs. So they
are –
A. P is dsDNA ,Q is ssDNA
B. P and Q both are ssDNA
C. P is ssDNA and Q is dsDNA
D. P and Q both are dsDNA.

22. Suppose You isolated a 10,500-bp plasmid (supercoiled,

cDNA) from E. coli. The plasmid contains one unique
re- cognition site for EcoRI, a restriction enzyme.
Restriction enzymes recognize a specific sequence and
cut both strands of the DNA at that sequence. You briefly
incubated the cDNA at 37°C in four separate reactions
containing the components listed below. You ran the
reaction on an agarose gel and visualized the DNA using
ethidium bromide and UV light. The reactions included
the appropriate buffer and ATP when required.
An agarose gel containing four lanes of possible products is given below. For each reaction,
indicate which lane on the gel contains the products that you would expect to see on your
agarose gel.

153
i) Buffer alone with DNA ladder
ii) DNAse I (Brief treatment)
iii) Topoisomerase I
iv) EcoRI
Choose the correct option -
A. 1-iii,2-ii,3-iv,4-i
B. 1-iii,2-i,3-iv,4-ii
C. 1-iv,2-i,3-ii,4-iii
D. 1-ii,2-i,3-iv,4-iii

23. A class of temperature sensitive E. coli mutants defective in DNA replication were identified
that ceased replication immediately upon increase in temperature. Which of the following
processes are likely to be defective in these mutants?
A. elongation step of DNA replication
B. segregation step of DNA replication
C. initiation of DNA replication
D. termination of DNA replication

24. In E. coli, though DNA polymerase I (Pol I) plays an essential role in the replication process, it
is not the major polymerase. Instead, the enzyme responsible for advancement of replication
fork is Pol III. From the four DNA structures (A, B, C and D) given below, students made
several interpretations about the shorter arm being extended by Pol I and/or Pol III.

1. 2.
HO-3’ 5’-PO4
HO-5’ 3’-OH

3. 4.

Which one of the interpretations written below is correct?

A. 1 will be extended by Pol III but not by Pol I.
B. Neither 2 nor 3 will be extended by either Pol I or Pol III.
C. 3 will be extended by both Pol I and Pol III.
D. 4 will be extended only by Pol I, but not by Pol III.

25. In semi-conservative mode of DNA replication two parental strands unwind and are used for
synthesis of new strands following the rule of complementary base pairing. Synthesis of
complementary strands require that DNA synthesis proceeds in opposite direction, while the
double helix is progressively unwinding and replicating in only one direction.one of the DNA
strands is continuously synthesized in the same direction as the advancing replication fork and
154
 is called leading strand whereas the other strands is synthesized discontinuously in segments
and is referred to as lagging strands. These short fragments made discontinuously are labelled
as Okazaki fragments. These Okazaki fragments need to be matured into continuous DNA
strands by which one of the following combinations of enzymes?
A. DNA Pol III and DNA Ligase
B. DNA Pol I and DNA Ligase
C. DNA Pol II and DNA Ligase
D. DNA gyrase and DNA Ligase

26. Although ribonucleoside triphosphates (rNTPs) are present at approximately 10-fold higher
concentration than deoxyribo-nucleoside triphosphates (dNTPs) in the cell but they are
incorporated into DNA at a rate that is more than 1000-fold lower than dNTPs. This is because
A. DNA polymerase cannot discriminate between dNTPs and rNTPs. But as soon as rNTPs are
incorporated in the DNA chain, they are hydrolyzed due to the presence of 2'-OH group.
B. DNA polymerase cannot discriminate between dNTPs and rNTPs. But Ils soon as rNTPs are
incorporated in the DNA chain, they are excised by the proofreading activity of DNA
polymerase.
C. DNA polymerase efficiently discriminates between rNTPs and dNTPs, because its nucleotide
binding pocket cannot accommodate a 2'-OH on the incoming nucleotide.
D. DNA polymerase cannot discriminate between rNTPs and dNTPs. Since the rate of
transcription in a cell is 106 times faster than replication, it cannot compete with RNA
polymerase for rNTPs.

