Tap 77 - So 1 Nam 2011

Tai lieu chia se tai: wWw.SinhHoc.edu.
vn
HOG
NGHE
I
AND TECHNOLOGY
ET. MTIIIGINE
Tai lieu chia se tai: wWw.SinhHoc.edu.vn
a0 ctno DUC vA DAo rAo DAI HQC THAI NGUYEN T+p ehi KHOA HQC vn C6NG NGHE Journal of Science and Technology
tn/c:
GS.TS. ru QUANG HrdN PGS.TS. CHU HOANG MAU PGS.TS. TRAN THI VIOT TRUNG
- tdng bi6n tAp: - Ph6 tdng bi6n tAp Thrrdng - Ph6 Tdng bi6n tAp: - Trtt'&ng Ban bi6n tAp: - Thtr ky Tda soan:
THS. Ltr TIEN DUNG THS. DOAN OTJC UAT
az(
TOA SOAN: Dai hoc Thr4i NguyOn, phudng TAn Thinh, thdnh phd Th6i NguyOn' Tel. 02 8 0. 3 8 402 8 8. Fax. 0280. 3852665 * E-mail: tapchikhcn.dhtn@ gmail'com'
Gia,y ph6p Hoat dQng biio
chi s6 1ZI)1GP-BTTTT, ngiry 261812010 cira BQ truong BQ Thong tin - Truyd-n^th0ng' thi4ng 0V20ll. rn ioir .udn, iap zzior)nqdm 20rr taiNhh in eao ihat Nguyen. In xong vh nop luu chidu http://www'lrc-tnu-edu.vn Bin dien tir tham khio iai rrang Web cira Trung ram Hoc 1i0u Dai hoc Th6i Nguyon:
Tai lieu chia se tai: wWw.SinhHoc.edu.vn THE LE GTII BAI

Tap chi Khoa hgc vd C6ng nghQ Dai hoc Th6i Nguy6n thucrng xuyOn nhAn ddng nhirng Ual Uao cua cdn bQ gidng d4y. can.bQ.nghien 9YY ud.6: illkhoa hQc'..trong vir ngouiDui hoo Th6i Nguy6n nhdm cdng bd kt qua nghidn ctlu, bhi t6ng quan hodc nhirng thbng tin trao C6i ttruqc mgi linh vuc khoa hoc c6ng nghQ. Sau ddy ld the 1 gui bdi cho Toa
soan:
1. T4p chi chi nhAn ddng nhirng bai b6o khoa hoc chua c6ng bd tr6n c6c b5o. t4p chi khoa hgc trong nr.rcrc vd qudc t6. 2. Bai b6o khoa h'c co thti v_it bing titing ViQt ho4c ti6ng .. ., 3. Khi n6p cho roa so4n. m5i Uai b6o can duoc in thdnh hai b6n trn giAy A+. kem theo dia CD. 4. CAu trirc bai b6o. 4.1. TOn bai b6o. 4.2. Ho tOn tac gid hoqc nhom ttrc gia, co quan cdng t6c. 4.3. M5i bdi bA; khdng ddi qu6 5 trang (khoang 3.000 tu). Trong bdi b6o, o nhirng nQi tdi liCu khoa hoc kh6c, cAn dung tac gi6 da lham khdo hoAc su dpng_k*i*, n.elrin lit,::. xp trong danh mgc tdi liOu danh dAl tang sd (dat trong m6c r.u6ng tl) - ld sd thu tg cua tdi liQu
Anh. .
.P
tham khao 4.4. Torn tirt n6i dung bdi b6o: tOi tneu i50 tir bang ti6ng Vit va duoc dich sang tiOng Anh (k ca riu AC Uai b6o;,,dtroi muc tom t6t ti6ng Vit co "Tir khoa"; duoi tom tdt ti6ng Anh co "'Key words" (t6i thi6u 05 tu hodc cum tu).
4.5. TAi li6u tham kh6o: - TLTK sip xp theo vAn A,B,C, tdi liQu titlng nu6c ngodi kh6ng phiOn 6m, kh6ng dich. DOi vcyi tdc gia la ngudi Viqt Nam x6p theo thir tg A, B, C theo ftn (kh6ng dAo t6n len trtroc ho). - Ddi voi tac gia la ngtrdi nu6c ngodi x6p theo lhu tg A, B, C theo hp. ,, - D6i vcri nhirng tai liOu khdng co t6n tac giit xOp thu tU A, B, C cua tir dau ti6n lOn c<v quan ban hanh tdi liQu (vi duiB0 Gi6o dgc vd Ddo t4o x6p vAn B)' TLTK la s6ch. lufln 6:n cAn ghi ddy du cdc thong tin theo thu tu: tn t6c gia hodc co quan ban lrdnh. Nam xuAt ban). ftn sdch,Nhd xudt bdn. noi xudt ban. TLTK ld bdi bao hoflc bai trong mQt cudn s6ch... cAn ghi dAy du c6c th6ng.tin.theo thfr tu: T6n tac gia. (NAm cdng b6), "TOn biri b6o", TAn Mp chi hoQc sdch, Tdp, (56), c6c s6 trang (gach ngang giira2 chir s6). 5.Hinh thfrc trinh bay: - Ngoai.phAl tieu d6, t6c gia va tom tit bdi b6.o (dAu tr4ngl) vd Summary (cu6i bdi). bdi b6o yeu .A,, phai trinh bdy tr6n kh6 ,A4 theo chidu doc. dugc chia 02 c6t v6i c6c th6ng s6 Pagesetup cu th6 nhu sau:Top:3.1cm, Bottom: 3.1cm, Left: 3.0cm. Right: 2.8cm, Header: 2.85cm, Footer: 2.85cm, With:7.25cm, Spacing:0.8cm. TOn bai b6o cO 12' chir in d6m: 10i dung bai b6o cd I 1; Font chir Unicode; hinh v6, dd thi trinh bdy phu hqp voi dQ ron-s cdt (7 .25 cn-r); c6c bdng biu qu6 l6n trinh bay tlreo trang ngang (Landscape)' - D6i vcyi c6c bai b6o i.O frle" bdng cdc phAn mdm chuy6n dpng nhu Latex, ACD/Chem Sketch hodc Science Helper for Word cfrng trinh bdy theo khudn dang n6u trOn. 6. Ndu bdi b6o kh6ng ducyc su dung. Ban biOn tap kh6ng tra l4i bAn th6o. 7. Titc gia hoac tac giachfnh trong nhom t6c giA cAn gni Aia chi, s6 di6n tho4i vdo cu6i
BAN BIEN TAP
A^

77 (01)
Nm
soT
Tp ch Khoa hc v Cng ngh
2011
Journal of Science and Technology

CHUYN SAN NNG - SINH - Y
Mc lc
Trang 3
NG XUN HONG, V TH QU - Mt s vn l lun v thc tin v pht trin nng thn nc ta trong giai on hin nay NGUYN TH HNG, NGUYN VIT HNG, THI TH NGC TRM - nh hng ca cc t hp phn bn n sinh trng, pht trin ca ging lc L23 v xun 2010 trn din tch t mt v ti huyn Hu Lng - tnh Lng Sn NGUYN VIT HNG, NGUYN TH HNG, NGUYN TH HUN - Nghin cu nh hng ca hnh thc nhn ging n kh nng sinh trng, pht trin v h s nhn ging ca cy khoai mn ti Bc Kn TRN TRUNG KIN, BI VN QUANG - nh hng ca liu lng ln n sinh trng, pht trin v nng sut ca ging ng cht lng protein cao (QPM) - QP4 v ng thng - LVN10 ti Thi Nguyn NG VN MINH, NGUYN VN TM, L TH THU - Nghin cu nh hng ca phn bn hu c vi sinh sn xut ti ch n sinh trng, pht trin ca ging la CTA 88 ti tnh Lo Cai NGUYN VIT HNG - nh hng ca mt trng n nng sut ging lc L23 v xun 2010 trn t mt v ti Hu Lng - Lng Sn NG VN MINH, O VN NI - Nghin cu kh nng sinh trng ca cy phn xanh h u trn t sau khai thc khong sn ti tnh Thi Nguyn NGUYN HU GIANG - Thc trng qun l v s tham gia ca cng ng a phng trong cng tc qun l bo v rng ti rng c dng Hu Lin, huyn Hu Lng, tnh Lng Sn NG VN MINH, NG KIM VUI, NGUYN CH HIU - Nghin cu kin thc bn a v cy rau b khai Erythropalum scandens BL ti vng ni pha Bc Vit Nam NGUYN HNG QUANG, EBRAHIMI R - Nghin cu nh hng ca cc dng thc n n kh nng sn xut ca g tht NGUYN TH THU M, TRN THANH VN, NGUYN TIN T - Nghin cu nh hng ca ging, mt bi th n kh nng sn xut tht ca g bn nui nht nng h TRN TH HOAN, T TRUNG KIN - Nghin cu nh hng ca khong cch trng sn ly l n sn lng l sn v gi thnh ca bt l sn TRNG HU DNG, NGUYN TH HNH - nh hng ca thi gian cai sa n sinh trng ca ln con v kh nng sinh sn ca ln ni ti Vit Yn, Bc Giang CHU HONG MU, NGUYN V THANH THANH, PHM TH THANH NHN - c tnh chu hn ca mt s ging ng a phng (zea mays l.) min ni pha NGUYN PH HNG, HONG TH THU YN - Nghin cu quan h NGUYN TH THU PHNG,bc vit nam di truyn tm s (peneaus monodon) bng k thut RAPD NGUYN VN HON, L NGC CNG, BI TH DU, NGUYN TH THU H, INH TH PHNG - c im mt s kiu thm thc vt phc hi t nhin tnh Bc Giang M VIT BC, M XUN VN - Bin ng s dng t lm nghip ti x Ngc Phi, huyn Ch n, tnh Bc Kn, Vit Nam (1990-2005) TH NGC OANH - H thng trang tri ca ngi ngho ti khu vc min ni tnh Qung Nam v cc gii php M VIT BC, M XUN VN - Cc nhn t nh hng n bin ng s dng t ti x Ngc Phi, huyn Ch n, tnh Bc Kn, Vit Nam (1990-2005) NGUYN KIM LNG - nh gi hiu qu iu tr ca Simvastatin bnh nhn i tho ng TYP2 c khng insulin
15 19 23 29 35 39 43 49 55 59 65 69 77 83 89 97 103 107 123

77 (01) soT o
Nm
Tp ch Khoa hc v Cng ngh
2011
Journal of Science and Technology

Content
Page
3
AGRICULTURE BIOLOGY MEDICINE

NGO XUAN HOANG, VU THI QUY - Discussion of some problems of practice and development rural in our country in the current period NGUYEN THE HUNG, NGUYEN VIET HUNG, THAI THI NGOC TRAM - The influence of combinations of fertilizers on the yield of l23 peanut variety on one-crop land, Huulung district, Langson province, spring 2010 NGUYEN VIET HUNG, NGUYEN THE HUNG, NGUYEN THE HUAN - Effect of propagation methods on growth, development and propagation regeneration capacity of taro in Backan province Tran Trung Kien, Bui Van Quang - The effect of phosphorus dosages on the growth, development and grain yeild of quality protein maize variety (QPM) - QP4 and normal maize variety - LVN10 in Thai Nguyen DANG VAN MINH, NGUYEN VAN TAM, LE THI THU - Study the offects of organic fertilizers processed in local area on the growth and development of the rice variety cta88 in Laocai province NGUYEN VIET HUNG - The influence of peanut density on the yield of l23 variety on one-crop land, Huulung district, Langson province, spring 2010 DANG VAN MINH, DAO VAN NUI - Study growth of wild legumes in the degraded soil after mining in Thainguyen province NGUYEN HUU GIANG - The current situation of forest management and the participatory of local community in forest protection at huu lien special-use forest, Huulung district, Langson DANG VAN MINH, DANG KIM VUI, NGUYEN CHI HIEU - Indigenous study about native plant species erythropalum scandens bl (Bo khai) in The Northern mountainous region of Vietnam QUANG N. H. AND EBRAHIMI R - Study on different feed form on the performance of broilers chicken NGUYEN THI THUY MY, TRAN THANH VAN, NGUYEN TIEN DAT - Effect of breeds, garden densities to performance of chicken raising semi intensive system at house hold TRAN THI HOAN, TU TRUNG KIEN - Study on effect of crop density on cassava leaf yield and cost of leaf powder TRUONG HUU DUNG, NGUYEN THI HANH - The influence of weaning time on the growth of piglets and reproductive performance of sows in Vietyen district, Bacgiang province CHU HOANG MAU, NGUYEN VU THANH THANH, PHAM THI THANH NHAN - The drought tolerant characteristics of some upland local maize cultivars (zea mays l.) in the North of Vietnam NGUYEN THI THU PHUONG, NGUYEN PHU HUNG, HOANG THI THU YEN - Study genetics diversity of shrimp (penaeus monodon) by rapd technique NGUYEN VAN HOAN, LE NGOC CONG, BUI THI DAU, NGUYEN THI THU HA, DINH THI PHUONG - Characteristics of some natural forest rehabilitation in Bacgiang province DAM VIET BAC, DAM XUAN VAN - Forest land-use change in ngoc phai commune, Chodon district, Backan province, Vietnam (1990-2005) DO THI NGOC OANH - Farming systems of the poor in mountainous areas of Quangnam province and possible solutions DAM VIET BAC, DAM XUAN VAN - Driving forces of land-use change in Ngocphai commune, Chodon district, Backan province, Vietnam (1990-2005) NGUYEN KIM LUONG - Evaluation of the effectiveness of treatment in patients simvastatin typ2 diabetes insulin resistance
15 19 23 29 35 39 43 49 55 59 65 69 77 83 89 97 103 107 123

Ng Xun Hong v cs Tp ch KHOA HC & CNG NGH 77(01): 3 - 13
MT S VN L LUN V THC TIN V PHT TRIN NNG THN NUC TA TRONG GIAI ON HIN NAY
Ng Xun Hong1*,V Th Qu2
1
Trng Cao ng Kinh t - K thut H Thi Nguyn; 2Trng i hc Nng lm - H Thi Nguyn
TM TT
Pht trin nng nghip, nng dn, nng thn l nhim v chin lc m bo thc hin thnh cng ng li cng nghip ho, hin i ho t nc theo nh hng x hi ch ngha, yu cu n lc to ln ca ton ng, c h thng chnh tr v s tham gia ca c x hi. Sau hn 20 nm chuyn i sang nn kinh t th trng, nng nghip v nng thn Vit Nam ch ng khai thc v pht huy cc li th, tim nng v ti nguyn thin nhin, t ai, lao ng v cc iu kin thun li khc y mnh pht trin nn nng nghip sinh thi, xy dng nng thn mi theo hng bn vng vi nhiu vng chuyn canh, sn xut ra nhiu nng sn hng ho xut khu c gi tr kinh t cao nh: go, cao su, c ph, ht iu, tiu, ch, lm sn, thu sn... C cu kinh t nng nghip, nng thn nc ta tng bc chuyn dch theo hng cng nghip ho, i sng ngi dn ngy cng c ci thin, b mt nng thn thay i ng k. Vi quyt tm cao, vi th v lc mi ca t nc, nht nh ng v Nh nc ta s lnh o nhn dn vt qua kh khn th thch, hon thnh cc nhim v ra, p ng mong i v cng c nim tin ca nhn dn vo ng v ch x hi XHCN. T kha: Vn , l lun v thc tin, pht trin, nng thn, Vit Nam
NNG NGHIP, NNG THN V PHT TRIN NNG THN Nng nghip v nng thn Nng thn l mt khi nim ch vng (khu vc) hnh chnh bn ngoi thnh th, i lp vi n l thnh ph, th x; l khu vc lnh th rng ln ngoi thnh ph. Khng gian nng thn trong ting Anh l Rural area (cn gi country hay country site). Trong khng gian nng thn bao gm cc im dn c sinh sng, cng vi cc ngi nh, ci sn, mnh vn, cc din tch cng nng, cc c s h tng nh ng x giao thng, cng vin, khun vin, qung trng, h thng cung ng in nc, h thng tiu thot nc thi, rc thi, cc im phc v cho hot ng cng ch (trng hc, trm x, cu lc b, sn th thao,), cc im mang tnh cht tn gio (n, cha, miu, nh th, ngha trang,), cc im phc v cho kinh t x hi (bu in, nh bo tng, trin lm, ch,), din tch v khong khng dnh cho ngh ngi, gii tr v tnh dng cng nh cc din tch c chng khc.
Tel: 0912140868
Khng gian nng thn khng ng ngha vi vic sn xut nng nghip m rng hn. N m nhn nhiu chc nng i vi x hi. l nhng chc nng c bn nht nh: sn xut lng thc, thc phm cho n cp nc ngt ti cc th, cung cp nng lm, thu hi sn v nhiu ti nguyn khc, cho n cung ng cc khong khng qu him phc v cho ngh dng v du lch sinh thi. Cui cng th khng gian nng thn trong xu th mi cn l ni thng tr ca tiu b phn c dn th cng chung sng vi c dn nng thn. Theo Riedel (1998) th khng gian nng thn thc hin cc chc nng sau: Chc nng nh c; Chc nng sn xut nng nghip; Chc nng sinh thi; Chc nng ngh dng; Chc nng dch v cho cc ngnh. Pht trin nng thn Khi nim v pht trin nng thn rt rng v a dng, thay i theo tng giai on pht trin ca nn kinh t v tu thuc vo c im kinh t x hi ca tng quc gia. + Khi nim pht trin nng thn gn lin vi khi nim pht trin nng nghip, mc tiu chnh ca pht trin nng thn l pht trin sn xut nng nghip qua tng thu nhp v ci thin i sng cho c dn nng thn. 3

