Accepted Manuscript

Title: Tick-borne bacteria and protozoa detected in ticks

collected from domestic animals and wildlife in central and
southern Portugal

Authors: André Pereira, Ricardo Parreira, António José Cotão,

Mónica Nunes, Maria Luı́sa Vieira, Fábia Azevedo, Lenea
Campino, Carla Maia

PII: S1877-959X(17)30071-7
DOI: http://dx.doi.org/10.1016/j.ttbdis.2017.09.008
Reference: TTBDIS 877

To appear in:

Received date: 7-2-2017

Revised date: 15-9-2017
Accepted date: 15-9-2017

Please cite this article as: {http://dx.doi.org/

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
Tick-borne bacteria and protozoa detected in ticks collected from domestic

animals and wildlife in central and southern Portugal

Short title: Bacteria and protozoa in ticks from animals, Portugal

André Pereira1,2,3, Ricardo Parreira2,4, António José Cotão5, Mónica Nunes2,4*, Maria

Luísa Vieira2,4, Fábia Azevedo4, Lenea Campino2,3, Carla Maia1,2,3**

1
Faculty of Veterinary Medicine, Universidade Lusófona de Humanidades e

Tecnologias, Lisboa, Portugal

2
Global Health and Tropical Medicine (GHTM). Instituto de Higiene e Medicina

Tropical (IHMT), Universidade Nova de Lisboa (UNL), Lisboa, Portugal

3
Medical Parasitology Unit. IHMT, UNL
4
Medical Microbiology Unit. IHMT, UNL
5
RIAS Wildlife Rehabilitation and Research Centre, Olhão, Portugal

*Presently at Institute for Experimental Biology and Technology (IBET), Oeiras,

Portugal

** Corresponding author. Carla Maia: carlamaia@ihmt.unl.pt

Permanent address: Global Health and Tropical Medicine (GHTM). Instituto de Higiene

e Medicina Tropical (IHMT), Universidade Nova de Lisboa (UNL), Lisboa, Portugal

1
Abstract

Ticks are vectors of many human and animal pathogens. The aim of this study was to

screen bacteria and protozoa from ticks infesting domestic animals and wildlife

collected in central and southern Portugal. A total of 593 ticks, comprising 465 (78.4%)

adults, 122 (20.6%) nymphs, and six (1.0%) larvae, were collected from 283 hosts of 25

different species (4 domestic and 21 wild). Overall, the analysis of DNA extracts

prepared from ticks collected from hosts of 11 different species in the districts of

Castelo Branco, Portalegre, Lisboa, Setúbal, Beja and Faro, revealed the presence of

genomic sequences from Anaplasma sp., A. ovis, Babesia sp., relapsing fever-like

Borrelia sp., Ehrlichia spp., Rickettsia aeschlimannii, Ri. helvetica, Ri. massiliae, Ri.

raoultii, Ri. slovaca, Candidatus Ri. barbariae, Theileria annulata and T. ovis, in

specimens of Dermacentor marginatus, Hyalomma lusitanicum, Hy. marginatum,

Rhipicephalus bursa and Rh. sanguineus sensu lato. The obtained results suggest the

circulation of a wide variety of infectious agents, some of zoonotic concern, in hard

ticks from Portugal. Further studies should be conducted to better characterize (both

genetically and phenotypically) the putative novel microorganisms detected, both in

what regards their potential pathogenity towards vertebrates, and to assist the

implementation of effective control strategies for the management of ticks and human

and animal tick-borne pathogens.

Keywords: Bacteria, molecular methods, Portugal, protozoa, ticks.

2
Introduction

Ticks can transmit a variety of pathogens of veterinary and medical importance. In the

context of climate changes and globalization scenarios, tick-borne diseases (TBD) such

as anaplasmosis, ehrlichiosis, Lyme borreliosis, piroplasmosis and rickettsiosis

represent emerging threats to public and animal health worldwide (Dantas-Torres et al.,

2012). Twenty-three species of hard ticks belonging to five genera (Dermacentor,

Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus) have been described as endemic

in Portugal, and have been reported to infest humans, domestic animals and wildlife,

including birds (Santos-Silva et al., 2011; Estrada-Peña et al., 2014; Silva, 2014).

Among the agents transmitted by ticks those classified as Anaplasma or Ehrlichiaare

obligate intracellular bacteria responsible for causing anaplasmosis and ehrlichiosis in

humans and/or domestic animals (Doudier et al., 2010; Rar and Golovljova, 2011). In

Portugal, molecular and serological detection approaches have disclosed the circulation

of the agents responsible for bovine (A. marginale) and ovine (A. ovis) anaplasmosis,

cyclic thrombocytopenia (A. platys) and canine monocytic ehrlichiosis (E. canis) in

different species of mammals (Cardoso et al., 2015; Gomes and Rebêlo, 2008; Pereira et

al., 2016a; Renneker et al., 2013; Yisaschar-Mekusas et al., 2013). Furthermore, A.

marginale and A. platys have also been detected in hard ticks (Ferrolho et al., 2016;

Maia et al., 2014a; Santos-Silva et al., 2016).

Lyme borreliosis caused by spirochetes of the Borrelia burgdorferi sensu lato (s.l.)

complex is the most prevalent human TBD in the northern hemisphere (Rizzoli et al.,

2011). In Portugal, Bo. afzelii, Bo. burgdorferi sensu stricto (s.s.) Bo. garinii and Bo.

lusitaniae were detected in humans (Collares-Pereira et al., 2004; Lopes de Carvalho et

al., 2008; Nunes, 2016; Rocha et al., 2012). These and other species of the Bo.

burgdorferi s.l. complex have been found in both domestic animals (Cardoso et al.,

3
2012; Maia et al., 2014b, 2015) and wildlife (de Sousa et al., 2012; Faria et al., 2015;

Norte et al., 2013), as well as in hard ticks (Baptista et al., 2004; Maia et al., 2014b;

Milhano et al., 2010; Nunes et al., 2016). In addition, Borrelia spp. belonging to the

relapsing fever (RF) group (including Bo. miyamotoi and two genetically distinct RF-

like Borrelia) have recently been detected in ticks (Nunes et al., 2015, 2016).

Mediterranean spotted fever (MSF) caused by Rickettsia conorii is a notifiable disease

in Portugal, where a high incidence of clinically complicated cases with a high fatality

rate (up to 32.3%) have been described (de Sousa et al., 2003). Other Rickettsia species

associated with human disease in Europe (including Ri. slovaca, the causative agent of

tick-borne lymphadenopathy, and Ri. sibirica mongolitimonae, responsible for

lymphangitis-associated rickettsiosis (Oteo and Portillo, 2012) have also been reported

in Portuguese patients (de Sousa et al., 2006; 2013). Additionally, Ri. aeschlimannii, Ri.

conorii, Ri. helvetica, Ri. massiliae, Ri. monacensis, Ri. raoultii, Ri. sibirica and Ri.

slovaca have also been detected in ticks from different parts of the country (Bacellar et

al., 1995; de Sousa et al., 2006; Maia et al., 2014a; Milhano et al., 2010; Santos-Silva et

al., 2006).

Piroplasmoses caused by Babesia and Theileria protozoan parasites are responsible for

life-threatening diseases in domestic animals, and some of them (Ba. divergens, Ba.

microti and Ba. venatorum) are emergent human pathogens in Europe (Häselbarth et al.,

2007; Martinot et al., 2011). In Portugal, a fatal case of human babesiosis due to Ba.

divergens has been reported (Centeno-Lima et al., 2003), while multiple Babesia and

Theileria species (Ba. bigemina, Ba. bovis, Ba. caballi, Ba. canis, Ba. divergens, Ba.

microti, Ba. vogeli, T. annulata, T. buffeli, T. capreoli, T. equi, T. orientalis and

Theileria sp. OT3) have anecdotally been reported in domestic animals (Cardoso et al.,

2010; Criado-Fornelio et al., 2003; Gomes et al., 2013; Ribeiro et al., 2013; Silva et al.,

4
2010; Simões et al., 2011; Vilhena et al., 2013; Yisaschar-Mekuzas et al., 2013) and

wildlife (Cardoso et al., 2013; Pereira et al., 2016a). Furthermore, Ba. vogeli was

detected in Rh. sanguineus s.l. (Maia et al., 2014a) and T. annulata and T. equi in Rh.

bursa (Ferrolho et al., 2016).

The majority of TBD are zoonoses, and domestic as well as wildlife act as reservoir

hosts, amplifying hosts or sentinels for human infections (Dantas-Torres et al., 2012).

For these reasons, the detection of pathogens in ticks collected from animals is crucial

to predict their emergence and spread, in view of protecting humans and the animals.

Therefore, the aim of this work was to screen the presence of bacteria and protozoa in

ticks infesting domestic animals and wildlife, collected in eight districts from central

and southern Portugal.

