CE701_Unit1_Week1 (1)

Theory of Signal and Systems
CE701 – 2020/21
Unit 1: Deterministic Signals and Systems
Week 1: Introduction and Definitions

Dr Vito De Feo
Office Number: 2NW.5A.521
E-mail: vito.defeo@essex.ac.uk
Tel: 4946 Zoom: vitodefeo

1. What is a signal?
2. What is a system?
3. Examples of Signals and Systems
4. Telecommunication systems
5. What will we study and learn?
6. Books / Slides / Recordings / Moodle
7. Exam and assessment
Voice Signal: an analogue signal
5-30 m Short range

transmission
Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 3
Digital Signal – On/Off

Transmission
300 m

Guided Transmission
Channel

Transmission
30 km Long range
transmission
Memorization
Verba
? Volant !
a few days later…

Elaboration
Interference
Cancellation

Analog Transmission
Transducer
Electric
Transducer
Signal
Memorization
Transmission
Elaboration

What is a Signal?
• A signal is a pattern of variation of a physical
quantity
• Signals are variables that carry information
Examples of signal include:
• Electrical signals
– Voltages and currents in a circuit
• Acoustic signals
– Acoustic pressure (sound) over time
• Mechanical signals
– Velocity of a car over time
• Video signals
– Intensity level of a pixel (camera, video) over time

How is a Signal Represented?
• Mathematically, signals are represented as a function of time and of one
or more independent variables.
• For instance a black & white video signal intensity is dependent on x, y
coordinates and time t f(x,y,t)
• On this course, we shall be exclusively concerned with signals that are a
function of a single variable: time
f(t)

Signals
• A signal is a function of time, e.g.,
– f is the force on some mass
– vout is the output voltage of some circuit
– p is the acoustic pressure at some point
• notation:
– f, vout, p or f(.), vout(.), p(.) refer to the whole signal or
function
– f(t), vout(1.2), p(t + 2) refer to the value of the signals at
times t, 1.2, and t + 2, respectively
• for times we usually use symbols like t, t , t1, . . .

Example: Signals in an Electrical Circuit
R vs (t ) - vc (t )
i (t ) =
R
dv (t )
+ i i (t ) = C c
vs C vc dt
-
dvc (t ) 1 1
+ vc (t ) = vs (t )
dt RC RC
• The signals vc and vs are patterns of variation over time
Step (signal) vs at t=1

vs, vc
RC = 1
First order (exponential) response
for vc
• Note, we could also have considered the voltage across the resistor or the
current as signals
What is a System?
• Systems process input signals to produce
output signals
• Examples:
– A circuit involving a capacitor can be viewed as a
system that transforms the source voltage (signal)
to the voltage (signal) across the capacitor
– A CD player takes the signal on the CD and
transforms it into a signal sent to the loud speaker

How is a System Represented?
• A system takes a signal as an input and
transforms it into another signal
Input signal Output signal

System
x(t) y(t)
• In a very broad sense, a system can be

represented as the relation between the
output signal and the input signal
• The output signal is a function of the input
signal (a function of a function of time)
Example: An Electrical Circuit System
R
vs (t ) - vc (t )
i (t ) =
R
dv (t )
+ i i (t ) = C c
vs C vc dt
-
dvc (t ) 1 1
+ vc (t ) = vs (t )
dt RC RC
• Simulink representation of the electrical circuit
vs(t) vc(t)
vs, vc
first order
system t

Signals and Systems - Examples
Human speech production system — anatomy and block diagram

Example: 1D
biological signals:
ECG

Example: 1D biological
signals: EEG
amplitude
time

1D biological signals:
DNA sequencing
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATG……

Signals used in Telecommunication
• AM radio signal
• FM radio signal
• cable TV signal
• audio signal
• NTSC video signal
• 10BT Ethernet signal
• telephone signal

Video Signal
x

Example: 2D
MRI biological signals:
MI
US
CT

Biological Signal Analysis
• Examples:
– Brain signals (EEG)
– Cardiac signals (ECG)
– Medical images (x-ray, PET, MRI)
• Goals:
– Detect abnormal activity (heart attack, seizure)
– Help physicians with diagnosis
• Tools: Filtering, Fourier Transform

Example
• Brain waves are usually contaminated by noise
and hard to interpret

Communication Systems


•Communication system is a technological realisation/implementation of the necessary
means which serve for conveying information from a source to a destination some
distance away.
•A typical communication system contains numerous sub-systems, such as electronic

circuitry, microprocessors, photonic circuits, etc., which curry generic communication-
related tasks (signal processing, information/data coding, etc.).
•Each sub-system in its turn consists of many various components, such as transmitters,
receivers, electronic amplifiers, optical amplifiers, filters, regenerators, special cables,
optical fibres, modulators, multiplexers, etc.
•Communication systems are integrated into bigger entities, called communication

networks. The main task of communication networks is the overall data traffic
management, which includes data arrangements into blocks called packets, packet
addressing, packet routing to the destination, data integrity, protection and security, etc.

Communication system with input and output transducers
(Transducer converts signal in one form

of energy to another form of energy)
• The purpose of any communication system – to convey information from its source to destination.
•Noise and distortions corrupt transmitted signal. A primary objective of communication system - to minimise errors.

Analog Information – Analog Transmission
Analog Transducer Source Channel Analog

Source Encoder Encoder Modulator
CHANNEL
Receiver Decoder Decoder Demodulator

Analog Information – Analog Transmission

CHANNEL
UNIT 1 UNIT 1

UNITS 1/2

Digital Information – Digital Transmission
Digital Source Channel Digital

CHANNEL
UNIT 3 UNIT 4 UNIT 3
Digital Source Channel Digital


Analog Information – Digital Transmission
Analog Transducer A/D

Source Converter
DIGITAL
UNIT 1 UNIT 3 TRANSMISSION
Analog Transducer D/A SYSTEM
Receiver Converter
UNITS 3/4

Definitions
• Information (central concept in communication), messages and/or signals:
– Information (defies precise definition) → Messages (information produced by the source)
– Analogue and digital – two distinct categories of messages. (Analog message - a physi-cal quantity
varying with time; Digital message – ordered sequence of discrete symbols).
– Fidelity (accurate reproduction of sound/images) (for analog) versus accuracy (for digital)
– Transducers – devices that convert messages to electrical signals and vice versa
• Elements:
– Transmitter – produces transmitted signal at the input suited to the transmission channel
– Modulation/demodulation and coding/decoding – always required in signal processing
– Channel – medium connecting source and destination (attenuation, dispersion)
– Receiver (includes: amplification, demodulation, decoding, filtering)
– Loss (channel), distortion (imperfect response of the system to the signal; equalisers), interference
(power lines, other transmitters) and noise (random signals)
• Technological (hardware) and Fundamental (noise and bandwidth) limitations of transmission:

– Noise (present even w/o signal; thermal noise, optical noise, electrical noise); SNR=S/N
– Bandwidth – applies to both signal and system (signal bandwidth - frequency content or spectrum
of the signal; system bandwidth - transmission bandwidth of the system)
– Shannon-Hartley theorem (will be discussed in detail later in the module).

