Environmental Science and Pollution Research (2021) 28:6242–6248

https://doi.org/10.1007/s11356-020-12119-7

SHORT RESEARCH AND DISCUSSION ARTICLE

Flow cytometry in the analysis of hematological parameters

of tilapias: applications in environmental aquatic toxicology
Juliana Moreira Mendonça Gomes 1 & Ives Charlie-Silva 2 & Anderson Kenedy Santos 3 & Rodrigo Ribeiro Resende 3 &
Juliana A. S. Gomes 1 & Andrea Teixeira de Carvalho 4 & José Dias Corrêa Junior 1

Received: 27 August 2020 / Accepted: 15 December 2020 / Published online: 4 January 2021
# The Author(s), under exclusive licence to Springer-Verlag GmbH, DE part of Springer Nature 2021

Abstract
Blood tissue has been used to assess animal health and the environment in which they live. This tissue is easily acquired and has
the ability to respond to various adverse conditions. Several techniques have been employed in the detection of xenobiotic-
induced cell damage in blood cells. In general, traditionally used technologies, such as cellular analysis in blood smears, are time-
consuming and require great analytical capacity. The present study proposes flow cytometry as a method to detect changes in
blood cell populations. Tilapia (Oreochromis niloticus) was selected as a model for plotting the profile of fish blood cell
populations after exposure to xenobiotics without euthanizing animals or using cell markers. Populations of erythrocytes and
lymphocytes were detected only by combining the techniques of FACSAria cell sorting and light microscopy. Systemic dele-
terious effects were found through blood analysis, such as an increased lymphocyte-rich population at 48 h of exposure followed
by a subsequent decrease. Moreover, the time-dependent expression of Nrf2 suggests its participation in increased membrane
disruption, indicating it has a central role in erythrocyte lifespan. The present results shed light on the viability of using flow
cytometry for blood analysis of living fish.

Keywords Flow cytometry . Cell sorting . Blood . Nrf2 . Lymphocyte . Erythrocyte . Tilapia

Introduction
The study of blood cells is useful for assessing environmental
contamination through fish health and represents a technique
used routinely in clinical research in aquaculture (Fazio 2019;
Prado et al. 2014). Fish are able to retain and accumulate toxic
substances in their tissues, with consequent negative effects
on hematological, metabolic, nutritional, and immunological
parameters (Al-Yakoob et al. 1994; Bols et al. 2001; Gomes
et al. 2015; Vazzana et al. 2014). Nevertheless, they are con-
sidered ideal organisms for the study of aquatic toxicology
and, therefore, are widely used as bioindicators of environ-
mental pollution (Audu et al. 2015).
Many cases of environmental contamination by toxic
agents produced by factories, farms, or household activities
involving inappropriate use of water resources have been de-
scribed in recent years (Cajaraville et al. 2000; Islam et al.
2015; Loutfy et al. 2012). Among such agents are heavy

Responsible Editor: Ludek Blaha

* José Dias Corrêa Junior Juliana A. S. Gomes

correajr@ufmg.br juliana@icb.ufmg.br
Juliana Moreira Mendonça Gomes Andrea Teixeira de Carvalho
julianammgomes@gmail.com atcteixeira@gmail.com
Ives Charlie-Silva 1
charliesilva4@hotmail.com Department of Morphology, UFMG, Belo Horizonte, MG, Brazil
2
Anderson Kenedy Santos Department of Pharmacology, UFMG, Belo Horizonte, MG, Brazil
andersonk.santos@hotmail.com 3
Departamento de Biochemistry, UFMG, Belo Horizonte, MG, Brazil
4
Rodrigo Ribeiro Resende René Rachou Research Center, Oswaldo Cruz Foundation, Belo
rrresende@hotmail.com Horizonte, MG, Brazil
Environ Sci Pollut Res (2021) 28:6242–6248
metals like cadmium, a highly toxic substance that harms the
aquatic environment (Cajaraville et al. 2000). The cadmium
has been identified to decrease levels of cellular antioxidants,
damaging DNA, proteins, and membranes (Bertin and
Averbeck 2006; Wang et al. 2012). Recent studies have
shown that cadmium toxicity affects blood cells of the periph-
eral blood of Oreochromis niloticus by increasing nuclear
abnormalities and membrane disruption (Al-Asgah et al.
2015; Gomes et al. 2015; Vazzana et al. 2014).