Quan nim ny a n s thnh cng ca cuc Cch mng xanh v rt lc quan sau khi gii quyt mt bc v vn an ninh lng thc trong thp k 60. C th ni, pht trin nng thn giai on ny ng ngha vi hin i ho sn xut v i sng cho c dn nng thn. + Ngn hng Th gii nh ngha: Pht trin nng thn l vic ci thin mc sng ca mt s ng ngi c mc thu nhp thp ang sinh sng vng nng thn nhm to nn tin trnh pht trin nng thn mt cch t gic v n nh. nh ngha ny l s k tha chin lc hot ng cho vay vn trn quy m cc quc gia, vi s m bo em li nhiu li ch kinh t nht cho cc nc ny. + i vi cc nc ang pht trin, quan im pht trin nng thn a chc nng nhn mnh vo kha cnh pht trin vng bn, pht trin tng hp c kinh t, x hi, chnh tr, vn ha, mi trng nng thn. Theo nh ngha ca Hi ng th gii v mi trng v pht trin (WCED) th pht trin bn vng l s pht trin p ng cc nhu cu hin ti m khng lm tn hi n kh nng p ng nhu cu ca cc th h tng lai. Nhn chung, ngi ta thng nht v c bn 3 mc tiu ln nht i vi pht trin nng thn, l: (1) m bo s tng trng v kinh t, nng cao thu nhp cho dn c nng thn. (2) Tng phc li x hi, nng cao dn tr v i sng tinh thn cho cng ng ngi dn nng thn. (3) Duy tr s ng vng ca nng thn, bo v mi trng, c bit l trong nhng iu kin qu trnh th ha, cng nghip ha din ra nhanh. Tuy nhin, t c cc mc tiu c bn ny, ni dung pht trin nng thn c th thay i theo tng thi k, giai on pht trin mi quc gia. Trong nhng nc ngho hn, mc tiu pht trin nng thn nghing nhiu v bo m an ninh lng thc v thc y tng trng kinh t, thit lp c s h tng ban u.Trong khi cc nc pht trin v nhng ni qu trnh CNH din ra mnh m, nhng c gng ca Chnh ph tp trung nhiu cc ni dung h tr cho nng thn ng 4
vng, gim thiu nhim mi trng v s pht trin bt bnh ng gia cc vng VAI TR CA NNG NGHIP V NNG THN TRONG PHT TRIN KINH T NC TA Nng nghip, nng dn, nng thn ng vai tr to ln trong s nghip pht trin kinh t x hi, bo v t quc v xy dng ch ngha x hi nc ta. Nng nghip m bo vng chc an ninh lng thc, cung cp nguyn liu cho cng nghip; xut khu nng sn em li ngun ngoi t quan trng cho nn kinh t; to vic lm v thu nhp cho a s ngi dn. Nng thn l mi trng sng ca a s nhn dn, l a bn hot ng sn xut nng nghip, ni bo tn v pht trin cc truyn thng vn ho dn tc. Pht trin nng nghip, nng thn, nng cao i sng vt cht v tinh thn cho nng dn l nhim v chin lc, l c s m bo n nh tnh hnh chnh tr x hi, bo m s pht trin hi ho v bn vng theo nh hng XHCN ca nn kinh t c nc v ca tng vng lnh th. Sau hn 20 nm chuyn i sang nn kinh t th trng, nng nghip v nng thn Vit Nam ch ng khai thc v pht huy cc li th, tim nng v ti nguyn thin nhin, t ai, lao ng v cc iu kin thun li khc y mnh pht trin nn nng nghip sinh thi, xy dng nng thn mi theo hng bn vng vi nhiu vng chuyn canh, sn xut ra nhiu nng sn hng ho xut khu c gi tr kinh t cao nh: go, cao su, c ph, ht iu, tiu, ch, lm sn, thu sn... C cu kinh t nng nghip, nng thn nc ta tng bc chuyn dch theo hng cng nghip ho, i sng ngi dn ngy cng c ci thin, b mt nng thn thay i ng k. t c nhng thnh tu l do c s tp trung lnh o v mi mt ca ng v Nh nc ta trn mt trn nng nghip v pht trin nng thn, c s phi hp ch o cht ch gia cc B, Ban ngnh Trung ng vi cc cp chnh quyn a phng, trong h thng chnh sch u t v huy ng vn ca Nh nc gi vai tr c bit quan trng gp phn thc hin thng li s nghip ny. Vn

u t ca Nh nc, vn ca cc t chc trong v ngoi nc, vn ca ngi dn c huy ng mt cch tch cc vo cng cuc xy dng c s vt cht k thut, gp phn thc y pht trin kinh t, vn ho, x hi nng thn, nng cao hiu qu sn xut nng nghip, xo i gim ngho Hot ng ti chnh v huy ng vn u t vo lnh vc nng nghip, pht trin nng thn ngy cng c x hi ho vi nhiu thnh phn kinh t, nhiu t chc x hi cng tham gia. T s pht trin ca nng nghip bc tranh v x hi nng thn c nhng gam mu ti sng. Tuy nhin cho n nay, Vit Nam v c bn vn l mt nc nng nghip, cha thot khi tnh trng nc ngho v km pht trin, 73,7% dn s sng nng thn vi 13,26 triu h, trong c 11 triu h chuyn sn xut nng nghip v 67% lc lng lao ng x hi lm vic trong ngnh nng nghip, nng nghip vn cn chim ti trn 20% GDP ca c nc. Sc cnh tranh ca c ngnh, ca phn ln cc doanh nghip nng nghip v ca hng ho nng sn xut khu ca nc ta cn nhiu bt cp c v s lng, v cht lng, mu m, chng loi v gi c, kinh nghim v uy tn thng mi trn th trng th gii. Tc hi nhp kinh t ca Vit Nam cn kh khim tn. Xp hng nng lc cnh tranh ca Vit Nam qua cc nm rt thp: Nm 1997 xp th 49/53 nc so snh, nm 2000 xp th 65/80, nm 2004 xp th 77 trong s 102 nc so snh. Hin nay khi nc ta tr thnh thnh vin chnh thc ca T chc Thng mi Th gii (WTO), sn xut nng nghip v nng sn hng ho ca Vit Nam ang ng trc nhiu c hi, ng thi cng ang ng trc nhng kh khn thch thc. p ng nhu cu ca thc tin th vic xy dng nng thn mi l vn cp bch. Xy dng nng thn mi l mt tin trnh ci bin tnh hnh nng thn hin nay ngy cng pht trin vn ti vn minh thi i. Tc l nng cao i sng ngi dn khng nhng ch tp trung vo vic tng cng sn xut nng, lm, ng nghip v pht trin mnh sn xut phi nng nghip m cn nng cao phc li, ci thin mi trng sng c v chnh tr x hi v mi trng sinh thi.
MT S THNH TU XY DNG V PHT TRIN NNG NGHIP NNG THN NC TA Kt cu h tng kinh t-x hi nng thn c tng cng, nht l thu li, giao thng, gp phn thc y pht trin sn xut, lm thay i b mt nng thn Thu li pht trin theo hng a mc tiu gp phn quan trng pht trin sn xut nng nghip. Giai on 2001-2005, nng lc ti tng thm 575 ngn ha, nng lc tiu tng thm 235 ngn ha a tng din tch la c ti ca c nc t khong 83%, c ph 50%, rau mu 20%. H thng qun l, vn hnh h thng thu li c cng c v tng cng nng lc. Vng ven bin tng cng xy dng h thng cc cng p ngn mn, gi nc ngt, nhiu cng trnh a vo s dng v pht huy tc dng. Bc u thc hin cc cng trnh thu li ven bin phc v nui trng thu sn, gn ngt ho vi vic nui trng thu sn nc mn, nc l v tn dng v khai thc thu sn ma l Giao thng v in nng thn: Nh u t ngn sch Nh nc kt hp thc hin phng chm Nh nc v nhn dn cng lm nn lnh vc ny c bc pht trin kh nhanh v s lng. n nay, trn phm vi c nc c: 96,9% s x c ng t n khu trung tm, trong 70% c nha ho, b tng ho. n nay, in li quc gia cp in cho 97,95% s huyn; 96,8% s x, phng v 93,3% s h c s dng in li quc gia. Nh nng thn: n nay, hu ht cc thn, bn trong c nc u c nh 2- 3 tng, s dng cc thit b ni tht nh th; nhiu x, thn nng thn vng ng bng Bc b, vng min Trung c bn hon thnh vic xa nh tranh tre, na l; vng BSCL c bn hon thnh vic xa nh p, nh chi Nhiu huyn, x min Bc v min Trung c bn ngi ho nh . Ring vng BSCL, n nay xy dng 1.100 cm, tuyn dn c, m bo b tr cho khong 200 ngn h dn ang sng thng xuyn trong vng ngp l v sng chung vi l khi c l ln. 5

Trng hc, trm x v ch nng thn: Giai on 2000-2006, xy dng thm 24.466 phng hc, ang trin khai xy dng tip 14.233 phng hc. Do , n nm 2006 c hn 40% s trng hc c kin c ho; 99,3% s x c trng tiu hc, 90,8% s x c trng trung hc c s, 10,8% s x c trng trung hc ph thng; 88,3% s x c trng mu gio/mm non, c 54,5% s thn c lp mu gio, 16,1% s thn c nh tr, thu ht cc chu trong tui c n lp. n nay c nc c 45% s x t chun quc gia v y t x. C 9.013 x c trm y t (chim 99,3% tng s x, tng 128 x so vi nm 2001). Khu vc nng thn c 3.964 trm y t x (chim 44%) c xy dng kin c ho. n nm 2006, c 3348 x, chim 36,9% c c s khm, cha bnh t nhn trn a bn x. n nay, hu ht cc huyn, cm x v nhiu x xy dng c ch. Ring a bn nng thn c 6.940 ch, trong 74,9% s ch c nng cp. Thng tin lin lc: hu ht cc x trn c nc c chuyn pht bo ch, trong c 91% s x c bo n trong ngy. Tnh n nm 2006 lp c hn 2.848 tng i bu in ti vng nng thn, 64/64 tnh thnh c mng cp quang; 100% x c in thoi c nh, bnh qun 6,67 my/100 dn; c hn 80.000 thu bao Internet ti khu vc nng thn; 85,5% s x c im bu in vn ha. Nc sch v v sinh mi trng nng thn: n 2007 c 70% dn c nng thn c nc sinh hot hp v sinh (trong khong 30% ngi dn c dng nc t tiu chun 09 ca B Y t); 12% s x c h thng thot nc thi chung; 28% x c t chc thu gom rc thi v 51% ngi dn nng thn s dng nh tiu hp v sinh. Vn ho - th thao: Cui nm 2007, c nc c 100% s huyn c Trung tm vn ho, th thao; 38,6% s x c nh vn ho; 36% s thn (bn, p) c nh vn ho thn v im vui chi th thao; 6,8% s thn c im vui chi ca tr em. C 28.272 cu lc b vn ho th thao cc loi hnh khu vc nng thn. 6
i sng vt cht, tinh thn ca ngi dn hu ht cc vng nng thn ngy cng c ci thin; xo i gim ngho t thnh tu to ln. Do sn xut pht trin, thu nhp tng, i sng nng dn hu khp cc vng c ci thin r rt. T nm 1996 n nay, thu nhp bnh qun u ngi nng thn tng ln hn 2,7 ln (nm 2007, bnh qun t 6,7 triu ng/ngi theo gi hin hnh); thu nhp bnh qun 1 h nng thn t 26,1 triu ng, tng 11,3 triu ng (tng 75,8% so vi nm 2002). Nh thu nhp ca ngi dn tng nn iu kin sinh hot ca h nng thn ngy cng c ci thin, nht l v nh , mua sm vt dng lu bn, phng tin i li v cc vt dng t tin. Chin lc xa i gim ngho c y mnh vi nhiu chng trnh (Chng trnh 134, Chng trnh 135), chnh sch, hnh thc h tr c th, trc tip cho cc i tng chnh sch, vng su, vng xa, vng ng bo dn tc cn nhiu kh khn. n 2007, v c bn xa c i, t l h ngho khu vc nng thn cn 18% (c nc l 14,9%), mc d chun ngho tng ln. y l thnh tu ln ca nc ta c cng ng quc t nh gi cao. Cng tc n n p ngha, chm sc thng binh, gia nh lit s, ngi c cng v cc i tng chnh sch, cc i tng x hi, c cc cp cc ngnh quan tm, c kt qu thit thc (nm 2005, xy dng v bn giao c 11.000 nh tnh ngha, hn 81.000 nh tnh thng). Vic cu tr cc h b nh hng bi thin tai, dch bnh c thc hin tch cc vi quy m ngy cng ln hn. Ring nm 2007, Chnh ph xut gn 80 ngn tn go d tr quc gia cu tr cc h thiu i do thin tai. Nh nc tng cng u t pht trin s nghip gio dc, y t, vn ha, th dc, th thao nng thn, nht l cc vng cn nhiu kh khn, ng thi thc hin x hi ha nhng vng c iu kin. - Y t: Hu ht cc x c s khm bnh cho ngi ngho, nhiu bnh dch nguy him c pht hin, khng ch kp thi. Nm 2006, 36,9% s x c c s khm cha bnh t nhn; 89,8% s thn c cn b y t. T l ngi c khm, cha bnh nm 2006 khu vc nng thn l 38,1% (cao gp 2 ln nm 2002), 51,6% ngi dn nng thn c bo him y t.

- Gio dc: n nm 2006, t l dn s t 10 tui tr ln bit ch khu vc nng thn tng t 90,9% nm 2002 ln 92% nm 2006. T nm 2007 c chnh sch cho con em cc h ngho, cn ngho v h chnh sch c vay vn vi li sut u i hc tp cc trng i hc, cao ng... (n thng 2 nm 2008 c hn 30% s sinh vin thuc h ngho c vay vn). - Vn ho: Cc hot ng vn ho, thng tin, th dc, th thao c tng cng, nng cao mc hng th v vn ho cho nhn dn. Cc hnh thc nh thng tin, c ng, in v pht hnh sch, ti liu phim nh, pht trin th vin x, nh vn ho x, thn bn, im vui chi gii tr, vn ngh qun chng, vn ho truyn thng v cc loi hnh cu lc b v vn ho nng thn khc c tng cng. Phong tro "Ton dn on kt xy dng i sng vn ho" khi dy tinh thn on kt cng ng dn c, bc u c tc ng hiu qu n xy dng i sng vn ho vng nng thn. Gia nh vn ho, Lng vn ho c cng nhn m bo cht lng c tc ng tch cc n vic xy dng ngi nng dn v t tng, o c, li sng, np sng; to ra b mt nng thn mi, n nh v chnh tr, tng bc pht trin v kinh t - vn ho - x hi. - Th dc, th thao: T l ngi tham gia luyn tp th dc th thao thng xuyn, nng cao th lc hng nm tng ln; hu ht cc huyn nng thn thng xuyn t chc i hi th dc th thao vi s tham gia ng o ca nhn dn. Cc hnh thc t chc sn xut nng thn tip tc c i mi Kinh t h tip tc pht trin theo hng m rng quy m sn xut, a dng ho ngnh ngh, gp phn ch yu to tng trng nng nghip, thu nhp cho nng dn. n nm 2006 c nc c 10,46 triu h nng, lm nghip v thu sn (gim 766 nghn h, gim 6,8% so vi nm 2001). V quy m s dng t, bnh qun mt h nng nghip s dng 0,63 ha t sn xut nng nghip (tng 12% so vi nm 2001). Thc hin dn in i tha, s tha rung bnh qun/h gim t 6 tha xung cn 4-5 tha. Nhiu h c kinh
nghim v sn xut nng nghip c li thu, mn thm t sn xut (nm 2004 c 3,6 % s h thu, mn t nng nghip, n nm 2007 c 19% s h thu, mn t). Kinh t trang tri tip tc pht trin theo hng a ngnh ngh, xut hin ngy cng nhiu gia tri, trang tri chn nui, thu sn t hiu qu kinh t cao. n nay, c nc c hn 110 nghn trang tri, bnh qun 1 trang tri c 4,5 ha, vn 240 triu ng, bnh qun 3,4 lao ng, t sut hng ho t 95,8%. Kinh t hp tc c chuyn bin tch cc: T hp tc pht trin nhanh (840 ngn t), hot ng a dng, ph hp vi trnh ca nng dn, nht l ng bng sng Cu Long. Cc HTX chuyn i v thnh lp mi theo Lut, nhiu HTX thc hin vai tr h tr kinh t ngy cng c hiu qu. Hin c gn 7 ngn HTX nng nghip, trong 84% l HTX chuyn i v 16% thnh lp mi, nm 2005 c 88,8% s HTX nng nghip hot ng c li. H thng chnh tr c s nng thn c tng cng; vai tr lnh o ca t chc ng c nng cao; dn ch c s c pht huy; an ninh, trt t c gi vng n nay, cc t chc ng, chnh quyn v cc on th qun chng cp x, th trn khu vc nng thn c bn c kin ton, 89% s thn, bn c t chc ng, bnh qun 30 ng vin/10.000 dn. Cht lng ng vin v t chc c s ng ngy cng c quan tm, phn loi nm 2006 c 62,7% t chc c s ng t tiu chun vng mnh; hu ht cn b ch cht cp x, th trn t trnh vn ho cp trung hc tr ln; a s qua o to trnh trung cp chnh tr. Phn ln cc t chc ng c s, cc ng vin pht huy tt vai tr l ht nhn gi vng s n nh v t tng chnh tr; nh hng, vn ng t chc nhn dn thc hin cc ch trng, chnh sch ca ng v cc nhim v pht trin nng nghip, nng thn, xy dng cuc sng mi trn a bn. Mt trn T quc Vit Nam cng vi cc on th qun chng ang i mi phng thc hot ng, ng gp tch cc trong vic vn ng nhn dn thc hin cc ch trng, chnh sch ca ng v Nh nc v pht trin nng 7