Material and methods

From December 2013 to September 2015, ticks were collected directly from domestic

animals and wildlife, as well as from a number of resident and migratory birds (Table

1). Collection was done by convenience sampling (i.e. collections were carried out from

farmed animals, animals attending veterinarian clinics and from wildlife in a

rehabilitation center to which the collectors were granted access to) in eight districts

from central and southern Portugal. These included Castelo Branco (39° 48' 42.744" N,

7° 36' 11.354" W), Santarém (39° 19' 59.320" N, 8° 54' 20.421" W), Lisboa (38° 44'

37.463" N, 9° 13' 48.878" W), Setúbal (38° 17' 49.645" N, 9° 15' 24.456" W),

Portalegre (39° 17' 20.407" N, 7° 28' 4.855" W), Évora (38° 34' 11.761" N, 7° 58'

51.778" W), Beja (38° 1' 20.892" N, 7° 57' 31.202" W) and Faro (37° 1' 4.518" N, 7°

58' 29.704" W). All the animals were alive at the time ticks were collected from them,

which was carried out in compliance with the Portuguese legislation for the protection

5
of animals (Decree-Law no. 113/2013). Most tick specimens were kept alive at 4 ºC

until they were identified (Pereira et al., 2016b). In those situations where immediate

transport to the laboratory could not be guaranteed, the collected specimens were kept at

4 ºC in RNAlater® (Ambion, EUA). The identification of ticks to the species level was

carried out using taxonomic keys (Estrada-Peña et al., 2004; Pérez-Eid, 2006); their

development stage and gender were also recorded. All the tick specimens were then

stored at -80 ºC until further use.

DNA extraction

Tick homogenates were prepared from either (i) engorged female ticks (starting from

half a specimen that had been longitudinally dissected with sterile forceps and surgical

blades), (ii) non-engorged adults, or (iii) pools of up to 4 nymphs and larvae (grouped

according to species, development stage, gender, host and geographic origin). Their

preparation was carried out by mechanical disruption directly in 1 ml of NZYol®

(Nzytech, Portugal) following the manufacturer’s instructions. The DNA was dissolved

in nuclease-free water, quantified in a Nanodrop® 1000 (Thermo Scientific, EUA), and

stored at -20 ºC until further use.

PCR amplification

Detection of Anaplasma/Ehrlichia spp., A. centrale/A. marginale/A. ovis, A.

phagocytophilum, Babesia/Theileria spp., Bo. burgdorferi s.l., relapsing fever Borrelia,

and Rickettsia spp. DNA in tick homogenates was carried out by either conventional or

nested PCR PCR, using previously described primers and reaction conditions (Table 2).

6
PCR amplifications were performed in a final volume of 25 μl using NZYTaq 2x Green

Master Mix (Nzytech, Portugal), 2.5-5 μl of each DNA extract, and a variable

concentration of each primer (ranging from 2 to 20 μM). In all amplification series,

positive (containing genomic DNA of the targeted microorganism, i.e. A. marginale,

Ba. canis, Bo. duttoni, Ri. conorii) and negative (without DNA) controls, were included.

PCR amplifications were carried out in a Thermo Electron Corporation® Px2 Thermal

Cycler (VWR, USA), and the obtained PCR products visualized under UV illumination

after electrophoresis on 1.5% agarose gels stained with Greensafe premium® (Nzytech,

Portugal). A 100 bp DNA ladder was used as a molecular-weight size marker (Nzytech,

Portugal).

PCR products were purified from agarose gel slices with NZYGelpure® (Nzytech,

Portugal), and subsequently sequenced (LIGHTrun™ Sequencing Service, GATC-

biotech, Germany) with the same primers used for DNA amplification.

DNA sequence analyses

Species identity (bacteria and protozoa) was tentatively assessed by analyses of the

obtained nucleotide sequences on the basis of the closest BLASTn match (identity ≥

98% using MegaBLAST and considering a query cover no smaller than 96%) with

homologous sequences deposited at GenBank.

Phylogenetic relationships were inferred from nucleotide sequence alignments produced

with MAFFT v.7 using the G-INS-i iterative alignment option (Katoh and Standley,

2013). Phylogenetic tree construction was carried out using a Maximum Likelihood

(ML) approach and the Kimura’s 2-P (K2P) evolutionary model, assuming  distributed

substitution rates among sites, as indicated by Mega v.6.0 (Tamura et al., 2013) on the

basis of the Akaike information criterion. Alternatively, an empirically defined model

7
(GTR++I) was also used. The topological robustness of the obtained trees was

assessed by bootstrapping, using 1000 resampling of the original alignment data. The

final trees were manipulated for display using FigTree v.1.2.2. (available at

http://tree.bio.ed.ac.uk/software/figtree/).

The representative sequences obtained in the course of this work were deposited at

DNA Data Bank of Japan (DDBJ) (http://www.DDBJ.nig.ac.jp) under accession

numbers LC229317 to LC229346 and LC229594 to LC229643.

Absolute and relative frequencies of bacteria and/or protozoa DNA detected in

ticks The calculation of the absolute [number of ticks where the DNA of each bacteria

or protozoa (or both) was detected] and relative [number of ticks where the DNA of

each bacteria or protozoa (or both) was detected/total number of ticks analysed]

frequencies was performed with Microsoft® Office Excel 2013.

Results

A total of 593 ticks from five genera, comprising 465 (78.4%) adults (276 males and

189 females), 122 (20.6%) nymphs, and six (1.0%) larvae (Table 3), were collected

from 283 hosts of 25 different species (4 domestic and 21 wildlife; Table 1). All the

immature stages were collected from wildlife.

Among the ticks analysed, 19.1% (113/563) were found to be infected with either

bacteria and/or protozoa, as disclosed by the detection of either bacteria or protozoa

DNA in 103 of them (mono-infected) while 10 carried DNA from two microorganisms

(double-infections; Table 4).

8
Using a set of general primers that targeted the 16S rDNA Anaplasma spp. DNA was

detected in 40 ticks (6.7%) corresponding to 37 Rh. sanguineus s.l., two Hy.

marginatum and one Rh. bursa.

Thirty-five sequences obtained from Rh. sanguineus s.l. and Rh. bursa, collected from

domestic animals from the Beja district, showed 99%-100% identity with A. centrale

described in Rh. microplus from the Philippines (Ybañez et al., 2013) with A. marginale

described in cattle (and with A. ovis described in sheep and goats from Italy (Zobba et

al., 2014). Furthermore, two sequences obtained from Hy. marginatum and one from

Rh. sanguineus s.l. were found to be 100% identical to that amplified from a putative

novel species of Anaplasma detected in Hy. asiaticum from China (Kang et al., 2014).

Sequencing of the msp4 coding sequences amplified from the samples where the

presence of A. centrale/A. marginale/A. ovis 16S rDNA had been previously detected,

confirmed the presence of A. ovis in six Rh. sanguineus s.l. The phylogenetic analysis of

the obtained msp4 sequences, along with related sequences obtained from GenBank,

corroborated the BLAST identification (supplementary Fig. 1). Unfortunately, attempts

to amplify msp4 sequences from the other 29 DNA extracts failed.

Among the samples where Anaplasma sp. DNA had been detected (using 16S rDNA-

specific primers) it was possible to obtain one groEL sequence, which was amplified

from one Rh. sanguineus s.l. collected from a sheep. Its analysis revealed 82% identity

with homologous Anaplasma sp. sequences (Kang et al., 2014) available in the public

genomic databases. However, when their evolutionary relationships were inferred

through phylogenetic reconstruction using the maximum likelihood optimization

criterion, these could not be clearly elucidated (Fig. 1). In fact, the obtained sequence

was not included in any monophyletic group, and even its suggested topological

association to the sequence identified as Anaplasma sp. found in Hy. asiaticum

9
collected from the vegetation in the Xinjiang region in China, was not supported by a

significant bootstrap value.

Using 16S rDNA primers Ehrlichia spp. DNA was detected in 6 (1.0%) Hy.

marginatum, all collected from cattle from the Beja district. The analysis of the

sequences obtained showed 100% identity with those previously described in Hy.

asiaticum from China (Zobba et al., 2014), and corresponding to a putative novel

species of Ehrlichia . Unfortunately, phylogenetic reconstruction based on alignments

of the obtained sequences did not reveal the segregation of these sequences into species-

defining monophyletic clusters. Altough amplification of groEL sequences failed from

the six DNA extracts, this was not determined by DNA quality/presence of inhibitors in

the extracts used, as other DNA amplifications (gltA and ompB) proved successful.

DNA of Borrelia spp. was detected in two Rh. sanguineus s.l. collected from sheep

from the Beja district by two nested-PCR protocols targeting flaB and glpQ. The

unambiguous identity of the amplified DNA fragments was assessed by BLASTn

homology searches. These revealed > 99% identity with RF-like Borrelia sp. previously

detected in Rh. sanguineus s.l. from Portugal (Nunes et al., 2016). Further

characterization of these sequences was conducted on the basis of phylogenetic analyses

that also included many other references directly downloaded from the public databases

(accession numbers displayed in supplementary Fig. 2a and 2b). Both sequences were

found to segregate in a topologically stable monophyletic cluster characterized as

Borrelia sp..