27. You have labelled DNA in a bacterium by flowing cells in medium containing either 14N
nitrogen or the heavier isotope,15N Furthermore, you have isolated pure DNA from these
organisms, and subjected it to CsCl density gradient centrifugation leading separation of light
(14N ) and heavy (15N) forms of DNA to different locations in the centrifuge tube. In the next
experiment, bacteria were regrown first in a medium containing 15N so that all the DNA made
by cells will be in heavy form. Then these cells were transferred to a medium containing only
14N and allowed the cells to divide for one generation. DNAs were extracted and centrifuged

as above in the CSCI gradient. A hybrid DNA band was observed at a position located between
and equidistant from the 15N and 14N DNA bands. Based on the above observation, which one
of the following conclusions is correct
A. Replication of DNA is conservative
B. Replication of DNA is semi-conservative
C. Replication of DNA is dispersive
D. Replication by rolling circle mode

28. In a genetic assay, randomly generated fragments of yeast DNA were cloned into a bacterial
plasmid containing gene 'X' essential for yeast viability on minimal media. The recombinant
plasmid was used to transform a yeast strain deficient in recombination and lacking 'X' gene.
Transformants, which survive on minimal media and form colonies should essentially have:

155
A. Yeast centromeric sequence which ensures integrity of the plasmid after transformation.
B. Enhancers for the essential gene missing in the transformed strain.
C. A sequence similar to bacterial origin of replication
D. Yeast autonomous replicating sequence.

29. It takes 40 minutes for a typical E. coli cell to completely replicate its chromosome.
Simultaneous to the ongoing replication, 20 minutes of a fresh round of replication is
completed before the cell divides. What would be the generation time of E. coli growing at
37°C in a complex medium?
A. 20 minutes
B. 40 minutes
C. 60 minutes
D. 30 minutes

30. In the diagram below, the dotted line marks the point of initiation of bidirectional replication

1. On the right side of the dotted line, leading strand synthesis occurs using the upper strand as the
template.
2. On the right side of the dotted line, leading strand synthesis occurs using the lower strand as the
template.
3. A ligase deficient (lig-) mutant would affect replication of the upper strand on the left side of
the dotted line.
4. A ligase deficient (lig-) mutant would affect replication of the lower strand on the left side of
the dotted line.
Which one of the following options represents the combinations of the correct statements?
A. 1 and 4
B. 2 and 3
C. 2 and 4
D. 1 and 3

31. Which one of the following statements about DNA replication is INCORRECT?
A. During DNA replication, when adjacent bidirectional forks converge, the lagging strand will
meet the leading strand of the same template strand
B. Mispaired nucleotide at the 3'-OH end of the primer strand triggers the 3-5' exonucleolytic
proofreading activity
C. In a replication bubble moving bidirectionally, the same parental DNA strand cannot serve as a
template for both the lagging and leading strand synthesis
156
D. DNA replication involves a RNA-DNA chimeric molecule

32. A 6.4 Kb plasmid DNA has two restriction endonuclease sites, Hindiii and EcoRI. Complete
double digestion of the plasmid with both the enzymes yields two fragments of 3.1 and 3.3 Kb.
In order to study the DNA repair process, a G:T mismatch was introduced in one strand of
Hindll site and the damaged plasmid was incubated in a reconstituted repair system containing
all the factors and enzymes required for repair. If the efficiency of the repair system is 50%,
which one of the following band patterns on agarose gel will be obtained after treating the
repaired-

A. B.

C. D.

33. In a genetic assay, randomly generated fragments of yeast DNA were cloned into a bacterial
plasmid containing gene 'X' essential for yeast viability on minimal media. The recombinant
plasmid was used to transform a yeast strain deficient in recombination and lacking 'X' gene.
Transformants, which survive on minimal media and form colonies should essentially have:
A. Yeast centromeric sequence which ensures integrity of the plasmid after transformation.
B. Enhancers for the essential gene missing in the transformed strain.
C. A sequence similar to bacterial origin of replication
D. Yeast autonomous replicating sequence.

