The Plant Journal (2003) 33, 875–885

Phytochrome control of flowering is temperature sensitive

and correlates with expression of the floral integrator FT
Karen J. Halliday1,
, Michael G. Salter2, Elin Thingnaes2,y and Garry C. Whitelam2
1
School of Biological Sciences, University of Bristol, Woodland Road, Bristol BS8 1UG, UK, and
2
Biology Department, University of Leicester, University Road, Leicester LE1 7RH, UK

Received 18 October 2002; revised 27 November 2002; accepted 9 December 2002.

For correspondence (e-mail k.j.halliday@bristol.ac.uk).
y
Present address: Department of Horticulture and Crop Sciences, Agricultural University of Norway, PO Box 5022, N-1432 Ås, Norway.

Summary
In Arabidopsis flowering is accelerated by reduced red:far-red (R:FR) ratio which signals the presence of
neighbouring vegetation. Hastened flowering is one component of the shade-avoidance syndrome of
responses, which alter many aspects of development in response to the threat of potential competition.
Of the red/far-red-absorbing photoreceptors it is phyB that plays the most prominent role in shade-avoid-
ance, although other related phytochromes act redundantly with phyB. It is well established that the phyB
mutant has a constitutively early flowering phenotype. However, we have shown that the early flowering
phenotype of phyB is temperature-dependent. We have established that this temperature-sensitive flower-
ing response defines a pathway that appears to be independent of the autonomous-FLC pathway. Further-
more, we have demonstrated that the phytochromes control the expression of the floral promoter FT. We
have also shown that other phyB-controlled responses, including petiole elongation, are not sensitive to
the same temperature change. This suggests that discrete pathways control flowering and petiole elonga-
tion, components of the shade-avoidance response. This work provides an insight into the phytochrome
and temperature interactions that maintain flowering control.

Keywords: phytochrome, temperature, flowering, Arabidopsis, phyB, phyE.

Introduction
The onset of flowering in plants is often determined by the
interaction of environmental cues with endogenous devel-
opmental signals. Temperature and light signals are
amongst the most important and well-characterised envir-
onmental factors that regulate flowering time (Samach and
Coupland, 2000; Simpson and Dean, 2002; Simpson et al.,
1999). In particular, changes in day length and exposure to
extended periods of cold temperature, both of which are
predictable and reliable indicators of seasonal progression,
control floral transition in many plants. In Arabidopsis, the
acceleration of flowering following an extensive period of
cold treatment (vernalization) is observed in many ecotypes
and can be mapped as monogenic trait, with a vernalization
requirement conferred by dominant alleles of the FRI gene
(see Johanson et al., 2000). The product of the FRI gene
promotes the accumulation of FLC, a MADS box transcrip-
tion factor that acts as a floral repressor (e.g. Michaels and
Amasino, 1999). A related gene, FLM/MAF1 also acts as a
floral repressor though it appears to do so in a FRI-inde-
pendent manner (Ratcliffe et al., 2001; Scortecci et al., 2001).
FLC is also controlled by genes that act in the autonomous
pathway and so represents an important convergence point
for flowering pathways (Michaels and Amasino, 2001;
Sheldon et al., 1999). Downstream targets for FLC are the
floral integrators FT and SOC1/AGL20 (Lee et al., 2000;
Rouse et al., 2002).
Like temperature, photoperiod is recognised as a major
environmental determinant of flowering time in many
plants. The acceleration of flowering by long days (LDs)
in Arabidopsis involves the interaction of photoreceptors,
principally cryptochrome 2 (cry2) and phytochrome A
(phyA), with the endogenous circadian oscillator (Yanovsky
and Kay, 2002). These light-signalling pathways converge
at the circadian-regulated transcriptional regulator CO,
providing a mechanism for the photoperiodic regulation
of flowering in Arabidopsis (Suarez-Lopez et al., 2001;