nghip v kinh t nng thn; cc cuc vn ng do Mt trn T quc Vit Nam ch tr cng vi nhiu phong tro khc ca cc on th gp phn tch cc vo s nghip pht trin nng nghip, nng thn v nng cao i sng, n nh chnh tr, x hi nng thn. Do vic thc hin quy ch dn ch c s ngy cng i vo n np nn n nm 2007, c 100% x, th trn trin khai v thc hin Qui ch dn ch c s theo tinh thn cc ngh quyt ca Trung ng. Ch trng dn bit, dn bn, dn lm, dn kim tra c t chc kh a dng, vi nhiu hnh thc phong ph, cng khai, minh bch nng thn. Ngi dn c iu kin tham gia, gim st cc hot ng ca chnh quyn, t chc chnh tr, x hi a phng c tc ng mnh, lm chuyn bin phng thc lnh o, cng tc iu hnh, qun l v l li lm vic ca cc cp y ng, chnh quyn, Mt trn T quc v cc on th nhn dn; nng cao thm tinh thn trch nhim ca cn b, ng vin, cng chc trong thc thi cng v ng thi tng s ng thun v on kt nng thn. MT S KH KHN V TN TI TRONG PHT TRIN NNG NGHIP NNG THN Nng thn pht trin thiu quy hoch, kt cu h tng kinh t-x hi cn yu km n nay, khong 20% khu dn c nng thn c quy hoch, nhng cht lng thp, qun l thc hin yu km. Hu ht lng, x pht trin t pht, cnh quan nng thn b ph v, nhiu nt vn ha b pha tp. Quy hoch pht trin cng nghip v dch v v nng thn nhiu ni thiu thn trng, t trng cy lng thc c nguy c b st gim nghim trng. Thy li cha p ng nhu cu ca sn xut nng nghip, hin cn 0,7 triu ha t la, 50% din tch c ph, 80% din tch rau mu cha c ti tiu ch ng. Cht lng ng giao thng nng thn thp, cha p ng yu cu lu thng hng ho. in nng thn khng m bo c v cht lng v s lng. Khng t c s khm cha bnh, trng hc cn tm b; nhiu nh vn ha khng pht huy c chc nng l ni sinh hot cng ng. 8
i sng vt cht v tinh thn ca c dn nng thn cn thp, chnh lch giu ngho gia thnh th v nng thn, gia cc vng ngy cng ln; t l h ngho cn cao; pht sinh nhiu vn x hi bc xc Nm 2006 thu nhp bnh qun nng thn ch bng 47,8% so vi th, chnh lch gia nhm thu nhp cao nht vi nhm thp nht nng thn l 6,5 ln. Tuy chun ngho ca nc ta cn thp, nhng t l h ngho nng thn vn cao, hin cn 58 huyn c t l h ngho trn 50%, nht l min ni pha Bc (45 huyn), t l h ngho trong ng bo dn tc thiu s cao gp 3 ln ngi Kinh. Xo i gim ngho cha tht s bn vng, c xu hng chm li, nguy c ti ngho cn cao khi thin tai, dch bnh xy ra Tnh trng thiu vic lm vn gay gt; h thng an sinh x hi chm c hnh thnh. nhiu vng cht lng khm cha bnh, gio dc cn thp, hot ng vn ho, th dc th thao ngho nn. i sng ca mt b phn ln nng dn b thu hi t gp nhiu kh khn; thu nhp t sn xut nng nghip khng sng, lc lng lao ng vo th kim sng ngy cng tng; mt s vng nng thn, t nn x hi gia tng, dn ch c s cha c pht huy ng mc, an ninh trt t din bin phc tp. Nhng vn trn ang to ra nhiu bc xc, bt n trong x hi nng thn. Cng nghip, dch v nng thn pht trin chm cha thc y mnh m chuyn dch c cu kinh t v lao ng nng thn; Cc hnh thc t chc sn xut nng thn i mi chm, cha tr lc tt cho sn xut hng ho S doanh nghip cng nghip, dch v nng thn cn t v tng chm. Rt t nh my trc tip phc v sn xut nng nghip, phn ln vt t nng nghip nh phn bn, thuc th y, bo v thc vt v my mc nng nghip vn phi nhp khu (nm 2007, nhp khu khong 5,5 t USD). T trng nng nghip trong c cu kinh t nng thn cn chim hn 40% so vi 20% ca c nc, nhiu vng ch yu vn l sn xut nng nghip. Chuyn dch lao ng t nng nghip sang cng nghip v dch v cn rt chm, trong giai on 2001-2006, ch gim bnh qun gn 2%/nm. Nng sut lao ng nng nghip cn thp ch bng khong 1/2 ca Thi Lan, Innxia v Philipin.

Kinh t h ng vai tr ch yu, nhng ph bin l quy m nh (36% h c di 0,2 ha). Kinh t trang tri mi ch chim hn 1% tng s h nng, lm, ng nghip ca c nc. Kinh t tp th chm pht trin, nhiu HTX hot ng hnh thc, cha lm tt vai tr cng vi kinh t nh nc dn tr thnh nn tng. i mi, sp xp nng lm trng quc doanh tin hnh chm, vic r sot, iu chnh qu t ai gp nhiu vng mc. Lao ng nng thn thiu vic lm. Cha c c ch, chnh sch mnh thu ht cc doanh nghip u t nhiu vo a bn nng thn. Vn ho - x hi nng thn cn nhiu bt cp nh: H thng an sinh x hi yu km; Mc hng th vn ho ca ngi dn cn thp, t nn x hi gia tng, an ninh trt t c din bin phc tp; X hi nng thn b phn ho, quan h cng ng b tn thng, tnh th ng ca nng dn nhiu ni cn ln Hin cha hnh thnh mt h thng an sinh x hi thng nht v thng sut cho cc vng nng thn. H thng hin hnh mi nhm b p cho nhng ngi c cng, cu tr nht thi cho nhng ngi kh khn khi c dch bnh, thin tai. a s nng dn phi t lo cho bn thn v gia nh khi gp kh khn, ri ro. Hin ti mi c khong 50% dn c nng thn c bo him y t, nhng ngi cn li phi t lo khi b bnh m au. Np sng vn ho chm hnh thnh; kt qu t c trong xy dng np sng vn ho cha bn vng. Thi h, tt xu, t nn x hi vn gia tng. Mc hng th v vn ho ca nng dn cn thp, cn c khong cch qu xa gia cc vng min; sinh hot vn ho cng ng cn ngho nn, thiu sc hp dn, thu ht. Sinh hot vn ho cc vng nng thn ch yu gm cc sinh hot truyn thng. Cc hot ng th dc th thao rt t, ch yu da vo nh trng. Tnh trng nghin ma tu, t nn mi dm, c bc c xu hng pht trin. Mt s h tc vn dai dng, thm ch c ni tri dy, nht l trong ma chay, ci xin Trong nng thn ang din ra s phn tng x hi, s chnh lch v iu kin v mc sng gia tng trong phm vi c nc v mi lng, x. Chnh lch v thu nhp gia nhm 10%
giu nht vi 10% ngho nht nm 2002 l 12,5 ln, nm 2004 l 13,5 ln. Trong khi cc mi quan h cng ng c truyn, nht l quan h lng x - nn tng x hi nng thn nhiu ni b xi mn nghim trng. Nhiu quan h cng ng lng, x trc y c s dng rt c hiu qu th nay ang b hnh chnh ho. Trong khi quan h dng h tip tc tn ti v c ni tri dy mnh m lm mo m cc mi quan h nhiu vng nng thn. Cho ti nay cha c chin lc v pht trin giai cp nng dn. S chuyn dch c cu lao ng nng nghip, nng thn cn mang tnh t pht v thiu s chun b. Cht lng lao ng nng nghip, nng thn cn thp so vi yu cu CNH, HH, nht l vng cao, vng xa. Vic nng cao trnh gic ng chnh tr ca nng dn nhiu ni cha c quan tm thng xuyn ng mc. Nhiu ni quyn li ca nng dn khng c m bo (phi ng gp nhiu, b thua thit khi b thu hi t, vic thc thi dn ch cha c m bo). Tnh trng ngho kh, chnh lch thu nhp v cuc sng, nhng tiu cc trong cuc sng, nht l tnh trng tham nhng, quan liu, ca quyn, thoi ho, bin cht ca mt b phn cn b, ng vin lm nh hng, thm ch xi mn nim tin ca mt b phn nng dn. Mi trng ngy cng nhim, nng lc thch ng, i ph vi thin tai thp. Pht trin sn xut nng nghip, ngnh ngh nng thn thng tp trung vo ti a ho li nhun kinh t, khng quan tm ng mc ti mi trng gy suy thoi nghim trng, bnh dch pht sinh trn din rng ang t ra thch thc ln i vi s nghip pht trin nng thn bn vng. Mi trng nhiu vng nng thn ngy cng b nhim, ch yu do cht thi sinh hot, chn nui, nng dc. Hu ht cc vng ven th, khu cng nghip b nh hng ngy cng trm trng. Nhiu lng ngh b nhim nng n. Trong khi mi ch c 33% s h c nh tiu hp v sinh, 74,7% h c nh tm, 12,2% x c cng trnh thot nc; 28,4% x c t chc thu gom rc thi. Cng vi s bin i ca kh hu ton cu, thin tai c xu hng gia tng c v tn sut v cng , e da nghim trng s pht trin bn vng ca mi vng trong c nc. 9

Trong 10 nm (1995-2005), bnh qun mi nm nc ta phi chu 7 cn bo, 5 trn l, lm mt tch v cht 800 ngi, thit hi vt cht 5.000 t ng. Ring nm 2007, mc d c rt nhiu n lc phng chng, thin tai trn din rng lm cht 462 ngi, thit hi 11.514 t ng, gn bng 1% GDP. Tuy vy, nng lc phng chng cn rt hn ch. H thng cnh bo cn nhiu yu km, nht l vi sng thn, l qut, st l ni. H thng thng tin cha thng sut, nht l vi ng dn trn bin, ngi dn cc vng su, vng xa. C s h tng cn thp km, nhiu cng trnh xy dng cha p ng yu cu k thut phng chng gi bo, l. Hu ht cc vng thiu phng tin cu h, cu nn trong bo l, nht l khi c thm ha ln MT S BI HC KINH NGHIM TRONG PHT TRIN NNG NGHIP V NNG THN NC TA Phong tro "Ton dn on kt xy dng i sng vn ha" Phong tro ton dn on kt xy dng i sng vn ha l mt trong nhng gii php ln thc hin Ngh quyt T. 5 (kha VIII) vi mc ch xy dng nn vn ha Vit Nam tin tin, m bn sc dn tc. Hng ng phong tro ny, hu ht cc a phng quan tm ch o v c nhn dn ng tnh ng h, phong tro ny c xem l cuc vn ng chnh tr - x hi gp phn thc hin thng li nhim v kinh t - x hi ca cc a phng. n nm 2008, c nc c 14/17 triu gia nh t danh hiu gia nh vn ha, t t l 80,67%, trong c 534 ngn gia nh vn ha tiu biu c biu dng ti cc Hi ngh gia nh vn ha tiu biu cc cp. 42/87 ngn lng t tiu chun vn ha, t t l 47,87%, trong c hn 7 ngn lng vn ha tiu biu c khen thng cc cp. c 3.663 x, 37.124 thn (p) c nh vn ha; gn 3 triu cu lc b cc loi hnh, 7 ngn t, i vn ngh qun chng. 70/90 nghn khu dn c c nh gi l thc hin tt np sng vn ha trong vic ci, vic tang, l hi. Thng qua phong tro, cc hot ng ung nc nh ngun, l lnh m l rch, nng dn sn xut gii gip nhau xo i gim ngho, thanh nin lp nghip, t ph n tit kim v hot ng 10
nhn o huy ng hng trm t ng gp phn gii quyt xo nh tm cho cc i tng chnh sch, v tinh thn ny cng th hin r nt ti cc vng su, vng xa, vng kh khn, vng gp phi thin tai. Bn cnh nhng kt qu rt to ln m phong tro t c, cn mt s mt hn ch: Phong tro trin khai cha ng u cc vng, nhiu phong tro c kt qu tt ban u nhng cn thiu tnh bn vng, nhiu quy nh, quy c v np sng vn ha cha c t gic thc hin, cha to ra c nhng chuyn bin r nt, vng chc trong i sng tinh thn ca cn b, ng vin v cc tng lp nhn dn c s, cha p ng c yu cu ca Ngh quyt Trung ng 5 (kha VIII): ...Lm cho vn ha thm su vo ton b i sng v hot ng x hi, vo tng ngi, tng gia nh, tng tp th v cng ng trn a bn dn c, vo mi lnh vc v quan h con ngi.... Thc hin quy ch dn ch v ci cch th tc hnh chnh c s Cuc vn ng chnh tr ny c khi ng t nm 1997 v c trin khai rng ri tt c cc x trong c nc. Theo : Vic huy ng cc khon ng gp ca dn vo vic ca lng, ca x u c bn bc rng ri trong cng ng thn hoc HND x. Hn 95% x, phng, th trn thc hin nim yt cng khai cc th tc hnh chnh, cc khon ph, l ph, ng gp ca dn, cng khai cc phng n sn xut, cc cng trnh xy dng h tng kinh t - x hi nng thn c vn dn gp u c cng ng c Ban gim st hoc Ban Thanh tra nhn dn gim st cht lng v chi tiu. Do c s ng thun trong vic huy ng ni lc xy dng nng thn, cht lng cc cng trnh c nng ln, mu thun trong ni b nng dn gim hn, vic khiu kin ng ngi, trn lan nh thi gian trc c khc phc. Ngi dn c nim tin v tch cc tham gia hn vo cng cuc ci cch nng thn. Vic thc hin quy ch dn ch c s cn gn lin vi qu trnh ci cch th tc hnh chnh cp x, phng. Theo , vic gii quyt cc th tc hnh chnh nh cp giy php xy dng, ng k kinh doanh, a

chnh, h tch, h khu, cng chng; ch cho cc i tng chnh sch c cng khai ho. Nhiu th tc c gii quyt nhanh, gn, gim bt phin h cho nhn dn, c nhn dn ng tnh. Tuy nhin, bn cnh nhng kt qu t c vic thc hin quy ch dn ch c s hin vn cn nhiu vn tn ti cn phi khc phc nh vic thc hin quy ch dn ch gn vi ci cch th tc hnh chnh cn thiu ng b; Nhiu th tc hnh chnh cn rm r, bnh giy t cha gim, lm phin h cho dn phi i li nhiu ln trong khi mt s cng chc c s cn nhng nhiu dn; mt s ni cha hnh thnh c c ch gim st ca ngi dn Chng trnh pht trin nng thn mi cp x Chng trnh pht trin nng thn mi cp x c trin khai ti 14 x im ca B Nng nghip v Pht trin nng thn (tng ln 18 x trong nm 2004) v khong 200 x im ca cc a phng. Chng trnh pht trin nng thn mi cp x bao gm 5 ni dung c bn: pht trin kinh t hng ho vi mt c ch ph hp khai thc c li th ca a phng, c th trng tiu th; pht trin c s h tng ph hp vi nn nng nghip hng ho p ng yu cu cng nghip ho; xy dng khu dn c vn minh; tng cng cng tc vn ho, y t, gio dc trong nng thn v xy dng i ng cn b; tng cng s lnh o ca cp u ng, pht huy vai tr ca cn b t chc qun chng, thc hin tp trung dn ch. Chng trnh pht trin nng thn cp x trin khai c mt s hot ng nh o to cho cn b cc x im, trin khai qui hoch cho 18 x im ca B Nng nghip v Pht trin nng thn, lng ghp cc chng trnh, d n v khuyn nng, nc sch v v sinh mi trng nng thn cho 18 x im. Nh vy, c s h tng v b mt nng thn ca cc x im c s thay i ng k, nhiu h thng nc sch, x l nc thi hnh thnh v i vo hot ng c hiu qu. Sn xut nng nghip v nht l ngnh ngh c hiu qu cao hn, sn phm lm ra cnh tranh c trn a bn trong nc cng nh quc t. Tuy nhin, bn cnh nhng kt qu t c, m hnh pht trin nng thn cp x bc l
mt s tn ti: K hoch xy dng m hnh i hi nhu cu vn rt ln li khng c ngun lc m bo nn hu ht cc m hnh cp x u khng c tnh kh thi. Mt khc m hnh c xy dng theo dng d n u t pht trin nn cn b v ngi dn "im" c tm l li, trng ch vo Nh nc m cha huy ng c ngun lc ca ngi dn v cng ng nn cha mang tnh x hi su sc v v vy thiu tnh bn vng trong xy dng nng thn mi; i ng cn b x tuy c c o to, nhng ni dung o to cha tm, tnh trng ph bin l cha nm vng yu cu v phng php trin khai d n; B my t chc ch o trin khai chng trnh khng c hnh thnh thng nht, ng b t cp trung ng xung cc a phng, khng phn nh r trch nhim ca cc B, ngnh, cc cp chnh quyn trong vic t chc ch o, trin khai, theo di v nh gi chng trnh nn ri rc v hiu qu thp. Phong tro xy dng c s h tng nng thn Phong tro ny c khi ng u nm 2000 v nhanh chng lan rng ra cc vng qu trong c nc hng vo kin c ho giao thng, in, knh mng ni ng, trng hc, trm x, tr s UBND, nh vn ho thn, x... Nhiu tnh p dng phng chm " Nh nc v nhn dn cng lm" c chnh sch h tr thch hp vi cc cng trnh nh h tr t 10-50% gi tr cng trnh bng xi mng hoc vt liu xy dng khc. Phong tro thu ht s tham gia ng gp tch cc ca ngi dn vo ci to iu kin sng v sn xut nng thn. B mt nng thn c i thay nhanh chng. Tuy nhin, phong tro ny cng tn ti mt s hn ch l: - C s h tng phn ln do cng ng t thit k, xy dng thng khng tun th theo cc tiu chun k thut theo quy nh ca nh nc nn ph bin l cht lng thp, khng p ng yu cu bn vng. - Huy ng qu mc s ng gp ca ngi dn v cng ng nn gy phn ng tiu cc trong b phn nhn dn. n th im xy dng m hnh nng thn mi cp thn, bn Nm 2007, B Nng nghip v Pht trin nng thn trin khai th im n Xy dng 11