Traditional methods for analyzing blood cells, such as
blood smear counts, are generally not very productive and
require long time periods to be performed (Pereira et al.
2013; Seriani et al. 2015). Flow cytometry is one of the most
modern diagnostic techniques capable of enhanced and rapid
data acquisition and has been widely applied in studies of fish
blood cells (Anbumani and Mohankumar 2015; Fazio et al.
2019; Mathew et al. 2016; McGrath et al. 2017). Although
this technique is widely used in hematology, pathology, and
immunology human clinic, its application in the study of fish
blood is still scarce (Fazio et al. 2019).
Blood parameters of different species of fish such as striped
bass (Morone saxatilis), rainbow trout (Oncorhynchus
mykiss), flat mullet (Mugil cephalus), and goldfish
(Carassius auratus) have been evaluated using the flow cy-
tometry technique (Acar et al. 2018; Fazio et al. 2019; Parrino
et al. 2018). However, for the tilapia (O. niloticus), the corre-
spondence between cell morphology of various blood cell
types and their location in flow cytometry graphs needs to
be determined for these parameters to be evaluated. Thus, in
the present study, blood populations were characterized in
flow cytometry and in vivo blood assay was performed in
order to evaluate blood cell damage induced by cadmium in
O. niloticus using flow cytometry. Relationships between
blood parameters and expression of Nrf2 (Nuclear Factor
Erythroid 2-Related Factor) were also assessed to confirm
damage from Cd exposure.
Material and methods
Animals and biometrics
The animals measured 11.85 ± 2.09 cm in total length and
22.39 g ± 6.67 in body weight, which are characteristic of
individuals of O. niloticus that have not reached sexual matu-
rity (Lim and Webster 2006). All animals exhibited a good
general appearance with no visible changes to their exterior
surface.
Blood acquisition by caudal puncture
The animals were anesthetized with 25 mg/L of eugenol
(Biodinâmica Europa S.L.®) (Çavaş and Könen 2008;
6243
Palhares and Grisolia 2002; Summak et al. 2010) and 0.5
mL of peripheral blood was taken via caudal venipuncture
with a syringe containing 0.1 mL of 0.25 M EDTA (ethylene-
diaminetetraacetic acid) at pH 6.8.
Cell sorting and light microscopy
Blood samples of O. niloticus were separately diluted in a 20 ×
volume of phosphate-buffered saline containing 5% bovine
serum albumin (BSA). Each sample was filtered in a cell
strainer (40 μm, BD) and separated into different population
types using flow cytometry (BD-FACSAria III – Cell Sorting)
(Inoue et al. 2002; Traver et al. 2003). The device’s quartz
cuvette flow is cell-gel-coupled by refractive index-matching
with a numerical aperture of 1.2. The forward and side scatter
detectors were composed of a photodiode emitting laser at
488 nm with associated 488/10 bandpass filter. A minimum
of 100,000 cell counts were performed for each cell popula-
tion. This separation was also based on data obtained for
O. niloticus in the literature (Gomes et al. 2015; Witten et al.
1998). Smears of blood from the vials obtained by separation
were prepared on air-dried slides and stained with May-
Grünwald solution for 6 min. Images were acquired with Q-
color digital camera coupled to an Olympus BX41 light mi-
croscope with a × 100 objective (Palhares and Grisolia 2002).
Fish assays: cytotoxicity induced by cadmium
A total of 63 specimens of O. niloticus were randomly
assigned to one of nine treatments with seven animals per
group. Fish were submitted to fasting during the experimental
period to eliminate influence on the results (Praskova et al.
2011; Prášková et al. 2012). Animals were exposed to one of
three levels of cadmium chloride: 0 mg/L (control) 0.25 mg/L
(Cd-0.25) and 2.5 mg/L (Cd-2.5). These animals were evalu-
ated at 48 h and 96 h of exposure (48E and 96E), and after a
subsequent 48 h in clean water (96E+48D), with the latter
being considered the depuration group. During the assays,
50% of the total water volume was renewed every 48 h and
cadmium levels were corrected by adding the appropriate Cd
stock solution. At each experimental evaluation (48E, 96E,
and 96E+48D), all animals from each group were anesthetized
with 25 mg/L of eugenol (Biodinâmica Europa S.L.®) (Çavaş
and Könen 2008; Palhares and Grisolia 2002; Summak et al.
2010). No deaths were reported during the experiment.