ß 2003 Blackwell Publishing Ltd 875


876 Karen J. Halliday et al.
Yanovsky and Kay, 2002). CO has been shown to be a
positive regulator of FT and SOC1 (Samach et al., 2000;
Yanovsky and Kay, 2002). Indeed, the levels of FT and SOC1
mRNA appear to be determined by a balance of CO and FLC
activity (Hepworth et al., 2002; Samach et al., 2000). Thus,
FT and SOC1 represent important integration points
between temperature- and light-signalling pathways.
In addition to photoperiod, other light signals also have a
marked effect of flowering time. Light quality, specifically
the relative proportions of red and far-red light (R:FR ratio),
provides a powerful signal that regulates both vegetative
development and the transition to flowering. The light
reflected from green vegetation is attenuated in the blue
and red regions, but relatively rich in the green and far-red
regions. This alteration in R:FR ratio is detected by the
reversibly photochromic red/far-red-absorbing phyto-
chromes and in many plants leads to the initiation of a
syndrome of responses called shade avoidance (Smith and
Whitelam, 1997). Shade-avoidance responses include
increased stem and petiole elongation and the acceleration
of the transition to flowering. In rosette plants, such as
Arabidopsis, acceleration of the onset of flowering is per-
haps the most dramatic response to low R:FR ratio signals
(e.g. Bagnall, 1993; Halliday et al., 1994). The precocious
flowering induced by exposure to low R:FR ratio light, has
possible fitness implications, as it may increase the like-
lihood of survival to reproduction under the otherwise
unfavourable conditions of vegetational shade (Botto and
Smith, 2002; Donohue et al., 2001; Dudley and Schmitt,
1995).
Of the five phytochromes in Arabidopsis, at least three
(phyB, phyD and phyE) play a role in the perception of the
R:FR ratio signal and the initiation of shade-avoidance
responses (see Whitelam et al., 1998). From the physiolo-
gical analysis of null mutants, it is apparent that phyB is the
principal photoreceptor involved in R:FR ratio signal per-
ception. Thus, compared with wild-type plants phyB
mutants are constitutively elongated and early flowering
and display attenuated responses to low R:FR ratio.
Mutants that are null for either phyD or phyE have less
obvious phenotypes, although their deficiency is far more
evident when phyB is also absent (Aukerman et al., 1997;
Devlin et al., 1998; 1999). Thus, phyBphyD and phyBphyE
double mutants are more elongated, earlier flowering than
monogenic phyB mutants. These observations suggest that
phyD and phyE contribute to control of the shade-avoid-
ance response.
Relatively little is known about the genes that act down-
stream of the phytochromes in the low R:FR ratio-induced
acceleration of flowering. Phytochrome B-deficiency has
been reported to regulate expression of the floral meristem
identity gene LFY, independent of CO and FT, suggesting
that the pathway is separate from the photoperiodic path-
way (Blázquez and Weigel, 1999). The low R:FR ratio signal,
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
or phyB deficiency can correct the late flowering of several
induced mutations in components of the autonomous path-
way that confer a vernalization requirement (Bagnall, 1993;
Halliday et al., 1994). As the normal function of these
autonomous pathway components is to limit the expres-
sion of FLC (e.g. Sheldon et al., 1999) and the induced
mutations have elevated FLC expression, it is possible that
phytochromes may also control FLC levels.
In the present study, we have investigated the roles of
different phytochromes and the interaction between phy-
tochrome status and ambient temperature in the regula-
tion of the transition to flowering. Using mutants that are
null for single or multiple phytochromes, we reveal an
important role for temperature in phytochrome-regulated
flowering. We demonstrate that the flowering time gene
FT is regulated by the phytochromes. Furthermore, we
show that other phytochrome responses are not subject
to the same temperature control. This suggests the phyto-
chromes have evolved different mechanisms to regulate
specific responses.
Results
The early flowering phenotype of the phyB mutant is
temperature dependent
It is now well established that phyB plays a major role in the
perception of alterations in R:FR ratio, a sensitive means of
detecting the presence of potential competitors. Low R:FR
light ratio triggers the shade-avoidance syndrome of
responses which includes increased petiole and internode
elongation, reduced apical dominance and early flowering
(e.g. Devlin et al., 1996; Halliday et al., 1994). This syndrome
of responses is thought to confer competitive advantage
when resources are limited.
Consistent with previous reports, we found that when
grown under a constant temperature of 228C, the phyB
mutant displayed a constitutive elongated petiole and early
flowering phenotype. Under short-day (SD) growth condi-
tions (8-h photoperiods), phyB mutants flowered with about
10 fewer rosette leaves than wild-type plants (Figure 1).
However, quite remarkably the early flowering phenotype
of phyB was completely abolished when plants were grown
at the slightly lower temperature of 168C (Figures 1 and 2).
Wild-type plants flowered slightly later at 168C compared
with 228C, producing more than four additional leaves. The
phyA mutant behaved in a similar manner to wild-type
plants under both temperature regimes. However, the
68C difference in temperature had a huge impact on phyB
mutants, which produced 16 more leaves at bolting under
the cooler conditions than phyB mutants grown at 228C.
Similar temperature-dependent effects on flowering time
were observed in the phyAphyB double mutant. Whilst

Figure 1. The effect of temperature on flowering time of wild type, phyA,
phyB, phyAphyB, phyAphyBphyD, and phyAphyBphyDphyE mutants. Flow-
ering time was measured as the number of primary rosette leaves produced
at bolting in plants grown in 8-h photoperiods (photon irradiance, 400–
700 nm, 180 mmol m2 sec1) at 228C (1) or 168C (1). Standard errors are
shown. Nomenclature: A ¼ phyA, B ¼ phyB, D ¼ phyD and E ¼ phyE
null mutations.
phyAphyB flowered slightly earlier than the monogenic
phyB mutant under all test conditions, growth at 168C
invoked a delay in flowering of a similar magnitude to
the monogenic phyB mutant. These data suggest that under
our experimental conditions, whilst the effects of the phyA
mutation on flowering were largely independent of tem-
perature, the impact of the phyB mutation on flowering
time was strongly dependent on the ambient temperature.
To establish if these effects were specific to plants grown
under SD conditions we tested whether the phyB mutant
retained its early flowering phenotype following growth
under long days (LDs: 16-h photoperiods) at 168C (Figure 3).
We observed that flowering was also delayed in phyB under
LDs at 168C. In fact, phyB mutants flowered slightly later
than the wild type under these conditions. Thus, it appears
that the early flowering phenotype of phyB is temperature-
dependent and this conditional phenotype operates under
different photoperiodic conditions.
Although growth at 168C abolished the early flowering of
phyB, the elongated petiole phenotype was still evident in
phyB mutants grown at this temperature (Figure 2). This
indicates that the effects imposed by a change in tempera-
ture on phyB-mediated flowering responses are not
observed for this phyB-controlled elongation response.
Thus, these different facets of phyB action may represent
different branches of the phyB-signalling network.
As phyB plays a predominant role in R:FR ratio percep-
tion and the initiation of shade avoidance, the observation
that the flowering time phenotype of the phyB mutant is
temperature-conditional raises the question whether the
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Phytochrome regulation of FT 877
Figure 3. Flowering time of wild type, phyA, phyB, phyAphyB, phyAphyB-
phyD, and phyAphyBphyDphyE mutants grown in long days. Flowering time
was measured as the number of primary rosette leaves produced at bolting
in plants grown at 168C (1) in 16-h photoperiods, photon irradiance, 400–
700 nm, 180 mmol m2 sec1. Standard errors are shown.
Table 1 The effects of temperature on the wild-type response to
low R:FR ratio light
Number of rosette leaves at flowering
Temperature (8C) High R:FR ratio Low R:FR ratio
22 6.90  0.29 5.60  0.22
16 10.00  0.56 6.80  0.25
Rosette leaf number was counted at flowering time for plants
grown in high or low R:FR ratio light at 228C (1) or 168C (1).
Standard errors are shown.
flowering response of wild-type plants to R:FR ratio is also
temperature-dependent. The data in Table 1 show that
wild-type seedlings grown under low R:FR ratio at 168C
display a classical acceleration of flowering. These results
suggest that although the phyB-mediated flowering
response to shade may be perturbed at 168C other phyto-
chromes are capable of fully compensating for the apparent
loss of phyB action under these conditions.
PhyE severely delays flowering in the
phyAphyBphyD mutant
The effects of growth temperature on the flowering phe-
notype were particularly striking in the phyAphyBphyD
triple mutant. In line with previous reports, when grown
under short days at 228C the phyAphyBphyD mutant was
very early flowering, producing only approximately nine
leaves at bolting (Figure 1). In comparison, wild-type plants
 1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
878 Karen J. Halliday et al.

