1

L5 Types of PCR and applications of PCR

Specific objectives
By the end of this lecture you should be able to:
1. Discuss the factors that should be considered in designing effective PCR primers.
2. Explain why the annealing temperature the most important to be considered in running a PCR
reaction.
3. Explain what is meant by the “melting temperature (Tm) of a primer-template hybrid”.
4. Calculate Tm for the primer sequence 5’ GGGCCCATAATGGCATCGCG 3’
5. Describe the following types of PCR
(a) Inverse PCR
(b) Nested PCR
(c) RT-PCR
(d) Competitor RT-PCR
6. Write brief notes on application of PCR in
(a) Studying minute quantities of DNA
(b) Determining the amount of RNA in a sample.
(c) Comparing different genomes
7. Compare the use of RFLPs and PCR in clinical diagnosis.

Assembly of a PCR reaction

The reaction is assembled in a single tube, and then placed in thermal cycler (a programmable
heating/cooling block). For example a reaction for amplifying human genome DNA sequence may be
assembled as follows:
 Input genomic DNA, 0.1-1 g
 Primer 1, 20 pmoles
 Primer 2, 20 pmoles
 20 mM Tris-HCl, pH 8.3 (at 20oC)
 1.5 mM magnesium chloride
 25 mM potassium chloride
 50 M each deoxynucleotide triphosphate (dATP, dCTP, dGTP,dTTP)
 2 units of Taq polymerase
A layer of mineral oil is placed over the reaction mix to prevent evaporation. The reaction is cycled 25-35
times, with the following temperature programme:
Denaturation 94oC, 0.5 min
Primer annealing 55oC, 1.5 min
Extension 72oC, 1 min
 2

Typically, the reaction takes some 2-3 hours overall.

Notes:
 The optimal temperature for the annealing step will depend upon the primers used.
 The pH of the Tris.HCl buffer decreases markedly with increasing temperature. The actual pH varies
between about 6.8 and 7.8 during the thermal cycle.
 The time taken for each cycle is considerably longer than 3 min (0.5 + 1.5 + 1 min), depending upon
the rates of heating and cooling between steps

5.1.2 Design of primers for PCR

The success or failure of a PCR reaction depends on the design of the primers. A primer is a short
single-stranded oligonucleotide which, when attached by base-pairing to a single-stranded template
molecule, acts as the start point for complementary strand synthesis directed by a DNA polymerase
enzyme.
If the primers are incorrectly designed then PCR may fail because (a) no amplification occurs (b)
the wrong fragment or more than one fragment, is amplified.
 3

Appropriate primers should meet the following conditions:

 They must correspond with the sequences flanking the target region on the template molecule
 Each primer should be complementary to its template strand in order for hybridization to occur
 The 3’ ends of the hybridized primers should point towards one another.
 4

Target sequence to be amplified should not be greater than about 3 kb in length and ideally should be less
than 1 kb. Fragments up to 10 kb can be amplified by standard PCR techniques, but the longer the
fragment the less efficient the amplification and the more difficult it is to obtain consistent results. The
number of amplified molecules produced during the PCR reaction measures the efficiency of PCR.
Amplification of very long fragments up to 40 kb is possible but requires special methods.

5.1.3 Factors that are important in choosing effective primers

(a) Primers should be 17 to 30 nucleotides in length.
If the primers are too short, they might hybridize to non-target sites and give undesirable amplification
products. For example, if the total human DNA is used in PCR with a pair of primers 8 nucleotides in
length, the attachment sites for these primers will be expected to be on average, once every 4 8 bp (65,536
bp). This will give approximately 46, 000 possible sites in the 3,000,000 kb human genome. In this case,
it is very unlikely that a pair of 8-mer primers would give a single, specific amplification product.