Cadmium concentration of the water
The cadmium concentration in the water of each tank was
evaluated during the experiment by atomic absorption spec-
trometry. Briefly, water samples were collected from all tanks
using polyethylene tubes previously decontaminated with
10% nitric acid solution for 48 h. Three replicates were
6244
performed for each treatment. Integrated absorbances were
determined using a Varian SpectrAA 240 atomic absorption
spectrometer (Victoria, Australia) equipped with a graphite
furnace with integrated platforms (Varian, Part Number 01-
900327-0) and polarized Zeeman background correction. A
hollow Cd cathode lamp (Photron, Part Number p808) was
operated at 10 mA with a slit of 0.5 nm and a wavelength of
228.8 nm. Argon 99.996% (White Martins, Belo Horizonte,
MG, Brazil) was used as the purge gas with a flow rate of 250
mL/min (Borba da Silva et al. 2003).
Evaluation of blood cells by flow cytometry
Blood cell quantification and membrane disruption analy-
ses were performed using a BD FACScan flow cytometer
(Becton Dickinson), while data analysis was performed
using the FlowJo Version 9.2 software®. For membrane
disruption analysis, 25 μl aliquots of blood were incubat-
ed for 15 minutes with 3 μl of propidium iodide (50
μg/ml) (PI, Sigma) in the dark. The samples were resus-
pended in 1 ml of PBS (phosphate-buffered saline) and
immediately analyzed by flow cytometry. A total of
30,000 cells per animal were observed with all FACS
parameters (FSC and SSC) and region settings being kept
identical throughout all evaluations (Canonico et al.
2004).
Real-time quantitative PCR
Total RNA was isolated from blood of O. niloticus using
TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according
to the manufacturer's instructions. Seven juvenile O. niloticus
were pooled for controls and dose-groups, with cDNA being
generated from total RNA using First Strand cDNA Synthesis
Kit (Termo®). For this, 2 μg mRNA was treated with DNAse
for 20 min at 25 °C and then for 10 min at 65 °C in the
presence of dNTP, OligoDT, Mulv, and RNAout. The cycles
used were 10 min at 25 °C for oligoDT annealing, 1 h at 42 °C
for cDNA synthesis, and 10 min at 70 °C for enzyme inacti-
vation. PCR amplifications were performed with a
StepOnePlus Real-Time PCR System (Applied
Biosystems®) with qPCR using SYBR Green/ROX qPCR
Master Mix. Amplification conditions were 95 °C for 5 min
for initial denaturing followed by 50 cycles of 60 s at 60 °C for
annealing and extension and 10 s at 95 °C for denaturing. All
reactions were run in duplicate (Tao et al. 2013). The primer
sequences (5′–3′) used were as follows: Nrf2 (NM_182889.1)
F-GGCGATCCTCCTGTAAACCC and R-CGAAGGAT
CCGTCTTCGGTT; β-actin (NM_001101.3) F-
CAATTCACTAGGCAGCGTCC, and R-ACGAGCCA
GTGTTAGTACCT.
Environ Sci Pollut Res (2021) 28:6242–6248
Statistical analysis
All acquired data were analyzed for normality using the
Kolmogorov Smirnov test. Statistical analysis performed for
expression of the Nrf2 gene and membrane disruption for Lrp
was one-way ANOVA followed by the Bonferroni post-test.
All analyses used the GraphPad Prism 5 software. The report-
ed values were expressed as mean ± standard deviation (SD)
and results with p < 0.05 were considered statistically
significant.
Results
Cell sorting and light microscopy
Blood cell types were separated into different fractions by
FACSAria cell sorting according to morphology (SSC, side
scatter X FSC, forward scatter) (Fig. 1). Figure 1a shows a
typical distribution of O. niloticus blood cells in cytometric
plots and the relative frequencies of each population prior to
sorting. Four populations (P2, P3, P4, and P5) were collected
in different vials and acquired again in order to confirm their
locations (Fig. 1b, c, d, and e). The results reveal events in P2
regions when cells should only be observed in the purified
portion of P3 (Fig. 1c), P4 (1d), and P5 (1e). Similarly, the
fractions containing cells of P5 appeared in the same position
of cells of P4 (Fig. 1e).