Figure 4. Immunoblots of phytochrome protein levels in wild-type and

phyAphyBphyD mutant seedlings. Bands were detected by monoclonal
antibodies selective for phyC and phyE. Protein extracts were made from
12-day-old seedlings grown in 8-h photoperiods at 228C (1) or 168C (1).
Figure 2. Phenotypes of wild type and phyB mutant in 168C short days.
Plants were grown for 78 days in 168C (1), 8-h photoperiods, photon
irradiance, 400–700 nm, 180 mmol m2 sec1.

flowered with approximately 35 leaves under the same
conditions. However, when grown under identical photo-
periods, but at 168C, the phyAphyBphyD mutant flowered
with approximately 40 rosette leaves, a similar leaf number
to the wild type. Thus, a change of just 68C completely
abolished the extreme early flowering phenotype of the
phyAphyBphyD mutant. These data suggest a possible role
for phyA and phyD, in addition to phyB, in the temperature-
regulated control of flowering. Substantial delays in flower-
ing for plants grown at 168C compared with plants grown at
228C were also observed for phyAphyBphyD mutants
grown under LDs (Figure 3). Indeed, like phyB, the phyA-
phyBphyD mutant flowered slightly later than the wild type
under these conditions.
When grown at 168C the phyAphyBphyDphyE mutant
flowered considerably earlier than the phyAphyBphyD
mutant. In SDs, the quadruple mutant flowered with
approximately 16 leaves, 25 fewer leaves than phyAphyB-
phyD (Figure 1). In LDs, phyAphyBphyDphyE flowered with
approximately 5 leaves, that is, 19 fewer leaves than the
phyAphyBphyD mutant (Figure 3). Thus, the absence of
phyE substantially reduced the effects of temperature on
flowering in phyAphyBphyD. These data suggest that in
phyAphyBphyD the delay in flowering observed following
growth at 168C is largely mediated by phyE, and therefore
suggest a role for phyE in the temperature-dependent
control of flowering.
It was a possibility that the comparatively late-flowering
phenotype of phyAphyBphyD plants grown at 168C was a
consequence of elevated phyE and/or phyC levels. This was
tested by Western blot analysis. Figure 4 shows that for
both phyC and phyE, protein levels were very similar in
wild-type and phyAphyBphyD mutant seedlings. Previous
work showed that phyC levels were reduced in a phyB

Figure 5.
(a) Phenotypes of the wild type and phyAphyBphyD triple mutant grown in 22 or 168C.
(b) Total leaf number (rosette þ axillary) of 168C-grown wild type and phyAphyBphyD mutant.
All plants were grown in 8-h photoperiods (photon irradiance, 400–700 nm, 180 mmol m2 sec1), at 228C (1) or 168C (1). Standard errors are shown.

ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885


mutant background (Hirschfield et al., 1998). In our experi-
ments, phyC levels are similar in phyAphyBphyD mutant
and wild-type seedlings. This suggests that the effect of
phyB deficiency on phyC levels is overcome when phyA
and phyD are removed in addition to phyB. Figure 4 also
shows that phyC and phyE protein levels were identical in
extracts from phyAphyBphyD mutant seedlings grown at
either 16 or 228C. These data suggest that the delayed
flowering of the phyAphyBphyD triple mutant grown at
168C, mediated by phyE, may be a result of down-stream
signalling events.
The extraordinary plasticity of the flowering response in
the phyAphyBphyD mutant is accompanied by equally
dramatic changes in the vegetative phenotype (Figure 5a).
The prolonged vegetative phase of phyAphyBphyD ob-
served in plants grown at 168C was characterised by a loss
of apical dominance and the consequent development of
numerous axillary rosette leaves, which formed in a basal–
apical direction. This is typical of development during
prolonged vegetative growth and is seen in several late-
flowering mutants, e.g. fca and fwa (Page et al., 1999; Soppe
et al., 2000). The first of the axillary leaves was visible to the
eye in both wild-type plants and phyAphyBphyD mutants
between days 52 and 57, approximately half way through
the vegetative phase. However, the phyAphyBphyD vege-
tative period was so long that total leaf number (rosette þ
axillary leaves) at flowering time was far in excess of the
wild type (Figure 5a,b). Indeed, the mature adult phenotype
of the phyAphyBphyD mutant was quite striking, with
plants becoming quite bushy in appearance.
The development of axillary leaf primordia is thought to
be under the control of auxin. Indeed, rapid lateral shoot
development in the axr1, max1 and max2 mutants (Stirn-
berg et al., 1999; 2002) provides genetic evidence that auxin
negatively regulates this process. This appears to be the
case for phyAphyBphyD as we were able to completely
inhibit axillary shoot development by exogenously apply-
ing synthetic auxin (data not shown).
The phytochromes regulate FT levels
The signalling pathways via which the phytochromes con-
trol flowering in the shade-avoidance pathway are not yet
known. We were therefore interested in establishing if the
floral integrators FT and SOC1 were regulated by the phy-
tochromes and temperature in this response. We also
wanted to ascertain whether the phytochromes signalled
through the CO-dependent photoperiodic pathway, or
through the FLM/FLC branches of the temperature-sensitive
pathway. These components of the flowering pathways are
controlled mainly at a transcriptional level, we therefore
used quantitative PCR to measure transcript levels in
22-day-old wild-type, phyB and phyAphyBphyD seedlings
grown either at 22 or 168C (Figure 6).
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Phytochrome regulation of FT 879
Expression levels of CO were slightly elevated in the phyB
mutant relative to the wild type and phyAphyBphyD under
22 or 168C. However, this relatively small increase in CO
mRNA did not correlate with accelerated flowering in phyB
and so is unlikely to be significant. For the vernalization-
responsive genes FLC and FLM, expression levels were low
in all genotypes at both temperatures. This suggests that
FLC and FLM expression does not change in response to
changes in ambient temperature or reduced phytochrome
status. As the floral integrator SOC1 is a convergence point
for the photoperiod and autonomous pathways, we wanted
to check whether it was also a target for phytochrome.
SOC1 was expressed to a similar low level in the wild type
and the phytochrome mutants at 168C. Under 228C levels
were slightly, but sequentially elevated in the phyB and
phyAphyBphyD mutants, respectively. These modest rises
in SOC1 expression correlate with the degree of early
flowering observed in the mutants. Therefore, it is possible
that SOC1 levels contribute to the early flowering pheno-
type at 228C. The most impressive temperature-dependent
response to phytochrome status was observed in FT tran-
script levels, where for plants grown at 228C transcript
abundance was 20-fold higher in phyB and 40-fold higher
in phyAphyBphyD, compared with the wild type. These
changes in FT expression correlate with the phyB and
phyAphyBphyD early flowering phenotypes providing
indirect evidence that phyB, and other phytochromes, delay
flowering through repression of FT expression at 228C. This
contrasts with the situation seen for plants grown at 168C,
where FT transcript levels were generally lower and more
similar among the different genotypes. Thus, at 168C the
observed repression of FT expression may have occurred
as a direct consequence of temperature. Alternatively, FT
transcription may have been repressed by photoreceptor
action in the wild-type and mutant plants. Our results
suggest such a role for phyE. When grown at 168C, the
early flowering phyAphyBphyDphyE quadruple mutant had
sixfold higher levels of FT expression than phyAphyBphyD
(Figure 7). Hence, there is a positive correlation bet-
ween phyE loss, acceleration of flowering, and FT levels.
This provides indirect evidence that at 168C phyE inhibits
flowering in the phyAphyBphyD mutant via repression of
FT.
PhyB and phyD control the rate of vegetative
development
In wild-type seedlings, development through the juvenile
phase, during which the first four leaves are formed, is
slow. Thereafter, leaves are produced at an increasing
rate until approximately two-thirds of the way through
the vegetative phase when leaf production slows prior
to bolt emergence (Figure 8). Although the overall rate
of development is slower in plants grown at the cooler