Rickettsia spp. DNA was found in 71 (12.0%) ticks (29 Hy. marginatum, 29 Rh.

sanguineus s.l., 10 D. marginatus, two Rh. bursa and one Hy. lusitanicum) using

primers targeting the gltA gene. Blast analysis showed that gltA sequences obtained

from Rh. sanguineus s.l. (n=13), Rh. bursa (n=1), Hy. marginatum (n=6), D. marginatus

10
(n=5), and Hy. lusitanicum (n=1) presented 99-100% identity with Ri. massiliae (Castro

et al., 2015), Ri. raoultii (Fernández de Mera et al., 2013), Ri. slovaca (Vitorino et al.,

2007) and Ri. helvetica (Hodžić et al., 2016). Sequencing of the ompB gene partially

amplified from the samples where it was not possible to obtain an unambiguous

identification of Rickettsia species on the basis of gltA sequence analysis, confirmed the

presence of Ri. aeschlimannii in Hy. marginatum (n=15) and D. marginatus (n=1), and

Ri. massiliae (n=10) and Candidatus Ri. barbariae (n=1) in Rh. sanguineus s.l. The

obtained sequences were also aligned with homologous references from a broad range

of Rickettsia species (downloaded from the public databases), and their phylogenetic

relationships were inferred, revealing their segregation within Ri. aeschlimannii, Ri.

massiliae and Candidatus Ri. barbariae clades (supplementary Fig. 3). Amplification of

ompB failed from 18 samples. As mentioned above for groEL, this was not determined

by the DNA quality/presence of inhibitors, as other DNA amplifications were

successful.

Babesia sp. 18S rDNA was detected in one Rh. sanguineus s primers targeting. This

sequence showed 92% identity with Babesia sp. described in a pig from Italy (Zobba et

al., 2011). When its evolutionary relationships were inferred through phylogenetic

reconstruction, it was found to be excluded from any of the bootstrap-supported

monophyletic groups, and even its suggested topological association to the sequence

identified as Babesia sp., was not consistent (i.e. supported by bootstrap analysis; Fig.

2).

Using the primers targeting the piroplasmid 18S rDNA, Theileria spp. DNA was

amplified in three (0.5%) ticks (two Rh. sanguineus s.l. and one Rh. bursa) collected

from one dog, one sheep and one cow from the Beja district. Nucleotide sequences

amplified from the three ticks revealed 100% identity with sequences deposited in the

11
databases, and identified as T. ovis (detected in sheep from China) and as T. annulata

(detected in cattle from India). The phylogenetic analysis of the obtained sequences

placed them in two stable monophyletic clusters (supported by high bootstrap values)

along with related sequences downloaded from public databases (supplementary Fig. 4).

Finally, Anaplasma sp./Ri. massiliae and Anaplasma sp./T. ovis co-infections were

found in four and two Rh. sanguineus s.l., respectively. Co-infection with A. ovis/Ri.

massiliae was also detected in two Rh. sanguineus s.l.. In addition, two Hy. marginatum

were also found to be co-infected with Ehrlichia sp. and Ri. aeschlimannii or with

Ehrlichia sp. and Rickettsia sp.

Discussion

In the last years, several tick-borne agents that were considered non-pathogenic, have

now been associated with symptomatic human infections, while novel species of

bacteria and protozoa (not to mention viruses) of undetermined pathogenicity continue

to be detected in ticks worldwide (Parola et al., 2013; Vayssier-Taussat et al., 2013).

The present study reveals a considerable diversity of bacteria and protozoa, some of

which of veterinary and zoonotic importance, circulating in between ticks collected

from domestic animals and wildlife from different districts distributed throughout

central and southern Portugal.

The detection of Anaplasma spp. DNA in the present study corroborates the circulation

in Portugal of these bacteria in ticks collected from domestic animals and wildlife

(Ferrolho et al., 2016; Maia et al., 2014a; Renneker et al., 2013). Therefore, it was not

entirely surprising to confirm the presence of A. ovis in Rh. sanguineus s.l. collected

from sheep, as it had been previously reported in sheep (Renneker et al., 2013) and in

cervids (Pereira et al., 2016a). Infection with this bacterium is widespread in small and

12
wild ruminants, but due to their minor economic importance, few efforts to implement

suitable control measures have been made (Renneker et al., 2013). However, as a case

of human anaplasmosis due to A. ovis in a young adult from Cyprus has been reported

(Chochlakis et al., 2010), the zoonotic potential of this pathogen towards humans should

be clarified.

Up to date, E. canis is the only species of Ehrlichia identified in dogs (Alexandre et al.,

2009; Maia et al., 2015; Yisaschar-Mekuzas et al., 2013) and red foxes (Cardoso et al.,

2015) from Portugal. Surprisingly, in the present study Ehrlichia DNA obtained from

Hy. marginatum collected from cattle revealed 100% identity with a putative novel

species of Ehrlichia described in Hy. asiaticum from China (Kang et al., 2014).

Unfortunately, their analysis based on a high-resolution genetic marker (such as groEL)

failed repeatedly, most probably due to mismatched hybridization between the primers

used and their targets. Consequently, further work should be carried out to characterize

this putative novel Ehrlichia species genetically.

Despite the fact that species classified as belonging to the Bo. burgdorferi s.l. complex

have been detected in Portugal over the years (Collares-Pereira et al., 2004; Faria et al.,

2015; Maia et al., 2014a, 2014b, 2015; Nunes et al., 2016), their presence was not

revealed in the present study, most probably due to the low number of Ixodes ticks

analyzed (the main vector of these spirochetes in Europe). In addition, although all the

Ixodes ticks analysed have been classified as I. ricinus, at least some of them may

actually correspond to I. inopinatus, as both species were recently reported as occurring

allopatrically in south-western Portugal (Estrada-Peña et al., 2014), and their

morphological distinction is difficult to establish. In the present study, the phylogenetic

analysis of Borrelia flaB and glpQ sequences, obtained from Rh. sanguineus s.l.

collected from sheep, placed them in a stable monophyletic group that included

13
exclusively Borrelia sp. previously identified by Nunes et al. (2016) in Rh. sanguineus

s.l. questing ticks. The obtained data reinforces the apparent circulation in Portugal of

novel RF-like Borrelia in hard ticks. Therefore, future work must be carried out to

characterize (both genetically and phenotypically) these new RF bacteria, including

assessment of their putative pathogenicity for vertebrates.

In light of current knowledge, most of the agents of spotted fever group are regarded as

potentially zoonotic (Parola et al., 2013). In the present study, Ri. massiliae was

detected in Rh. sanguineus s.l., and for the first time in Rh. bursa, corroborating

previous data obtained in Portugal (Lopes de Carvalho et al., 2008; Maia et al., 2014a)

and Spain (Toledo et al., 2009). Although Ri. aeschlimannii has been associated with

MSF-like disease in Africa, the first human autochthonous case has recently been

reported in Europe (Germanakis et al., 2013). Ri. aeschlimannii is frequently found in

Hy. marginatum (as in the present study) as well as in other Hyalomma spp. which seem

to be responsible for the natural maintenance of this bacterium (Portillo et al., 2015;

Santos-Silva et al., 2006). Curiously, Ri. aeschlimannii was also detected in D.

marginatus but further work must be performed to unravel the potential role played by

these ticks as alternative vectors for this pathogen. In the same line of reasoning, the

unusual detection of Ri. raoultii and Ri. helvetica in Hy. marginatum suggests an

involvement of different tick genera in their natural maintenance (Chisu et al., 2015;

Guo et al., 2015; Santibáñez et al., 2015). Further, the detection of Ri. helvetica in D.

marginatus collected from wild boar also reinforces the idea that these wild ungulates

might maintain the pathogen in nature (Ortuño et al., 2007). The continuous detection of

Ri. slovaca in D. marginatus (Bacellar et al., 1995; Instituto Nacional de Saúde Doutor

Ricardo Jorge, 2014, 2015; Milhano et al., 2010), together with the report of

autochthonous human cases (de Sousa et al., 2013), highlights the need to implement

14
measures to control vectors and possible reservoir hosts of Rickettsiae. Candidatus Ri.

barbariae is a presumed new species of the genus Rickettsia described by Mura et al.

(2008) in Rh. turanicus from Italy. This bacterium was previously detected in Rh. bursa

from Portugal, and designated, at the time, Rickettsia sp. PoTiRb169 (de Sousa et al.,

2006). The detection in the present study of Candidatus Ri. barbariae in Rh. sanguineus

s.l. reinforces its presence in Portugal, and points towards the possible role played by

Rhipicephalus ticks in the natural maintenance of this bacterium.