Nng thn mi theo phng php tip cn mi da vo ni lc v do cng ng lm ch. n th im ny c trin khai 15 thn ti 14 tnh i din cho cc vng kinh t vn ho khc nhau. Ni dung ch yu gm: o to nng cao nng lc pht trin cng ng; Nng cp iu kin sng cho ngi dn nng thn; H tr ngi dn pht trin sn xut hng ho nng nghip, dch v nng thn nng cao thu nhp v pht trin mi lng mt ngh. Qua vic s kt xy dng m hnh nng thn mi sau 2 nm thc hin, n xy dng m hnh nng thn mi ca B Nng nghip v Pht trin nng thn t c 6 ni dung: + hnh thnh c 15 m hnh thc tin v xy dng nng thn mi theo phng php tip cn mi t cng ng v do cng ng lm ch. + Bc u thay i c nhn thc ca cn b c s v ngi dn trong vic xc nh ni dung xy dng nng thn mi, cc bc cng vic phi lm v trnh t tin hnh, cch thc huy ng ni lc ti ch cho xy dng nng thn mi; + hnh thnh c t chc ca ngi dn (Ban pht trin thn bn), l i din ca cng ng dn c thn, bn t ch trong vic bn bc, la chn, quyt nh cc ni dung xy dng nng thn mi v cuc sng trn a bn ca h. + Khi dy thc t ch, sng to ca ngi dn trong pht huy ni lc xy dng nng thn mi, khng li vo tr gip bn ngoi. + Xc nh r hn ni dung, phng php, cch lm, mi quan h phi hp gia cc cp trong xy dng m hnh nng thn mi theo phng php tip cn t cng ng thn, bn. Tuy m hnh cha hon thin, nhng thu ht s quan tm ca nhiu a phng t chc xy dng thm m hnh nng thn mi a phng (ngoi 15 m hnh th im ca B). Tuy vy, cn mt s tn ti: + Nhn thc ca cc ngnh, cc cp mt s a phng v xy dng nng thn mi cn cha y , cha ng vi ch trng ca n.
+ Thiu lc lng t vn chuyn nghip v xy dng nng thn theo phng php tip cn mi nn cn b v ngi dn c s rt lng tng khi thc hin. K hoch ca Ban pht trin thn, bn phi sa i nhiu ln lm chm tin thc hin n. + Cha c c ch ti chnh ring thc hin m hnh nn gy ra rt nhiu kh khn cho c s trong vic tip nhn vn ngn sch. Tm li: Pht trin nng nghip, nng dn, nng thn l nhim v chin lc m bo thc hin thnh cng ng li cng nghip ho, hin i ho t nc theo nh hng x hi ch ngha, yu cu n lc to ln ca ton ng, c h thng chnh tr, s tham gia ca c x hi. Vi quyt tm cao, vi th v lc mi ca t nc, nht nh ng v Nh nc ta s lnh o nhn dn vt qua kh khn th thch, hon thnh cc nhim v ra p ng mong i v cng c nim tin ca nhn dn vo ng v ch x hi XHCN. TI LIU THAM KHO [1]. Ban ch o xy dng n: Nng nghip,
nng dn, nng thn, T trnh B Chnh tr, H Ni thng 6/2008. [2]. B Nng nghip v Pht trin nng thn, n: Chng trnh Mc tiu quc gia xy dng nng thn mi, H Ni, 5/2009. [3]. Chi cc Pht trin nng thn, S Nng nghip v Pht trin nng thn H Ni, n chng trnh Xy dng m hnh nng thn mi Thnh ph H Ni, H Ni, 3/2009. [4]. Nguyn Trung Dng, Pht trin tng hp bn vng khng gian nng thn Hng ti mt lng qu thun Vit trong th k 21, H Ni, 6/2009. [5]. ng Kim Sn, V Trng Bnh, Mt s l lun v pht trin nng thn, Tp ch Nng nghip v Pht trin nng thn s 8/2007. [6]. Nguyn Vn Thng v Nguyn K Tun, (2007), Kinh t Vit Nam nm 2006 Cht lng tng trng v hi nhp kinh t quc t, Nxb i hc Kinh t Quc dn, H Ni. [7]. Nguyn Vn Thng v Nguyn K Tun, (2008), Kinh t Vit Nam nm 2007 Nm u tin gia nhp T chc Thng mi Th gii, Nxb i hc Kinh t Quc dn, H Ni. [8]. Trng i hc Kinh t Quc dn, (2004), Mt s vn kinh t x hi Vit Nam thi k i mi, Nxb Chnh tr Quc gia, H Ni.
12

SUMMARY DISCUSSION OF SOME PROBLEMS OF PRACTICE AND DEVELOPMENT RURAL IN OUR COUNTRY IN THE CURRENT PERIOD
Ngo Xuan Hoang1, Vu Thi Quy2
1
College of Technology and Economics - TNU; 2College of Agriculture and Forestry- TNU
Development of agriculture, farmers and rural areas is a strategic task to ensure successful implementation of the policy of industrialization and modernization of the country under a socialist orientation, requires tremendous effort of the entire Party, the political system and participation of society. After 20 years of transition to market economy discourse, agriculture and rural Vietnam has actively exploit and promote the advantages and potentials of natural resources, land, labor and other things other advantages to boost the development of ecological agriculture and building a new countryside in a sustainable manner with the specialized farming, much agricultural produce export goods with high economic value as: Rice, rubber, coffee, cashew nuts, pepper, tea, forestry, fisheries ... The economic structure of agriculture, rural water. I wish I wish I had step shift towards industrialization, fishing life enough people increasingly improve, face significant changes countryside. With determination, the position and strength of our country, most of the Party and State will lead the people to overcome challenges and fulfill the tasks set out expectations and confidence of People in the Party and the socialist regime society. Key words: Problems, theories and practices, development, rural, Vietnam
Tel: 0912140868
13

Nguyn Th Hng v cs Tp ch KHOA HC & CNG NGH 77(01): 15 - 18
14

NH HNG CA CC T HP PHN BN N SINH TRNG, PHT TRIN CA GING LC L23 V XUN 2010 TRN DIN TCH T MT V TI HUYN HU LNG - TNH LNG SN
Nguyn Th Hng, Nguyn Vit Hng*, Thi Th Ngc Trm
Trng i hc Nng Lm - Thi Nguyn
TM TT
Hu Lng l mt huyn trung du ca tnh Lng Sn, ni c iu kin kh hu, t ai tng i thun li cho cy lc sinh trng pht trin. Th nghim v xun nm 2010 ti Hu Lng tp trung nghin cu nh hng ca cc t hp phn bn n sinh trng pht trin ca cy lc. Kt qu cho thy t hp phn bn (5000 kg phn hu c + 500 kg vi bt +30 kg N +90 kg P 2O5 +60 kg K2O/ha) l thch hp nht vi ging L23 trn t mt v la ca huyn Hu Lng, Lng Sn. T kha: Cy lc, phn bn, nng sut, t mt v
T VN Hu Lng l mt huyn trung du ca tnh Lng Sn, ni c iu kin kh hu, t ai tng i thun li cho cy lc sinh trng pht trin. Tuy nhin hin nay trong qu trnh canh tc lc, ngi dn vn s dng cc ging c v canh tc theo phng thc truyn thng. Nng sut cy lc rt thp, ch yu phc v nhu cu tiu dng ca gia nh, c d tha mi mang bn. Sn xut manh mn v hiu qu kinh t thp. Trong nhng nm gn y, cc nh khoa hc v ang tp trung nghin cu, kho nghim tm ra nhng b ging lc thch hp nht cho tng vng lnh th, trong c vng trung du min ni pha Bc. K hoch ca huyn trong nhng nm ti s trin khai a cc ging lc mi vo sn xut, khuyn co nng dn a cy lc vo cng thc lun canh vi la, ng thi chuyn mt s din tch sn xut la nng sut thp, khng ch ng nc ti sang trng lc. Nghin cu c tin hnh vi mc tiu tm ra t hp phn bn thch hp nhm nng cao nng sut lc trn t mt v la ca huyn Hu Lng, tnh Lng Sn; trn c s , gp phn hon thin quy trnh sn xut lc trn t mt v la ca huyn. PHNG PHP TH NGHIM - Th nghim c tin hnh trn ging lc L23. Th nghim c b tr theo phng
Tel: 0912386574; Email: Hathuyduc2002@yahoo.com
php khi ngu nhin hon chnh gm 05 cng thc, 03 ln nhc li. (1) Nn = 5 tn phn hu c + 500 kg vi bt/ha. (2) Nn + 400 kg NPK (5:10:3)/ha (/c). (3) Nn + 20 kg N + 70 kg P2O5 + 40 kg K2O/ha. (4) Nn + 30 kg N + 90 kg P2O5 + 60 kg K2O/ha. (5) Nn + 40 kg N + 100 kg P2O5 + 80 kg K2O/ha. - Din tch th nghim l 7,5m2 (1,5m x 5m) - S th nghim: 3 x 5 = 15 (). - Tng din tch th nghim: 112,5 m2 (khng k di bo v) - X l s liu th nghim theo phn mm IRRISTAT 4.0. KT QU NGHIN CU nh hng ca cc t hp phn bn n cc giai on sinh trng pht trin ca ging lc L23 v Xun 2010 Sau khi lc mc mm, gp iu kin thun li nn cy lc sinh trng pht trin nhanh, mnh. cng thc 1, lc ra hoa sm nht (31 ngy) v sm hn cng thc i chng 1 ngy. Cng thc 3 lc ra hoa cng vi cng thc i chng (32 ngy). Cc cng thc cn li u ra hoa mun hn i chng (1 - 2 ngy). Cc cng thc th nghim u c thi gian ra hoa di hn hoc bng cng thc i chng. Chnh lch gia cc cng thc khng ln, ch t 1 n 3 ngy. Cng thc 1 c thi gian ra hoa bng cng thc i chng v ngn nht trong cc cng thc th nghim (30 ngy). Tng thi gian sinh trng cc cng thc c 15

chiu hng tng dn theo mc phn bn cc cng thc (t 110 n 118 ngy). Trong , cc cng thc c mc phn bn cao hn i chng (cng thc 3, 4, 5) th c tng thi gian sinh trng u di hn i chng. S cnh cp 1 trn cy cng thc 1 v cng thc 5 thp hn so vi cng thc i chng 0,3 cnh/cy v thp hn chc chn tin cy 95%. S cnh cp 2 trn cy cng thc 1 v cng thc 5 cng thp hn so vi cng thc i chng (0,6 - 0,9 cnh/cy) chc chn tin cy 95%. Cng thc 4 c s cnh cp 2 trn cy cao hn cng thc i chng 0,2 cnh/cy v cao hn chc chn tin cy 95%. Nh vy ta nhn thy kh nng phn
cnh ca ging lc L23 cng thc phn bn 4 l mnh nht. nh hng ca cc t hp phn bn n mc nhim mt s bnh ca ging lc L23 v Xun 2010 Mc nhim bnh cc cng thc u tng ng nhau v tng ng i chng. Bnh g st cc cng thc u nhim nh (cp bnh 3), ring cng thc 1 t l nhim cao hn cc cng thc khc v cao hn i chng (cp bnh 5). Bnh m en v m nu cng tng t, hu ht cc cng thc u cp bnh 3 (nhim nh), ring cng thc 5 th t l nhim bnh cao hn (cp bnh 5), bnh ho xanh vi khun im 1 (nh).
Bng 1. nh hng ca cc t hp phn bn n cc giai on sinh trng pht trinv kh nng phn cnh Cng thc 1 2 (/c) 3 4 5 CV% LSD 5% Thi gian mc...ra hoa (ngy) 31 32 32 33 34 Thi gian ra hoa (ngy) 30 30 31 33 33 Tng thi gian sinh trng (ngy) 110 111 112 115 118 Cnh cp 1 (cnh/cy) 4,9 5,2 5,3 5,2 4,9 2,5 0,2 Cnh cp 2 (cnh/cy) 1,6 2,5 2,6 2,7 1,9 4,4 0,2
Bng 2. nh hng ca cc t hp phn bn n mc nhim mt s bnh ging lc th nghimn L23 v Xun 2010 Bnh hi Cng thc 1 2 (/c) 3 4 5 G st (cp bnh) 5 3 3 3 3 m en (cp bnh) 3 3 3 3 5 m nu (cp bnh) 3 3 3 3 5 Ho xanh VK (im) 1 1 1 1 1
Bng 3. nh hng ca cc t hp phn bn n nng sut v cc yu t cu thnh nng sut ca ging lc L23 v Xun 2010
Cng thc Tng s qu/ cy S qu chc/ cy T l qu 1 nhn (%) T l qu 3 nhn (%) P 100 qu (g) P 100 ht (g) T l ht/qu (%) NS c th (g/cy) NSLT (t/ha) NSTT (t/ha)
1 2 (/c) 3 4 5 CV% LSD 5%
13,6 15,6 17,0 17,5 16,6 3,5 1,1
10,5 12,9 14,2 14,7 14,0 2,3 0,6
13,3 11,1 11,2 9,2 13,4 -
0,6 0,0 0,0 0,0 0,2 -
170,5 171,2 171,6 172,3 172,5 4,1 0,2
68,5 69,1 69,3 70,4 71,1 6,2 0,3
68,2 68,4 68,5 68,6 68,0 3,1 0,2
13,9 18,0 20,3 21,4 20,1 2,8 1,0
46,3 60,0 67,7 71,2 67,1 2,8 3,3
19,1 22,9 26,2 29,3 26,2 4,6 2,2
16

nh hng ca cc t hp phn bn n cc yu t cu thnh nng sut v nng sut ca ging lc L23 v Xun 2010 - nh hng ca cc t hp phn bn n tng s qu/cy: Tng s qu/cy cng thc 1 v cng thc 5 l thp hn so vi cng thc i chng (1,0 - 2,0 qu/cy). Nhng ch cng thc 1 l thp hn chc chn tin cy 95%. Cng thc 3 v cng thc 4 c tng s qu/cy cao hn so vi i chng t 1,4 1,9 qu/cy v chc chn tin cy 95%. - nh hng ca cc t hp phn bn n khi lng 100 qu: Khi lng 100 qu cng thc 1 thp hn so vi cng thc i chng 0,7g v chc chn tin cy 95%. Cc cng thc 3, 4 v 5 u l cc cng thc c khi lng 100 qu cao hn cng thc i chng t 0,4 - 1,3g v chc chn tin cy 95%. - nh hng ca cc t hp phn bn n nng sut l thuyt: Nng sut l thuyt t cao nht cng thc 4 (71,2 t/ha) v nng sut l thuyt thp dn cc cng thc c mc phn bn thp hn v cao hn, thp nht l cng thc 1 vi mc phn bn nn. Nng sut l thuyt cc cng thc 3, 4, 5 cao hn cng thc i chng t 7,1 - 11,2 t/ha v chc chn tin cy 95%. Ring cng thc 1 c nng sut l thuyt thp hn so vi cng thc i chng 13,7 t/ha tin cy 95%. - nh hng ca cc t hp phn bn n nng sut thc thu: Ging nh nng sut l thuyt, nng sut thc thu cc cng thc cng cao nht l cng thc 4 (29,3 t/ha) v thp hn cc cng thc cn li, thp nht l cng thc 1 (19,1 t/ha). Nng sut thc thu
Triu ng/ha
cng thc 1 thp hn so vi cng thc i chng 3,8 t/ha chc chn tin cy 95%. Cng thc 3 v cng thc 5 c nng sut thc thu tng ng nhau v u cao hn so vi cng thc i chng tin cy 95%. nh hng ca cc t hp phn bn khc nhau n hiu qu kinh t ging lc L23 trong v Xun 2010 Qua hch ton kinh t, th nghim nh hng ca cc t hp phn bn khc nhau n ging lc L23 trong v Xun 2010 cho kt qu nh trnh by biu 1. Vi ch chm sc nh nhau v mc u t nh trnh by th ta thy: tng thu v li thun cc cng thc c s khc bit. Cng thc 4 cho nng sut lc cao nht (29,3 t/ha), ng thi tng thu v li thun cng t cao nht so vi cc cng thc khc trong th nghim (31,18 triu ng/ha v 12,77 triu ng/ha). Li thun cao hn cng thc i chng l 4,65 triu ng/ha. cng thc 3 v cng thc 5 cho nng sut nh nhau (26,2 t/ha), nhng do mc chi ph cho phn bn cng thc 5 ln hn (3,2 triu ng/ha) nn li thun thp hn so vi cng thc 3 (3,2 triu ng/ha). Cng thc 3 cho li thun cao hn i chng l 1,33 triu ng/ha, trong khi li thun cng thc 5 li thp hn i chng 1,82 triu ng/ha. Tng thu ca cng thc 1 thp hn so vi cng thc i chng (5,7 triu ng/ha), trong khi mc u t cho cng thc 1 thp hn cng thc i chng 1,44 triu ng/ha nn li thun ca cng thc 1 thp hn i chng 4,26 triu ng/ha.
43.95
50.00 40.00 30.00 20.00