The populations acquired after sorting (P2, P3, P4, P5)
were identified through light microscopy. The smears made
from each cellular suspension acquired by FASCAria cell
sorting revealed the presence of cellular debris in the P2 re-
gion, cells with typical characteristics of lymphocytes and
thrombocytes in the P3 region and a mixture of erythrocytes
and granulocytes in regions P4 and P5. The quantification of
different cell types in smears of blood from the sorted vials
demonstrated a higher frequency of lymphocytes than throm-
bocytes in the P3 region, which was therefore called Lrp (lym-
phocyte-rich population). Erythrocytes were much more fre-
quent than granulocytes in the P4 region, which was therefore
called Erp (erythrocyte-rich population) (Fig. 1).
Water physical-chemical parameters
Physical-chemical parameters of the water were within ranges
reported as favorable for the health and survival of O. niloticus
(Lim and Webster 2006): temperature 22.80 ± 0.85 (°C); dis-
solved oxygen 7.32 ± 0.19 (mg/L); ammonia 0.73 × 10-3 (mg/
L); and pH 7.32 ± 0.19. Dissolved oxygen concentrations
were at least 95% of the air saturation value throughout the
test. Figure 2 shows the concentration of cadmium present in
each tank.
Environ Sci Pollut Res (2021) 28:6242–6248
Fig. 1 Typical aspect of blood cells of O. niloticus separated by
FACSAria cell sorting, along with images and quantifications of blood
cells by light microscopy. 1—Flow cytometry: total blood (a) followed
by second reading in same cytometer of: P2, cellular debris (b); P3,
portion rich in lymphocytes (c); P4, portion rich in erythrocytes (d); and
Fig. 2 Cadmium concentration of the water by atomic absorption
spectrometry. The cadmium concentrations used were 0 mg/L (control),
0.25 mg/L (Cd-0.25) and 2.5 mg/L (Cd-2.5). “E,” exposure and “D,”
depuration. The data show that the determined cadmium concentration
was compatible with that expected for each tank. nd, not detectable
6245
P5, portion rich in granulocytes (e). SSC (side scatter) X FSC (forward
scatter). 2—Light microscopy: images and cell quantifications from
blood smears showing a population rich in lymphocytes in P3 and a
population rich in erythrocytes in P4
Population frequencies, membrane disruption
Flow cytometry revealed significant changes in the frequen-
cies of Lrp and Erp during exposure to cadmium, with differ-
ences among control groups (Fig. 3). The two exposure
groups in Lrp exhibited similar behaviors, with both increas-
ing in 48 h and then decreasing in 96 h of exposure. The Cd-
2.5 group had higher frequencies of Lrp than the Cd-0.25
group at depuration time (Fig. 3b). The frequency of Erp
was more stable than that of Lrp, with its only significant
changes occurring between 48 h of exposure and depuration
time (96E + 48D) of Cd-0.25 group. At 48 h of exposure, the
frequency of the Cd-2.5 group in Erp was greater than that of
Cd-0.25 (Fig. 3a). Membrane rupture in Lrp increased during
the first 48 h of exposure in Cd-2.5 when it reached its max-
imum (Fig. 3d). There was no significant differences in Lrp
6246
Fig. 3 Blood population analysis
for O. niloticus exposed to
cadmium. Erythrocyte-rich por-
tion (Erp) (a) and lymphocyte-
rich portion (Lrp) (b) quantified
by flow cytometry. c Expression
of the Nrf2 gene and d membrane
disruption for Lrp of O. niloticus
exposed to cadmium. Asterisks
indicate significant differences by
ANOVA and Bonferroni test (a,
b, and c) or Mann Whitney test
(d) (p < 0.05). “E,” exposure and
“D,” depuration
between exposure times (48 and 96 h) for any of the treat-
ments, but a decrease was observed in depuration time for the
group exposed to Cd-2.5 (Fig. 3d).
Nrf2 expression
The increased expression of Nrf2 at 48 h was more intense for
the Cd-0.25 group, which then reversed with it being more
intense for Cd-2.5 at 96 h. The maximum increase was close
to six-times the basal expression (control) for both exposure
groups. The expression of Nrf2 decreased in the Cd-0.25
group at 96 h of exposure with subsequent subexpression in
the depuration period when it remained below basal (control).
The Cd-2.5 group only decreased during depuration (Fig. 3c).