If 17-mer primers are used, then expected frequency of a 17-mer sequence is once every 417 bp
(17,179,869,184 bp). This is more than five times greater than the length of the human genome, so a 17-
mer primer would be expected to have just one hybridization site in total human DNA. So a pair of 17-
mer primers should give a single, specific amplification product.
 5

If the primers are too long, complete hybridization to the template molecules cannot occur in the
time allowed during the reaction cycle. The length of the primer influences the rate at which it hybridizes
to the template DNA. Longer primers hybridize at a slower rate.
(b) A GC content of about 50% is ideal. For primers with a low GC content, it is desirable to choose a
long primer so as to avoid a low melting temperature.
(c) Sequences with long runs (i.e. more than three or four) of a single nucleotide should be avoided.
(d) There should be no complementarity between the two primers.

5.1.4 Working out the correct temperature for PCR

The annealing temperature is the most important one to be considered because it can affect the
specificity of the reaction. This is because DNA-DNA hybridization is temperature-dependent. It the
temperature is too high, no hybridization between the primers and template will occur. If the temperature
is too low, mismatched hybrids (one in which not all the correct base pairs have formed) are stable.
Mismatches increase the number of potential hybridization sites for each primer, and make amplification
to occur at non-target sites on the template molecule.
Therefore, the ideal annealing temperature should be low enough to enable hybridization between
primer and template, but high enough to prevent formation of mismatched hybrids. This temperature is
estimated by determining the melting temperature or Tm of the primer-template hybrid. The Tm is the
temperature at which the correctly base-paired hybrid dissociates (melts). A temperature 1 or 2oC below
this should be low enough to allow the correct primer-template hybrid to form, but too high for a hybrid
with a single mismatch to be stable. Tm can be determined either experimentally or calculated using the
formula
 6

Tm = (4x G+C + (2x A+T )oC

G+C number of G and C nucleotides in the primer sequence
A+T number of A and T nucleotides in the primer sequence.

The two primers should be designed so that they have identical melting temperatures.
The temperature to be used will be 1-2oC below the calculated temperature.
 7

5.2 Types of PCR

5.2.1 Reverse Transcriptase PCR (RT-PCR)

 The method involves copying the mRNA using reverse transcriptase, as in standard cDNA synthesis.
 Oligo(dT)-primed synthesis is often used to generate the first strand cDNA.
 PCR primers are then used as normal, although the first few cycles may be biased in favour of
copying the cDNA single-stranded product until enough copies of the second strand have been
generated to allow exponential amplification from both primers.

 One use of RT-PCR is in determining the amount of mRNA in a sample (competitor RT-PCR).
 A series of samples is spiked with increasing amounts of a competitor RNA that will produce a
PCR product that is different in size to the prospective target fragment. (Figure…….)
 The competitor RNA ‘competes’ with the target RNA for the primers and other resources in the
reaction during PCR. The target and competitor are amplified using the same primer pair
(Figure…..)
 If the target and competitor products are of different sizes, they can be separated on the basis of
size on an electrophoresis gel. (figure……).
 When the two bands are of equal intensity, the amount of target sequence in the original sample is
the same as the amount of competitor added.
 In this case the equal band intensities in lane 3 enable the amount of target mRNA in the original
sample to be determined, as this is the point where the competitor and target were present at equal
concentrations at the start of the PCR process (Figure…….).
 8

5.2.2 Nested PCR

 This techniques helps to overcome the problems associated with a large number of PCR cycles, which
can lead to error prone synthesis.
 This technique increases both the sensitivity and fidelity of the basic PCR protocol.
 It involves using two sets of primers.
 The first external set generates a normal PCR product.
 Primers that lie inside the first set are then used for a second PCR reaction. These internal or nested
primers generate a shorter product (figure……).
 9

5.2.3 Inverse PCR

 Often a stretch of DNA sequence is known, but the desired target sequence lies outside this region.
This causes problems with primer design, as there may be no way of determining a suitable primer
sequence for the unknown region.
 Inverse PCR (IPCR) involves isolating a restriction fragment that contains the known sequence plus
flanking sequences.
 By circularising the fragment, and then cutting inside the known sequence, the fragment is essentially
inverted.
 Primers can then be synthesized using the known sequence data and used to amplify the fragment,
which will contain the flanking regions.
 Primers that face away from each other (with respect to direction of product synthesis) in the original
known sequence are required, so that on circularisation they are in the correct orientation.
 The technique can also be used with sets of primers for nested PCR.
 Analysis and interpretation of the results usually requires DNA sequencing to determine the areas of
interest.
 10