THEORY OF SIGNALS AND SYSTEMS
CE701 – MSc in ACS and EE

2020-2021 Academic Year
https://www1.essex.ac.uk/modules
SYLLABUS OUTLINE
• The course goals: This course provides a theoretical/mathematical foundation and princip-
les for the study of communication systems and solving other electronic engineering problems.
•It starts with mathematical concepts, such as Fourier transforms, probability density functions
and convolution.
•It then uses these tools to examine the operation of modern communication systems, such as
quadrature amplitude modulation.
•The course finishes with a discussion of performance bounds, and identifies how close
commercially important systems are to these bounds.
•Mathematical review
Shifting and scaling functions, Woodward's notation.
Probability: random variables; calculation of mean and variance.
• Transform theory
Definition of Fourier forward and inverse transforms, some Fourier transform pairs.
Power spectra, convolution and autocorrelation.
• Basics of probability theory and noise in communication systems

Probability density functions (pdfs), the Gaussian distribution.
Gaussian tail area, other pdfs and signal-to-noise ratio (SNR).

SYLLABUS OUTLINE
• Signal modulation
Analysis of amplitude modulation.
Time and frequency domain performance.
Analysis of digital modulation.

Signal space and signal constellation.
ASK, FSK and PSK modulation schemes, FM modulation.
QAM.
• Signal detection
Detection of digital signals.
Optimal decision theory, maximum a-posteriori detection, decision regions.
Error calculations.
• Basics of information theory an signal coding

Digital coding efficiency and performance.
Introduction to information theory.
Source coding, the Huffman algorithm.
Channel coding, system comparisons, Shannon bound.

LEARNING OUTCOMES
On completion of the course, the student is expected to:
1. Perform the shift and scale communication functions, using Woodward's notation
2. Calculate the mean and variance using of a probability density function
3. Apply the Fourier transform as a signal processing tool
4. Understand and evaluate effect of noise in communications
5. Analyse analogue and digital signal modulation techniques
6. Analyse signal processing and transmission in optical-fibre communication systems
7. Apply concepts of information theory to design Huffman codes to compress data
8. Describe and apply the Shannon-Hartley bound

MODULE OUTLINE
•Module composition: 10 lectures (20 hours) + 10 problem-solving classes (10 hours) + 3 labs
(6 hours).
•The module is intellectually challenging and requires your hard work during the term.
•The lectures, classes, and labs are equally important for your understanding of the material.
You should make all efforts to attend all these activities. In case you miss a lecture or a class,
you have to revise the outstanding material in order to understand the next lecture.
•During the lectures make your own notes/comments on the lecture notes. Pay particular
attention to the parts which you may not clearly understand in class. Do not leave your
questions unanswered.
•Do not hesitate to ask me to clarify or repeat my explanations during the lecture.
•Please, revise briefly the covered in-class material before every next lecture (“no-gaps rule”).
•You are provided with very detailed lecture notes which are based on the recommended
texts. Please, use these texts as well as any other suitable sources in your studies.
•You are also welcome to contact me with any queries you may have, either by e-mail or by
Moodle Forum or by Zoom (academic support hours or appointment).

RECOMMENDED TEXTS
1. Carlson, A.B., Crilly, P.B. (2010) Communication Systems: An Introduction to Signals and Noise in
Electrical Communication, 5 ed., McGraw-Hill Education – Europe.
2. Couch, L.W. (2007 or 2013) Digital and Analog Communication Systems, 7 or 8 ed., Pearson.
3. Glover, I. and Grant, P. (2010) Digital Communications, 3 ed., Prentice-Hall.
4. Proakis, J., Salehi, M. (2008) Digital Communications, 5 ed., McGraw-Hill Education.
5. Sklar, B. (2001) Digital Communications: Fundamentals and Applications, 2 ed., Prentice-Hall.
6. Schwartz, M. (1990) Information Transmission, Modulation, and Noise, 4 ed., McGraw-Hill.
7. CE701 Lecture Notes + supporting material on Moodle (videos, links, pdf files, etc.)

READING LIST
https://essex.rl.talis.com/modules/ce701.html
Copyright © The McGraw-Hill Companies,

Inc. Permission required for reproduction or
display.
Permission has been requested and

granted by the publisher for use of all
necessary electronic materials from
Carlson’s book in the CE701 module.
The use of the material is gratefully
acknowledged by the lecturer.

PERLEGO
https://ereader.perlego.com/1/book/812319/2

MODULE ASSESSMENT
•MODULE ASSESSMENT: The module is assessed via the two assessment components:
1. 40% coursework mark = 10% Progress Test + 20% Assignment1 + 10% Assignment2 (Lab).
CW=(0.1PT + 0.2Asgn1 +0.1Asgn2)/0.4.
2. 60% exam mark (2:00 hour exam). Total Mark = 0.4CW + 0.6Ex.
•Progress Test (PT) consists of 10/20 MCQs.
•There will be a mock-PT exercise before the real PT.
• Assignment1 consists of original problem solving, essays (+work with original publications).
• Assignment2 is a lab report. The Assignments are submitted after the Christmas Vacation.
•Your work on the Assignment is very important as it completely covers all Learning Outcomes of
the module and helps you in solving the problems at the exam.
•Marking criteria will be explained to you in detail before the corresponding assessment exercise
(PT, Assignment, Labs).
•Exam paper composition and

Theory marking
of Signals criteria
and Systems will1 -be
- Unit explained
Week 1- V. De Feo at the revision lecture. 44
MODULE RESOURCES


Classification of Signals

Classification of signals
• Continuous time – Discrete time
• Analog – Digital (numerical)
• Periodic – Aperiodic
• Energy – Power
• Deterministic – Random (probabilistic)
• Note
– Such classes are not disjoint, so there are digital signals
that are periodic of power type and others that are
aperiodic of power type etc.
– Any combination of single features from the different
classes is possible
Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo
Continuous time
• Continuous time signal: a signal that is specified for
every real value of the independent variable
– The independent variable is continuous, that is it
takes any value on the real axis
– The domain of the function representing the
signal has the cardinality of real numbers
amplitude
§§ Signal ↔ f=f(t)
§§ Independent variable ↔ time (t), position (x)
§§ For continuous-time signals: tÎ!
time

Continuous time
• Most of the signals in the physical world are CT signals, since the
time scale is infinitesimally fine (e.g., voltage, pressure, temperature,
velocity).
• Often, the only way we can view these signals is through a
transducer, a device that converts a CT signal to an electrical signal.
• Common transducers are the ears, the eyes, the nose… but these are
a little complicated.
• Simpler transducers are voltmeters, microphones, and pressure
sensors.