880 Karen J. Halliday et al.
Figure 6. Expression levels of the flowering genes FLC, FLM, CO, SOC1
and FT.
Gene expression was determined for phyB and phyAphyBphyD relative
to WT levels. Seedlings were grown for 22 days at 228C (1) or 168C (1)
and transcript levels were measured by quantitative PCR. All plants
were grown in 8-h photoperiods, photon irradiance, 400–700 nm, 180 mmol
m2 sec1.
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Figure 7. Expression levels of FT in phyAphyBphyDphyE relative to phyA-
phyBphyD at 168C. Plants were harvested at 22 days, and expression levels
were measured by quantitative PCR. All plants were grown at 168C (1) in
8-h photoperiods, photon irradiance, 400–700 nm, 180 mmol m2 sec1.
Figure 8. Rosette leaf production rate in wild type, phyA, phyB, phyAphyB,
phyAphyBphyD, and phyAphyBphyDphyE mutants.
Rosette leaf number was counted at time intervals (days) until flowering
time in plants grown in 8-h photoperiods (photon irradiance, 400–700 nm,
180 mmol m2 sec1), at either 228C (1) or 168C (1). Standard errors are
shown. Nomenclature: A ¼ phyA; B ¼ phyB; D ¼ phyD and E ¼ phyE
null mutations.

temperatures, this pattern of development is consistent for
plants grown in 22 or 168C.
In accordance with previous observations (Mazzella
et al., 2001) we demonstrate that loss of phyB significantly
slowed the rate of rosette leaf production (Figure 8). In
addition, we have demonstrated that this effect was not
dependent on temperature as phyB mutants produced
rosette leaves more slowly than the wild type when grown
at either 22 or 168C (Figure 8). However, when phyB was
grown at the cooler temperature its leaf production rate
markedly accelerated just prior to bolting. It was as a result
of this final burst of rapid development, prior to bolting, that
the otherwise slowly developing phyB mutant flowered
with a similar number of leaves as the wild type. The
phyAphyB double mutant produced leaves at an identical
rate to the phyB mutant. This and the lack of a phyA mutant
phenotype in this respect suggest that phyA does not
contribute significantly to the control of leaf production rate.
When compared with wild-type plants, leaf production
was also slowed in the phyAphyBphyD mutant following
growth at either 22 or 168C (Figure 8). However, growth at
168C revealed a role for phyD in the control of leaf formation
rate. At the cooler temperature, the phyAphyBphyD mutant
exhibited a reduced rate of development throughout the
vegetative phase. This, coupled with the abolition of the
early flowering phenotype of phyAphyBphyD means that
these mutants flowered extremely late (at 90 days) at 168C.
In a similar fashion to plants grown at 228C, phyAphyBphyD
mutants grown at 168C produced leaves at the same rate as
phyB and phyAphyB, but just for the first half of the vege-
tative phase. During the second half of the vegetative phase
the rate of leaf production in the triple mutant was slower
than that of the phyB and phyAphyB mutants. Indeed,
although phyB and phyAphyBphyD flowered with a similar
number of primary rosette leaves, phyAphyBphyD flow-
ered some approximately 17 days later than phyB. This
delayed development must be due to the action of the
phyD mutation acting to repress leaf production rate in
the second half of the vegetative phase. As the phyAphyB-
phyDphyE quadruple mutant produced leaves at an even
slower rate than the phyAphyBphyD mutant, this reveals
redundant actions of phyA and/or phyE in control of leaf
formation.
Discussion
As the reproductive success of the plant hinges on the
decision of when to flower, it is no surprise that the flower-
ing-signalling network is intricate. However, even though
this developmental decision is subject to a high level of
control, these pathways converge at common components:
the key regulators of flowering (Simpson and Dean, 2002).
We have shown that the phytochrome-controlled flowering
pathway is subject to temperature regulation and that it
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Phytochrome regulation of FT 881
appears to act independently of the autonomous-FLC path-
way.
In the natural environment it is the explicit role of the
phytochromes to adjust the plants developmental pro-
gramme to maximise reproductive success in response
to changes in the local environment. The phytochromes
can regulate flowering, elongation growth and apical dom-
inance in response to the R:FR ratio of ambient light. This
complex of responses, which comprise components of the
shade-avoidance response, enables the plant to adjust its
developmental programme in response to potential com-
petitors. Of the phytochromes, it is phyB that exerts the
greatest control on flowering, although phyA, phyD and
phyE each contribute to varying extents (Devlin et al., 1998;
1999; Halliday et al., 1994).
We have shown that the much reported early flowering
phenotype of the phyB mutant is temperature conditional.
The dramatic acceleration in flowering observed in phyB at
228C was completely abolished at 168C where the phyB
mutant flowered at a similar time as the wild type. Compar-
able observations were also made for the phyAphyBphyD
triple mutant, which flowered very early at 228C, but with a
similar number of rosette leaves as the wild type at 168C. In
contrast, the elongated petiole phenotype of phyB and
phyAphyBphyD was observed in plants grown at either
22 or 168C. This suggests that control of this aspect of
the shade-avoidance phenotype is independent of tempera-
ture, consistent with the notion that discrete pathways
control the elongation and flowering components of the
shade-avoidance response.
Little is known of how the phytochromes control flower-
ing in context with the established flowering pathways. By
focussing on key components and integrators of the flower-
ing network, we have gained valuable insights into how the
phytochromes influence flowering. For many genes that
regulate flowering their activity strongly correlates with
their levels of expression. One such gene is FLC, an impor-
tant vernalization-responsive gene and floral integrator
(Simpson and Dean, 2002).
Earlier work by Bagnall (1993) demonstrated that either
vernalization or reduced R:FR ratio conditions could abolish
the late-flowering phenotype of the autonomous pathway
mutants fca, and fve. Furthermore, a low temperature treat-
ment could eliminate the response to light quality, suggest-
ing one or more convergence points for these signalling
pathways. As FLC is an important common component of
the vernalization and autonomous pathways it was possi-
ble that FLC was also an integration point for phytochrome-
signalling (Michaels and Amasino, 1999; 2001; Sheldon
et al., 1999). Furthermore, as vernalization results in the
reduction of FLC mRNA, it was possible that FLC may also
be subject to control by persistent changes in ambient
temperature. Another potential target for phytochrome
action in this response was FLM, which appears to regulate