34. In humans, the enzyme having reverse transcriptase activity is:

A. Ribonuclease P
B. Ribonuclease D
C. Recombinase
D. Telomerase

157
35. Telomerase, a RNA- protein complex which completes the replication of telomeres during
DNA synthesis, is a specialized
A. RNA dependent DNA polymerase
B. DNA dependent DNA polymerase
C. DNA dependent RNA polymerase
D. RNA dependent RNA polymerase

36. Telomerase, a protein RNA complex, has special reverse transcriptase activity that completes
replication of telomeres during DNA synthesis. Although it has many properties similar to
DNA polymerase, some of them are also different. Which one of the following properties of
telomerase is different from that of DNA-polymerase?
A. Telomerase requires a template to direct the addition of nucleotide
B. Telomerase can only extent a 3'-OH end of DNA
C. Telomerase does not carry out lagging strand synthesis
D. Telomerase acts in processive manner

37. In order to study the role of telomeres in DNA replication, genetically engineered mice were
prepared, where the gene for telomerase RNA was knocked out. When cells from these
knockout mice were taken and cultured in vitro, they proliferated even after 100 cell divisions
which is quite unlikely in the case of human cells. Which of the following is the correct
reason?
A. Humans and mice are fundamentally different with respect to their requirements for telomerase
enzymes in the context of DNA replication.
B. In vitro, mice DNA becomes circular due to end to end chromosome fusion and does not
require Enzyme in telomerase for DNA end replication.
C. Mice have a very long stretch of telomere DNA sequence compared to that of humans.
D. In vitro, mice DNA replication does not require the removal of RNA primers.

38. When circular plasmids having a centromere sequence are transformed into yeast cells, they
replicate and segregate in each cell division. However, if a linear chromosome is generated by
cutting the plasmid, at a single site with a restriction endonuclease, the plasmids are quickly
lost from the ends. What could be done so as to restore its stability and can be inherited? yeast.
It is known that genes on the plasmids are lost because of the instability of the chromosome
A. Methylation of adenine residues of the plasmid.
B. Complexing the plasmid ends with histone proteins.
C. By incorporating telomere sequences to the end of plasmid.
D. By incorporating acetylated histone proteins to the plasmid ends.

39. As topoisomerases play an important role during replication, a large number of anticancer
drugs have been developed that inhibit the activity of these enzymes. Which of the following
statements: NOT true about topoisomerases as a potential anticancer drug target?
A. As cancer cells are rapidly growing cells, they usually contain higher levels of topoisomerases.
B. The transient DNA breaks created by topoisomerases are usually converted to permanent break
158
 the genome in the presence of topoisomerase targeted drugs.
C. As cancer cells often have impaired DNA repair pathways, they are more susceptible-towa
topoisomerase targeted drugs.
D. The drugs which specifically target topoisomerases, usually do not affect normal fast growing
cells.

40. A bacterial population has a plasmid with copy number 'n'. It was observed that on an average
in one out of 2(n-1) cell divisions, there was spontaneous plasmid curing. It was inferred from
the observation that:
1. Each cell division does not have equal probability of plasmid curing.
2. There is no evidence for any mechanism of plasmid segregation in the two daughter cells.
3. Plasmid distribution to daughter cells is random.
4. Each plasmid has an equal chance of being in either of the two daughter cells.
Which of the combinations of above statements is true?
A. 1 and 2
B. 2 and 4
C. Only 1
D. 2, 3 and 4

41. Reverse transcriptase has both ribonuclease and polymerase activities. Ribonuclease a activity
required for
A. the synthesis of new RNA strand
B. the degradation RNA strand
C. the synthesis of new DNA strand
D. the degradation of DNA strand