Discrete time
• Discrete time signal: a signal that is specified only for
discrete values of the independent variable
– It is usually generated by sampling so it will only
have values at equally spaced intervals along the
time axis
– The domain of the function representing the
signal has the cardinality of integer numbers
amplitude
§§ Signal ↔ f=f[n], also called sequence

§§ Independent variable ↔ n
§§ For discrete-time functions: t ÎZ
time (discrete)

Discrete time
• We can write a collection of numbers (1, -3, 7, 9) representing a
signal as a function of a discrete variable, n. x[n] represents the
amplitude, or value of the signal as a function of n, which takes on
integer values.
• Many human-generated signals are discrete (e.g., MIDI codes, stock

market prices, digital images).
• In this course, we will show that most of the properties that apply to
CT signals apply in a similar manner to DT signals.
Continuos - Discrete time
Analog - Digital

Analog
• Analog signal: signal whose amplitude can take on any
value in a continuous range
– The amplitude of the function f(t) (or f(x)) has the
cardinality of real numbers
– The difference between analog and digital is similar to the
difference between continuous-time and discrete-time. In
this case, however, the difference is with respect to the
value of the function (y-axis)
– Analog corresponds to a continuous y-axis, while digital
corresponds to a discrete y-axis
• An analog signal can be both continuous time
and discrete time

Digital
• Digital signal: a signal is one whose amplitude can take on
only a finite number of values (thus it is quantized)
– The amplitude of the function f() can take only a finite
number of values
– A digital signal whose amplitude can take only M different
values is said to be M-ary
– Binary signals are a special case for M=2
amplitude
time
Example
– Continuous time analog
amplitude
time
– Continuous time digital (or quantized)

§§ binary sequence, where the values of the function can only be one or zero.
amplitude
time

Example
• Discrete time analog
amplitude
time
• Discrete time digital
§§ binary sequence, where the values of the function can only be one or zero.
amplitude
time

Continuous System Example
• A digital player/recorder
Analog/Digital Digital/Analog
Converter Processor
Converter
Reconstructed
Analog Input Sampling Signal Digital Output
Digital Signal

Summary
Signal amplitude/
Real Integer
Time or space
Analog Digital
Real
Continuous-time Continuous-time
Analog Digital
Integer
Discrete-time Discrete time

Periodic - Aperiodic
• Periodic signal with period T0
• Aperiodic signal

• A signal f(t) is periodic if there exists a positive constant T0 such that
f (t + T0 ) = f (t) "t
– The smallest value of T0 which satisfies such relation is said the period of the
function f(t)
– A periodic signal remains unchanged when time-shifted of integer multiples of the
period
– Therefore, by definition, it starts at minus infinity and lasts forever
-¥ £ t £ +¥ t Î°
-¥ £ n £ +¥ nÎZ
– Periodic signals can be generated by periodical extension

• CT Periodic signals: x(t ) = x(t + T )
• DT Periodic signals: x(n) = x(n + N )

Causal and non-Causal signals
• Causal signals are signals that are
zero for all negative time (or spatial
positions), while
• Anticausal are signals that are zero for

all positive time (or spatial positions).
• Noncausal signals are signals that

have nonzero values in both positive
and negative time

Causal and non-causal signals
• Causal signals
f (t) = 0 t <0
• Anticausals signals
f (t) = 0 t ³0
• Non-causal signals
$t1 < 0: f (t1 ) =0

Signal operations: Amplitude Operations
In general: Reversal
y(t)=Ax(t)+B
B>0 à Shift up
B<0 à Shift down
Scaling
|A|>1à Gain
|A|<1à Attenuation
A>0àNO reversal
A<0à reversal
Scaling

Signal operations: time inversion
X(t) Time Y=X(-t)
Reversal

Signal operations: time inversion
• (Time) inversion: mirror image of f(t) about the vertical axis
j (t ) = f (-t )
f(t)
f(-t)

Signal operations: time shifting
• Shifting: consider a signal f(t) and the same signal delayed/anticipated by T
seconds f(t)
T>0
t
f(t+T)
anticipated
t
T
delayed
f(t-T)
t
Time Shifting
• The original signal g(t) is shifted
by an amount t0 .
Time Shift: y(t)=g(t-to)
• g(t)àg(t-to) // to>0 àSignal

Delayedà Shift to the right
X(t) Time Y=X(t-to)

Shifting
Delay

Time Shifting X(t) Time
Shifting
Y=X(t-to)
• The original signal x(t) is

shifted by an amount t0 .
Time Shift: y(t)=x(t-to)
• X(t)àX(t-to) // to>0 àSignal

Delayedà Shift to the right
• X(t)àX(t+to) // to<0
àSignal Advancedà Shift to
the left

Time inversion and shifting
Shifting to the right; increasing in time à Delaying the signal! shift to the left of t=0 by
two units!
Delayed/ Advanced/
Moved right Moved left
Reversed &
Delayed
Or rewrite as: X[-(t-2)]

Or rewrite as: X[-(t+1)] Hence, reverse the signal in time.
Hence, reverse the Then shift to the right of t=0
This is really: signal in time. by two units!
X(-(t+1)) Then shift to the left of
t=0
by one unit!
Signal operations: time scaling
• (Time) Scaling: compression or expansion of a signal in time
f(t)
f(2t) t
compression j (t ) = f (2t)
t
f(t/2)
expansion j (t ) = f (t /2)

Example: Given x(t), find y(t) = x(2t). This

SPEEDS UP x(t) (the graph is shrinking)
The period decreases! X(t) Time Y=X(at)
Scaling

Example: Given x(t), find y(t) = x(2t). This
SPEEDS UP x(t) (the graph is shrinking)
The period decreases!
What happens to the period T?
The period of x(t) is 2 and the period of y(t) is 1,
X(t) Time Y=X(at)

Scaling
a>1 à Speeds up à Smaller period à Graph shrinks!

a<1 à slows down à Larger period à Graph expands

Example of Time Scaling (tàt/a)

Example of Time scaling
• Given y(t),
– find w(t) = y(3t)
– v(t) = y(t/3).

Signal operations: scaling
• Scaling: generalization
a >1
j (t ) = f (at ) ® compressed version
j (t ) = ⎛çæt ⎞
⎜
f⎝ ÷ö® dilated (or expanded) version
⎟
a
è ⎠ø
Viceversa for a < 1

Signal operations: shifting,
scaling, inversion
• Combined operations: f(t) → f(at-b)
• Two possible sequences of operations
1. Time shift f(t) by to obtain f(t-b). Now time scale the shifted signal f(t-b) by a to
obtain f(at-b).
2. Time scale f(t) by a to obtain f(at). Now time shift f(at) by b/a to obtain f(at-b).
• Note that you have to replace t by (t-b/a) to obtain f(at-b) from f(at) when replacing t by
the translated argument (namely t-b/a))

Even and Odd signals
• An even signal is any signal f such that f (t) = f (-t). Even signals can be
easily spotted as they are symmetric around the vertical axis.
• An odd signal, on the other hand, is a signal f such that f (t)= - (f (-t))

Even and Odd signals
f (t )
Even signals
f (-t ) = f (t )
t
odd signals f (t )
f (-t ) = - f (t )
t
Theory of Signals and Systems - Unit 1 - Week 1-

80
V. De Feo
Decomposition in even and odd
components
• Any signal can be written as a combination of an even and an odd signals
– Even and odd components
1
f (t ) = ( f (t ) + f (-t )) + 1 ( f (t ) - f (-t ))
2 2
1
f e (t ) = ( f (t ) + f (-t )) even component
2
1
f o ( t) = ( f (t ) - f (-t )) odd component
2
f (t ) = fe (t ) + fo (t )

Example

Example
• Proof

Some properties of even
and odd functions
• even function x odd function = odd function
• odd function x odd function = even function
• even function x even function = even function
• Area a a
ò f (t ) dt = 2ò f (t )dt
e e
-a 0
a
ò f (t ) dt = 0
e
-a

and odd functions
• Even and odd signals
Represent Xo(t) in terms of X(t) only!
1. X(t) = Xe(t) + Xo(t)
2. X(-t) = X(t) ß Even Represent Xe(t) in terms of X(t) only!
3. X(-t) = -X(t) ß Odd