5.3 Applications of PCR

5.3.1 PCR can be used to study minute quantities of DNA.

 PCR can use a single molecule as the template for an amplification reaction. Amplification of DNA
from an isolated sperm cell has been demonstrated. A sperm cell contains just one haploid copy of the
human genome.
 This sensitivity means that molecular analysis can be applied to specimens that do not contain enough
DNA for standard cloning procedures.
 PCR has been used:
(a) In forensic analysis, enabling genetic fingerprinting techniques to be used with single hairs and
even bloodstains.
(b) To amplify DNA from bones of murder victims, allowing identification to be made even on
remains that are too badly decayed for conventional analysis.
(c) In archaeology and palaentology, by enabling nucleotide sequences to be obtained from traces of
DNA present in preserved or fossilized material.
(d) To study the genetic affinities of ancient peoples through amplification and sequence analysis of
traces of DNA retained in their bones or preserved in specimens such as mummies and bog
bodies.

5.3.2 PCR can be used in clinical diagnosis

 RFLP analysis is used to screen for human gene mutations that might lead to genetic diseases.
This is possible only if the mutation results in a detectable change in the length of a restriction
fragment.
 Mutations for many genetic diseases do not result in an RFLP and can only be detected if the
relevant region of the genome is sequenced.
 11

 This means preparing a gene library for each individual and then isolating and sequencing the
clone containing the mutated gene. This approach is too time-consuming to be used within a
routine screening programme.
 PCR enables sequence information to be obtained very quickly by amplification of the relevant
region of the genome followed by direct analysis of the PCR products.
Prepare a hybridization purify subclone
Gene library probing to DNA to obtain a
Identify the fragment short
(a) Desired clone enough for sequencing
(b)

DNA sample PCR Sequence the gene

Traditional (a) and PCR-based (b) methods for obtaining the sequence of a gene from human DNA
 PCR has made it possible to have
o Rapid clinical diagnosis
o Accelerated research into genetic diseases by allowing many different group at risk to be
examined so that new mutations can be identified.
 PCR has been used in diagnosis of pathogenic diseases. For example, amplification of viral DNA in
human samples often enables diagnosis to be made days, weeks or even months before the onset of
symptoms. The treatment of many diseases, especially cancers caused b virus e.g. cervical cancer
caused by human papillomaviruses, is generally more successful if begun early.
5.3.3 PCR can be used to amplify RNA
 RNA molecules are first converted into single-stranded cDNA with the enzyme reverse transcriptase.
This technique is therefore called RT-PCR.
 PCR primers and Tag polymerase are then added and the amplification is carried out as in standard
technique.
 RT-PCR has been used to measure the relative amounts of mRNA in different tissues or in the same
tissue at different times. Amount of mRNA enables in a cell is a reflection of the activity of the parent
gene. So quantification of mRNA enables changes in gene expression to be monitored.
 Old method of northern hybridization is only possible for mRNAs that are relatively abundant. So
PCR allows the study of the less active genes.
 An estimate of the actual amount of mRNA present at the start of PCR can be made by comparing the
band intensity on a gel with a series of controls produced by amplifying known amounts of DNA.
 12

5.3.4 PCR can be used to compare different genomes

 Random amplification of DNA is a useful technique in phylogenetics, an area of research concerned
with the evolutionary history and lines of descent of species and other groups of organisms.
 The banding pattern seen when products of PCR with random primers are electrophoresed is a
reflection of the overall structure of the DNA molecule used as the template. If the starting material is
total cell’s DNA, then the banding pattern represents the organization of the cell’s genome.
 Differences between the genomes of the organisms, whether members of the same or of different
species, can therefore be measured by PCR with random primers. Two closely related organisms
would be expected to yield more similar banding patterns than two organisms that are more distant in
evolutionary terms. This technique is referred to as RAPD analysis.