Discussion
This present work is the first to describe an integrated flow-
cytometry based method for assessing fish peripheral blood,
which is accurate and can be used in a wide range of assays. It
was applied to measuring damage to peripheral blood cells,
such as changes in blood cell type frequencies and membrane
disruption, using time-lapsed assay. The data obtained suggest
that this integrated cytometric approach can be used to assess
the general condition of fish health. Many studies in recent
years have employed the traditional method of the Neubauer
chamber to analyze blood cells; however, flow cytometry is
fast and producing almost immediate results, and thus enables
faster analyses. Studies have used flow cytometry with fish
blood cells (Anbumani and Mohankumar 2015; Mathew et al.
2016; McGrath et al. 2017), but the present study used
Environ Sci Pollut Res (2021) 28:6242–6248
integrative data involving the position of blood cell popula-
tions as determined by flow cytometry according to morphol-
ogy, size, and granularity.
The cells contained in each population we then identified
by separation via cell sorting and visualized and quantified by
light microscopy. Lymphocytes of O. niloticus were found in
a similar position in flow cytometry graphs as those of carp
(Cyprinus carpio), salmon (Salmo salar L.), and zebrafish
(Danio rerio) (Inoue et al. 2002; Langenau and Zon 2005;
Traver et al. 2003), whereas erythrocytes were not. Gomes
et al. (2015) demonstrated the same position for erythrocytes
through lysis. Although each population will have more than
one type of blood cell, some are more frequent, such as lym-
phocytes in the P3 region (80%) and erythrocytes in the P4
region (91%). Granulocytes were found distributed in P4 and
P5, but it was not possible to evaluate this cell type using FSC
× SSC. Defining these populations made it possible to evalu-
ate the effects of cadmium on blood cells using flow
cytometry.
Flow cytometry clearly demonstrated that exposure of
O. niloticus to cadmium induces oxidative stress in fish blood,
as evidenced by increased Lrp (lymphocyte-rich portion) and
altered Nrf2 expression and membrane disruption in Lrp.
Yuan et al. (2017) reported that an increase in the pathway
of Nrf2 expression is involved in antioxidant and immune
responses in teleost fish. Additionally, Abdel-Tawwab and
Wafeek (2017) reported that O. niloticus exposed to cadmium
showed greater activity of oxidative stress enzymes. Gomes
et al. (2015) demonstrated that increased ROS production
during 24 h of exposure to cadmium occurred in association
with an increase in the number of erythrocytes with membrane
disruption. The present work demonstrated that lymphocytes
Environ Sci Pollut Res (2021) 28:6242–6248
had the same response as erythrocytes, but more subtle. These
events seem to be related to the overexpression of Nrf2 during
48 and 96 h of exposure to cadmium. Similar data were re-
ported by Zheng et al. (2016), who found increased levels of
ROS and lipid oxidation, accompanied by a rise in Nrf2 levels
in the liver and brain of zebrafish after acute exposure to
cadmium (1 mg/L). These data suggest that the mechanism
of action of Nrf2 (synthesis of antioxidant enzymes) expres-
sively reduces membrane damage after 48 h of exposure to
cadmium in Erp and after 96 h of exposure in Lrp.
The increase in membrane disruption in Erp and Lrp was
more expressive with the highest concentration of cadmium.
This finding may be related to the low increase in the
expression of Nrf2 in 48 h with this concentration
compromising cellular antioxidant responses. Increasing
Nrf2 expression between 48 and 96 h, and reduction only in
depuration, suggests the maintenance of organisms and cells
under a regime of inhibition of antioxidant mechanisms. Such
a finding was also obtained by Lu Wang and Gallagher (2013)
during acute exposure of zebrafish to cadmium, which result-
ed in this element inhibiting the expression of Nrf2 and thus
inducing damage to olfactory tissues due to elevated oxidative
stress.
Several studies involving the exposure of fish to cadmium
have found numerous alterations to blood cells. The present
study, using flow cytometry, demonstrated that animals ex-
posed to the highest concentration of cadmium experienced a
slight increase in the percentage of lymphocytes, but no
changes in the frequencies of erythrocytes of Erp. Nussey
et al. (1995) also reported an increase in the percentage of
lymphocytes for Oreochromis mossambicus in the first 48 h
of acute and chronic exposure to copper.
Conclusion
The present study established a faster and more efficient tech-
nique for analyzing blood cells of O. niloticus blood cells.
Flow cytometry was able to demonstrate that cadmium pro-
motes an increase in lymphocytes with 2 days of exposure.