Several Theileria and Babesia species have been reported in domestic animals (Cardoso

et al., 2010; Gomes et al., 2013; Ribeiro et al., 2013; Vilhena et al., 2013) and wildlife

(Cardoso et al., 2013; Pereira et al., 2016a) from Portugal, and B. divergens also

associated with a fatal human case (Centeno-Lima et al., 2003). However, and to the

best of our knowledge, only two studies evaluated the presence of these protozoa in

ticks (Ferrolho et al., 2016; Maia et al., 2014). In the present study, a 18S rDNA

sequence identified as Babesia sp. was amplified from one Rh. sanguineus s.l., and its

analysis revealed common ancestry with that found in a putative new species described

in a pig from Italy. The later exhibited clinical signs compatible with babesiosis (Zobba

et al., 2011). Once again, a thorough genetic/phenotypic characterization as well as the

assessment of impact of these parasites on animal health is justified.

Another interesting result from this study regards the first record of T. ovis in ticks. This

protozoan is associated with the benign theileriosis of the small ruminants (Shayan et

al., 2016). Despite the fact that Rh. bursa is usually regarded as the vector of T. ovis in

the Mediterranean basin (Ferrer and Castella, 1999), its detection in Rh. sanguineus s.l.

collected from a sheep (as well as in the shepherd dog used to herd the sheep flock in

question) points towards the existence of alternative vectors for this protozoa.

Additionally, T. ovis was also recently detected in blood samples collected from

15
shepherd dogs in Iran (Gholami et al., 2016), further strengthening the need to evaluate

the epidemiological associations between T. ovis, Rh. sanguineus s.l., dogs, and small

ruminants. Finally, tropical theileriosis, caused by T. annulata, is an endemic infection

of Portuguese cattle with a national prevalence of 21.3% (Gomes et al., 2013).

Hyalomma ticks are regarded as the main vector of T. annulata (Tait and Hall, 1990),

but the results here obtained (i.e. detection of the protozoan in Rh. bursa), corroborate

the hypothesis suggested by Ferrolho et al. (2016), that Rh. bursa may also be

associated with the transmission of the pathogen.

Ticks co-infections, and the consequent possible co-transmission of pathogens to

vertebrates, might have important implications for animal and public health (Moutailler

et al., 2016). As in Portugal, ticks, domestic animals and wildlife have been found

infected by multiple pathogens (Gomes et al., 2013; Maia et al., 2014a; 2014b; 2015;

Milhano et al., 2010; Pereira et al., 2016a), the detection of tick co-infections (as

revealed by amplification of DNA from multiple origins) was not surprising. The co-

transmission of different combinations of pathogens to vertebrates may lead to an

increase of the severity of the observed clinical signs, and/or the development of non-

characteristic clinical outcomes which may complicate the diagnosis, treatment and

prognosis of these infections (Diuk-Wasser et al., 2016; Maia et al., 2014b; Moutailler

et al., 2016), with potential significant economic repercussions for the cattle industry

(Chen et al., 2014), and profound consequences for disease management programs and

wildlife conservation (Pereira et al., 2016a).

Conclusions

The present study reinforces the existence of a wide variety of bacteria and protozoa,

some of which with zoonotic potential, circulating in ticks collected in central and

16
southern Portugal. The epidemiological significance of detecting DNA of pathogens in

ticks should be carefully considered. On one hand, this may suggest that the ticks in

question play a putative role in the transmission of a given agent, on the other hand, the

detection of the DNA may only indicate an exposure of the arthropod to it. Therefore,

competence studies for each pathogen-tick pair should be experimentally clarified. The

obtained data emphasize the need to better characterize (both genetically and

phenotypically) the putative novel agents as probable new infectious agents with

pathogenic potential for vertebrates. Finally, and as the conventional amplification-

based assays only detect a restricted number of targeted pathogens known to be

transmitted by specific species of ticks, new genetic tools and sequencing platforms

should be used for the detection, and characterization, of microbial DNA sequences.

Without the need for any a priori knowledge of which particular microorganisms are

circulating within a given study area, this approach will boost surveillance efforts and

support the implementation of effective control strategies for the management of ticks

and human and animal tick-borne pathogens.

Competing interests

The authors declare that they have no competing interests.

Acknowledgements

We are deeply thankful to the wild boar and deer hunters, administrators of Federação

de Caçadores do Algarve, Clube de Caçadores e Pescadores de Tavira, and to Centro de

Recuperação e Investigação de Animais Selvagens (RIAS) for allowing and/or for

actively collaborating in the collection of ticks. This work was partially supported by

Funds to GHTM (UID/Multi/04413/2013). AP and MN have the support of the

Portuguese Ministry of Education and Science (via Fundação para a Ciência e a

17
Tecnologia), through PhD grant SFRH/BD/116516/2016 and SFRH/BD/78325/2011,

respectively and CM through an Investigator Starting Grant IF/01302/2015. The work

of C. Maia was done under the frame of EurNegVec COST Action TD1303.

18
References

Alexandre, N., Santos, A., Núncio, M., Sousa, R., Boinas, F., Bacellar, F., 2009.

Detection of Ehrlichia canis by polymerase chain reaction in dogs from Portugal. Vet.

J. 181, 343-344.

Bacellar, F., Regnery, R.L., Núncio, M.S., Filipe, A.R., 1995. Genotypic evaluation of

rickettsial isolates recovered from various species of ticks in Portugal. Epidemiol.

Infect. 114, 169-178.

Baptista, S., Quaresma, A., Aires, T., Kurtenbach, K., Santos-Reis, M., Nicholson, M.,

Collares-Pereira, M., 2004. Lyme borreliosis spirochetes in questing ticks from

mainland Portugal. Int. J. Med. Microbiol. 293, 109-116.

Barber, R.M., Li, Q., Diniz, P.P., Porter, B.F., Breitschwerdt, E.B., Claiborne, M.K.,

Birkenheur, A.J., Levine, J.M., Chandler, K., Kenny, P., Nghiem, P., Wei, S., Greene,

C.E., Kent, M., Platt, S.R., Greer, K., Schatzberg, S.J., 2010. Evaluation of brain tissue

or cerebrospinal fluid with broadly reactive polymerase chain reaction for Ehrlichia,

Anaplasma, spotted fever group Rickettsia, Bartonella, and Borrelia species in canine

neurological diseases (109 cases). J. Vet. Intern. Med. 24, 372-378.

Cardoso, L., Yisaschar-Mekuzas, Y., Rodrigues, F.T., Costa, A., Machado, J., Diz-

Lopes, D., Baneth, G., 2010. Canine babesiosis in northern Portugal and molecular

characterization of vector-borne co-infections. Parasit. Vectors. 3, 27.

Cardoso, L., Mendão, C., Madeira de Carvalho, L., 2012. Prevalence of Dirofilaria

immitis, Ehrlichia canis, Borrelia burgdorferi sensu lato, Anaplasma spp. and

Leishmania infantum in apparently healthy and CVBD-suspect dogs in Portugal - a

national serological study. Parasit. Vectors. 5, 62.

19
Cardoso, L., Cortes, H.C., Reis, A., Rodrigues, P., Simões, M., Lopes, A.P., Vila-

Voçosa, M.J., Talmi-Frank, D., Eyal, O., Solano-Gallego, L., Baneth, G., 2013.

Prevalence of Babesia microti-like infection in red foxes (Vulpes vulpes) from Portugal.

Vet. Parasitol. 196, 90-95.

Cardoso, L., Gilad, M., Cortes, H.C., Nachum-Biala, Y., Lopes, A.P., Vila-Viçosa,

M.J., Simões, M., Rodrigues, P.A., Baneth, G., 2015. First report of Anaplasma platys

infection in red foxes (Vulpes vulpes) and molecular detection of Ehrlichia canis and

Leishmania infantum in foxes from Portugal. Parasit. Vectors. 8,144.

Castro, L.R., Gabrielli, S., Iori, A., Cancrini, G., 2015. Molecular detection of

Rickettsia, Borrelia, and Babesia species in Ixodes ricinus sampled in northeastern,

central, and insular areas of Italy. Exp. Appl. Acarol. 66, 443-452.

Centeno-Lima, S., do Rosário, V., Parreira, R., Maia, A. J., Freudenthal, A.M., Nijhof,

A.M., Jongejan, F., 2003. A fatal case of human babesiosis in Portugal: molecular and

phylogenetic analysis. Trop. Med. Int. Health. 8, 760-764.

Chen, Z., Liu, Q., Liu, J. Q., Xu, B. L., Lv, S., Xia, S., Zhou, X.N., 2014. Tick-borne

pathogens and associated co-infections in ticks collected from domestic animals in

central China. Parasit. Vectors. 7, 237.

Chisu, V., Foxi, C., Zobba, R., Sotgiu, F., Alberti, A., Masala, G. 2015. First

identification of Rickettsia helvetica detected from Hyalomma marginatum ticks in

Sardinia, Italy, in: Abstract book – International congress on Rickettsia and other

intracellular bacteria, Switzerland: ESCCAR, p. 146.