42. The RNA primer synthesized during the replication process in bacteria is removed by?
A. DNA gyrase
B. Primase
C. DNA polymerase I
D. DNA polymerase II

43. Which of the following characteristics with respect to bacterial DNA polymerase III are
TRUE?
1. Initiation of chain synthesis
2. 5'-3' polymerization
3. 3’-5 ‘ exonuclease activity
4. 5'-3' exonuclease activity

A. 1 and 2 only
B. 2 and 3 only
C. 2 and 4 only
D. 1 and 4 only
159
44. The deadly 'death cap' mushroom, Amanita parodies, produces a toxin called α-amanitin. This
toxin specifically inhibits eukaryotic RNA polymerases II and III. Now guess which cellular
process is inhibited by this toxin?
A. DNA synthesis
B. Cell division
C. RNA synthesis
D. RNA splicing

45. In the presence of glucose and lactose, Escherichia coli utilizes glucose. However, lactose also
enters the cells because of
A. A low level of permease is always present in the cell
B. It uses the same transporter as glucose
C. It diffuses through the bacterial cell membrane
D. It is transported through porins

MULTIPLE SELECT QUESTION (MSQ)

46. According to a recent analysis of the human genome, which of the following conclusions does
demonstrate our genetic connection with other, more primitive organisms?
A. Only 35,000 genes are required to make a human.
B. Human DNA contains hundreds of bacterial genes.
C. Numerous homeotic genes are shared among humans and other animals.
D. There are over 40 newly identified disease genes.

47. Which of the following options would not cause the determination of one amino acid by more
than one codon?
A. redundancy of genetic code.
B. continuous nature of genetic code.
C. punctuation in genetic code.
D. universal nature of genetic code.

48. The enzymes do not involve in transcription are-

A. DNA Polymerase I
B. DNA Polymerase III
C. RNA Polymerase
D. DNA Polymerase II

49. Select the correctly matched pairs

A. Purines – Nitrogenous bases cytosine, thymine and uracil
B. Recombinant DNA – DNA formed by joining the DNA segments from two different sources
C. rRNA – RNA found in ribosomes
160
D. ATP – The energy-carrying compound in the cell

50. Which enzyme is produced during lactose catabolism by E.coli?

A. 𝜷-galactosidase
B. Lactose Permease
C. Thiogalactoside transacetylase
D. Lactose dehydrogenase

51. Which is required for protein synthesis?

A. Initiation codon
B. Peptidyl transferase
C. GTP
D. None of the above.

52. Select a ribozyme

A. Peptidyl transferase
B. Helicase
C. Ribonuclease-P
D. None of the above

53. In a DNA strand the nucleotides are not linked together by

A. glycosidic bonds
B. phosphodiester bonds
C. peptide bonds
D. hydrogen bonds.

54. Which of the following statements is the most appropriate for sickle cell anemia ?
A. It cannot be treated with iron supplements.
B. It is a molecular disease.
C. It confers resistance to acquiring malaria.
D. None of the above.

55. Select the correct match of enzyme with its related function.
A. DNA polymerase – Synthesis of DNA strands
B. Helicase – Unwinding of DNA helix
C. Ligase – Joins together short DNA segments
D. A,C.

56. Which of the following can be described as 'a sequence that can be several thousand base pairs
upstream or downstream of a eukaryotic promoter and which increases gene expression as
much as 200-fold.'
161
A. CAAT box
B. TATA box
C. Insulator
D. Enhancer

57. Read the sequence of nucleotides in the given segment of mRNA and the respective amino acid
sequence in the polypeptide chain to answer the following question
mRNA : AUGUUUAUGCCUGUUUCUUAA
Polypeptide : Met-Phe-Met-Pro-Val-Ser
Which codons respectively code for proline and valine amino acids in the given polypeptide
chain, respectively?
A. CCU & GUU
B. GUU & UCU
C. UCU & UAA
D. GUU & CCU