• Properties
Xe + Ye = Ze Xe * Ye = Ze
Xo + Yo = Zo Xo * Yo = Ze
Xe + Yo = Ze + Zo Xe * Yo = Zo

and odd functions
• Even and odd signals
1. X(t) = Xe(t) + Xo(t)
2. X(-t) = X(t) ß Even
3. X(-t) = -X(t) ß Odd
• Properties
Xe + Ye = Ze Xe * Ye = Ze
Xo + Yo = Zo Xo * Yo = Ze
Xe + Yo = Ze + Zo Xe * Yo = Zo
Know
These! Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 86
and odd functions
Change tà -t
• Prove that product of two even
signals is even. x(t ) = x1 (t ) ´ x2 (t ) ®
x(-t ) = x1 (-t ) ´ x2 (-t ) =
x1 (t ) ´ x2 (t ) = x(t )
• Prove that product of two odd
signals is odd.
x(t ) = x1 (t ) ´ x2 (t ) ®
• What is the product of an even x(-t ) = x1 (-t ) ´ x2 (-t ) =
signal and an odd signal? Prove it!
x1 (t ) ´ - x2 (t ) = - x(t ) =
x(-t ) ¬ Even

Other types of symmetry
• A right-sided signal is zero for t < T and a left-sided signal is zero for t > T, where T can be
positive or negative.

Deterministic - Probabilistic
• Deterministic signal: a signal • Probabilistic (or random) signals: the
whose physical description in amplitude values cannot be predicted
known completely precisely but are known only in terms of
probabilistic descriptors
• A deterministic signal is a signal in
which each value of the signal is • The future values of a random signal
fixed and can be determined by a cannot be accurately predicted and can
mathematical expression, rule, or usually only be guessed based on the
table. averages of sets of signals
• Because of this the future values of – They are realization of a stochastic
the signal can be calculated from process for which a model could be
past values with complete available
confidence. – Examples: EEG, evocated potentials, noise
in CCD capture devices for digital cameras
– There is no uncertainty
about its amplitude values
– Examples: signals defined
through a mathematical
function or graph

Example
• Deterministic signal
amplitude
time
• Random signal
amplitude
time

Finite and Infinite length (duration
or support) signals
• A finite length signal is non-zero over a finite set of values of the
independent variable
f = f (t ), "t : t1 £ t £ t2
t1 > -¥, t2 < +¥
• An infinite length signal is non zero over an infinite set of values of the
independent variable
– For instance, a sinusoid f(t)=sin(ωt) is an infinite length signal

Example of finite length (duration
or support) signals
• The function is not zero on a finite support
[a, b]
f (t )
a
b

Finite amplitude (domain) signals
• The function takes values within a finite
interval [a, b]
b f (t )

Bounded/Unbounded Casual/Anti-
casual signals
• A signal can be bounded or unbounded depending on the stability of the system.

Energy and Power of a signal
i (t )
•Consider power dissipated in a resistor R R
at an instant moment of time t:
Ohm’s law: v(t ) = i (t ) R
•Instantaneous power dissipated in the resistor: Þ P(t ) = v(t )i (t ) = i 2 (t ) R = v 2 (t ) / R;
•In order to normalise power it is usually assumed R = 1 W : Þ P (t ) = i 2 (t ) = v 2 (t );
•Energy dissipated in the resistor over an infinitesimal interval dt: Þ dE = P(t )dt ;
•Energy dissipated in the resistor over a finite time interval T: Þ E = ò P(t )dt = ò v 2 (t )dt ;
T T
f (t ) f (t )
2
t t
¥
E ( x) ! ò x ( t ) dt
2
-¥

• Signal energy
+¥
Ef = ò f 2 (t)dt
-¥
+¥
Ef = ò f (t) 2 dt
-¥
• Generalized energy : Lp norm

– For p=2 we get the energy (L2 norm)
(ò ( f (t ) ) dt )
p 1/ p
f (t ) =
1 £ p < +¥
i (t )
•Consider power dissipated in a resistor R R
at an instant moment of time t:
Ohm’s law: v(t ) = i (t ) R
•Energy dissipated in the resistor over a finite time interval T: Þ E = ò P(t )dt = ò v 2 (t )dt ;
T T
f (t ) f (t )
2
t t
¥
E ( x) ! ò x ( t ) dt
2
-¥
E 1 1
•Average power dissipated in the resistor: Þ P= = ò P(t )dt = ò v 2 (t )dt.
T TT TT
•Signals v (t ) , for which the above integral exists and yields a finite power, 0 < P < ¥ , are called
finite power signals. TheTheory
finiteofpower 0 < P < ¥ . 97
signals are the signals with well-defined power:
Signals and Systems - Unit 1 - Week 1- V. De Feo
•Only functions that satisfy condition 0 < P < ¥ can be expanded in Fourier series!
Energy and Power of periodic signals
•If signal has infinite support (length, duration), it exists all the time,
i.e. during infinite time interval T®¥. It is obvious that because of this,
the energy of any infinite support signal is infinite, E®¥.
•If signal is periodic, say with period T0, it exists all the time, i.e. it is an
infinite support signal. Because of this, the energy of any periodic
signal is infinite, E®¥.
•Average power of a periodic signal dissipated in the resistor over any
interval T=nT0 is, however, finite, and is equal to the average power
dissipated over a period T0: 1 1 1
P= ò P(t )dt = ò P(t )dt = ò (t )dt.
2
v
T T
T0 T0 T0 T0
•For any periodic signal, the above integral exists and yields a finite
power, 0 < P < ¥ , so that they are called periodic power signals. For this
reason, periodic signals can be expanded in Fourier series!
• Power
– The power is the time average (mean) of the squared signal amplitude, that is the
mean-squared value of f(t)
+T /2
1
T ®¥ T ò
Pf = lim f 2
(t)dt
-T /2
+T /2
1
ò
2
Pf = lim f (t) dt
T ®¥ T
-T /2

Root Mean Square (RMS) Value
• The square root of the power is the root mean square (rms) value
– This is a very important quantity as it is the most widespread
measure of similarity/dissimilarity among signals
– It is the basis for the definition of the Signal to Noise Ratio (SNR)
– It is such that a constant signal whose amplitude is =rms holds
the same power content of the signal itself
• There exists signals for which neither the energy nor the power
are finite, the rms is infinite.
f
ramp
0 t
Energy and Power signals
• A signal with finite energy is an energy signal
– Necessary condition for a signal to be of energy type is that the
amplitude goes to zero as the independent variable tends to
infinity
• A signal with finite and different from zero power is a power signal
– The mean of an entity averaged over an infinite interval exists if
either the entity is periodic or it has some statistical regularity
– A power signal has infinite energy and an energy signal has zero
power
– There exist signals that are neither power nor energy, such as the
ramp
• All practical signals have finite energy and thus are energy signals
– It is impossible to generate a real power signal because this would
have infinite duration and infinite energy, which is not doable.
Questions on energy and power
§Power is the time average of energy. Why?
§What is an example of a signal for which the energy integral is
bounded? We refer to such signals as energy signals.
§What is an example of a signal for which the energy integral is
unbounded but the power integral is bounded? We refer to these
as power signals.
§What is an example of a signal for which the power integral is
unbounded? Such signals are often described as being unstable.
Can such a signal exist in the real world?