882 Karen J. Halliday et al.
flowering independently of the autonomous-FLC pathway
(Ratcliffe et al., 2001; Scortecci et al., 2001).
Our results showed the differential affects on flowering at
22 and 168C in phyB and phyAphyBphyD did not result from
changes in FLC or FLM expression. FLC and FLM transcript
levels were low in all genotypes at 22 and 168C. These data
suggest that FLC and FLM expression do not contribute to
this phytochrome-controlled flowering response. In sup-
port of these findings, we have recently shown that FLC
levels do not respond to changes in R:FR ratio (data not
shown). Thus, it appears that this temperature-sensitive
phytochrome flowering pathway defines a pathway that
acts independently of the autonomous-FLC pathways.
CO is an important link between the circadian clock
and light, promoting flowering in inductive photoperiods
(Putterill et al., 1995; Suarez-Lopez et al., 2001; Yanovsky
and Kay, 2002). Under LDs the peak of CO expression is
broader than under SDs with the highest levels of CO
mRNA coinciding with dawn and dusk (Suarez-Lopez et al.,
2001). This photoperiodic adjustment of CO mRNA, which
results from the coincidence of light and the circadian
phase, is important for induction of flowering under LDs
(Yanovsky and Kay, 2002). Growth in photoperiods with
incandescent light extensions revealed a role for phyA
in controlling the waveform and levels of CO mRNA
(Yanovsky and Kay, 2002). We therefore wanted to establish
if there were differences in CO expression in our tempera-
ture-sensitive phytochrome mutants. Our data indicate that
whilst CO transcript levels were slightly elevated in phyB,
they were similar in phyAphyBphyD mutant and wild-type
seedlings under 22 and 168C. Furthermore, the moderately
raised CO mRNA levels observed in phyB did not correlate
with the flowering behaviour of the mutant. These observa-
tions suggest that this temperature-sensitive phytochrome
pathway does not operate via control of CO transcription.
However, our data do not exclude the possibility that CO
has a post-transcriptional role in these flowering pathways.
Indeed, such a role is proposed in the phyA- and cry2-
mediated photoperiodic flowering response (Yanovsky
and Kay, 2002).
The myriad of pathways that control flowering time and
flower meristem identity converge on floral integrators
such as FT and SOC1/AGL20 (see Simpson and Dean,
2002). Indeed, both FT and SOC1 are common targets for
the automomous-FLC and the photoperiodic pathways
(Lee et al., 2000; Rouse et al., 2002; Samach et al., 2000;
Yanovsky and Kay, 2002). Recently, the mechanism via
which the automomous-FLC and the photoperiodic-CO
pathways control SOC1 has been demonstrated (Hepworth
et al., 2002). We set out to test whether SOC1 and/or FT
were also targets for the temperature-controlled phyto-
chrome-mediated flowering pathway. In our experiments,
SOC1 expression was elevated 3- and 4.4-fold in the phyB
and phyAphyBphyD mutants, respectively, at 228C. These
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
data do not support a prominent role for SOC1 in this
response, although they do not eliminate a post-transcrip-
tional role. In contrast, FT expression was greatly enhanced
in phyB and phyAphyBphyD at 228C. Relative to the wild
type, FT levels were 19-fold higher in phyB and 40-fold
higher in phyAphyBphyD. This rise in FT transcript corre-
lates with the observed early flowering phenotypes of the
mutants. Previous work has demonstrated that FT mRNA
accumulation correlates with early flowering (Kardailsky
et al., 1999; Kobayashi et al., 1999). Thus, our data suggest
that the early flowering of these phytochrome mutants
under 228C is due, at least in part, to reduced FT repression.
When the ambient temperature was reduced to 168C, the
phyB and phyAphyBphyD mutants no longer flowered
early and FT expression was low. Loss of phyE accelerated
both phyAphyBphyD mutant flowering and triggered an
elevation in FT transcript. This demonstrates that the sup-
pression of FT at cooler temperatures was not solely due to
the effects of temperature, as FT repression was relieved by
loss of phyE. These data provide evidence in support of a
role for FT in the temperature-dependent induction of flow-
ering mediated by the phytochromes. Our observations are
interesting in context with the recent findings that cry2
controls flowering, at least partly, by the repression of phyB
action (Mockler et al., 1999). As cry2 regulates FT expres-
sion in a CO-dependent fashion, it is quite conceivable that
these photoreceptor pathways converge at CO and/or FT.
The early flowering phenotypes of the phyB and phyA-
phyBphyD mutants when grown at 228C suggests that
phyB, and to a lesser extent phyA and phyD, antagonise
flowering promoted by warm temperatures. This appears
to occur, at least partly, via repression of FT. Under cooler
temperatures, the phyB and phyAphyBphyD mutants are
no longer early flowering and FT expression is low. Thus, at
168C, in these genetic backgrounds, the phyB mutation had
no impact on flowering. As removal of phyA and phyD in
addition to phyB did not alter flowering this suggests that
phyA and phyD are either inactive at 168C, or they have a
functional requirement for phyB and/or each other in this
response. The removal of phyE in addition to phyA, phyB
and phyD relieves the repression of FT and accelerates
flowering. Furthermore, the delayed flowering imposed
by phyE in the phyAphyBphyD mutant was not simply a
result of altered phyE or phyC levels, as levels were iden-
tical in the triple mutant at 16 and 228C. These data reveal a
new and potentially important role for phyE signalling in
the control of flowering at 168C, conditions where phyB is
less active. They are also in keeping with our observations
that wild-type plants grown at 168C show a normal accel-
erated flowering response to low red/far-red ratio light.
Further analysis will establish whether other phytochromes
in addition to phyE have a role in this temperature-regu-
lated response. These findings provide an environmental
context for ‘redundant’ actions of the phytochromes in the