162
 EXERCISE - II

IAT PREVIOUS YEAR QUESTIONS

1. Provided low ace recognition serenon for restriction (REI), 2 (REL2) and 3(RE3) Arrows
indicate the position where it on the two strands Which of the following on the RE1 DNA
ligate to?
IAT 2017

A. All the RE1, RE2 and RE3 digested DNA

B. Only to RE1 digested DNA
C. Only RE1 anal RE3 digested DNA
D. Only to RE1 and RE2 digested DNA

2. DNA fragments of 100 base pairs (bp), 300 hp and 500 bp were separated by agar gel correct
arrangement of the fragments separated on the gel in the increasing order.
IAT 2018
A. 500 bp < 300 bp < 100 bp
B. 100 bp < 300 bp < 500 bp
C. 100 bp > 300 bp > 500bp
D. 500 bp > 300 bp > 100bp

3. Which of the followinɡ is palindromic sequence ʔ IAT 2021

A. 5' GAATTC 3’
3' CTTAAG 5’
B. 5' GACTTC 3’
3' CTGAAG 5’
C. 5’GAAGTC 3’
3' CTTCAG 5’
D. 5' GACCAG 3’
3' CTGGTC 5’

163
4. When the ribosome encounters a stop codon in the mRNA, during translation, which one of the
followng binds to the stop codon?
IAT 2023
A. Release factor.
B. Rho factor.
C. Termination factor.
D. Sigma factor.

164
 NEST PREVIOUS YEAR QUESTIONS

1. A short peptide has a sequence of amino acids valine serine-methionine-proline, and the t-
RNAs used in its synthesis have the following corresponding anticodons: 3-CAG-5, 3-UCG-5,
3-UAC-5, 3-UUU-5. What is the sequence of DNA codes the peptide?
NEST 2013
A. 5' GACGCTCATTTT 3'
B. 5' CAGTCGTACTTT 3'
C. 5' UUUCAUGCUGAC 3'
D. 5' TTTCATGCTGAC 3’

2. Two different DNA samples were isolated from biological specimens. Further experi ments
demonstrated that one of these (X) was composed of 30% A. 30% G, 20% T and 20% C but
could not be cut by an exonuclease (an enzyme that cuts mucleotides from the ends of DNA).
The second DNA sample (Y) could be cut by the exonuclease and was found to be composed
of 30% A, 30% T, 20% G and 20% C. Which of the following statements can be correctly
deduced from the above?
NEST 2013
A. DNA X has double-stranded, linear structure.
B. DNA X has a single-stranded, circular structure.
C. DNA Y has a double-stranded, circular structure.
D. DNA Y has a single-stranded, linear structure.

3. Huntington's disease is a genetic disorder that leads to defects in brain function and is always
fatal. The affected gene consists of a sequence of DNA having multiple re- peats of the
nucleotide sequence CAG. A fac tor that determines whether an allele of this gene causes
Huntington's disease or not is the number of CAG repeats. The graph on the right shows the
age (in years) at which patients (each represented by a dot) first de- veloped symptoms of
Huntington's desease and the number of CAG repeats in the allele causing Huntington's disease
in each patient. From the above graph, which of the following would be correct?
NEST 2014

A. There could be factors other than number of CAG repeats that determine the age of
onset.
165
B. There is a negative correlation between age of onset and number of CAG repeats.
C. Huntington's disease is fatal and is therefore not heritable.
D. Huntington's disease is heritable and can be passed onto offspring.

4. An aquatic plant, Cabomba caroliniana, shows substantial developmental plasticity. The

submerged leaves of the plant are feathery (which are not damaged due to flowing underwater
currents) while leaves on the surface are padded (and help in floatation). The correct statement
related to the above phenotypes is:
NEST 2015
A. The genome content of the submerged leaves is different from that of leaves on the surface.
B. The observed phenotypic variation in leaves is not influenced by diverse growth conditions.
C. These phenotypic variations are due to somatic mutations.
D. The submerged and floating leaves may have variations in the expression patterns of structural
and / or regulatory genes.