Signals as vectors
Size (module) of a signal: Norm
• "Size" indicates largeness or strength.
• We will use the mathematical concept of the norm to quantify this
notion for both continuous-time and discrete-time signals.
• The energy is represented by the area under the curve (of the
squared signal)
• For a signal, the norm is the square root of the energy
f (t )
2
x (t ) = ò x (t )
2
dt
t
¥
E ( x) ! ò x ( t ) dt 103
2
Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo -¥
Signals as vectors

Ortogonal Signals

Some important signals
We shall introduce two auxiliary functions, the unit step function or
Heaviside function u(t − a) (following) and Dirac’s delta δ(t − a)
These functions are suitable for solving ODEs with complicated right
sides of considerable engineering interest, such as single waves,
inputs (driving forces) that are discontinuous or act for some time
only, periodic inputs more general than just cosine and sine, or
impulsive forces acting for an instant (hammerblows, for example).

Some important signals
Singularity functions in continuous-time systems
•Singularity functions are discontinuous or have discontinuous

derivatives.
•Singularity functions are mathematical idealizations and, strictly

speaking, do not occur in physical systems.
They serve as good approximations to certain limiting conditions in

physical systems.
We will discuss two types of singularity functions:

unit step function and unit impulse function
Unit step function
Unit step function
The unit step function is defined as
1 t >0
u (t ) = {
0 t <0
(u(t) has no definition at t = 0, or one may define u(0) = 1 or u(0) = ½)

1
u[n]
ì1 n ³ 0
u[n] = í
î0 n < 0
-5 -4 -3 -2 -1 0 1 2 3 4 5
n

Note: Unit Step Function
a discontinuous continuous-time signal

Unit step function shift
u(t)
1 ...
-2 -1 1 2 3 4 t
u(t-2)
1 ...
-2 -1 1 2 3 4 t
u(t+0.5) General View:

1 ...
x(t ± t0) for t0 > 0
-2 -1 1 2 3 4 t “+t0” gives Left shift (Advance)
“–t0” gives Right shift (Delay)
10/22
Unit step function shift
ì1, t " 0 1
u (t ) = í
î0 , t ! 0 t
Shift a
1
ì1, t " a
u (t - a ) = í
î0 , t ! a t
a
Theory of Signals and Systems - Unit 1 - Week 1- 111

V. De Feo
Unit Step Function Applications:
Creating Block Function (window)
1
• rect(t/T) Note:
Period is T; & symmetric
-T/2 T/2
• Can be expressed as u(T/2-t)-u(-T/2-t) 1

– Draw u(t+T/2) first; then reverse it!
-T/2 T/2
-T/2 T/2
• Can be expressed as u(t+T/2)-u(t-T/2)
• Can be expressed as u(t+T/2).u(T/2-t) -T/2 T/2

Unit Step Function Time Shifting
• x(t) = u(t+1)- u(t-2)
u(t+1)- u(t-2)
t=0 t

Unit Step Function
t=0
• Determine x(t) + x(2-t) , where x(t) = u(t+1)- u(t-2)

u(t+1)- u(t-2)
– Which is x(t):
– find x(2-t): Reverse and then advance in time

– à First find y(t)=x[-(t-2)];
First we reverse x(t)

Then, we delay it by 2 unites as
shown below:
Add the two functions: x(t) + x(2-t)

Time Shifting
Example
• Given x(t) = u(t+2) -u(t-2),
– find
• x(t-t0)=
• x(t+t0)=
Answer:
• x(t-t0)= u(t-to+2) -u(t-to-2),
• x(t+t0)= u(t+to+2) -u(t+to-2),
But how can we draw this function?

Amplitude Operations Example
Given x2(t), find 1 - x2(t).
Remember:
This is y(t) =1 Ans.
Multiplication of two signals:x2(t)u(t)
Step unit function

Ans.
Signals can be added or multiplied

Amplitude Operations Example
Note: You can also think of it as X2(t)
being amplitude revered and then
Given x2(t), find 1 - x2(t). shifted by 1.
Remember: This is y(t) =1
Multiplication of two signals:x2(t)u(t)
Step unit function
Signals can be added or multiplied à e.g., we can filter parts of a signal!

Sign function
ì 1, t " 0
ï
sgn(t ) = í 0, t = 0
ï- 1, t ! 0
î
sgn (t ) = u (t ) - u (-t )

Rectangular Pulse Function: pt(t)
Subscript
pt(t) specifies the
1
pulse width
-t/2 t/2 t
We can build a Rectangular Pulse from Unit Step Functions:
pt(t) = u(t + t/2) – u(t – t/2) This is helpful because we

will have lots of results that
apply to the step function
u(t + t/2)
1
-t/2 t
u(t - t/2)
1
-t/2 t/2 t
0–0=0 1–0=1 1–1=0 21/22
Rectangular (or window) function
The

Representation of a rectangular
pulse by step functions
f (t ) = u (t - 2) - u (t - 4) = Π! t − 𝑡" 𝑤𝑖𝑡ℎ 𝑇 = 2 𝑎𝑛𝑑 𝑡" = 3

Building Signals with Pulses: shifted pulses are used to “turn other
functions on and off”. This allows us to mathematically describe complicated
functions in terms of simpler functions.
Continues up forever
2 g(t) = 0.5t + 1
This
1
Continues down 1 2 Delay by 1 t Times

forever
p2(t - 1)
1 Width of 2 This
2 t
Multiplying By One
Multiplying “Turns On” g(t)
Gives
By Zero 3
“Turns Off”
g(t) 2 f(t) = (0.5t + 1)p2(t - 1)
1 This
1 2
Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo t 122
Unit ramp signal
r (t )
ìt, t ³ 0
r (t ) = í
î0, t ! 0 t
dr (t ) t
u (t ) = or r (t ) = ò u (t )dt
dt -¥
𝑟 𝑡 = 𝑡 $ 𝑢(𝑡)

Relationship between u(t) & r(t)
Whatt is ò -¥
u(l)dl ?
Depends on t value
Þfunction of t: f(t)
t
Þ f (t) = ò u(l )dl What is f(t)?
-¥
-Write unit step as a function of l
-Integrate up to l = t i.e., Find Area
-How does area change as t changes?
u(l) t
1 Þ f (t) = ò
-¥
u(l)dl = 1×t = t = r(t)
Þ t
l=t l r(t) = ò u(l )dl
-¥
Area = f(t)
“Running Integral of step = ramp”

Overlooking this, we can roughly say u(t) = dr(t)
dt
r(t) u(t)
1 ... t 1 ...

Signal simple operation : ＋・－
f (t )
f (t ) = u (t ) - r (t ) + r (t - 1)
u (t )
r (t - 1)
r (t )

General Ramp signal
! "!! #!
𝑟 𝑡 =! $𝑢 𝑡 + !!
$ 𝑢(𝑡 − 𝑡$ )
!