control of flowering. It appears that at 228C phyB is the
major regulator of low R:FR ratio-induced flowering, whilst
at lower temperatures, phyE has the greater role. This type
of accommodative behaviour exhibited by the phyto-
chromes is not unusual in pathways that have been subject
to strong selection pressure, such as flowering (Stearns,
2002).
A reduction in ambient growth temperature is accompa-
nied by a slowing of plant development. However, we have
demonstrated that phytochromes also regulate develop-
mental rate, but between 16 and 228C this effect is inde-
pendent of temperature. In agreement with previous
observations (Mazzella et al., 2001), we showed that a lack
of phyB slowed the rate of leaf production, suggesting a
prominent role for phyB in this respect. At 228C roles for
additional phytochromes were not apparent, as flowering
was so rapid in plants lacking multiple phytochromes. At
168C, the loss of the early flowering phenotype in mutants
null for phyB allowed us to establish a role for phyD in
regulating the rate of leaf production. The removal of phyD
slowed leaf production rate in the phyAphyB mutant back-
ground, but only in the second half of the vegetative phase.
Indeed, the reduced rate of vegetative development
imposed by the phyD mutation in the phyAphyB back-
ground was sufficient to delay flowering by a further
20 days. These data reveal roles for phyB and phyD in
the control of growth rate where they operate in overlap-
ping phases of the vegetative development. The even more
slowly growing phyAphyBphyDphyE quadruple mutant
revealed minor roles for either phyA and/or phyE in this
regulation. This represents the first evidence that the phy-
tochromes act collectively to regulate the rate at which
development proceeds.
Conclusion
Analysis of mutants null for one or more phytochrome
species under different ambient growth temperatures has
revealed that the phyB monogenic mutant early flowering
phenotype is temperature dependent. Moreover, we have
demonstrated that at the cooler temperature of 168C phyE
has a prominent role in the regulation of flowering. This
temperature-sensitive flowering pathway appears to oper-
ate independently of the autonomous-FLC pathway. We
have correlative data that suggest this newly defined ther-
mosensory pathway functions at least partly through the
regulation of FT. Thus, FT appears to be an important
integration point for the photoperiod, the autonomous-
FLC and the phytochrome-regulated flowering pathways.
Not all the phytochrome-mediated responses are subject to
temperature modification. Within the same temperature
range (16–228C) phytochrome control of leaf elongation
and rosette leaf-formation rate was not substantially
altered. This provides an insight into the divergent strate-
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Phytochrome regulation of FT 883
gies that have evolved in phytochrome-signalling path-
ways controlling different responses.
Experimental procedures
Plant material and growth conditions
All the experiments described were performed with Arabidopsis
Heynh, ecotype La-er. The phytochrome mutant alleles used were
phyA-2 (Whitelam et al., 1993), phyB-1 (Koornneef et al., 1980),
phyD-1 (Aukerman et al., 1997) and phyE (Devlin et al., 1998). As
the phyD-1 mutation is a naturally occurring allele found in the Ws
ecotype, near-isogenic La-er phyD-1 mutant lines were created by
introgression of the phyD-1 mutation into the La-er ecotype as
described by Aukerman et al. (1997).
In all experiments seeds were sown on 0.8% Lehle medium
(Lehle Seeds, Round Rok, TX), and stratified in darkness at 48C
for 5 days before transfer to different photoperiods or continuous
white light (for high/low R:FR ratio experiments) at 228C (1) or
168C (1). After a further 5 days, uniform seedlings were trans-
planted to 5 cm  5 cm  5 cm pots containing a 3 : 1 compost–
horticultural silver–sand mix. In photoperiod experiments, plants
were grown at either 228C (1) or 168C (1) under short days
(8 h : 16 h light:dark cycles), or long days (16 h : 8 h light:dark). In
high/low R:FR ratio experiments, seedlings were also grown at
either 228C (1) or 168C (1). R:FR ratio treatments began after
1 day of adaptation. Light was provided by Osram (Osram Ltd., St.
Helens, UK) L65/80 W/30 warm white fluorescent tubes, photon
irradiance 400–700 nm, 180 mmol m2 sec1. Light conditions for
plants grown under continuous light were as follows: high R:FR
ratio at 228C (1), R:FR ratio ¼ 6.1, photon irradiance 400–700 nm,
91 mmol m2 sec1; at 168C (1), R:FR ratio ¼ 5.8, photon irradi-
ance 400–700 nm, 99 mmol m2 sec1; low R:FR ratio at 228C (1),
R:FR ratio ¼ 0.11, photon irradiance 400–700 nm, 92 mmol
m2 sec1, at 168C (1), R:FR ratio ¼ 0.12, photon irradiance
400–700 nm, 99 mmol m2 sec1.
Plant growth assays
For plants grown under short-day photoperiods, rosette leaf
counts were carried out twice a week. Leaves were counted only
when the petiole was visible to the naked eye. Flowering time was
recorded as primary rosette leaf number at inflorescence produc-
tion. Rosette leaves were distinguished from axillary leaves on the
basis of morphological differences.
Protein extraction and immunoblotting
Proteins were extracted as described previously by Devlin et al.
(1992). After resolution on 8% SDS–polyacrylamide gels, proteins
were electroblotted to an Imobilon-P polyvinylidene difluoride
membrane (Millipore Corp., Bedford, MA). Membranes were
probed with the following monoclonal antibodies: C1 and C13,
specific for phyC (Somers et al., 1991); and 2C1, which is selective
for phyD (Hirschfield et al., 1998). Protein bands were visualized by
secondary incubation with horseradish peroxidase–anti-mouse
immunoglobulin antibodies and chemiluminescence (Amersham
International, Bucks., UK).
Quantitative RT-PCR
Plants were grown under short-day conditions and RNA samples
were prepared from shoot tissue harvested 22 days post-germina-