5. A living cell is characterized by the presence of several cellular structures and molecular
processes. The correct statement regarding living cells is:
NEST 2015
A. The nucleus is a characteristic feature of all living cells.
B. An mRNA sequence is never completely represented in its translated product.
C. Anticodons are located on the rRNA.
D. Splicing of introns in prokaryotes occurs in the cytoplasm.

6. Which of the following pairs is an incorrect match

NEST 2016
A. Transcriptional repression - gene regulation
B. Post-translational modifications - phosphorylation
C. Cytoplasm - exon splicing of eukaryotic pre-mRNA
D. Enhancers - increased transcription

7. A 1000 base pair double-stranded DNA (B form) has a melting temperature (T,,) of 58°C. If a
duplex RNA (A form) of the same length and sequence is constructed, then the T,, of this new
RNA duplex with respect to the DNA (B form) would be
NEST 2023
A. higher due to greater stability of A form of RNA duplex.
B. lower due to lower stability of A form of RNA duplex.
C. lower because of unfavourable enthalpy of formation of RNA duplex
D. identical, as the number of hydrogen bonds remain the same.

8. In the given pedigree, circles represent females, and squares represent males. Filled shapes
indicate affected individuals, while unfilled shapes indicate unaffected individuals. Based on the
pedigree information provided below, identify the inheritance pattern.
NEST 2023

166
A. Autosomal dominant
B. Autosomal recessive
C. X-linked dominant
D. a-linked recessive

9. Restriction enzymes recognize certain sequences within the DNA and cleave them. If a DNA
fragment is cleaved with BamHI restriction enzyme, it generates sticky ends. If the same DNA
fragment is cleaved with Sau3A restriction enzyme, it generates sticky ends. The cleaved
fragments can be joined using DNA ligase. The recognition and cleavage site (red arrows) for
BamHI and Sau3A are given below. N represents any of the nucleotides.
NEST 2023

Based on this information and assuming there is only a single cleavage site, choose the correct
option.
A. If a Sau3A cleaved end is ligated to a BamHI cleaved end, the ligated fragment can be further
digested using Sau3A irrespective of the neighbouring sequence.
B. If a BamHI cleaved end is ligated to a Sau3A cleaved end, the ligated fragment can be further
digested using BamHI irrespective of the neighbouring sequence.
C. If both the recognition sequences are reverse complemented then it cannot be cleaved using
either BamHI or Sau3A.
D. If a BamHI cleaved end is ligated to a Sau3A cleaved end and reverse complemented then the
ligated fragment can be digested using BamHI irrespective of the neighbouring sequence.

167
 ANSWER KEY

EXERCISE -I

IAT BASED PROBLEMS:

1. D 2. C 3. B 4. B 5. D
6. D 7. C 8. D 9. A 10. A
11. D 12. C 13. A 14. A 15. C
16. D 17. A 18. B 19. C 20. D
21. A 22. B 23. C 24. B 25. D
26. C 27. A 28. B 29. C 30. C

NEST BASED PROBLEMS :

1. B 2. B 3. D 4. C 5. B

6. B 7. C 8. A 9. B 10. D

11. D 12. A 13. C 14. B 15. D

16. D 17. A 18. C 19. D 20. B

21. A 22. C 23. A 24. B 25. B

26. C 27. B 28. D 29. A 30. C

31. C 32. B 33. D 34. D 35. A

36. C 37. C 38. C 39. D 40. D

41. B 42. B 43. B 44. C 45. A

46. A,B,C 47. B,C,D 48. A,B,D 49. B,C,D 50. A,B,C

51. A,B,C 52. A,C 53. A,C,D 54. A,B,C 55. A,B,C

56. D 57. A

168
 EXERCISE : II

IAT PREVIOUS YEAR QUESTIONS

1. C 2. B 3. A 4. A

NEST PREVIOUS YEAR QUESTIONS

1. D 2. B 3. A,B,D 4. D 5. B

6. C 7. A 8. B 9. A

169