Chochlakis, D., Ioannou, I., Tselentis, Y., Psaroulaki, A., 2010. Human anaplasmosis

and Anaplasma ovis variant. Emerg. Infect. Dis.16, 1031-1032.

20
Collares-Pereira, M., Couceiro, S., Franca, I., Kurtenbach, K., Schäfer, S. M., Vitorino,

L., Gonçalves, L., Baptista, S., Vieira, M.L., Cunha, C., 2004. First isolation of Borrelia

lusitaniae from a human patient. J. Clin. Microbiol. 42, 1316-1318.

Criado-Fornelio, A., Martinez-Marcos, A., Buling-Saraña, A., Barba-Carretero, J.C.,

2003. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and

piroplasmids in cats from southern Europe: A molecular study. Vet. Microbiol. 93, 307-

317.

Dantas-Torres, F., Chomel, B.B., Otranto, D., 2012. Ticks and tick-borne diseases: a

One Health perspective. Trends Parasitol. 28, 437-446.

de la Fuente, J., Van Den Bussche, R.A., Prado, T.M., Kocan, K.M., 2003. Anaplasma

marginale msp1α genotypes evolved under positive selection pressure but are not

markers for geographic isolates. J. Clin. Microbiol. 41, 1609-1616.

de la Fuente, J., Massung, R.F., Wong, S.J., Chu, F.K., Lutz, H., Meli, M., von

Loewenich, F.D., Grzeszczuk, A., Torina, A., Caracappa, S., Mangold, A.J., Naranjo,

V., Stuen, S., Kocan K.M., 2005. Sequence analysis of the msp4 gene of Anaplasma

phagocytophilum strains. J. Clin. Microbiol, 43, 1309-1317.

de Sousa, R., Nóbrega, S. D., Bacellar, F., Torgal, J., 2003. Mediterranean spotted fever

in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann. N. Y. Acad.

Sci. 990, 285-294.

de Sousa, R., Barata, C., Vitorino, L., Santos-Silva, M., Carrapato, C., Torgal, J.,

Walker, D., Bacellar, F., 2006. Rickettsia sibirica isolation from a patient and detection

in ticks, Portugal. Emerg. Infect. Dis. 12, 1103-1108.

de Sousa, R., Lopes de Carvalho, I., Santos, A.S., Bernardes, C., Milhano, N., Jesus, J.,

Menezes, D., Núncio, M.S., 2012. Role of the lizard Teira dugesii as a potential host for

Ixodes ricinus tick-borne pathogens. Appl. Environ. Microbiol. 78, 3767-3769.

21
de Sousa, R., Pereira, B.I., Nazareth, C., Cabral, S., Ventura, C., Crespo, P., Marques,

N., da Cunha, S., 2013. Rickettsia slovaca infection in humans, Portugal. Emerg. Infect.

Dis. 19, 1627-1629.

Diuk-Wasser, M.A., Vannier, E., Krause, P.J., 2016. Coinfection by Ixodes tick-borne

pathogens: ecological, epidemiological, and clinical consequences. Trends Parasitol. 32,

30-42.

Doudier, B., Olano, J., Parola, P., Brouqui, P., 2010. Factors contributing to emergence

of Ehrlichia and Anaplasma spp. as human pathogens. Vet. Parasitol. 167, 149-154.

Estrada-Peña, A., Bouattour, A., Camicas, J.L., Walker, A.R., 2004. Ticks of domestic

animals in the mediterranean region: a guide to identification of species. Zaragoza:

Universidade de Zaragoza.

Estrada-Peña, A., Nava, S., Petney, T., 2014. Description of all the stages of Ixodes

inopinatus n. sp. (Acari: Ixodidae). Ticks Tick. Borne. Dis. 5, 734-743.

Faria, A.S., Paiva-Cardoso, M.D., Nunes, M., Carreira, T., Vale-Gonçalves, H.M.,

Veloso, O., Coelho, C., Cabral, J.A., Vieira-Pinto, M., Vieira M.L., 2015. First

Detection of Borrelia burgdorferi sensu lato DNA in serum of the wild boar (Sus

scrofa) in Northern Portugal by nested-PCR. Ecohealth, 12, 183-187.

Fernández de Mera, I.G., Ruiz-Fons, F., de la Fuente, G., Mangold, A.J., Gortázar, C.,

de la Fuente, J., 2013. Spotted fever group rickettsiae in questing ticks, central Spain.

Emerg. Infect. Dis. 19, 1163-1167.

Ferrer, D., Castella, J., 1999. Seroprevalence of Theileria ovis in small ruminants in

north-east Spain determined by the indirect fluorescent antibody test. Vet. Rec. 145,

346-347.

Ferrolho, J., Antunes, S., Santos, A.S., Velez, R., Padre, L., Cabezas-Cruz, A., Santos-

Silva, M.M., Domingos, A., 2016. Detection and phylogenetic characterization of

22
Theileria spp. and Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks

Tick. Borne. Dis. 7, 443-448.

Germanakis, A., Chochlakis, D., Angelakis, E., Tselentis, Y., Psaroulaki A., 2013.

Rickettsia aeschlimannii infection in a man, Greece. Emerg. Infect. Dis., 19, 1176-1177.

Gholami, S., Laktarashi, B., Shiadeh, M.M., Spotin, A., 2016. Genetic variability,

phylogenetic evaluation and first global report of Theileria luwenshuni, T. buffeli, and

T. ovis in sheepdogs in Iran. Parasitol. Res. 115, 2125-2130.

Gomes, J., Rebêlo, E., 2008. Seroprevalência da anaplasmose bovina em Portugal, in:

Abstract book – IV Veterinary Sciences Congress, Portugal: Portuguese Society of

Veterinary Sciences, p. 211.

Gomes, J., Soares, R., Santos, M., Santos-Gomes, G., Botelho, A., Amaro, A., Inácio,

J., 2013. Detection of Theileria and Babesia infections amongst asymptomatic cattle in

Portugal. Ticks Tick. Borne. Dis. 4, 148-151.

Guo, L.P., Mu, L.M., Xu, J., Jiang, S.H., Wang, A.D., Chen, C.F., Guo, G., Zhang,

W.J., Wang, Y.Z., 2015. Rickettsia raoultii in Haemaphysalis erinacei from marbled

polecats, China-Kazakhstan border. Parasit. Vectors. 8, 461.

Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Eyal, O., Baneth, G.,

2011. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys,

Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel.

Clin. Microbiol. Infect. 17, 459-463.

Häselbarth, K., Tenter, A., Brade, V., Krieger, G., Hunfeld, K., 2007. First case of

human babesiosis in Germany - clinical presentation and molecular characterization of

the pathogen. Int. J. Med. Microbiol. 297, 197-204.

23
Hodžić, A., Fuehrer, H.P., Duscher, G.G., 2016. First molecular evidence of zoonotic

bacteria in ticks in Bosnia and Herzegovina. Transbound. Emerg. Dis. doi:

10.1111/tbed.12473.

Instituto Nacional de Saúde Doutor Ricardo Jorge, 2014. Relatório REVIVE 2013 –

Culicídeos e Ixodídeos: Rede de Vigilância de Vetores.

http://repositorio.insa.pt/bitstream/10400.18/2233/1/Relatorio_REVIVE_2013.pdf

(accessed 10.12.16).

Instituto Nacional de Saúde Doutor Ricardo Jorge. Relatório, 2015. REVIVE 2014 –

Culicídeos e Ixodídeos: Rede de Vigilância de Vetores.

http://repositorio.insa.pt/bitstream/10400.18/3026/3/INSA_Relatorio-

REVIVE_2014.pdf (accessed 10.12.16).

Kang, Y.J., Diao, X.N., Zhao, G.Y., Chen, M.H., Xiong, Y., Shi, M., Fu, W.M., Zhang,

Y.Z., 2014. Extensive diversity of Rickettsiales bacteria in two species of ticks from

China and the evolution of the Rickettsiales. BMC Evol. Biol. 14, 167.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software

version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772-780.

Lopes de Carvalho, I., Milhano, N., Santos, A., Almeida, V., Barros, S., Sousa, R.,

Núncio, M.S., 2008. Detection of Borrelia lusitaniae, Rickettsia sp. IRS3, Rickettsia

monacensis, and Anaplasma phagocytophilum in Ixodes ricinus collected in Madeira

Island, Portugal. Vector Borne Zoonotic Dis. 8, 575-579.

Maia, C., Ferreira, A., Nunes, M., Vieira, M. L., Campino, L., Cardoso, L., 2014a.

Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal.

Ticks Tick. Borne. Dis., 5, 409-414.

Maia, C., Ramos, C., Coimbra, M., Bastos, F., Martins, A., Pinto, P., Nunes, M., Vieira,

M.L., Cardoso, L., Campino, L., 2014b. Bacterial and protozoal agents of feline vector-

24
borne diseases in domestic and stray cats from southern Portugal. Parasit. Vectors. 7,

115.