Example
f (t ) = 3u (t ) + tu (t ) - [t - 1]u (t - 1) - 5u (t - 2)

Example
• Plot
f (t ) = 3[t + 2]u (t + 2) - 6[t + 1]u (t + 1) + 3[t - 1]u (t - 1) + 3u (t - 3)
• t<-2 à f(t)=0
• -2<t<-1 à f(t)=3[t+2]
• -1<t<1 à f(t)=-3t
• 1<t<3 à f(t)=-3
• 3<t< à f(t)=0

parabolic signal
f p (t )
ìt 2 , t ³ 0
f p (t ) = í
î 0, t ! 0
t
𝑓% 𝑡 = 𝑡 " $ 𝑢 𝑡

sinc signal
f p (t )
sin pt
sin c(t ) =
pt
sin(𝑥)
lim =1
&→$ 𝑥

Woodward’s Notations
Rectangular pulse:
The other notations used in the literature are rect() and P(t).
Triangular pulse:
or, equivalently, L{t} = 1 - |t|, where |t| £1

The Convolution Integral
• This particular integration is called the
convolution integral
¥
y (t ) = ò x(t )h(t - t )dt ,
-¥
t ³0
!""#""$
x(t ) * h(t )
• Equation y (t ) = x(t ) * h(t ) is called the
convolution representation of the system
• Remark: a CT LTI system is completely
described by its impulse response h(t)
The Convolution Integral

Example: Analytical Computation
of the Convolution Integral
• Suppose that x(t ) = h(t ) = p (t ), where p(t)
is the rectangular pulse depicted in figure
p (t )
0 T t
Example – Cont’d
• In order to compute the convolution

integral
¥
y (t ) = ò x(t )h(t - t )dt ,
-¥
t ³0
we have to consider four cases:

• Case 1: t £ 0
h(t - t ) x(t )
t -T t 0 T t
y (t ) = 0
• Case 2: 0 £ t £ T
h(t - t ) x(t )
t -T 0 t T t
t
y (t ) = ò dt = t
0
• Case 3: 0 £ t - T £ T ® T £ t £ 2T
x(t ) h(t - t )
0 t -T T t t
T
y (t ) = ò dt = T - (t - T ) = 2T - t
t -T
• Case 4: T £ t -T ® 2T £ t
x(t ) h(t - t )
0 T t -T t t
y (t ) = 0
y (t ) = x(t ) * h(t )
0 T 2T t

Convolution (integral)
u (t ) h(t ) = 4 - t / 2
t t
-2 3 8

Convolution
(1) t ! -2
h(t - t ) u (t )
y (t ) = 0
t -8 t -2 3

(2) - 2 ! t ! 3
h(t - t ) u (t )
t t -t
y (t ) = ò 2(4 - )dt
-2 2
t -8 - 2t 3
(3) 3 ! t ! 6
h(t - t ) u (t )
3 t -t
y (t ) = ò 2(4 - )dt
t -8 - 2 3 t -2 2

(4) 6 ! t ! 11
u (t ) h(t - t )
3 t -t
y (t ) = ò 2(4 - )dt
-2 t -8 3 t t -8 2
(5) 11 ! t
u (t )
h(t - t )
y (t ) = 0
-2 3 t -8 t

t ! -2 y (t ) = 0
t t -t
-2!t !3 y (t ) = ò 2(4 - )dt
-2 2
3 t -t
Ans: 3!t !6 y (t ) = ò 2(4 - )dt
-2 2
3 t -t
6 ! t ! 11 y (t ) = ò 2(4 - )dt
t -8 2
11 ! t y (t ) = 0

Unit impulse function (Dirac Delta function)
An airplane making a “hard” landing, a
mechanical system being hit by a
hammerblow, a ship being hit by a single
high wave, a tennis ball being hit by a
racket, and many other similar examples
appear in everyday life. They are
phenomena of an impulsive nature where
actions of forces—mechanical, electrical,
etc.—are applied over short intervals of
time.
We can model such phenomena and
problems by “Dirac’s delta function,” and
solve them very effectively by the Laplace
transform.
Other Names: Delta Function,
The Impulse Function Dirac Delta Function
One of the most important functions for understanding systems!!

Ironically…it does not exist in practice!!
Þ It is a theoretical tool used to understand what is important to
know about systems!
But… it leads to ideas that are used all the time in practice!!
There are three views we’ll take of the delta function:
Infinite height
Rough View: a pulse with: Zero width
Unit area
“A really narrow, really tall pulse that has unit area”

Slightly Less-Rough View: d (t) = lim 1 pe (t)
e ®0 e
1
1 p e (t)
e
e
1
Here we define pe (t) as:
e -e e t
2 2
Pulse having… height of 1/e and width of e

… which therefore has… area of 1 (1 = e ´1/e)
So as e gets smaller the pulse gets higher and narrower but always
has area of 1…
In the limit it “becomes” the delta function

Precise Idea: d(t) is not an ordinary function… It is defined
in terms of its behavior inside an integral:
The delta function d(t) is defined as

something that satisfies the following two
conditions: d (t) =0, for any t ¹ 0
e
òd (t)dt = 1, for any e > 0

-e
We show d(t) on a plot using an arrow…

(conveys infinite height and zero width)
d(t)
Caution… this is NOT the vertical
axis… it is the delta function!!!
0 t
f (t )
1
a
1 Area=1
d (t ) = lim [u (t ) - u (t - a)]
a ®0 a
a t
d (t )
(1)
d (t ) =
d
f (t ) Amplitude »¥
dt
t
width ® 0
kd (t - a )
(k )
a t
Unit impulse function
The unit impulse function is defined as
d (t ) = 0, t¹0 ì1 n = 0
¥ d [ n] = í
ò-¥
d (t )dt = 1 î0 n ¹ 0
1
d[n]
e e
u (t + ) - u (t - ) -5 -4 -3 -2 -1 0 1 2 3 4 5
d (t ) = lim 2 2
e ®0 e
Unit Impulse Function d(t)
• Not real (does not exist in nature – similar to i=sqrt(-1)
• Also known as Dirac delta function
– Generalized function or testing function
• The Dirac delta can be loosely thought of as a function of the real line
which is zero everywhere except at the origin, where it is infinite
• Note that impulse function is not a true function – it is not defined for
all values
– It is a generalized function
Mathematical definition
Mathematical definition
d(t)

Unit Impulse Function d(t)
• Also note that
• Also
d(t-to)
0 to

Relationship òd (l)dl = u(t)
t
between d(t) and u(t) -¥
For t < 0: the integrand = 0 Þ integral = 0 for t < 0
d(l)
l=t<0 0 Defines
l
the unit
Range of Integration step
function
For t > 0: we “integrate over” the delta Þ integral = 1 for t > 0
d(l)
0 l=t>0 l
Range of Integration

Relationship d (t) = d u(t)
dt
between d(t) and u(t)
Derivative = 0
u(t)
Derivative = 0
1 ...
t
Derivative = “¥” (“Engineer Thinking”)
Our view of the delta function having infinite height but

zero width matches this interpretation of the values of
the derivative of the unit step function!!