28.65 24.79 26.23 39.30 34.35 29.85
39.30 31.18 33.05
Thu Chi Li thun
12.77
10.00 0.00 1
8.12 3.86
9.45 6.25
2 (/c)
Cng thc
Biu 1. nh hng ca cc t hp phn bn khc nhau n hiu qu kinh t ging lc L23 trong v Xun 2010
17

KT LUN Ging lc L23 c kh nng thch ng tt v ph hp vi iu kin sn xut vng sinh thi huyn Hu Lng, tnh Lng Sn, c ngi dn a phng ng h v n nhn. Kt qu nghin cu ca chng ti bc u xc nh c ging L23 c kh nng cho nng sut cao hn cc ging tham gia th nghim t 5,8 - 11,1 t/ha. Nn c th pht trin rng ra sn xut Hu Lng, Lng Sn. T hp phn bn (5000kg phn hu c + 500kg vi bt + 30kg N + 90kg P2O5 + 60kg K2O/ha) l thch hp nht vi ging L23 trn t mt v la ca huyn Hu Lng, Lng Sn. Cn tip tc nghin cu mt s bin php k thut thm canh lc: mt , mc phn bn cho ging c la chn xc nh c hiu qu ca bin php ny mt cch chc chn, ph bin ra ngoi sn xut ti vng lc Hu Lng, Lng Sn, cng nh cc huyn trong tnh. TI LIU THAM KHO
[1]. Ng Th Dn (ch bin), Nguyn Xun Hng, Th Dung, Nguyn Th Chinh, V Th o, Phm Vn Ton, Trn nh Long, C.L.L. Gowda
(2000), K thut t nng sut lc cao Vit nam. Nxb Nng nghip, H Ni. [2]. ng Hng Dt (2007), Cy lc v bin php thm canh nng cao hiu qu sn xut, Nxb Thanh Ha. [3]. Trn nh Long, Nguyn Vn Chinh, Nguyn Vn Thng, Hong Minh Tm (1999), Tng qua tnh hnh nghin cu pht trin tin b trng lc Vit Nam trong thi gian qua v phng hng trong nhng nm ti, Hi tho v k thut trng lc ton quc Thanh Ho. [4]. Boote K.J., Keting DL. (1990), Growth stages of pranut, Arachis hypogaea L, Jounrnal series, Florida Agricultural Experiment stations. [5]. Gregory W.C; Krapovickas A. and Gregory M. P (1980), Structure variation evoluation and clasification in Arachis; Advances in Legume science. Proceedings of the International Legume Conference. [6]. Sankara Reddi G.H (1988), Cultivation, storage and marketing in groundnut, India Council of Agricultural Research, kridhi Anusandhan Bhavan, Pusa, New Delhi, pp. 318 - 382. [7]. Xu Zeyong (1992), Groundnut production and research in East Asia in the 1980s, in groundnut - a global perspective, ICRISAT, Patancheru, Andhra Pradesh 502324, India, pp.157 - 175.
SUMARY THE INFLUENCE OF COMBINATIONS OF FERTILIZERS ON THE YIELD OF L23 PEANUT VARIETY ON ONE-CROP LAND, HUU LUNG DISTRICT, LANG SON PROVINCE, SPRING 2010
Nguyen The Hung; Nguyen Viet Hung; Thai Thi Ngoc Tram
College of Agriculture and Forestry- TNU
Huu Lung is a midland district of Lang Son Province, where the climatic conditions, land is relatively favorable for peanut growth and development. The experiment in spring 2010 in Huu Lung focused to study the effects of combinations of fertilizers to the growth and development of peanut. Results showed that combined fertilizer (5000 kg manure + 500 kg lime + 30 kg N + 90 kg P2O5 + 60 kg K2O/ha) is most appropriate for a variety L23 on the one-crop land of Huu Lung District, Lang Son. Keywords: Groundpeanut, fertilizers, yield, one-crop land
18

Nguyn Vit Hng v cs Tp ch KHOA HC & CNG NGH 77(01): 19 - 22
NGHIN CU NH HNG CA HNH THC NHN GING N KH NNG SINH TRNG, PHT TRIN V H S NHN GING CA CY KHOAI MN TI BC KN
Nguyn Vit Hng*, Nguyn Th Hng, Nguyn Th Hun
Trng i hc Nng Lm H Thi Nguyn
TM TT
Nghin cu nh hng ca hnh thc nhn ging n kh nng sinh trng, pht trin v kh nng nhn ging ca cy khoai mn ti Bc Kn cho thy: Cy ging khoai mn c nhn ging trng t c G1 t cy invitro c kh nng cho nng sut t 65.65 t/ha, cao hn cy khoai mn ca Bc Kn trng t c con v cy khoai mn nui cy invitro, nhng kh nng nhn ging thp hn cy khoai mn nui cy invitro. Nhn ging khoai mn trng t nui cy invitro cho nng sut cha cao, nhng kh nng nhn ging t cao 7,8 c con/gc tc h s nhn ging t 1/10 cao hn nhn ging bng phng php truyn thng gp gn 02 ln. T kha: Cy mn, khoai mn, nng sut, s c, nhn ging
T VN Cy khoai mn (Colocasia esculeuta L. Schott)l cy mt l mm thuc h ry Araceae, chi Colocasia. y l cy c trng nhiu trn cc loi t khc nhau t t rung vn ng bng n t i dc min ni. Sn phm ca cy khoai mn c dng lm lng thc v c gi tr dinh dng cao. Ti Bc Kn, khoai mn c trng mt s h gia nh thuc vng ng bo dn tc Dao, Ty, Nng, nhng vi din tch nh l nn nng sut thp, sn lng khng ng k. Trong nhng nm va qua, trn a bn tnh c nhng ti, d n h tr nhm gip b con cc dn tc nhn rng din tch trng khoai mn. Mt trong nhng kh khn trong vic pht trin din tch cy khoai mn l thiu ging do h s nhn ging ca cy khoai mn thp. Hn na, vic t chc sn xut v ch o khu tuyn chn ging v u t thm canh cha c ch nn nng sut khoai cha cao, t l c t tiu chun lm ging cn rt thp. Theo Nguyn Th Ngc Hu (2002) h thng cung cp ging khoai mn hin nay l h thng khng chnh thc, ch yu l do nng dn t ging, trao i, mua hoc xin ca h hng trong, gia cc cng ng ln cn do ngun ging pht trin din tch ln gp nhiu kh khn. Nhn ging khoai bng cng ngh nui cy m c p dng nhiu ni trn th gii, cy con
nhn bng phng php nui cy m gi c c tnh di truyn t cy m v c kh nng sinh trng ng u, nng sut c cao, K. Murakami v cs (2006). Vit Nam, nhn ging cy khoai mn bng phng php nui cy m thc s cha c nghin cu. V vy vic nh gi kh nng sinh trng v kh nng nhn ging ca cy khoai mn nhn ging bng nui cy invitro, nhm cung cp ngun ging khoai vi cht lng tt cho tnh Bc Kn. Nn vic nghin cu v nh hng ca hnh thc nhn ging n kh nng sinh trng, pht trin, h s nhn ging cy khoai mn ti Bc Kn l ht sc cn thit. NI DUNG, PHNG PHP NGHIN CU i tng v phm vi nghin cu Th nghim c nghin cu trn cy khoai mn nui cy invitro, c G1 t cy nui cy invitro v c ging ly t c con c trng t nm trc. Tt c cc vt liu nghin cu u c ngun gc t khoai Bc Kn. Ni dung nghin cu - Nghin cu nh hng ca hnh thc nhn ging n kh nng sinh trng, pht trin v nng sut ca khoai mn. Phng php nghin cu Th nghim gm: 03 cng thc c b tr theo khi ngu nhin hon ton vi 03 ln nhc li vi din tch th nghim 20m2. Th nghim c trng vi mt 70cm x 40cm. Cng thc 1: Trng t c con ging khoai mn Bc Kn (/c) 19

Cng thc 2: Trng t c G1 t cy invitro Cng thc 3: Trng t cy invitro - Quy trnh th nghim theo quy trnh sn xut khoai mn ca Trng i hc Nng Lm Thi Nguyn. Cc ch tiu theo di theo phng php th nghim ng rung hin hnh. Thi gian v a im nghin cu - T thng 03 nm 2009 n thng 12 nm 2009 ti th trn Bng Lng, huyn Ch n, tnh Bc Kn KT QU NGHIN CU Nui cy m l mt bin php nhn ging nhanh nhiu loi cy trng, nhng khng phi cy trng no khi tin hnh nhn ging bng phng php ny cng em li hiu qu nh mong mun. xc nh hiu qu chnh xc ca phng php ny i vi cy khoai mn chng ti so snh kh nng sinh trng ca cy khoai mn c nhn ging bng ba hnh thc l cy nui cy invitro, c G1 t cy nui cy invitro v khoai mn Bc Kn, kt qu c trnh by bng 1. S liu bng 1 cho thy: Chiu cao cy ca cy cng thc 1 v cng thc 2 c mc
sinh trng tng ng nhau, t 71,77 72,07cm. Ring cy invitro c mc sinh trng chiu cao thp hn, t 67,40cm. Tng s l /cy chnh ca c ba cng thc tham gia nghin cu t t 8,63 - 8,80 l/cy. S thn ph ca cy quyt nh n s c con ca khoai mn khi thu hoch, kt qu theo di cho thy s thn ph ca cng thc trng t cy nui cy m c s thn ph ln nht t trung bnh 11,2 cy/gc, s sai khc c ngha mc 95%. Kt qu theo di thi gian li l ca cy khoai mn nhn ging bng invitro c thi gian vo cui thng 12, trong khi cy khoai trng t c bi bnh thng th c thi gian li l t u thng 12. Kt qu so cc yu t cu thnh nng sut ca cc loi c khoai mn c th hin qua bng 2. S liu bng 2 cho thy, cy c trng t c G1 cho c ci c kch thc nh ng knh c (58,17mm) v chiu cao c (83,11mm) ln hn hn cng thc 1 v cng thc 3. Khi lng c ci v nng sut l cc ch tiu cui cng c ngi trng khoai quan tm.
Bng 1. nh hng ca hnh thc nhn ging n kh nng sinh trng ca cy khoai mn Bc Kn Cng thc Cng thc 1 (/c) Cng thc 2 Cng thc 3 CV% LSD05 Chiu cao cy cui cng (cm) 72,07 b 71,77 b 67,40 a 9,65 2,80 Tng s l (l/cy) 8,80 a 8,67 a 8,63 a 7,82 0,32 S thn cy ph (cy) 5,2 a 6,9 a 11,2b 8,62 1,91 Thi gian l li ht 5/12 5/12 23/12 -
Bng 2. nh hng ca hnh thc nhn ging n kch thcv trng lng c ci ca ging khoai mn Bc Kn khi thu hoch Ch tiu Cng thc Cng thc 1 (/c) Cng thc 2 Cng thc 3 CV% LSD05 ng knh c ci (mm) 53,94 58,17 51,94 7,13 6,38 Chiu cao c ci (mm) 70,00 83,11 68,67 10,29 7,31 Khi lng c ci (g) 154,10 180,30 150,40 8,96 7,67 So vi /c (%) 100,00 117,00 97,62 -
20

Qua kt qu nghin cu cho thy, khi lng c ci ca cc cng thc th nghim t kh cao, t 150,40 - 180,30g/c. Trong cy trng t c khoai mn Bc Kn v cy nui cy invitro c khi lng c ci tng ng nhau, ring cng thc trng t c G1 cho khi lng c ci cao hn hn, t 180,30 g/c cao hn so vi i chng 17%, s sai khc c ngha mc tin cy 95%. Mt trong nhng kh khn ca vic pht trin din tch trng khoai mn hin nay l thiu ging. Tnh trung bnh mun pht trin 1 ha din tch khoai mn cn t 4-5 t c ging, lng ging khoai mn hin nay ch yu do ngi trng gi li nhng c con t v trc. Chnh v vy vic tng s lng c con cng chnh l mt trong nhng yu t gp phn nng cao h s nhn ging, gp phn gii quyt kh khn v ging cho ngi trng. nh gi kh nng nhn ging ca cc cng thc th nghim thng qua s lng v kch thc ca c con c trnh by qua bng 3. tin cho vic phn loi chng ti phn cc loi c con lm ba loi. Loi 1 l cc c con c ng knh c ln hn 3 cm, loi 2 l cc
C loi 1 S c Khi lng (c) c (g) 2,3 59,3 1,7 60,5 65.65
c c ng knh c t 2-3 cm, loi 3 l cc c nh kch thc nh hn 2 cm. S liu bng 3 cho thy, trong cc cng thc th nghim cng thc khoai trng t cy nui cy m c s tuy s lng c loi 1 khng c, nhng s lng c loi 2 t trung bnh 7,8 c/gc, trong khi cng thc khoai trng t ging G1 v ging khoai c ging bng phng php truyn thng u c s c loi 2 ch t t 2,2-2,4 c/gc. C ba cng thc th nghim u c nhng c con c kch thc nh hn 2cm, loi c ny khi em ra trng cy con pht trin rt km, do vy khi nghin cu bin php k thut cho ging khoai mn Bc Kn cn c bin php ta bt cc thn ph qu nh tng cng dinh dng nui c. nh hng ca cc hnh thc nhn ging cy khoai mn ti nng sut ca cc cng thc th nghim c th hin qua th 1. Nng sut l ch tiu cui cng th hin r nht kt qu sau mt v trng khoai. Trong th nghim, cng thc trng t cy nui cy invitro (cng thc 3) c nng sut tng ng vi i chng (cng thc 1) trng t c con ging khoai mn Bc Kn nhng thp hn cng thc 2.
C loi 2 Khi lng c (g) 41,7 43,5 35,1 C loi 3 Khi lng c (g) 21,4 19,8 20,5
Bng 3. nh hng ca hnh thc nhn ging n s con c/gc v khi lng c ca khoai mn Bc Kn Ch tiu Cng thc Cng thc 1 (/c) Cng thc 2 Cng thc 3
66 64 62 60 58 56 Cng thc 1 Cng thc 2 Cng thc 3 59.59 59.42 Nng sut (t/ha)
S c (c) 2,4 2,2 7,8
S c (c) 3,2 2,6 3,9
th 1. nh hng ca hnh thc nhn ging n nng sut ca khoai mn Bc Kn
21