884 Karen J. Halliday et al.
tion. Tissue was harvested in either the middle of the photoperiod
(FLC and FLM) or the middle of the dark period (CO, FT and SOC1).
RNA was extracted using RNeasy miniprep kits (Qiagen) as per
manufacturer’s instruction and DNA removed with DNA-free
(Ambion). RNA quantification was performed using a TD-360
minifluorometer (Turner Designs) with ribo-green RNA quantifica-
tion system (Molecular Probes). A volume of 2 mg total RNA was
placed in a 40-ml RT-PCR reaction (Qiagen Omniscript), two reac-
tions per treatment.
Quantitative PCR was performed using Brilliant QPCR Core
Reagent kit (Stratagene) and sybr-green (Molecular Probes) on
the MX4000 Multiplex Quantitative PCR System (Stratagene). For
each gene PCR was optimised for MgCl2 concentration, relative
primer concentration and annealing temperature to give linearity
using a standard curve from a dilution series as per manufacturer’s
instructions. Samples from the PCR reactions were gel analysed
using an Agilent Bioanalyser to ensure that only single PCR pro-
ducts were produced. For each gene MgCl2 concentration at 2 mM,
a primer concentration of 150 nM and an annealing temperature of
548C proved optimal PCR conditions. Actin 2 was used as a control
gene (Ratcliffe et al., 2001).
Gene Primer sequence
ACTIN2 F TCAGATGCCCAGAAGTCTTGTTCC
R CCGTACAGATCCTTCCTGATATCC
FLC F CTTGTGGATAGCAAGCTTGT GGG
R CATGAGTTCGGTCTTCTTGGCTC
FT F TACGAAAATCCAAGTCCCACTG
R AAACTCGCGAGTGTTGAAGTTC
FLM F CTTGAGACTGCTCTGTCCGTAAG
R CCAGAACCTGGTTCTCTTCTCTC
SOC1 F CGAGCAAGAAAGACTCAAGTGTTTAAGG
R TTCATGAGATCCCCACTTTTCAGAGAG
CO F GACCACTCTACTCACCACCAAAG
R CAACCTCCTTGGCATCCTTATC
Relative expression levels were determined using the Compara-
tive CT method (User Bulletin 2, ABI PRISM Sequence Detection
System, pp. 11–15, 1997, PE Applied Biosystems).
Acknowledgements
We thank Wendy Stoddart for technical assistance and the BBSRC
for financial support. We also wish to thank John Butler, Eugene
Halligan and Joe Lunec (Oxidative Stress Group, Department of
Clinical Biochemistry, University of Leicester) for helpful assis-
tance with QPCR.
References
Aukerman, M.J., Hirschfeld, M., Wester, L., Weaver, M., Clack, T.,
Amasino, R.M. and Sharrock, R.A. (1997) A deletion in the
PHYD gene of the Arabidopsis Wassilewskija ecotype defines
a role for phytochrome D in red/far-red light sensing. Plant Cell,
9, 1317–1326.
Bagnall, D.J. (1993) Light quality and vernalization interact in
controlling late flowering Arabidopsis ecotypes and mutants.
Ann. Bot. 71, 75–83.
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Blázquez, M.A. and Weigel, D. (1999) Independent regulation of
flowering by phytochrome B and gibberellins in Arabidopsis.
Plant Physiol. 120, 1025–1032.
Botto, J.F. and Smith, H. (2002) Differential genetic variation in
adaptive strategies to a common environmental signal in Ara-
bidopsis accessions: phytochrome-mediated shade avoidance.
Plant Cell Environ. 25, 53–63.
Devlin, P.F., Halliday, K.J., Harberd, N.P. and Whitelam, G.C. (1996)
The rosette habit of Arabidopsis thaliana is dependent upon
phytochrome action: novel phytochromes control internode
elongation and flowering time. Plant J. 10, 1127–1134.
Devlin, P.F., Patel, S.R. and Whitelam, G.C. (1998) Phytochrome E
influences internode elongation and flowering time in Arabi-
dopsis. Plant Cell, 10, 1479–1487.
Devlin, P.F., Robson, P.R., Patel, S.R., Goosey, L., Sharrock, R.A.
and Whitelam, G.C. (1999) Phytochrome D acts in the shade-
avoidance syndrome in Arabidopsis by controlling elongation
growth and flowering time. Plant Physiol. 119, 909–915.
Devlin, P.F., Rood, S.B., Somers, D.E., Quail, P.H. and Whitelam,
G.C. (1992) Photophysiology of the elongated internode (ein)
mutant of Brassica rapa – ein mutant lacks a detectable phyto-
chrome B-like polypeptide. Plant Physiol. 100, 1442–1447.
Donohue, K., Pyle, E.H., Messiqua, D., Heschel, M.S. and Schmitt,
J. (2001) Adaptive divergence in plasticity in natural populations
of Impatiens capensis and its consequences for performance in
novel habitats. Evolution, 55, 692–702.
Dudley, S.A. and Schmitt, J. (1995) Genetic differentiation in
morphological responses to simulated foliage shade between
populations of Impatiens-capensis from open and woodland
sites. Funct. Ecol. 9, 655–666.
Halliday, K.J., Koornneef, M. and Whitelam, G.C. (1994) Phyto-
chrome B, and at least one other phytochrome, mediate the
accelerated flowering response of Arabidopsis thaliana L. to low
red/far-red ratio. Plant Physiol. 104, 1311–1315.
Hepworth, S.R., Valverde, F., Ravenscroft, D., Mouradov, A. and
Coupland, G. (2002) Antagonistic regulation of flowering-time
gene SOC1 by CONSTANS and FLC via separate promoter
motifs. EMBO J. 21, 4327–4337.
Hirschfield, M., Tepperman, J.M., Clack, T., Quail, P.H. and Shar-
rock, R.A. (1998) Coordination of phytochrome levels in phyB
mutants of Arabidopsis as revealed by apoprotein-specific
monoclonal antibodies. Genetics, 149, 523–535.
Johanson, U., West, J., Lister, C., Michaels, S., Amasino, R. and
Dean, C. (2000) Molecular analysis of FRIGIDA, a major deter-
minant of natural variation in Arabidopsis flowering time.
Science, 290, 344–347.
Kardailsky, I., Shukla, V.K., Ahn, J.H., Dagenais, N., Christensen,
S.K., Nguyen, J.T., Chory, J., Harrison, M.J. and Weigel, D.
(1999) Activation tagging of the floral inducer FT. Science,
286, 1962–1965.
Kobayashi, Y., Kaya, H., Goto, K., Iwabuchi, M. and Araki, T. (1999)
A pair of related genes with antagonistic roles in mediating
flowering signals. Science, 286, 1960–1962.
Koornneef, M., Rolff, E. and Spruit, C.J.P. (1980) Genetic control of
light-inhibited hypocotyl elongation in Arabidopsis thaliana (L.).
Heynh Z Pflanzenphysiol. 100S, 147–160.
Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S.,
Kwon, Y.M. and Lee, I. (2000) The AGAMOUS-LIKE 20 MADS
domain protein integrates floral inductive pathways in Arabi-
dopsis. Genes Dev. 14, 2366–2376.
Mazzella, M.A., Cerdan, P.D., Staneloni, R.J. and Casal, J.J. (2001)
Hierarchical coupling of phytochromes and cryptochromes
reconciles stability and light modulation of Arabidopsis devel-
opment. Development, 128, 2291–2299.