Relationship between d(t) and u(t)
t
ò -¥
d (t )dt = u (t )
du (t )
= d (t )
dt

Relationship between d(t) and u(t)
n
ì1 n ³ 0
å d [k ] = í = u[n]
k = -¥ î0 n < 0
u[n] - u[n - 1] = d [n]
1 1
u[n]
d[n]
-5 -4 -3 -2 -1 0 1 2 3 4 5 -5 -4 -3 -2 -1 0 1 2 3 4 5
n

Continuous and Piecewise-Continuous Signals
• A continuous-time signal, x(t), is discontinuous at a fixed point, t1,
( ) ( ) - +
if x t1- ¹ x t1+ where t1 - t1 and t1 - t1 are infinitesimal positive numbers.
( )
• A signal is continuous at the point t1 if x t1 = x(t1 ) = x t1 .
- +
( )
• If a signal is continuous for all points t, x(t) is said to be a continuous signal.
• Note that we use continuous two ways: continuous-time signal and
continuous (as a function of t).
• The ramp function, r(t), and the sinusoid are
examples of continuous signals, as is the
triangular pulse shown to the right.
• A signal is said to be
piecewise continuous
if it is continuous at all
t except at a finite or
countably infinite
collection of points
ti, i = 1, 2, 3, …
Derivative of a Continuous-Time Signal
x(t1 + h) - x(t1 )
• A CT signal, x(t), is said to be differentiable at a fixed point, t1, if
has a limit as h è 0: h
dx (t ) x(t + h) - x(t1 )
= lim 1
dt t =t1 h®0 h
independent of whether h approaches zero from h > 0 or h < 0.
• To be differentiable at a point t1, it is necessary but not sufficient that the
signal be continuous at t1.
• Piecewise continuous signals are not differentiable
at all points, but can have a derivative in the
dx (t )
dt
[ ( ) ( )]
+ x t1+ - x t1- d (t - t1 )
generalized sense:
• dx(t ) dt is the ordinary derivative of x(t) at all t, except at t = t1. d (t ) is an
impulse concentrated a t = t1 whose area is equal to the amount the function
“jumps” at the point t1.
• For example, for the unit step function,
the generalized derivative of Ku (t ) is:
[ ( ) ( )]
K u 0 + - u 0 - d (t - 0) = Kd (t )

Unit Impulse Properties
1. Scaling
– Kd(t)à Area (or weight) under = K
2. Time Shift
– X(t) d(t-to) àX(to) d(t-to)
• Example: Draw 3x(t-1) d(t-3/2) where x(t)=sin(t)
– Using x(t) d(t-to) àX(to) d(t-to) ;
– 3x(3/2-1) d(t-3/2)=3sin(1/2) d(t-3/2)

Multiplication of a function by d(t)
f(t)d(t) = f(0)d(t), f(t) continuous at t=0.
f(t)d(t – T) = f(T)d(t – T), f(t) continuous at t=T.
Sampling (Sifting) property of d(t), d[n]

¥ ¥ 1
ò-¥
f (t )d (t )dt = f (0) ò d (t )dt = f (0)
-¥
f(t)
¥
ò-¥
f (t )d (t - T )dt = f (T )
d(t)
å
¥
-¥
f [n]d [n] = f [0]
å
¥
-¥
f [n]d [n - N ] = f [ N ]
-1 -0.5 0 0.5 1
The area under the curve obtained by the product of the unit impulse function
shifted by T and (t) is the value of the function f(t) for t=T
The Sifting Property is the most important property of d(t):
t0 +e
ò f (t)d (t - t )dt = 0 f (t0 ) "e > 0

t0 -e
f(t)
Integrating the
f(t0) product of f(t)
f(t0) and d(t – to)
t0 t returns a single
number… the
d(t- t0) value of f(t) at
the “location” of
the shifted delta
t0 function
t
As long as the integral’s limits surround the

“location”
Theory of Signals and Systems of the
- Unit delta…
1 - Week 1- V. De otherwise
Feo it returns zero 163
Steps for applying sifting property:
Step 1: Find variable of integration
t 0 +e
Step 2: Find the argument of d(•)
ò f (t)d (t - t )dt = 0 f (t0 ) Step 3: Find the value of the
variable of integration that causes
t0 -e
the argument of d(•) to go to zero.
Step 4: If value in Step 3 lies inside
limits of integration… Take
everything that is multiplying d(•)
Example #1: and evaluate it at the value found in
7 step 3; Otherwise… “return” zero
ò sin(pt)d (t -1)dt = ? Step 1: t Step 2: t – 1

-4 Step 3: t – 1 = 0 Þ t = 1
Step 4: t = 1 lies in [–4,7] so
d (t - 1) evaluate… sin(p´1) = sin(p) = 0
sin(pt)
7
1 2 3 t ò sin(pt)d (t -1)dt = 0
-4 - Unit 1 - Week 1- V. De Feo
Theory of Signals and Systems 164
2
Example #2:
ò sin(pt)d (t - 2.5)dt = ?
0
Step 1: Find variable of integration: t

Step 2: Find the argument of d(•): t – 2.5
Step 3: Find the value of the variable of integration that causes the
argument of d(•) to go to zero: t – 2.5 = 0 Þ t = 2.5
Step 4: If value in Step 3 lies inside limits of integration… No!
Otherwise… “return” zero…
d (t - 2.5) 2
sin(pt) òsin(pt)d(t - 2.5)dt = 0

0
1 2 3 t
Range of Integration Does NOT “include delta function”

7
Example #3:
ò sin(wt)(t - 3) d (3t + 4)dt = ?Because of this… handle
2
-4 slightly differently!
Step 0: Change variables: let t = 3t € dt = 3dt € limits: tL = 3(-4) tL = 3(7)
21
1
ò3 sin(wt / 3)(t / 3 - 3)2d (t + 4)dt = ?
-12
Step 1: Find variable of integration: t

Step 2: Find the argument of d(•): t + 4
Step 3: Find the value of the variable of integration that causes the argument of
d(•) to go to zero: t = –4
Step 4: If value in Step 3 lies inside limits of integration… Yes!
Take everything that is multiplying d(•): (1/3)sin(wt/3)(t/3 – 3)2
…and evaluate it at the value found in step 3:
(1/3)sin(–4/3w)(–4/3 – 3)2 = 6.26sin(–4/3w)
7
ò sin(wt)(t - 3)2
d (3t + 4)dt = 6.26sin(- 4 / 3w)
-4
Sampling
f (t ) f * (t )
…
t t
¥
f * (t ) = å f (t )d (t - nT )
n ® -¥

• Integration of a test function
– Example
• Other properties:
Make sure you can understand why!

• Example: Verify
1
• Evaluate the following ò (3t
2
+ 1)d (t ) = ?
-1
Remember:

• For good discussion of d-function and its properties, see Ref. 1, Ch.2, Sec. 2.5, pp. 68-71.

Properties of the Convolution Integral
• Associativity
x(t ) * (v(t ) * w(t )) = ( x(t ) * v(t )) * w(t )
• Commutativity
x(t ) * v(t ) = v(t ) * x(t )
• Distributivity w.r.t. addition
x(t ) * (v(t ) + w(t )) = x(t ) * v(t ) + x(t ) * w(t )

Properties of the
Convolution Integral - Cont’d
ì xq (t ) = x(t - q )
• Shift property: define ï v (t ) = v(t - q )
í q
then ï w(t ) = x(t ) * v(t )
î
w(t - q ) = xq (t ) * v(t ) = x(t ) * vq (t )
• Convolution with the unit impulse
x(t ) * d (t ) = x(t )
• Convolution with the shifted unit impulse
x(t ) * d q (t ) = x(t - q )
Periodic Signals
Periodic signals are important because many human-made
signals are periodic. Most test signals used in testing circuits
are periodic signals (e.g., sine waves, square waves, etc.)
A Continuous-Time signal x(t) is periodic with period T

if: x(t + T) = x(t) "t
x(t) T
... ...
x(t) x(t + T) t
Fundamental period = smallest such T

When we say “Period” we almost always mean “Fundamental Period”
Periodic Signals: Woodward’s Notations

Sampling function: Woodward’s Notations
= repT{d(t)}g(t)

Real and Complex Signals
• Complex signals are an important abstraction in many disciplines
such as communications and multidimensional signal processing.
• In general, x is a complex quantity and has:
§ a real and imaginary part, or equivalently
§ a magnitude and a phase angle.
• A very important class of signals
is complex exponentials:
§ CT signals of the form x(t) = est
§ DT signals of the form x[n] = zn
where z and s are complex
numbers.