Tuy vy, s c con li nhiu hn, nn rt ph hp cho mc tiu nhn ging nhanh. Cng thc 2 trng t c G1 c nng sut cao hn hai cng thc cn li, t 65,65 t/ha. Kt qu ny cho thy, vic chn lc ging chun v dng hnh thc nhn ging v tnh invitro nhn ging, sau ly c G1 ca cy invitro trng trong sn xut s gp phn to ra mt rung khoai ng u, v c kh nng cho nng sut cao. KT LUN V NGH Kt lun - Cy khoai mn G1 t cy invitro c kh nng cho nng sut t 65.65 t/ha, cao hn hn cy khoai mn ca Bc Kn trng t c con v cy khoai mn nui cy invitro, nhng kh nng nhn ging thp hn cy khoai mn nui cy invitro. - Cy khoai mn invitro khng cho nng sut cao, nhng c kh nng nhn ging nhanh t 7,8 c con/gc cao gp 2 ln so vi trng bng c truyn thng.
ngh - c kt lun chnh xc hn chng ti xin ngh tip tc nghin cu ti ny trong thi gian ti. TI LIU THAM KHO
[1]. Mai Thch Honh, Nguyn Cng Vinh (2006) Ging v k thut thm canh cy c c Nh xut bn Nng nghip, H Ni [2]. Mai Thch Honh (2006) Chn to v nhn ging cy c c Nxb Nng nghip, H Ni [3]. Nguyn Th Ngc Hu, Nghin cu c s khoa hc xy dng im bo tn ngun gen khoai mn s trn ng rung ti huyn Nho Quan, Ninh Bnh, Tuyn tp cc cng trnh khoa hc k thut nng nghip 2001-2002. [4]. K. Murakami, K. Takashi, K. Ogawa (2006), Morphological variation of corms in plant regenerated from calluses of Taro (Colocasia esculeuta L. Schott), SHS Acta Horticultae 725: V International Symposium on In Vitro Culture and Horticultural Breeding.
SUMMARY EFFECT OF PROPAGATION METHODS ON GROWTH, DEVELOPMENT AND PROPAGATION REGENERATION CAPACITY OF TARO IN BAC KAN PROVINCE
Nguyen Viet Hung, Nguyen The Hung, Nguyen The Huan
Results from a study of effect of propagation methods on growth, development of taro in Bac Kan Province indicated that taro seedlings generating from roots of taro which is generated by in vitro method has yield of 6.565 tons/ha, higher yield but fewer roots than those of taro seedlings generated by in vitro methods. In vitro seedlings did not have high root yield but one seedling had an average of 10.7 roots. It means regeneration rate is more than 10 which is at least two times higher than traditional method. Keywords: Tissue Culture, taro, yield, number of roots, propagation
22

Trn Trung Kin v cs Tp ch KHOA HC & CNG NGH 77(01): 23 - 27
NH HNG CA LIU LNG LN N SINH TRNG, PHT TRIN V NNG SUT CA GING NG CHT LNG PROTEIN CAO (QPM) - QP4 V NG THNG - LVN10 TI THI NGUYN
Trn Trung Kin1, Bi Vn Quang2
1
Trng i hc Nng Lm Thi Nguyn, 2Hi Nng dn Qung Ninh
TM TT
Th nghim vi ging ng QP4 (QPM) v LVN10 (ng thng) vi 5 cng thc bn ln: 0P 2O5 (i chng), 40P2O5, 80P2O5, 120P2O5, 160P2O5 (trn nn: 10 tn phn chung + 120N + 80K 2O) ti Thi Nguyn trong v Xun 2005, Thu ng 2005 v Xun 2006. Kt qu trung bnh ba v cho thy: So vi mc ln 0P2O5 th mc 160P2O5 thi gian sinh trng rt ngn 6 ngy ging QP4 v 7 ngy ging LVN10; Chiu cao cy tng 11,8% (QP4) v 15,6% (LVN10); Ch s din tch l tng 39,1% (QP4) v 44,7% (LVN10); Nng sut tng 90,2% (QP4) v 102,8% (LVN10). Vi hai ging ng QPM - QP4 v ng thng - LVN10, mc ln 120P2O5, c nng sut v hiu qu kinh t u t cao nht. T kho: Hiu qu kinh t, nng sut, ng cht lng protein cao, phn ln
T VN * T nm 2001 - 2005, Vin Nghin cu Ng phi hp vi Trng i hc Nng Lm Thi Nguyn tin hnh kho nghim mt s ging ng th phn t do (TPTD) c cht lng protein cao (QPM) v chn c ging ng QP4 c trin vng, cho nng sut v cht lng protein cao, p ng nhu cu ging ng TPTD QPM cho vng ni kh khn, ni ng bo cc dn tc thiu s vn cn tp qun dng ng lm lng thc chnh. Theo Evangelista (1999) nng sut ng tng ln cng vi vic tng liu lng ln, nng sut ch bt u gim xung khi bn n mc 160 kg P2O5/ha (Trn Vn Minh, 2004). Kt qu nghin cu bc u ca L Vn Hi, ging ng lai HQ2000 t nng sut v hiu qu kinh t cao nht mc phn bn 160N + 120P2O5 + 160K2O (L Vn Hi, 2002). Tuy nhin, vic nghin cu nh hng ca mc bn ln n ging ng TPTD QPM QP4 v ging ng thng - LVN10 vng trung du v min ni pha Bc th cha c nghin cu nc ta. Xut pht t nhu cu l lun v thc tin trn, chng ti thc hin ti "Nghin cu nh hng ca liu lng ln n sinh trng, pht trin v nng sut ca ging ng cht
*
lng protein cao (QPM) - QP4 v ng thng - LVN10 ti Thi Nguyn". VT LIU V PHNG PHP Vt liu nghin cu Ging ng QP4 l ging ng cht lng protein cao c trin vng; LVN10 l ging ng thng; Phn ln Supe (16% P2O5). Phng php nghin cu Th nghim trong 3 v: Xun 2005, Thu ng 2005 v Xun 2006 ti Trng i hc Nng Lm Thi Nguyn, trn t ct pha bc mu. Th nghim hai nhn t c b tr theo kiu Split - plot, 3 ln nhc li, phn ln l nhn t chnh gm 5 cng thc: P1 - 0P2O5 (i chng); P2 - 40P2O5; P3 - 80P2O5; P4 120P2O5; P5 - 160P2O5 (trn nn: 10 tn phn chung + 120N + 80K2O) v hai nhn t ph l G1 - QP4 v G2 - LVN10. Din tch th nghim chnh l 44,1 m2 (10,5 x 4,2 m), ph l 21 m2 (5 x 4,2 m); Gieo 6 hng/ vi khong cch cy 70 x 25 cm. Quy trnh k thut theo Vin Nghin cu Ng v CIMMYT, Quy phm kho nghim phn bn 10TCN216-95. KT QU V THO LUN nh hng ca cc mc ln n thi gian sinh trng S liu Bng 1 cho thy, nh hng ca ln n thi gian sinh trng qua cc cng thc (trung 23
Tel: 0983360276; Email:trantrungkiendhnl@yahoo.com

bnh ba v) th hin rt r. Bn ln tng lm rt ngn thi gian sinh trng, mc ln 160P2O5 cy ng sinh trng ngn hn 6 ngy (QP4) v 7 ngy (LVN10) so vi khng bn ln (0P2O5). nh hng ca mc bn ln n cc ging v Xun t hn v Thu ng 2 ngy (QP4) v 3 ngy (LVN10); nh hng n ging QPM QP4 t hn ging ng thng - LVN10. nh hng ca ln n cc c im hnh thi Trung bnh ca ba v th nghim cho thy, nh hng ca ln n chiu cao cy v chiu cao ng bp ca cc ging rt r, bn tng ln lm tng chiu cao cy v chiu cao ng bp, mc 160P2O5 lm tng thm 11,8% (QP4) v 15,6% (LVN10) so vi khng bn ln (0P2O5). Ging QP4 c chiu cao cy v chiu cao ng bp thp hn ging LVN10,
ng thi nh hng ca ln n chiu cao cy t hn so vi LVN10 (Bng 2). nh hng ca cc mc ln n chiu cao cy v Thu ng cao hn v Xun. nh hng ca ln n s l ca cc ging khng r. Hai ging QP4 v LVN10 c s l tng ng nhau (Bng 3). nh hng ca ln n ch s din tch l ca cc ging rt r, tng dn theo mc bn ln tng, mc 160P2O5 lm tng thm 39,1% QP4 v 44,7% LVN10 so vi khng bn ln (0P2O5). Nh vy, ln nh hng khng ln n s l nhng lm tng ch s din tch l gp phn tng nng sut sau ny. nh hng ca mc bn ln n cc ging v Xun cao hn v Thu ng; ng thi nh hng n ging QPM - QP4 thp hn ging ng thng - LVN10.
Bng 1. nh hng ca liu lng ln n thi gian sinh trng ca ging ng QPM - QP4 v ng thng - LVN10 n v tnh: Ngy CTPB 0P2O5 40P2O5 80P2O5 120P2O5 160P2O5 Tung phn X.05 T.05 X.06 QP4 72 62 72 LVN10 76 66 75 QP4 70 59 69 LVN10 73 62 71 QP4 69 57 67 LVN10 71 60 69 QP4 68 56 66 LVN10 70 58 68 QP4 68 56 66 LVN10 70 57 68 Ging Thi gian t gieo n Phun ru X.05 T.05 X.06 TB 76 66 76 73 80 70 80 77 73 62 72 69 76 65 74 72 71 59 69 66 74 62 72 69 70 58 68 65 72 60 70 67 70 58 68 65 72 59 70 67 Chn X.05 T.05 X.06 121 116 120 127 124 125 120 114 117 125 120 122 119 112 115 124 117 120 118 110 114 123 115 119 117 109 114 122 115 118
TB 69 72 66 69 64 67 63 65 63 65
TB 119 125 117 122 115 120 114 119 113 118
Bng 2. nh hng ca ln n chiu cao cy, chiu cao ng bp ca ging ng QPM - QP4 v ng thng - LVN10 CTPB 0P2O5 40P2O5 80P2O5 120P2O5 160P2O5 Ging QP4 LVN10 QP4 LVN10 QP4 LVN10 QP4 LVN10 QP4 LVN10 X.05 183,1 199,9 189,7 209,7 195,5 219,0 200,7 223,3 203,3 226,6 Cao cy (cm) T.05 X.06 186,8 180,6 194,2 195,7 192,3 186,7 210,0 205,6 197,9 191,6 219,5 214,6 207,6 198,2 226,4 221,0 210,9 201,5 230,3 224,8 TB 183,5 196,6 189,6 208,4 195,0 217,7 202,2 223,6 205,2 227,2 X.05 97,8 108,3 99,9 115,8 104,8 120,2 105,0 122,9 107,5 122,2 Cao ng bp (cm) T.05 X.06 100,5 97,6 114,4 111,5 100,9 97,9 118,3 115,1 102,6 98,7 119,5 118,0 105,4 103,3 121,7 118,3 107,0 108,4 125,6 120,7 TB 98,6 111,4 99,6 116,4 102,0 119,2 104,6 121,0 107,6 122,8
24

nh hng ca ln n kh nng chng chu Trung bnh ba v cho thy, mc bn ln nh hng rt r n t l r v gy thn, bn ln tng lm gim t l r v gy thn, mc 120P2O5 c t l r thp nht v cao nht l mc 0P2O5; mc 120P2O5 160P2O5 c t l gy thn thp hn mc 0P2O5 - 80P2O5. nh hng ca cc mc bn ln n t l r v gy thn v Thu ng t hn v Xun. Mc bn ln khc nhau cng nh hng n mc nhim su c thn v bnh kh vn, bn ln tng lm gim t l nhim su bnh. Mc bn 120P2O5 - 160P2O5 c t l nhim su c thn thp hn mc 0P2O5 - 80P2O5. mc 120P2O5 b nhim bnh kh vn thp nht trong c hai ging. nh hng ca cc mc bn ln n t l nhim su c thn v bnh kh vn v Thu ng t hn v Xun. Nh vy, bn ln c nh hng n kh nng chng chu ca ging QP4 v LVN10, bn mc ln cao 120P2O5 - 160P2O5 ng c kh nng chng chu tt hn mc 0P2O5 80P2O5. Ging QP4 c kh nng chng r, gy thn v su bnh tt hn LVN10. nh hng ca ln n cc yu t cu thnh nng sut v nng sut Mc ln nh hng ln n chiu di bp, mc ln tng th chiu di bp cng tng, mc 160P2O5 chiu di bp tng hn 23,7% (QP4) v 31,1% (LVN10); ng thi ng
knh bp cng tng 26,3% (QP4) v 28,2% (LVN10) so vi khng bn ln (0P2O5). nh hng ca ln n s hng ht/bp khng ln, bin ng t 13,6 (0P 2O5 ) 14,4 hng (120P 2 O5) QP4 v t 13,2 (0P 2O5 ) - 14,1 hng (120P 2 O5 ) LVN10. Ging QP4 c s hng ht/bp trung bnh cao hn ging LVN10 t 3 - 4 hng. Ln nh hng ln n s ht/hng v khi lng 1000 ht. Mc ln tng th s ht/hng cng tng, mc 160P 2O5 tng thm 26,6% (QP4) v 30,7% (LVN10); cng theo khi lng 1000 ht cng tng thm 16,7% (QP4) v 14,3% (LVN10) so vi khng bn ln (0P 2O5). Nng sut l thuyt (NSLT) trung bnh ba v ca cc ging cng tng khi cc mc ln tng t 0P2O5 - 160P2O5, bin ng t 52,6 - 84,2 t/ha (QP4) v t 54,8 - 91,1 t/ha (LVN10). Nh vy, mc 160P2O5 nng sut l thuyt tng thm 60,1% (QP4) v 66,2% (LVN10) so vi khng bn ln (0P2O5). nh hng ca ln n nng sut thc thu (NSTT) trung bnh ba v c th hin r nht, tng theo cc mc ln tng. Nng sut thc thu bin ng t 28,8 (0P2O5) - 54,5 t/ha (160P2O5) QP4 v t 29,8 (0P2O5) - 60,3 t/ha (160P2O5) LVN10, mc 160P2O5, nng sut thc thu tng hn 89,2% QP4 v 102,4% LVN10 so vi khng bn ln (0P2O5). nh hng ca cc mc bn ln n nng sut thc thu v Thu ng t hn v Xun (Bng 4b).
Bng 4a. nh hng ca cc mc ln n cc yu t cu thnh nng sut v nng sutca ging ng QPM - QP4 v ng thng - LVN10 CT PB Ging X.05 13,0 13,6 14,3 14,9 15,1 16,4 15,8 17,0 16,0 17,3 Di bp (cm) T.05 13,4 13,9 14,3 15,2 15,0 16,4 15,7 17,5 16,0 17,9 X.06 12,8 13,0 14,0 14,5 14,5 16,5 15,9 17,8 16,5 18,0 ng knh bp (cm) TB X.05 T.05 X.06 3,8 3,7 13,1 3,9 3,8 3,8 13,5 4,0 4,3 4,1 14,2 4,1 4,3 4,3 14,9 4,3 4,6 4,4 14,9 4,3 4,7 4,7 16,4 4,5 4,9 4,7 15,8 4,5 5,1 4,9 17,4 4,8 4,9 4,8 16,2 4,6 5,2 5,0 17,7 4,9 TB 3,8 3,9 4,2 4,3 4,4 4,6 4,7 4,9 4,8 5,0 HH/ bp (hng) TB 13,6 13,2 14,0 13,7 14,2 13,9 14,4 14,1 14,4 14,1 Ht/hng (ht) X.05 T.05 X.06 26,6 26,5 25,7 28,0 27,6 26,6 29,7 30,5 28,7 30,2 31,6 29,2 31,1 33,8 30,0 33,0 34,9 32,5 31,8 35,0 31,9 34,5 36,8 34,6 31,9 35,4 32,5 34,7 37,3 35,3 TB 26,3 27,4 29,6 30,3 31,6 33,5 32,9 35,3 33,3 35,8
QP4 0P2O5 LVN10 QP4 40P2O5 LVN10 QP4 80P2O5 LVN10 QP4 120P2O5 LVN10 QP4 160P2O5 LVN10
25