Maia, C., Almeida, B., Coimbra, M., Fernandes, M.C., Cristóvão, J.M., Ramos, C.,

Martins, Â., Martinho, F., Silva, P., Neves, N., Nunes, M., Vieira, M.L., Cardoso, L.,

Campino, L., 2015. Bacterial and protozoal agents of canine vector-borne diseases in

the blood of domestic and stray dogs from southern Portugal. Parasit. Vectors. 8, 759.

Martinot, M., Zadeh, M.M., Hansmann, Y., Grawey, I., Christmann, D., Aguillon, S.,

Jouqlin, M., Chauvin, A., De Briel, D., 2011. Babesiosis in immunocompetent patients,

Europe. Emerg. Infect. Dis. 17, 114-116.

Milhano, N., de Carvalho, I.L., Alves, A.S., Arroube, S., Soares, J., Rodriguez, P.,

Carolino, M., Núncio, M.S., Piesman, J., de Sousa, R., 2010. Coinfections of Rickettsia

slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari

Park, Portugal. Ticks Tick. Borne. Dis. 1, 172-177.

Moutailler, S., Valiente Moro, C., Vaumourin, E., Michelet, L., Tran, F.H., Devillers,

E., Cosson, J.F., Gasqui, P., Van, V.T., Mavinqui, P., Vourc’h, G., Vayssier-Taussat,

M., 2016. Co-infection of ticks: the rule rather than the exception. PLoS Negl. Trop.

Dis. 10, e0004539.

Mura, A., Masala, G., Tola, S., Satta, G., Fois, F., Piras, P., Rolain, J.M., Raoult, D.,

Parola, P., 2008. First direct detection of rickettsial pathogens and a new rickettsia,

“Candidatus Rickettsia barbariae”, in ticks from Sardinia, Italy. Clin. Microbiol. Infect.

14, 1028-1033.

Norte, A.C., Lopes de Carvalho, I., Núncio, M. S., Ramos, J.A., Gern, L., 2013.

Blackbirds Turdus merula as competent reservoirs for Borrelia turdi and Borrelia

valaisiana in Portugal: evidence from a xenodiagnostic experiment. Environ. Microbiol.

Rep. 5, 604-607.

25
Nunes, M., Parreira, R., Lopes, N., Maia, C., Carreira, T., Sousa, C., Vieira, M.L., 2015.

Molecular Identification of Borrelia miyamotoi in Ixodes ricinus from Portugal. Vector

Borne Zoonotic Dis. 15, 515-517.

Nunes M., 2016. Unraveling of Borrelia burgdorferi sensu lato genospecies diversity in

Portugal towards the development of more efficient diagnostic tools for Lyme disease.

PhD thesis in biomedical sciences, Instituto de Higiene e Medicina Tropical,

Universidade Nova de Lisboa, pp. 300.

Nunes, M., Parreira, R., Maia, C., Lopes, N., Fingerle, V., Vieira, M.L., 2016.

Molecular identification of Borrelia genus in questing hard ticks from Portugal:

Phylogenetic characterization of two novel Relapsing Fever-like Borrelia sp.. Infect.

Genet. Evol. 40, 266-274.

Ortuño, A., Quesada, M., López-Claessens, S., Castellà, J., Sanfeliu, I., Antón, E.,

Segura-Porta, F., 2007. The role of wild boar (Sus scrofa) in the eco-epidemiology of R.

slovaca in Northeastern Spain. Vector Borne Zoonotic Dis. 7, 59-64.

Oteo, J. A., Portillo, A., 2012. Tick-borne rickettsioses in Europe. Ticks Tick Borne

Dis., 3, 271-278.

Parola, P., Paddock, C., Socolovschi, C., Labruna, M., Mediannikov, O., Kernif, T.,

Abdad, M.Y., Stenos, J., Bitam, I., Fornier, P.E., Raoult, D., 2013. Update on tick-borne

rickettsioses around the world: a geographic approach. Clin Microbiol Rev, 26, 657-

702.

Pereira, A., Parreira, R., Nunes, M., Casadinho, A., Vieira, M.L., Campino, L., Maia,

C., 2016a. Molecular detection of tick-borne bacteria and protozoa in cervids and wild

boars from Portugal. Parasit. Vectors, 9, 251.

Pereira, A., Figueira. L., Nunes, M., Esteve, A., Cotão, A. J., Maia, C., Campino, L.,

Parreira, R., 2016b. Multiple Phlebovirus (Bunyaviridae) genetic groups detected in

26
Rhipicephalus, Hyalomma and Dermacentor ticks from southern Portugal. Ticks Tick.

Borne. Dis. 8, 45-52.

Pérez-Eid, C., 2006. Les tiques: identification, biologie, importance médicale et

veterinaire. Paris: Lavoisier.

Portillo, A., Santibáñez, S., García-Álvarez, L., Palomar, A.M., Oteo, J.A., 2015.

Rickettsioses in Europe. Microbes Infect. 17, 834-838.

Rar, V., Golovljova, I., 2011. Anaplasma, Ehrlichia, and ‘Candidatus Neoehrlichia’

bacteria: pathogenicity, biodiversity, and molecular genetic characteristics, a review.

Infect. Genet. Evol. 11, 1842-1861.

Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of

rickettsiae and estimation of intraspecies sequence divergence for portions of two

rickettsial genes. J. Bacteriol. 173, 1576-1589.

Renneker, S., Abdo, J., Salih, D.E., Karagenç, T., Bilgiç, H., Torina, A., Oliver, A.G.,

Campos, J., Kullmann, B., Ahmed, J., Seitzer, U., 2013. Can Anaplasma ovis in small

ruminants be neglected any longer? Transbound. Emerg. Dis. 60, 105-112.

Ribeiro, A.J., Cardoso, L., Maia, J.M., Coutinho, T., Cotovio, M., 2013. Prevalence of

Theileria equi, Babesia caballi, and Anaplasma phagocytophilum in horses from the

north of Portugal. Parasitol. Res. 112, 2611-2617.

Rizzoli, A., Hauffe, H., Carpi, G., Vourc, H.G., Neteler, M., Rosa, R., 2011. Lyme

borreliosis in Europe. Euro Surveill. 16, 1-8.

Rocha, R., Lisboa, L., Neves, J., García López, M., Santos, E., Ribeiro, A., 2012.

Neuroborreliosis presenting as acute disseminated encephalomyelitis. Pediatr. Emerg.

Care. 28, 1374-1376.

27
Roux, V., Raoult, D., 2000. Phylogenetic analysis of members of the genus Rickettsia

using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol.

Microbiol. 50, 1449-1455.

Santibáñez, S., Portillo, A., Palomar, A.M., Bell-Sakyi, L., Romero, L., Oteo, J.A.,

2015. Isolation and maintenance of Rickettsia raoultii in a Rhipicephalus sanguineus

tick cell line. Microbes Infect. 17, 866-869.

Santos-Silva, M., Sousa, R., Santos, A.S., Lopes, D., Queijo, E., Doreta, A., Vitorino,

L., Bacellar, F., 2006. Ticks and tick-borne Rickettsiae surveillance in Montesinho

Natural Park, Portugal. Ann. N. Y. Acad. Sci. 1078, 137-142.

Santos-Silva, M.M., Beati, L., Santos, A.S., de Sousa, R., Núncio M.S., Melo P.,

Santos-Reis, M., Fonseca, C., Vilela, C., Bacellar, F., 2011. The hard-tick fauna of

mainland Portugal (Acari:Ixodidae): an update on geographical distribution and known

associations with hosts and pathogens. Exp. Appl. Acarol. 55, 85-121.

Santos-Silva, M.M., Melo, P., Santos, N., Antunes, S., Duarte, L.R., Ferrolho, J.,

Milhano, N., Santos, P.T., Domingos, A., Santos, A.S., 2016. PCR screening of tick-

borne agents in sensitive conservation areas, Southeast Portugal. Mol. Cell. Probes. doi:

10.1016/j.mcp.2016.11.005.

Schwartz, J. J, Gazumyan, A., Schwartz, I., 1992. rRNA gene organization in the Lyme

disease spirochete, Borrelia burgdorferi. J. Bacteriol. 174, 3757-3765.

Shayan, P., Jafari, S., Fattahi, R., Ebrahimzade, E., Amininia, N., Changizi, E., 2016.

Identification and characterization of Theileria ovis surface protein (ToSp) resembled

TaSp in Theileria annulata. Parasitol. Res. 115, 1893-1899.

Silva, M., Marques, P. X., Oliva, A., 2010. Detection of Babesia and Theileria species

infection in cattle from Portugal using a reverse line blotting method. Vet. Parasitol.

174, 199-205.

28
Silva, M., 2014. Carraças, in: Núncio, M., Alves, M. (Eds.), Doenças associadas a

artrópodes vetores e roedores. Lisboa: Instituto Nacional de Saúde Doutor Ricardo

Jorge, pp. 29-34.

Simões, P. B., Cardoso, L., Araújo, M., Yisaschar-Mekuzas, Y., Baneth, G., 2011.