Michaels, S.D. and Amasino, R.M. (1999) FLOWERING LOCUS C
encodes a novel MADS domain protein that acts as a repressor
of flowering. Plant Cell, 11, 949–956.
Michaels, S.D. and Amasino, R.M. (2001) Loss of FLOWERING
LOCUS C activity eliminates the late-flowering phenotype of
FRIGIDA and autonomous pathway mutations but not respon-
siveness to vernalization. Plant Cell, 13, 935–941.
Mockler, T.C., Guo, H., Yang, H., Duong, H. and Lin, C. (1999)
Antagonistic actions of Arabidopsis cryptochromes and phyto-
chrome B in the regulation of floral induction. Development,
126, 2073–2082.
Page, T., Macknight, R., Yang, C.H. and Dean, C. (1999) Genetic
interactions of the Arabidopsis flowering time gene FCA, with
genes regulating floral initiation. Plant J. 17, 231–239.
Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995)
The CONSTANS gene of Arabidopsis promotes flowering and
encodes a protein showing similarities to zinc finger transcrip-
tion factors. Cell, 80, 847–857.
Ratcliffe, O.J., Nadzan, G.C., Reuber, T.L. and Riechmann, J.L.
(2001) Regulation of flowering in Arabidopsis by an FLC homo-
logue. Plant Physiol. 126, 122–132.
Rouse, D.T., Sheldon, C.C., Bagnall, D.J., Peacock, W.J. and Den-
nis, E.S. (2002) FLC, a repressor of flowering, is regulated by
genes in different inductive pathways. Plant J. 29, 183–191.
Samach, A. and Coupland, G. (2000) Time measurement and the
control of flowering in plants. Bioessays, 22, 38–47.
Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer,
Z., Yanofsky, M.F. and Coupland, G. (2000) Distinct roles of
CONSTANS target genes in reproductive development of Ara-
bidopsis. Science, 288, 1613–1616.
Scortecci, K.C., Michaels, S.D. and Amasino, R.M. (2001) Identifi-
cation of a MADS-box gene, FLOWERING LOCUS M, that
represses flowering. Plant J. 26, 229–236.
Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J., Edwards, J.A.,
Peacock, W.J. and Dennis, E.S. (1999) The FLF MADS box gene: a
repressor of flowering in Arabidopsis regulated by vernalization
and methylation. Plant Cell, 11, 445–458.
ß Blackwell Publishing Ltd, The Plant Journal, (2003), 33, 875–885
1365313x, 2003, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01674.x by NHS Education for Scotland NES, Edinburgh Central Office, Wiley Online Library on [17/07/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Phytochrome regulation of FT 885
Simpson, G.G. and Dean, C. (2002) Arabidopsis, the Rosetta stone
of flowering time? Science, 296, 285–289.
Simpson, G.G., Gendall, A.R. and Dean, C. (1999) When to switch to
flowering. Annu. Rev. Cell Dev. Biol. 15, 519–550.
Smith, H. and Whitelam, G.C. (1997) The shade avoidance syn-
drome: multiple responses mediated by multiple phyto-
chromes. Plant Cell Environ. 20, 840–844.
Somers, D.E., Sharrock, R.A., Tepperman, J.M. and Quail, P.H.
(1991) The hy3 long hypocotyl mutant of Arabidopsis is deficient
in phytochrome B. Plant Cell, 3, 1263–1274.
Soppe, W.J., Jacobsen, S.E., Alonso-Blanco, C., Jackson, J.P.,
Kakutani, T., Koornneef, M. and Peeters, A.J. (2000) The late
flowering phenotype of fwa mutants is caused by gain-of-
function epigenetic alleles of a homeodomain gene. Mol. Cell,
6, 791–802.
Stearns, S.C. (2002) Progress on canalization. Proc. Natl. Acad. Sci.
USA, 99, 10229–10230.
Stirnberg, P., Chatfield, S.P. and Leyser, H.M. (1999) AXR1 acts
after lateral bud formation to inhibit lateral bud growth in
Arabidopsis. Plant Physiol. 121, 839–847.
Stirnberg, P., van De Sande, K. and Leyser, H.M. (2002) MAX1 and
MAX2 control shoot lateral branching in Arabidopsis. Develop-
ment, 129, 1131–1141.
Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde,
F. and Coupland, G. (2001) CONSTANS mediates between the
circadian clock and the control of flowering in Arabidopsis.
Nature, 410, 1116–1120.
Whitelam, G.C., Johnson, E., Peng, J., Carol, P., Anderson, M.L.,
Cowl, J.S. and Harberd, N.P. (1993) Phytochrome A null mutants
of Arabidopsis display a wild-type phenotype in white light.
Plant Cell, 5, 757–768.
Whitelam, G.C., Patel, S. and Devlin, P.F. (1998) Phytochromes and
photomorphogenesis in Arabidopsis. Philos. Trans. R. Soc.
Lond. B Biol. Sci. 353, 1445–1453.
Yanovsky, M.J. and Kay, S.A. (2002) Molecular basis of
seasonal time measurement in Arabidopsis. Nature, 419,
308–312.