Bng 4b. nh hng ca cc mc ln n cc yu t cu thnh nng sut v nng sut ca ging ng QPM - QP4 v ng thng - LVN10 CT PB Ging X.05 260,1 280,7 287,7 299,5 296,3 310,0 307,1 321,6 308,7 325,0 P1000ht (g) T.05 X.06 279,0 265,3 290,7 279,5 300,5 284,0 305,0 298,7 311,3 294,0 316,7 306,7 317,1 309,3 325,0 317,0 318,6 311,1 328,3 319,4 NSLT (t/ha) TB X.05 T.05 X.06 268,1 49,0 58,5 50,3 283,6 52,4 59,3 52,7 290,7 65,2 70,8 64,0 301,1 68,7 71,0 68,9 300,5 70,5 80,0 72,6 311,1 78,3 84,1 79,4 311,2 77,5 87,7 80,7 321,2 85,4 92,3 86,8 312,8 79,9 89,5 83,3 324,2 89,2 93,9 90,1 TB 52,6 54,8 66,7 69,5 74,4 80,6 82,0 88,2 84,2 91,1 NSTT (t/ha) X.05 T.05 X.06 25,3 32,3 28,9 27,6 31,2 30,5 35,7 42,7 39,0 39,0 43,8 42,1 44,5 50,3 47,0 48,3 53,7 51,9 50,5 55,5 54,3 56,7 61,7 59,7 51,7 56,8 55,0 57,9 62,1 60,9 TB 28,8 29,8 39,1 41,6 47,3 51,3 53,4 59,4 54,5 60,3
QP4 0P2O5 LVN10 QP4 40P2O5 LVN10 QP4 80P2O5 LVN10 QP4 120P2O5 LVN10 QP4 160P2O5 LVN10
Bng 5. nh hng ca mc 160P2O5 so vi mc 0P2O5 mt s ch tiu chnh i vi hai ging ng QPM - QP4 v ng thng - LVN10 Ch tiu Thi gian sinh trng Chiu cao cy Ch s din tch l Nng sut thc thu n v tnh X.05 Ngy -4 % + 11,0 % + 45,8 % + 104,3 QP4 T.05 X.06 -7 -6 + 12,9 + 11,6 + 37,0 + 34,6 + 75,9 + 90,3 LVN10 TB X.05 T.05 X.06 TB -5 -9 -7 -6 -7 + 11,8 + 13,4 + 18,6 + 14,9 + 15,6 + 39,1 + 54,2 + 39,3 40,7 + 44,7 + 90,2 + 109,8 + 99,0 + 99,7 102,8 +
Qua x l thng k ba v cho thy, tt c cc cng thc c bn ln (40P2O5 - 160P2O5) u c nng sut thc thu cao hn cng thc khng bn ln (0P2O5) mc tin cy 99%; Cng thc 120P2O5 v 160P2O5 c nng sut thc thu thc thu tng ng nhau mc tin cy 95%. Ging QP4 t NSTT trung bnh qua cc cng thc bn ln thp hn ging LVN10 mc tin cy 95%. Trung bnh ba v th nghim cho thy, nh hng ca cc liu lng ln n mt s ch tiu chnh ca ging QPM - QP4 v ng thng - LVN10 rt r. cng thc 160P2O5, kt qu cc ch tiu t c tng thm nhiu so vi i chng khng bn ln (0P2O5) (Bng 5). nh hng ca cc mc ln n cc ch tiu chnh ca ging QPM - QP4 thp hn so vi ging ng thng - LVN10. Hiu qu kinh t qua cc cng thc bn ln mc khng bn ln (0P 2O5) do nng sut thc thu trung bnh ba v ca hai ging QP4 v LVN10 t rt thp nn hiu qu kinh t t thp nht. Vi mc bn 120P 2O5 c hai ging QP4 v LVN10 t hiu qu kinh t cao nht. Tm li, nh hng ca ln n cc ging ng rt r rt, nng sut ng tng ln cng vi vic 26
tng liu lng ln, kt qu ny cng ph hp vi nghin cu ca Evangelista (1999). KT LUN Kt qu trung bnh ba v th nghim cho thy: So vi mc ln 0P2O5 th mc 160P2O5 thi gian sinh trng rt ngn 6 ngy ging QP4 v 7 ngy ging LVN10; Chiu cao cy tng 11,8% (QP4) v 15,6% (LVN10); Ch s din tch l tng 39,1% (QP4) v 44,7% (LVN10); Nng sut tng 90,2% (QP4) v 102,8% (LVN10). Vi hai ging ng QPM - QP4 v ng thng - LVN10, mc ln 120P2O5 c nng sut v hiu qu kinh t u t cao nht. TI LIU THAM KHO
[1]. Afendulop K.P. (1972), nh hng ca phn bn n qu trnh pht trin cc c quan ca cy ng (ti liu dch), Mt s kt qu nghin cu ca cy ng, Nxb Khoa hc v K thut, H Ni. [2]. Chudry G.A., Ghulam - Habib, Muh amad Sadg, Khan. M.A., Eff of Nitrogen, Phosphorus and plant population on gain afield of dryland maize. [3]. CIMMYT (2001), The Quality Protein Maize Revolution (Nguyn Tin Trng, L Qu Kha dch).

[4]. Cook. G.W. (1975), Fertilizing for maximum yield. [5]. De. Geus (1973), Fertilizer guide for tropic and sutropic. [6]. G. F. Sprague, J. W. Dudley (1988), Corn and corn improvement. [7]. L Vn Hi (2002), Nghin cu phn ng ca ging ng lai cht lng protein cao HQ2000 vi phn bn trn t bc mu huyn Hip Ha - Bc Giang, Lun vn Thc s khoa hc Nng nghip.
[8]. Trn Trung Kin, Phan Xun Ho (2007), nh hng ca liu lng m n sinh trng, pht trin v nng sut ca ging ng cht lng protein cao (QPM) - QP4 v ng thng - LVN10 ti Thi Nguyn, Tp ch Khoa hc v Cng ngh nng nghip Vit Nam, S 4(5)/2007. 9, Trn Vn Minh (2004), Cy ng - nghin cu v sn xut, Nxb Nng nghip, H Ni.
SUMMARY THE EFFECT OF PHOSPHORUS DOSAGES ON THE GROWTH, DEVELOPMENT AND GRAIN YEILD OF QUALITY PROTEIN MAIZE VARIETY (QPM) - QP4 AND NORMAL MAIZE VARIETY - LVN10 IN THAI NGUYEN
Tran Trung Kien1*, Bui Van Quang2
1
College of Agriculture and Forestry - TNU, Quang Ninh Province Farmers Association
Experiment on 5 levels of phosphorus, as the main plots, combined with 2 varieties, as subplots, was undertaken in Thai Nguyen in the 2005 spring, in the 2005 winter - autumn and in the 2006 spring crop of corn. This experiment was arranged as Split - plot design having 3 replicates. Five main plots are P1 - 0P2O5; P2 - 40P2O5; P3 - 80P2O5; P4 - 120P2O5; P5 - 160P2O5 and two subplots are G1 - QP4 (QPM); G2 - LVN10 (normal maize). The research results (average of three crop) showed that: The mutunity durations of corn varieties at the level of 160P2O5 shorter than the control 6 days for QP4 and 7 days for LVN10; Plant 's height increased 11,8% for QP4 and by 15,6% for LVN10; Leaf area index increased 39,1% for QP4 and by 44,7% for LVN10; Grain yield increased 90,2% for QP4 and by 102,8% for LVN10. At the level of 120P 2O5, QP4 (QPM) and LVN10 (normal maize) reached the highest yield and economic effectiveness. Key words: Economic effectiveness, grain yield, quality protein maize, phosphorus
Tel: 0983360276; Email: trantrungkiendhnl@yahoo.com
27

28

ng Vn Minh v cs Tp ch KHOA HC & CNG NGH 77(01): 29 - 33
NGHIN CU NH HNG CA PHN BN HU C VI SINH SN XUT TI CH N SINH TRNG, PHT TRIN CA GING LA CTA 88 TI TNH LO CAI
ng Vn Minh1*, Nguyn Vn Tm1, L Th Thu2
1 2
Trng i hc Nng Lm H Thi Nguyn; Trm Khuyn nng huyn Bt Xt, tnh Lo Cai
TM TT
Nghin cu sn xut v s dng phn bn hu c vi sinh ch bin ti ch c tin hnh ti tnh Lo Cai. Nghin cu bao gm hai th nghim. Th nghim 1, s dng ch phm sinh hc EMUNIV x l rm r, cht n chung thnh phn hu c. Th nghim 2, tc gi s dng phn hu c vi sinh c ch bin t th nghim 1 nghin cu s nh hng ca chng ti sinh trng, pht trin ca ging la CTA 88. Th nghim gm 7 cng thc, s dng hai loi phn c ch bin t rm r v cht n chung vi cc mc bn 3 tn, 6 tn, 9 tn trn ha vi mc nn 60N + 60P 2O5 + 50 K20. Hu ht cc cng thc c bn thm phn hu c u c nng sut cao hn cng thc i chng, c bit l cc cng thc bn mc 9 tn/ha. T kha: Phn hu c, la, v ma, Coc San
T VN Thc trng mi trng nng thn Vit Nam hin nay ang c nhiu vn tn ti. Mt trong nhng tn ti l s pht sinh rc thi sinh hot c bit l cc cht thi t ph ph phm nng nghip. a s ngi nng dn thng ngh rng ph ph phm nng nghip l rc thi v l th b i. H tm cch loi b n hoc tm cch t b cc loi ph ph phm sau khi thu hoch nng nghip. iu ny s gy nhim mi trng v lng ph ngun nguyn liu phn bn v a s ph ph phm nng nghip u l cc cht hu c nn d dng phn hu nu c bin php x l hp l. Tuy nhin vic s dng phn bn hu c cho la tr thnh nhu cu khng th thiu c vi nng dn vng xui, nhng vn cha c thc s coi trng nhiu a phng do nhn thc ca ngi dn cha y v thiu ngun phn bn hu c (Nguyn Vn B, 2003). gii quyt cc kh khn trn, hin nay c nhiu phng php s dng cc ch phm vi sinh vt x l rc v ph phm nng nghip lm phn bn v ci to t (Jones P.T.C and Mollison J.L,.1984; L Vn Nhng, 2001; Phm Vn Ton, 2004; Nguyn M Hoa; 2008). Trn a bn x Cc San, huyn Bt Xt, tnh Lo Cai, mc d mt khi lng ln ph ph
Tel:0912334310; Email:dangminh08@gmail.com
phm nng nghip (5,36 tn/h/nm) (S liu iu tra nm 2009) ang b lng ph nhng cc h nng dn li b ra mt lng tin ln mua phn ha hc (0,147 tn/h/nm) (S liu iu tra 2009) phc v cho sn xut nng nghip. iu ny khng ch lm tng chi ph trong sn xut nng nghip v cn nh hng nghim trong n h sinh thi. V vy vic x l ph ph phm nng nghip lm phn bn phc v sn xut nng nghip khng ch tn dng c ngun rc thi m cn em li nhiu li ch v kinh t, x hi v mi trng. VT LIU V PHNG PHP TH NGHIM Nghin cu c tin hnh trong nm 2009 v 2010 ti x Cc San, huyn Bt Xt, tnh Lo Cai. Bao gm 2 ni dung: Ni dung 1: X l mt s ph phm nng nghip thnh phn hu c bng ch phm sinh hc EMUNIV - Cng thc th nghim gm: + Cng thc 1: 800kg rm + 100kg phn chung + 1 gi EMUNIV 500g. + Cng thc 2: 800kg cht n chung + 1 gi EMUNIV 500g. - Quy trnh x l: Nguyn liu, phn chung c chia lm 6 phn. Mt gi ch phm EMUNIV 500g c ha tan vo 20 lt nc. Ri u mt lp nguyn liu ri n mt lp phn chung v 29

ti mt lp ch phm EMUNIV, c nh vy cho n khi ht nguyn liu. Sau khi xong, ta phi che y ng bng bt, bao ti hoc nilon. C khong 10 - 15 ngy tin hnh o trn mt ln. - Cht lng phn bn c phn tch ti Trung tm ti nguyn v bo v mi trng tnh Vnh Phc Ni dung 2: Nghin cu nh hng ca phn hu c c sn xut t rm, cht n chung n sinh trng, pht trin ca ging la CTA 88 - Thi gian, a im: V ma nm 2010 ti x Cc San, huyn Bt Xt, tnh Lo Cai. - Vt liu nghin cu: Ging la CTA 88 nhp ni t Thi Lan - Cng thc th nghim: gm 7 cng thc + Cng thc 1: 60N +60 P2O5 + 50 K2O + 3 tn phn hu c t rm r + Cng thc 2: 60N + 60 P2O5 + 50 K2O + 6 tn phn hu c t rm r + Cng thc 3: 60N +60 P2O5 + 50 K2O + 9 tn phn hu c t rm r + Cng thc 4 : 60N +60 P2O5 + 50 K2O + 3 tn phn hu c t cht n chung + Cng thc 5: 60N +60 P2O5 + 50 K2O + 6 tn phn hu c t cht n chung + Cng thc 6: 60N +60 P2O5 + 50 K2O + 9 tn phn hu c t cht n chung
+ Cng thc 7 (i chng): 60N +60 P2O5 + 50 K2O - Phng php b tr th nghim: Th nghim c b tr theo kiu khi ngu nhin hon chnh vi ba ln nhc li (din tch mi 2,5 m x 3m) - Cc ch tiu theo di c tin hnh bng phng php nghin cu ca Vin nghin cu la quc t (IRRI). KT QU NGHIN CU Thnh phn cc cht dinh dng trong sn phm phn bn c ch bin t ph ph phm nng nghip. Cht lng sn phm phn bn ch bin t cht n chung v rm c x l bng EMUNIV u c cht lng tt, pH ca hai loi phn u thuc khong trung tnh. Hm lng N tng s v P2O5 tng s ca hai loi sn phm l ngang nhau. Tuy nhin, hm lng K2O tng s ca sn phm c ch bin t rm rt cao, chim 3,10% (Bng 1). nh hng ca cc cng thc bn phn hu c vi sinh n chiu cao cy ca ging la CTA 88 Chiu cao cy ca cy la chnh l kt qu ca s tng trng thn l. Chiu cao cy ph thuc vo nhiu yu t nh nhit , nh sng, phn bn.
Bng 1. Cht lng ca cc sn phm phn bn hu c Tn mu Rm + EMUNIV Cht n chung + EMUNIV Cc ch tiu P2O5 TS N TS (%) (%) 1,56 0,784 1,45 0,982 P 2O 5 (mg/100g) 26,11 32,10 K2O TS (%) 3,10 2,02
pHKCl 7,05 7,32
Mn (%) 22,11 25,41
Bng 2: nh hng ca cc cng thc bn phn hu c vi sinh n chiu cao cy ca ging la CTA 88 n v: cm Tun sau nhnh Cng thc 2 4 6 8 CT 1 51.90 74.86 94.09 109.66 CT 2 49.60 70.00 93.30 108.16 CT 3 51.86 70.43 91.96 111.66 CT 4 53.26 76.90 98.83 107.80 CT 5 49.60 74.60 96.30 110.00 CT 6 52.13 77.36 98.03 107.66 CT /c 53.06 75.56 96.66 112.60 CV % 4.0 4.7 4.2 4.1 LSD0,05 3.66 6.15 7.06 7.96
30

Kt qu nghin cu bng 2 cho thy: Chiu cao cy tng dn qua cc tun theo di. Tuy nhin chiu cao cy ca cc cng thc th nghim khc nhau khng nhiu. iu cho thy cc cng thc phn bn khc nhau khng nh hng nhiu n chiu cao cy cc giai on sinh trng pht trin. nh hng ca cc cng thc bn phn hu c vi sinh n s nhnh ca ging la CTA 88 S nhnh l mt ch tiu quan trng c lin quan cht ch n qu trnh hnh thnh s bng hu hiu v nng sut thu hoch. Kt qu nghin cu (Bng 3) cho thy: - Giai on t tun th 2 n tun th 4 sau nhnh, giai on cy la pht trin tng i hon chnh, cng vi thi tit rt thun li cho nhnh, c bit l ch nc ti ph hp nn tc nhnh t cao nht.
- T tun th 4 n tun th 8 sau nhnh, mc d s nhnh/khm vn tip tc tng nhng vi tc thp hn, v s nhnh la gn nh t ti a tun th 8 sau nhnh. tun ny, s nhnh cc cng thc dao ng t 12.25 nhnh/khm n 17.66 nhnh/khm. Cc cng thc 2, 3, 5, 6 s nhnh/khm c s sai khc vi cng thc i chng mc tin cy 95 %. Cng thc 1, 4 s nhnh/khm khng c s sai khc so vi cng thc i chng.. iu ny cho thy, cc cng thc khc nhau c nh hng ln n s nhnh. S nhnh/khm thng tng theo lng phn bn tng. nh hng ca cc cng thc bn phn hu c vi sinh n kh nng tch lu vt cht kh ca ging la CTA 88 Kh nng tch lu vt cht kh l mt ch tiu quan trng nh hng ti nng sut. Kh nng tch lu cht kh ca cy la cng cao th tim nng cho nng sut cng ln.
Bng 3. nh hng ca cc cng thc bn phn hu c vi sinh n s nhnh ca ging la CTA 88 n v: nhnh/khm Tun sau nhnh Cng thc 2 4 6 8 CT 1 5.85 10.60 12.50 14.63 CT 2 7.00 11.80 13.66 15.60 CT 3 6.90 11.16 16.06 17.33 CT 4 6.16 11.06 12.91 12.25 CT 5 7.58 12.20 14.58 16.76 CT 6 7.41 11.00 15.43 17.66 CT /c 7.58 10.20 12.41 12.73 CV % 9.7 12.3 14.0 14.3 LSD0,05 1.17 2.39 3.42 3.83 Bng 4. nh hng ca cc cng thc bn phn hu c vi sinh n kh nng tch lu vt cht kh ca ging la CTA 88 n v: g/khm Cng thc CT 1 CT 2 CT 3 CT 4 CT 5 CT 6 CT /c CV % LSD0,05 nhnh hu hiu 6.06 6.56 6.66 6.06 6.23 6.36 5.76 3.8 0.41 Giai on sinh trng Tr bng 15.06 18.83 19.20 17.00 17.63 18.43 16.00 2.3 0.69 Chn sp 21.00 25.86 26.73 23.66 24.20 24.80 22.06 2.6 1.07
31