Babesiosis due to the canine Babesia microti-like small piroplasm in dogs-first report

from Portugal and possible vertical transmission. Parasit. Vectors. 4, 50.

Tait, A., Hall, F.R., 1990. Theileria annulata: control measures, diagnosis and the

potential use of subunit vaccines. Rev. Sci. Tech. 9, 387-403.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6:

Molecular Evolutionary Genetics Analysis version 6.0. Mol. Bio. Evol. 30, 2725-2729.

Toledo, A., Olmeda, A.S., Escudero, R., Jado, I., Valcárcel, F., Casado-Nistal, M.A.,

Rodríguez-Vargas, M., Anda, P., 2009. Tick-borne zoonotic bacteria in ticks collected

from central Spain. Am. J. Trop. Med. Hyg. 81, 67-74.

Vayssier-Taussat, M., Moutailler, S., Michelet, L., Devillers, E., Bonnet, S., Cheval, J.,

Hébert, C., Eloit, M., 2013. Next generation sequencing uncovers unexpected bacterial

pathogens in ticks in western Europe. PLoS One. 8, e81439.

Vilhena, H., Martinez-Díaz, V.L., Cardoso, L., Vieira, L., Altet, L., Francino, O.,

Pastor, J., Silvestre-Ferreira, A.C., 2013. Feline vector-borne pathogens in the north and

centre of Portugal. Parasit. Vectors. 6, 99.

Vitorino, L., Chelo, I.M., Bacellar, F., Zé-Zé, L., 2007. Rickettsiae phylogeny: a

multigenic approach. Microbiology. 153, 160-168.

Wodecka, B., Leońska, A., Skotarczak, B., 2010. A comparative analysis of molecular

markers for the detection and identification of Borrelia spirochaetes in Ixodes ricinus. J.

Med. Microbiol. 59, 309-314.

29
Ybañez, A.P., Sivakumar, T., Ybañez, R.H., Ratilla, J.C., Perez, Z.O., Gabotero, S.R.,

Hakimi, H., Matsumoto, K., Yokoyama, N., Inokuma, H., 2013. First molecular

characterization of Anaplasma marginale in cattle and Rhipicephalus (Boophilus)

microplus ticks in Cebu, Philippines. J. Vet. Med. Sci. 75, 27-36.

Yisaschar-Mekuzas, Y., Jaffe, C. L., Pastor, J., Cardoso, L., Baneth, G., 2013.

Identification of Babesia species infecting dogs using reverse line blot hybridization for

six canine piroplasms, and evaluation of co-infection by other vector-borne pathogens.

Vet. Parasitol. 191, 367-373.

Zobba, R., Parpaglia, M.L., Spezzigu, A., Pittau, M., Alberti, A., 2011. First molecular

identification and phylogeny of a Babesia sp. from a symptomatic sow (Sus scrofa

Linnaeus 1758). J. Clin. Microbiol. 49, 2321-2324.

Zobba, R., Anfossi, A.G., Pinna Parpaglia, M.L., Dore, G.M., Chessa, B., Spezzigu, A.,

Rocca, S., Visco, S., Pittau, M., Alberti A., 2014. Molecular investigation and

phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of

neutrophil-tropic strains closely related to A. platys. Appl. Environ. Microbiol. 80, 271-

280.

30
Figure legends

Fig. 1 Maximum Likelihood phylogenetic tree based on multiple-Anaplasmataceae

groEL sequences alignments (460 nucleotides). The numbers at the nodes indicate

bootstrap percentages of 1000 resamplings (only values ≥ 75% are shown). The scale

bar indicates 10% nucleotide sequence divergence. The sequence obtained in the present

study and respective GenBank accession number is shown in boldface type.

31
Fig. 2 Maximum Likelihood phylogenetic tree based on multiple-Babesia 18S rDNA

sequences alignments (156 nucleotides). The numbers at the nodes indicate bootstrap

percentages of 1000 resamplings (only values ≥ 75% are shown). The scale bar

indicates 5% nucleotide sequence divergence. The sequence obtained in the present

study and respective GenBank accession number is shown in boldface type.

32
Table 1 Characterization of tick species (593 specimens) tested for the presence of
bacteria and protozoa DNA.
Common name Ticks District (n ticks)
(n hosts)
[scientific name]
Species Larvae Nymph Female Male Total
Barn owl (2) Hy. 3 3 Beja (3)
[Tyto alba] marginatum

Beech marten (1) I. frontalis 7 7 Beja (7)

[Martes foina]

Bonelli's eagle (1) Rh. bursa 1 4 5 Beja (5)

[Aquila fasciata]

Carrion crow (1) Hy. 1 1 Faro (1)

[Corvus corone] marginatum

Cattle (49) Hy. 35 72 107 Beja (147)

[Bos taurus] marginatum
Rh. bursa 20 8 28
Rh. 8 2 10
sanguineus
s.l.
Hy. 1 1 2
lusitanicum

Common buzzard Rh. 1 1 Beja (1)

(1) sanguineus
[Buteo buteo] s.l.

Common redstart Hy. 2 2 Faro (2)

(1) marginatum
[Phoenicurus
phoenicurus]

Dog (10) Rh. 9 9 18 Lisboa (8), Setúbal (5)

[Canis lupus sanguineus and Beja (5)
familiaris] s.l.

Eurasian eagle- Hy. 1 1 Faro (2)

owl (2) marginatum
[Bubo bubo]
Rh. 1 1
sanguineus
s.l.

European badger Rh. 1 1 Faro (1)

(1) sanguineus
[Meles meles] s.l.

European hare Rh. 1 9 10 Beja (22)

(15) sanguineus
[Lepus europaeus] s.l.
Hy. 5 5
lusitanicum
I. ricinus 1 2 3
Ha. punctata 1 1
Hyalomma 1 1
spp.
I. acuminatus 1 1
Rh. pusillus 1 1

33
European Rh. 2 2 Faro (2)
hedgehog (1) sanguineus
[Eurinaceus s.l.
europaeus]

European rabbit Hy. 28 28 Beja (106)

(49) lusitanicum
[Oryctolagus
cuniculus]
I. acuminatus 7 10 5 22
I. ricinus 4 3 9 16
Rh. 7 2 5 14
sanguineus
s.l.
Rh. pusillus 8 1 9
Ha. punctata 8 8
Ixodes spp. 1 5 1 7
Hy. 1 1
marginatum
Hyalomma 1 1
spp.

Great bustard (2) Hy. 7 7 Beja (7)

[Otis tarda] marginatum

Horse (1) Hy. 1 1 2 Santarém (2)

[Equus ferus lusitanicum
caballus]

Lesser black- Hy. 1 1 Faro (1)

backed gull (1) marginatum
[Larus fuscus]

Little owl (7) Hy. 12 a, 7 b 19 Faro (15 a) and Beja (7 b)

[Athene noctua] marginatum
Hyalomma 3a 3
spp.

Northern goshawk Hy. 1 1 Beja (1)

(1) marginatum
[Accipiter gentilis]

Red deer (2) D. marginatus 1c 1 Castelo Branco (1 d) and

[Cervus elaphus] Portalegre (1 c)
Hy. 1d 1
lusitanicum

Red fox (5) Rh. bursa 1e 3 e, 1 f 5 Faro (5 e) and Beja (1 f)

[Vulpes vulpes]
Rh. 1e 1
sanguineus
s.l.

Red-legged I. acuminatus 1 1 Beja (2)

partridge (2)
[Alectoris rufa]
Ixodes spp. 1 1

Sheep (115) Rh. 58 107 165 Beja (206)

[Ovis aries] sanguineus
s.l.
Hy. 11 15 26
marginatum
Hy. 5 5 10
lusitanicum
Rh. bursa 5 5

34
 Short-toed snake Hy. 1 1 Évora (1)
eagle (1) marginatum
[Circaetus
gallicus]

Wild boar (11) D. marginatus 3 h, 1 g, 3 g, 3 i, 12 Lisboa (8 g), Castelo

[Sus scrofa ferus] 1i 1h Branco (6 h) and
Portalegre (6 i)
I. ricinus 2g 1g 3
Hy. 1i 1i 2
lusitanicum
Hy. 1h 1
marginatum
Ixodes spp. 1g 1
Rh. 1h 1
sanguineus
s.l.