Although erythrocyte frequency did not change during expo-
sure, lymphocytes experienced a marked increase in damage
to the plasma membrane. This decrease in membrane disrup-
tion was modulated by increased expression of Nrf2. Flow
cytometry can contribute to acquiring data more rapidly and
efficiently, and without lethality, for environmental monitor-
ing, determining toxicological profiles and performing time-
lapsed assays of the same individual.
Funding This work was supported by Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPQ) number 301473/
2016-1 and Fundação de Amparo à Pesquisa do Estado de Minas
Gerais (FAPEMIG) 410 number APQ-02913-17.
6247
References
Abdel-Tawwab M, Wafeek M (2017) Fluctuations in water temperature
affected waterborne cadmium toxicity: hematology, anaerobic glu-
cose pathway, and oxidative stress status of Nile tilapia,
Oreochromis niloticus (L.). Aquaculture 477:106–111. https://doi.
org/10.1016/j.aquaculture.2017.05.007
Acar Ü, Parrino V, Kesbiç OS, Lo Paro G, Saoca C, Abbate F, Yılmaz S,
Fazio F (2018) Effects of different levels of pomegranate seed oil on
some blood parameters and disease resistance against Yersinia
ruckeri in rainbow trout. Front Physiol 9:1–7. https://doi.org/10.
3389/fphys.2018.00596
Al-Asgah NA, Abdel-Warith AWA, Younis ESM, Allam HY (2015)
Haematological and biochemical parameters and tissue accumula-
tions of cadmium in Oreochromis niloticus exposed to various con-
centrations of cadmium chloride. Saudi J Biol Sci 22:543–550.
https://doi.org/10.1016/j.sjbs.2015.01.002
Al-Yakoob S, Bou-Olayan AH, Bahloul M (1994) Trace metals in gills of
fish from the Arabian Gulf. B Environ Contam Toxicol 53:718–725.
https://doi.org/10.1007/BF00196945
Anbumani S, Mohankumar MN (2015) Gamma radiation induced cell
cycle perturbations and DNA damage in Catla Catla as measured by
flow cytometry. Ecotoxicol Environ Saf 113:18–22. https://doi.org/
10.1016/j.ecoenv.2014.11.011
Audu BS, Ajima MNO, Ofojekwu PC (2015) Enzymatic and biochemi-
cal changes in common carp, Cyprinus carpio (L.) fingerlings ex-
posed to crude leaf extract of Cannabis sativa (L.). Asian Pac J Trop
Dis 5:107–115. https://doi.org/10.1016/S2222-1808(14)60636-8
Bertin G, Averbeck D (2006) Cadmium: cellular effects, modifications of
biomolecules, modulation of DNA repair and genotoxic conse-
quences (a review). Biochimie 88:1549–1559. https://doi.org/10.
1016/j.biochi.2006.10.001
Bols NC, Brubacher JL, Ganassin RC, Lee LEJ (2001) Ecotoxicology
and innate immunity in fish. Dev Comp Immunol 25:853–873.
https://doi.org/10.1016/S0145-305X(01)00040-4
Borba da Silva JB, Gallindo Borges DL, Mesquita Silva Da Veiga MA,
Curtius AJ, Welz B (2003) Determination of cadmium in biological
samples solubilized with tetramethylammonium hydroxide by elec-
trothermal atomic absorption spectrometry, using ruthenium as per-
manent modifier. Talanta 60:977–982. https://doi.org/10.1016/
S0039-9140(03)00182-6
Cajaraville MP, Bebianno MJ, Blasco J, Porte C, Sarasquete C, Viarengo
A (2000) The use of biomarkers to assess the impact of pollution in
coastal environments of the Iberian Peninsula: a practical approach.
Sci Total Environ 247:295–311. https://doi.org/10.1016/S0048-
9697(99)00499-4
Canonico B, Zamai L, Burattini S, Granger V, Mannello F, Gobbi P,
Felici C, Falcieri E, Reilly JT, Barnett D, Papa S (2004)
Evaluation of leukocyte stabilisation in TransFix??-treated blood
samples by flow cytometry and transmission electron microscopy.
J Immunol Methods 295:67–78. https://doi.org/10.1016/j.jim.2004.