Complex Numbers
Complex numbers arise as roots of polynomials. Recall that the solution of
differential equations
Definition of j = -1 Þ j 2 =-1 involves finding roots of the
imaginary # j “characteristic polynomial”
and some Þ (- j)( j) = 1
resulting So…differential equations
properties: Þ (- j)(- j) = -1 often involve complex
numbers
Rectangular form of a complex number:
z = a + jb a = Re{z}
b = Im{z}
real numbers
The rules of addition and multiplication are straight-forward:

Add : (a + jb) + (c + jd ) = (a + c) + j(b + d)
Multiply : (a + jb)(c + jd ) = (ac - bd ) + j(ad + bc)
Polar Form
Polar form… an alternate way to express a
jq
z = re r>0 complex number…
Polar Form…
If r is negative then it is good for multiplication and division
NOT in polar form!!!
Note: you may have learned polar form as rÐq… we will NOT use that here!!
The advantage of the rejq is that when it is manipulated using rules of
exponentials and it behaves properly according to the rules of complex #s:
(a x )(a y ) = a x+ y a x / a y = a x- y

We need to be able convert between Rectangular and Polar Forms… this is made
easy and obvious by looking at the geometry (and trigonometry) of complex #s:
Geometry of Complex Numbers
r
Im b
z = a + jb q
b a
r q
a Re

Complex Exponentials vs. Sines and Cosines
Euler’s Equations:
(A)
(B)
(C)
(D)

Summary of Rectangular & Polar Forms
Rect Form:
z = a + jb
Re{z} = a = r cosq
Im{z} = b = r sinq
Warning: If you calculate the angle by first dividing b/a and then taking
the inverse tangent… your calculator will give you the wrong answer
whenever you have a < 0. In other words, for z values that lie in the II
and III quadrants.
You can always fix this by either adding or subtracting p… choose add
or subtract in order to give an angle that lies between –p and + p.
Use common sense… looking at the signs of a and b will tell you what
quadrant z is in… make sure your angle agrees with that!!! (See the
examples)
Conjugate of Z Denoted as
z* or z
z = a + jb Þ z* = a - jb
z = re jq Þ z* = rejq
Properties of z*
Imaginary parts cancel
1. z + z* = 2Re{z}
2. z ´ z* = (a + jb)(a - jb) = a 2 + b2 = z 2

Summary of General Results
Rect to Polar

The Euler’s Equation
Euler’s formulas:
e jq = cosq + j sin q
1 jq
cosq = (e + e - jq )
2
1 jq
sin q = ( e - e - jq )
2j
• Will be very useful for managing sinusoidal and complex
exponential signals. Particularly during differentiation or
integration of such signal functions.
• Exercise: Find the even and odd components of x(t) = ejt.
1931 - Week 1- V. De Feo

Theory of Signals and Systems - Unit
Real Exponential Signals
x(t) = C eat
x[n] = C ean,
where C and a are real.
Exercise: Plot the above exponentials.

Sinusoidal Signals
x(t) = A cos(w0t+q)
x[n] = A cos(w0n+q),
where A is the amplitude, w0 is the radian
frequency (rad/sec), and q is the phase angle
(rad).
Exercise: Plot A cos(w0t+q).

Exercise: Plot cos(w0t), cos(w1t), cos(w2t), where
w0<w1<w2.

Sinusoidal Signals
• Realize that Acos(w0t+q) is a scaled and shifted
version of cos t.
• This should be enough for plotting any cosine
function and any sine function.
• Notice that although A cos(w0t+q) is not equal
to A cos(w1t+q), it may be the case that A
cos(w0n+q) = A cos(w1n+q). Do you know
when?

Complex Exponential Signals
j (w 0t +q )
x(t) = Ae
x[n] = j (w 0 n +,q )
Ae
where A, q and w0 are real.
jw 0 t
• Exercise: Is z (t ) = Ae periodic?
• Exercise: How about the discrete case? Is
z[n] = Ae jw n
0
periodic?
General Exponential Signals
• x(t) = Ae ( jw +a ) t
• x[n] = Ae ( jw +a,) n
where A, a and w are real.
Exercise: Plot x(t) and x[n].

Complex Signals

Complex Signals
• Continuous time complex exponential
f (t ) = Ae jwt
• Euler s relations
• Discrete time complex exponential

– k=nT

Complex Signals
• Exponential function est
– Generalization of the function ejωt
s = s + jw

The complex exponential function
g (t ) = e jwt
j wn
g[ n] = e
dg (t ) j wt
= jw e
dt
Euler’s formula
e jwt = cos(wt ) + j sin(wt )

Exponential functions are important class of functions in
this course. We will be making use of this fact a lot in this
course
For example, suppose s = σ + jω s>0:
for a CT signal:
{ } { }
Â x(t ) = e st = Â e (s + jw )t = est cos( jwt )
s<0:
s>0:
For example, suppose z = e(σ + jω) for a DT

s<0:
signal:
{ } { }
Â x(t ) = z n = Â z (s + jw ) n = esn cos(wn)

s=σ s=jω
s=σ+jω s=σ+jω


CE701_Unit1_Week1 (1)

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

CE701_Unit1_Week1 (1)

Uploaded by

Copyright:

Available Formats

Theory of Signal and Systems

Week 1: Introduction and Definitions

Unit 1: Deterministic Signals and Systems

5-30 m Short range

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 4

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 5

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 6

a few days later…

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 8

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 9

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 10

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 11

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 12

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 13

Step (signal) vs at t=1

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 15

Input signal Output signal

• In a very broad sense, a system can be

• Simulink representation of the electrical circuit

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 17

Human speech production system — anatomy and block diagram

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 18

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 19

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 20

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 21

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 22

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 23

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 24

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 25

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 26

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 27

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 28

•A typical communication system contains numerous sub-systems, such as electronic

•Communication systems are integrated into bigger entities, called communication

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 29

(Transducer converts signal in one form

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 30

Analog Transducer Source Channel Analog

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 31

Analog Transducer Source Channel Analog

Analog Transducer Source Channel Analog

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 32

Digital Source Channel Digital

Digital Source Channel Digital

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 33

Analog Transducer A/D

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 34

• Technological (hardware) and Fundamental (noise and bandwidth) limitations of transmission:

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 35

CE701 – MSc in ACS and EE

• Basics of probability theory and noise in communication systems

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 37

Analysis of digital modulation.

• Basics of information theory an signal coding

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 38

2. Calculate the mean and variance using of a probability density function

3. Apply the Fourier transform as a signal processing tool

4. Understand and evaluate effect of noise in communications

5. Analyse analogue and digital signal modulation techniques

6. Analyse signal processing and transmission in optical-fibre communication systems

7. Apply concepts of information theory to design Huffman codes to compress data

8. Describe and apply the Shannon-Hartley bound

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 39

Theory of Signals and Systems - Unit 1 - Week 1- V. De Feo 40