Yellow-legged Hy. 5 5 Faro (6)

gull (1) marginatum
[Larus
michahellis]
Hyalomma 1 1
spp.
Hy.: Hyalomma; I.: Ixodes, Rh.: Rhipicephalus; D.: Dermacentor; The superscript letters
(a-i) match the number of tick specimens with the district where they were collected

35
Table 2 Oligonucleotide primers used for PCR amplification.
Infectious Targ Oligonucleotide sequences (5’-3’) Amplic Ref.
agent et on size
gene (bp)
Forward (concentration - µM) Reverse (concentration - µM)
Anaplasma 16S GGTACCYACAGAAGAAGTCC (10) TAGCACTCATCGTTTACAGC 345 Harrus
spp./Ehrlichi rDN (10) et al.
a spp. A (2011)
groE ACTGATGGTATGCARTTTGAYCG TCTTTRCGTTCYTTMACYTCAA 600 Barber
L (20) CTTC (20) et al.
(2010)
Anaplasma msp4 GGGAGCTCCTATGAATTACAGAGA CCGGATCCTTAGCTGAACAGG 851 de la
marginale/A. ATTGTTTAC (10) AATCTTGC (10) Fuente
centrale/A. et al.
ovis (2003)
Anaplasma msp4 ATGAATTACAGAGAATTGCTTGTA TTAATTGAAAGCAAATCTTGCT 849 de la
phagocytoph GG (10) CCTATG (10) Fuente
ilum et al.
(2005)
Babesia 18S AATACCCAATCCTGACACAGGG TTAAATACGAATGCCCCCAAC 408 Harrus
spp./Theileri rRN (10) (10) et al.
a spp. A (2011)
Borrelia ITS ** ACCATAGACTCTTATTACTTTGAC TAAGCTGACTAATACTAATTAC 380 Schwa
burgdorferi 5S- (5) CC (5) rtz et
sensu lato 23S al.
rRN (1992)
A
** ACCATAGACTCTTATTACTTTGACC GAGAGTAGGTTATTGCCAGGG 225
* A (5) (5)
flaB ** TGGTATGGGAGTTTCTGG (2) TAAGCTGACTAATACTAATTAC 774 Wodec
CC (2) ka et
al.
(2010)
** CAGACAACAGAGGGAAAT (2) TCAAGTCTATTTTGGAAAGCAC 604
* C (2)
Relapsing 16S GAGGTGATCCAGCCACACTTTCCA GCTTCGCTTGTAGATGAGTCTG 1324 Nunes
Fever rDN G (10) CGTC (10) et al.
Borrelia A (2016)
glpQ ** TAGCTCAYAGRGGYGCHAGYG (10) ATCCAYGSVCCYATRCCYTC 693 Nunes
(10) et al.
(2016)
** CCAGAACATACHYTAGARKCYAAA TATTCATARTCYGTTGGKGMY 598
* GC (10) TCDTYC (10)
Rickettsia gltA GGGGGCCTGCTCACGGCGG (10) ATTGCAAAAAGTACAGTGAAC 381 Regne
spp. A (10) ry et
al.
(1991)
omp CCGCAGGGTTGGTAACTGC (10) CCTTTTAGATTACCGCCTAA 833 Roux
B* (10) and
Raoult
(2000)
* All except Rickettsia helvetica; ** – outer primers; *** – inner primers

36
Table 3 Species, stage, gender and number of collected ticks.

Genus/species N.º (%) of ticks per development stage

Adult
Larva Nymph Female Male Total
Rhipicephalus 0 (0.0) 16 (13.1) 107 (56.6) 154 (55.8) 277 (46.7)
Rh. sanguineus s.l. 0 (0.0) 7 (43.8) 80 (74.8) 137 (89.0) 224 (80.9)
Rh. bursa 0 (0.0) 0 (0.0) 27 (25.2) 16 (10.4) 43 (15.5)
Rh. pusillus 0 (0.0) 9 (56.3) 0 (0.0) 1 (0.6) 10 (3.6)

Hyalomma 6 (100) 75 (61.5) 54 (28.6) 97 (35.1) 232 (39.1)

Hy. marginatum 0 (0.0) 42 (56.0) 46 (85.2) 88 (90.7) 176 (75.9)
Hy. lusitanicum 0 (0.0) 33 (44.0) 8 (14.8) 9 (9.3) 50 (21.6)
Hyalomma sp. 6 (100) 0 (0.0) 0 (0.0) 0 (0.0) 6 (2.6)

Ixodes 0 (0.0) 22 (18.0) 22 (11.6) 18 (6.5) 62 (10.5)

I. acuminatus 0 (0.0) 9 (40.9) 10 (45.5) 5 (27.8) 24 (38.7)
I. ricinus 0 (0.0) 4 (18.2) 6 (27.3) 12 (66.7) 22 (35.5)
Ixodes sp. 0 (0.0) 2 (9.1) 6 (27.3) 1 (5.6) 9 (14.5)
I. frontalis 0 (0.0) 7 (31.8) 0 (0.0) 0 (0.0) 7 (11.3)

Dermacentor 0 (0.0) 0 (0.0) 6 (3.2) 7 (2.5) 13 (2.2)

D. marginatus 0 (0.0) 0 (0.0) 6 (100) 7 (100) 13 (100)

Haemaphysalis 0 (0.0) 9 (7.4) 0 (0.0) 0 (0.0) 9 (1.5)

Ha. punctata 0 (0.0) 9 (100) 0 (0.0) 0 (0.0) 9 (100)
Total 6 (1.0) 122 (20.6) 189 (31.9) 276 (46.5) 593 (100)

37
Table 4 Bacteria and protozoa DNA in ticks from domestic and wild animals from Portugal.
Infectious agent Ticks Total
Species (n) Stage/gender Vertebrate (n) District fi ni
Anaplasma sp. 28 4.7%
Rh. sanguineus s.l. (20) Male Sheep (19) Beja
Rh. sanguineus s.l. (4) Female Sheep (4) Beja
Hy. marginatum (2) Male Cattle (2) Beja
Rh. bursa (1) Female Cattle (1) Beja
Rh. sanguineus s.l. (1) Male Dog (1) Beja
Ri. massiliae 18 3.0%
Rh. sanguineus s.l. (8) Female Sheep (8) Beja
Rh. sanguineus s.l. (7) Male Sheep (7) Beja
Rh. bursa (1) Male Red fox (1) Faro
Rh. sanguineus s.l. (1) Male European hedgehog (1) Faro
Rh. sanguineus s.l. (1) Male European badger (1) Faro
Rickettsia sp. 17 2.9%
Hy. marginatum (5) Male Cattle (5) Beja
Hy. marginatum (3) Female Cattle (3) Beja
Rh. sanguineus s.l. (3) Male Sheep (3) Beja
Rh. sanguineus s.l. (2) Female Sheep (2) Beja
D. marginatus (2) Male Wild boar (1) Lisboa
D. marginatus (1) Male Wild boar (1) Castelo Branco
D. marginatus (1) Female Red deer (1) Castelo Branco
Ri. aeschlimannii 15 2.5%
Hy. marginatum (10) Male Cattle (6) Beja
Hy. marginatum (3) Female Cattle (3) Beja
D. marginatus (1) Female Wild boar (1) Portalegre
Hy. marginatum (1) Nimph Little owl (1) Unknown
Ri. raoultii 6 1.0%
Hy.marginatum (5) Female Cattle (5) Beja
Hy. marginatum (1) Male Cattle (1) Beja
Ri. slovaca 5 0.8%
D. marginatus (2) Female Wild boar (2) Castelo Branco
D. marginatus (2) Male Wild boar (1) Portalegre
D. marginatus (1) Male Wild boar (1) Lisboa
A. ovis 4 0.7%
Rh. sanguineus s.l. (4) Male Sheep (4) Beja
Ehrlichia sp. 4 0.7%
Hy. marginatum (4) Male Cattle (4) Beja
Borrelia sp. 2 0.3%
Rh. sanguineus s.l. (1) Female Sheep (1) Beja
Rh. sanguineus s.l. (1) Male Sheep (1) Beja
Babesia sp. 1 0.2%
Rh. sanguineus s.l. (1) Female Sheep (1) Beja
Candidatus Ri. barbariae 1 0.2%
Rh. sanguineus s.l. (1) Male Cattle (1) Beja
Ri. helvetica 1 0.2%
Hy.lusitanicum (1) Female Wild boar (1) Portalegre
T. annulata 1 0.2%
Rh. bursa (1) Female Cattle (1) Beja
Anaplasma sp. + Ri. massiliae 4 0.7%
Rh. sanguineus s.l. (3) Male Sheep (3) Beja
Rh. sanguineus s.l. (1) Female Sheep (1) Beja
A. ovis + Ri. massiliae 2 0.3%
Rh. sanguineus s.l. (2) Male Sheep (2) Beja
Anaplasma sp. + T. ovis 2 0.3%
Rh. sanguineus s.l. (1) Female Dog (1) Beja
Rh. sanguineus s.l. (1) Male Sheep (1) Beja
Ehrlichia sp. + Ri. aeschlimannii 1 0.2%
Hy. marginatum (1) Male Cattle (1) Beja
Ehrlichia sp. + Rickettsia sp. 1 0.2%
Hy. marginatum (1) Male Cattle (1) Beja
Total 113 19.1%
A. – Anaplasma; D. – Dermacentor; E. – Ehrlichia; Ri. – Rickettsia; T. – Theileria; Hy. – Hyalomma;
Rh. – Rhipicephalus; s.l. - sensu lato; fi– absolute frequency; ni – relative frequency.

38