09.013
Çavaş T, Könen S (2008) In vivo genotoxicity testing of the amnesic
shellfish poison (domoic acid) in piscine erythrocytes using the mi-
cronucleus test and the comet assay. Aquat Toxicol 90:154–159.
https://doi.org/10.1016/j.aquatox.2008.08.011
Fazio F (2019) Fish hematology analysis as an important tool of aquacul-
ture: a review. Aquaculture 500:237–242. https://doi.org/10.1016/j.
aquaculture.2018.10.030
Fazio F, Saoca C, Costa G, Zumbo A, Piccione G, Parrino V (2019) Flow
cytometry and automatic blood cell analysis in striped bass Morone
saxatilis (Walbaum, 1792): A new hematological approach.
Aquaculture 513:734398. https://doi.org/10.1016/j.aquaculture.
2019.734398
6248
Gomes JMM, Ribeiro HJ, Procópio MS, Alvarenga BM, Castro ACS,
Dutra WO, da Silva JBB, Corrêa Junior JD (2015) What the eryth-
rocytic nuclear alteration frequencies could tell us about
genotoxicity and macrophage iron storage? PLoS ONE 10(11):
e0143029. https://doi.org/10.1371/journal.pone.0143029
Inoue T, Moritomo T, Tamura Y, Mamiya S, Fujino H, Nakanishi T
(2002) A new method for fish leucocyte counting and partial differ-
entiation by flow cytometry. Fish Shellfish Immun 13:379–390.
https://doi.org/10.1006/fsim.2002.0413
Islam MS, Ahmed MK, Habibullah-Al-Mamun M (2015) Determination
of heavy metals in fish and vegetables in bangladesh and health
implications. Hum Ecol Risk Assess 21:986–1006. https://doi.org/
10.1080/10807039.2014.950172
Langenau DM, Zon LI (2005) The zebrafish : a new model of t-cell and
thymic development. Nat Rev Immunol 5:307–317. https://doi.org/
10.1038/nri1590
Lim C, Webster CD (2006) Tilapia: biology, culture, and nutrition.
Binghamton, New York
Loutfy N, Mentler A, Shoeab M, Tawfic Ahmed M, Füerhacker M (2012)
Analysis and exposure assessment of some heavy metals in food-
stuffs from Ismailia city, Egypt. Toxicol Environ Chem 94:78–90.
https://doi.org/10.1080/02772248.2011.638445
Mathew ST, Johansson P, Gao Y, Fasth A, Ek T, Hammarsten O (2016)
A flow cytometry assay that measures cellular sensitivity to DNA-
damaging agents, customized for clinical routine laboratories. Clin
Biochem 49:566–572. https://doi.org/10.1016/j.clinbiochem.2016.
01.009
McGrath KE, Catherman SC, Palis J (2017) Delineating stages of eryth-
ropoiesis using imaging flow cytometry. Methods 112:68–74.
https://doi.org/10.1016/j.ymeth.2016.08.012
Nussey G, Van Vuren JHJ, Du Preez HH (1995) Effect of copper on the
differential white blood cell counts of the Mozambique tilapia
(Oreochromis mossambicus). Biochwz Physiol Biochem Physiol
11:381–388. https://doi.org/10.1016/0742-8413(95)00064-X
Palhares D, Grisolia CK (2002) Comparison between the micronucleus
frequencies of kidney and gill erythrocytes in tilapia fish , following
mitomycin C treatment. Genet Mol Biol 284:281–284. https://doi.
org/10.1590/S1415-47572002000300005
Parrino V, Cappello T, Costa G, Cannavà C, Sanfilippo M, Fazio F,
Fasulo S (2018) Comparative study of haematology of two teleost
fish (Mugil cephalus and Carassius auratus) from different environ-
ments and feeding habits. Eur Zool J 85:194–200. https://doi.org/10.
1080/24750263.2018.1460694
Pereira S, Cavalie I, Camilleri V, Gilbin R, Adam-guillermin C (2013)
Mutation research/genetic toxicology and environmental mutagene-
sis comparative genotoxicity of aluminium and cadmium in embry-
onic zebrafish cells. Mutat Res Genet Toxicol Environ Mutagen
750:19–26. https://doi.org/10.1016/j.mrgentox.2012.07.007
Prado LRGB, Felix C, Abessa DMS, Buruaem LM, Abujamara LD,
Kirschbaum AA, Turatti GCR, Ranzani-Paiva MJT, Correia AT,
Seriani R (2014) Hematological parameters and nuclear abnormali-
ties in peripheral erythrocytes of Achirus lineatus
(Pleuronectiformes: Achiridae). Comp Clin Pathol 24:169–175.
https://doi.org/10.1007/s00580-014-1880-3
Praskova E, Voslarova E, Siroka Z, Plhalova L, Macova S, Marsalek P,
Pistekova V, Svobodova Z (2011) Assessment of diclofenac LC50
reference values in juvenile and embryonic stages of the zebrafish
Environ Sci Pollut Res (2021) 28:6242–6248
(Danio rerio). Pol J Vet Sci 14:545–549. https://doi.org/10.2478/
v10181-011-0081-0
Prášková E, Živná D, Štěpánová S, Ševčíková M, Blahová J, Maršálek P
et al (2012) Acute toxicity of acetylsalicylic acid to juvenile and
embryonic stages of Danio rerio. Neuroendocrinol Lett 33:72–76
Seriani R, Abessa DMS, Moreira LB, Cabrera JPG, Sanches JQ, Silva
CLS, Amorim FA, Rivero DHRF, Silva FL, Fitorra LS, Carvalho-
Oliveira R, Macchione M, Ranzani-Paiva MJT (2015)
Ecotoxicology and environmental safety in vitro mucus transport-
ability , cytogenotoxicity , and hematological changes as non-
destructive physiological biomarkers in fi sh chronically exposed
to metals. Ecotoxicol Environ Saf 112:162–168. https://doi.org/10.
1016/j.ecoenv.2014.11.003
Summak S, Aydemir NC, Vatan O, Yılmaz D, Zorlu T, Bilalog R (2010)
Evaluation of genotoxicity from Nilufer Stream (Bursa/Turkey) wa-
ter using piscine micronucleus test. Food Chem Toxicol 48:2443–
2447. https://doi.org/10.1016/j.fct.2010.06.007
Tao W, Yuan J, Zhou L, Sun L, Sun Y, Yang S, Li M, Zeng S, Huang B,
Wang D (2013) Characterization of gonadal transcriptomes from
Nile tilapia (Oreochromis niloticus) reveals differentially expressed
genes. PLoS ONE 8(5):e63604. https://doi.org/10.1371/journal.
pone.0063604
Traver D, Paw BH, Poss KD, Penberthy WT, Lin S, Zon LI (2003)
Transplantation and in vivo imaging of multilineage engraftment
in zebrafish bloodless mutants. Nat Immunol 4:1238–1246. https://
doi.org/10.1038/ni1007
Vazzana M, Celi M, Tramati C, Ferrantelli V, Arizza V, Parrinello N
(2014) In vitro effect of cadmium and copper on separated blood
leukocytes of Dicentrarchus labrax. Ecotoxicol Environ Saf 102:
113–120. https://doi.org/10.1016/j.ecoenv.2014.01.018
Wang L, Gallagher EP (2013) Role of Nrf2 antioxidant defense in miti-
gating cadmium-induced oxidative stress in the olfactory system of
zebrafish. Toxicol Appl Pharmacol 266:177–186. https://doi.org/10.
1016/j.taap.2012.11.010
Wang L, Harris SM, Espinoza HM, Mcclain V, Gallagher EP (2012)
Characterization of phospholipid hydroperoxide glutathione metab-
olizing peroxidase (gpx4) isoforms in Coho salmon olfactory and
liver tissues and their modulation by cadmium. Aquat Toxicol 114–
115:134–141. https://doi.org/10.1016/j.aquatox.2012.02.025
Witten PE, Villwock W, Renwrantz L (1998) Haematogram of the tilapia
Oreochromis niloticus (Cichlidae, Teleostei) and application of a
putation phenoloxidase for differentiating between neutrophilic
granulocytes and monocytes. Can J Zool 76:310–319. https://doi.
org/10.1139/z97-202
Yuan SS, Lv ZM, Zhu AY, Zheng JL, Wu CW (2017) Negative effect of
chronic cadmium exposure on growth, histology, ultrastructure, an-
tioxidant and innate immune responses in the liver of zebrafish:
Preventive role of blue light emitting diodes. Ecotoxicol Environ
Saf 139:18–26. https://doi.org/10.1016/j.ecoenv.2017.01.021
Zheng J, Yuan S, Wu C, Lv Z (2016) Acute exposure to waterborne
cadmium induced oxidative stress and immunotoxicity in the brain
, ovary and liver of zebrafish (Danio rerio). Aquat Toxicol 180:36–
44. https://doi.org/10.1016/j.aquatox.2016.09.012
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.