Kt qu th hin bng 4 cho thy: - Giai on nhnh hu hiu: Kh nng tch lu vt cht kh dao ng t 5,76 6,66 g/khm. Trong cc cng thc 2, 3, 5, 6 cao hn cng thc i chng, sai khc c ngha mc tin cy 95%, cc cng thc cn li u khng sai khc so vi i chng. - Thi k tr bng: Qua theo di ta thy kh nng tch lu vt cht kh ca ging la CTA88 trong cc cng thc th nghim dao ng t 15.06 - 19.20 g/khm. Trong cng thc 3 c kt qu cao nht t 19,20 g/khm - Thi k chn sp: Giai on ny lng vt cht kh tch ly c trong cy t kh cao (t 21.00 - 26.73 g/khm), t cao nht cng thc 3. S nh hng ca cc mc phn bn trong giai on ny th hin r nht khi bn phn hu c ch bin t rm ra. Khi tng mc phn bn t 3 tn/ha ln 9 tn/ha lm tng mnh khi lng cht kh. nh hng ca cc cng thc bn phn hu c vi sinh n yu t cu thnh nng sut v nng sut ca ging la CTA 88 Nng sut la l yu t quan trng nht phn nh kt qu sinh trng, pht trin ca cy la. Nng sut la c to thnh bi cc yu t nh: S bng/m2, s ht chc/bng v khi lng 1000 ht. - S bng/m2: Trong cc yu t cu thnh nng sut la th s bng l yu t c tnh cht quyt nh nht v sm nht. Trong th nghim ta thy s bng/m2 l yu t c bin
ng ln v chu nh hng rt r ca cc cng thc bn phn, gia cc cng thc s bng/m2 dao ng t 620.50 n 720.82 bng/m2. - S ht chc/bng: S ht chc/bng trong cc cng thc th nghim t t 67.77 n 73.33 ht chc/bng, trong t cao nht cng thc 6. iu cho thy cng thc 6 t hiu qu cao nht trong vic quyt nh s ht chc trn bng. - Trng lng 1000 ht: Trng lng 1000 ht l yu t ph thuc rt nhiu vo bn cht di truyn ging. Tuy nhin trong thc t, trng lng 1000 ht s t gn gi tr tuyt i ca ging khi c thm canh hp l. - Nng sut l thuyt: Nng sut l thuyt th hin tim nng cho nng sut ca ging. Trong cc cng thc th nghim, nng sut t t 101.76 n 130,40 t/ha. Nng sut l thuyt t cao nht cng thc 6. - Nng sut thc thu: Nng sut thc thu l yu t c quan tm nht. Nng sut thc thu trong cc cng thc t kh cao t 56.33 n 67.03 t/ha. Tt c cc cng thc th nghim u c nng sut cao hn cng thc i chng, s sai khc chc chn mc tin cy 95%. nh hng ca phn bn n nng sut thc thu cho thy, nng sut thc thu tng khi bn tng lng phn hu c v nng sut thc thu t cao nht khi bn vi lng 9 tn/ha.
Bng 5. nh hng ca cc cng thc bn phn hu c vi sinh n yu t cu thnh nng sut v nng sut ca ging la CTA 88 Cng thc CT 1 CT 2 CT 3 CT 4 CT 5 CT 6 CT /c CV % LSD0,05 Cc ch tiu theo di S bng/m 670,34 710.64 716,18 668.30 665.13 720.82 620.50 2
Tng ht/bng Ht hc/bng 80,30 70,23 86,74 68,29 87.57 70.64 85.14 71.33 83.73 72.67 87.66 73.33 79.80 67.77 -
P1000 ht (g) 24,87 24.82 25.03 24.93 24.93 24.67 24.20 -
NSLT (t/ha) NSTT (t/ha) 117.08 61.63 120.45 64.23 126.63 67.03 118.84 61.53 120.50 63.5 130,40 65.00 101.76 56.33 4.5 4.99
32

KT LUN - Cc ph ph phm nng nghip rt a dng l ngun nguyn liu tt x l thnh phn hu c. Cht lng phn hu c x l t rm r v cht n chung u c cht lng tt. Trong t l K2O tng s ca phn hu c ch bin t rm cao hn (3,10%) phn hu c ch bin t cht n chung (1,02%) . T l cc cht dinh dng khc trong hai loi phn l tng ng nhau. - Phn hu c c ch bin t rm r v cht n chung u c nh hng tch cc n s nhnh/khm, n kh nng tch ly vt cht kh, cc yu t cu thnh nng sut v nng sut thc thu. Vi mc nn l 60N + 60 P2O5 + 50 K2O th nng sut thc thu ca ging la CTA 88 cng tng khi bn tng lng phn hu c. Bn phn hu c vi mc 9 tn/ha s cho nng sut cao nht.
TI LIU THAM KHO [1]. Nguyn Vn B (2003), Bn phn cn i cho

cy trng Vit Nam, Nxb Nng nghip (tr 24 - 37) [2]. Dilly.O and blume.H.P (1998), Indicators to assess sustainable land use with reference to soil microbiology, Advances in Geoecology 31, Inter. Soci of Soil Sci (ISSS), 23-48 [3]. Nguyn M Hoa, (2008) nh gi cht lng phn hu c vi sinh vi sinh c t ngun ph thi thc vt nng thn Tp ch Khoa hc t, S 30/2008 [4]. L Vn Nhng (2001), Cng ngh x l mt s ph thi nng sn ch yu (l ma, v thi c ph, rc thi nng nghip) thnh phn bn hu c sinh hc. ti KHCN 02-04B (2001) [5]. Phm Vn Ton (2004) Nghin cu cng ngh sn xut phn bn vi sinh vt a chng, phn bn chc nng phc v chm sc cy trng cho mt s vng sinh thi. ti Khoa hc cp Nh nc KC.04.04 (2001-2004)
SUMMARY STUDY THE OFFECTS OF ORGANIC FERTILIZERS PROCESSED IN LOCAL AREA ON THE GROWTH AND DEVELOPMENT OF THE RICE VARIETY CTA88 IN LAO CAI PROVINCE
Dang Van Minh1, Nguyen Van Tam1, Le Thi Thu2
2
College of Agriculture and Forestry- TNU Extension station in Bat Xat, Lao Cai province
The study was conducted in Coc San commune, Bat Xat district, Lao Cai province. The study consists of two experiments. In experiment 1, the authors used the biologic production EMUNIV to process straws and breeding wastes into organic fertilizers. These organic fertilizers were analyzed quality and the results showed that their whole quality is very good. In experiment 2, the authors used the organic fertilizers proceesed in experiment 1 to study their effects on the growth and development of the rice variety CTA 88. Experiment 2 consists 7 treatments ( including one control treatment), uses two kinds of organic fertilizers which were processed from straws and breeding wastes on the levels of 3 tons, 6 tons, 9 tons/ha and 60N + 60P 2O5 + 50 K20. Allmost all treatments which were added organic fertilizers increased rice yields, especially the treatments with 9 tons/ha. Keywords: Organic fertilize, rice, summer crop, Coc San
Tel:0912334310; Email: dangminh08@gmail.com
33

34

Nguyn Vit Hng Tp ch KHOA HC & CNG NGH 77(01): 35 - 38
NH HNG CA MT TRNG N NNG SUT GING LC L23 V XUN 2010 TRN T MT V TI HU LNG - LNG SN
Nguyn Vit Hng*
Trng i hc Nng Lm - H Thi Nguyn
TM TT
Cy lc c vai tr quan trng trong cng thc lun canh vi la, gp phn ci to t, cho hiu qu kinh t cao v tng thu nhp trn n v din tch. Ging lc L23 c trng trong th nghim v xun 2010 ti Hu Lng - Lng Sn vi 05 mt khc nhau t 25 - 50 cy/m2. Trong , mt trng lc L23 cng tha cho kt qu v thi gian sinh trng cng di v kh nng phn cnh cng ln. Mt gieo trng ging lc L23 thch hp nht trn t mt v la l 33 cy/m2 (30 x 10 cm). T kha: Cy lc, mt , nng sut, t mt v
T VN Lc (Arachis hypogaea line) l cy cng nghip ngn ngy, cy thc phm, cy ly du c gi tr kinh t cao, c kh nng ci to t tt. Trong nhng nm gn y, cc nh khoa hc v ang tp trung nghin cu, kho nghim tm ra nhng b ging lc thch hp nht cho tng vng lnh th. Sn xut lc Vit Nam ang tip cn dn vi tin b khoa hc th gii, gp phn y mnh sn xut, tng nng sut v sn lng, dn p ng c nhu cu cho tiu dng v cng nghip ch bin trong nc v xut khu. Tuy nhin hin nay trong qu trnh canh tc lc, ngi dn vn s dng cc ging c v canh tc theo phng thc truyn thng. Nng sut cy lc rt thp, hiu qu kinh t thp. Xut pht t thc t , chng ti tin hnh nghin cu ti vi mc tiu tm ra mt trng thch hp nhm nng cao nng sut lc trn t mt v la ca huyn Hu Lng, tnh Lng Sn; trn c s , gp phn hon thin quy trnh sn xut lc trn t mt v la ca huyn. PHNG PHP TH NGHIM - Th nghim c tin hnh trn t mt v vi ging lc L23 v c b tr theo phng php khi ngu nhin hon chnh gm 05 cng thc, 03 ln nhc li. Cc cng thc th nghim bao gm: (1) Mt 50 cy/m2 (20 x 10cm). (2) Mt 40 cy/m2 (25 x 10cm). (3) Mt 33 cy/m2 (30 x 10cm). (4) Mt 25
cy/m2 (40 x 10cm). (5) Mt 29 cy/m2 (35 x 10cm) (/c). Mt i chng l mt hin nay c ngi dn a phng trng ph bin. - Din tch th nghim l 8 m2 (1,6m x 5m) (khng k rnh). - S th nghim: 3 x 5 = 15 (). KT QU NGHIN CU nh hng ca mt trng n cc giai on sinh trng pht trin v kh nng phn cnh ca ging lc L23 v Xun 2010 Mt trng c nh hng n thi gian sinh trng ca lc L23. Tng thi gian sinh trng cc cng thc c chiu hng tng dn theo khong cch trng cc cng thc (t 110 n 115 ngy). Nh vy c ngha l mt cng tha th thi gian sinh trng cng di. Mt cng c nh hng n kh nng phn cnh ca cy. Kh nng phn cnh cng ln khi mt cng tha. C th qua s liu bng 1 ta thy s cnh cp 1 c s khc nhau khng chc chn gia cc cng thc tin cy 95%. Ring ch c cng thc 5 c s cnh cao hn (5,2 cnh/cy). Nh vy s cnh cp 1 khng chu nh hng nhiu bi mt . S cnh cp 2 c s khc bit gia cc cng thc tng i ln. So vi i chng, cng thc 1 c s cnh cp 2 t hn 1,2 cnh/cy, cng thc 2 t hn 0,9 cnh/cy, cng thc 3 t hn 0,2 cnh/cy. Ring c cng thc 4 nhiu hn i chng 0,1 cnh/cy. C ngha l s cnh cp 2 cng thc 1, 2 thp hn i chng tin cy 95%. 35

nh hng ca mt trng n mc nhim bnh ging lc L23 v Xun 2010 V c bn, L23 l mt ging khng bnh. Trong v Xun 2010, ging lc L23 cc cng thc mt khc nhau ch nhim mt s bnh thng thng trn cy lc nh g st, m en, m nu hay ho xanh vi khun mc nh v rt nh. Mc nhim bnh cc cng thc u tng ng nhau v tng ng i chng. Bnh g st, m en u cp bnh 3 (nh), bnh ho xanh vi khun im 1 (nh). Ring bnh m nu, cc cng thc 3, 4, 5 cng cp bnh 3 (nh), nhng cng thc 1, 2 th mc nhim bnh cao hn (cp 5). nh hng ca mt trng n cc yu t cu thnh nng sut v nng sut - nh hng ca mt n tng s qu/cy: So vi cng thc i chng, tng s qu/cy cc cng thc 1, 2 v 3 thp hn t 1,1 n 6,7 qu/cy l chc chn tin cy 95%. Tng s qu cng thc 4 khng sai khc so vi i chng. Nh vy tng s qu/cy cng thc 4 v cng thc i chng l tng ng nhau v cao hn cc cng thc cn li chc chn tin cy 95%. - nh hng ca mt n khi lng 100 ht: cng thc 1 v 2 c khi lng 100 ht thp hn i chng t 5,2 n 5,7 g chc chn tin cy 95%. Cc cng thc 3 v 4 c khi lng 100 tng ng so vi i chng. - nh hng ca mt n nng sut l thuyt: Cng thc 1 v cng thc 4 cho kt qu nng sut l thuyt thp hn i chng 5,4 - 7,3 t/ha v thp hn chc chn tin cy 95%. Cng thc 3 c nng sut l thuyt cao nht t 67,5 t/ha cao hn chc chn so vi i chng 7,8 t/ha tin cy 95%. Cng thc 2 c nng sut l thuyt t 56,6 t/ha tng ng i chng. - nh hng ca mt n nng sut thc thu: Cng thc 1 v cng thc 4 cho kt qu nng sut thc thu thp hn i chng t 3,7 4,0 t/ha chc chn tin cy 95%. Cng thc 2 cho kt qu nng sut thc th cao hn i chng 1,1 t/ha, nhng khng chc chn tin cy 95%. C ngha l nng sut thc thu cng thc 2 tng ng vi i chng. 36
Ring ch c cng thc 3 l cho nng sut thc thu cao nht, cao hn 6,5 t/ha so vi i chng v chc chn tin cy 95%. nh hng ca mt n tng s qu/cy: So vi cng thc i chng, tng s qu/cy cc cng thc 1, 2 v 3 thp hn t 1,1 n 6,7 qu/cy l chc chn tin cy 95%. Tng s qu cng thc 4 khng sai khc so vi i chng. Nh vy tng s qu/cy cng thc 4 v cng thc i chng l tng ng nhau v cao hn cc cng thc cn li chc chn tin cy 95%. - nh hng ca mt n khi lng 100 ht: cng thc 1 v 2 c khi lng 100 ht thp hn i chng t 5,2 n 5,7 g chc chn tin cy 95%. Cc cng thc 3 v 4 c khi lng 100 tng ng so vi i chng. - nh hng ca mt n nng sut l thuyt: Cng thc 1 v cng thc 4 cho kt qu nng sut l thuyt thp hn i chng 5,4 - 7,3 t/ha v thp hn chc chn tin cy 95%. Cng thc 3 c nng sut l thuyt cao nht t 67,5 t/ha cao hn chc chn so vi i chng 7,8 t/ha tin cy 95%. Cng thc 2 c nng sut l thuyt t 56,6 t/ha tng ng i chng. - nh hng ca mt n nng sut thc thu: Cng thc 1 v cng thc 4 cho kt qu nng sut thc thu thp hn i chng t 3,7 4,0 t/ha chc chn tin cy 95%. Cng thc 2 cho kt qu nng sut thc thu cao hn i chng 1,1 t/ha, nhng khng chc chn tin cy 95%. C ngha l nng sut thc thu cng thc 2 tng ng vi i chng. Ring ch c cng thc 3 l cho nng sut thc thu cao nht, cao hn 6,5 t/ha so vi i chng v chc chn tin cy 95%. nh hng ca mt trng hiu qu kinh t ca ging lc L23 trong v Xun 2010 Kt qu hch ton kinh t cc cng thc trng mt khc nhau i vi ging lc L23 trong v Xun 2010 c th hin di qua biu 1. Mt cng ln th chi ph cho ging cng cao. cng thc 1 vi mt 50 cy/m2 th chi ph cho ging l ln nht nn tng chi ph cng cao nht (32,32 triu ng/ha). Tip , chi ph gim dn cc cng thc 2, 3, 5 v thp nht cng thc 4 (30,54 triu ng/ha).

Bng 1. nh hng ca mt n cc thi gian sinh trng v kh nng phn cnh ca cc ging lc L23 v Xun 2010 Cng thc 1 2 3 4 5 (/c) CV LSD05 Bnh hi Cng thc 1 2 3 4 5 (/c) Tng thi gian sinh trng (ngy) 110 110 112 115 114 G st (cp bnh) 3 3 3 3 3 Cnh cp 1 (cnh/cy) 5,1 5,1 5,1 5.2 5,1 3,1 0,3 m en (cp bnh) 3 3 3 3 3 m nu (cp bnh) 5 5 3 3 3 Cnh cp 2 (cnh/cy) 1,5 1,8 2,5 2,8 2,7 6,1 0,3 Ho xanh VK (im) 1 1 1 1 1
Bng 2. nh hng ca mt n mc nhim mt s bnh ging lc L23 v Xun 2010
Bng 3. nh hng ca mt trng n nng sut v cc yu t cu thnh nng sut ca ging lc L23 v Xun 2010 Cng thc Tng S qu T l s qu chc qu 1 /cy /cy nhn (%) 11,1 8,1 9,6 13,5 10,0 14,1 16,7 13,6 9,2 18,0 13,8 8,7 17,8 13,6 10,1 3,6 2,3 1,0 0,5 T l qu 3 nhn (%) 4,5 0,0 1,5 0,2 0,0 P 100 qu (g) 171,2 171,5 172,5 173,6 173,9 0,2 0,7 P 100 ht (g) 70,1 69,6 75,6 75,5 75,3 0,5 0,6 T l ht/ qu (%) 67,6 68,4 69,8 69,5 69,6 0,2 0,3 NS c th (g/cy) 10,9 14,2 20,5 21,0 20,6 2,7 0,9 NSLT (t/ha) NSTT (t/ha)
1 2 3 4 5 (/c) CV% LSD.05
54,3 56,6 67,5 52,4 59,7 3,2 3,5
19,6 24,4 29,8 19,3 23,3 4,5 2,0
Triu ng/ha
50 40 30 20
32.32 29.4 36.6 31.76
44.7
34.95 31.18 30.54 28.95 30.95
Thu Chi Li thun
13.52
10
2.92
4.84 1.59
4.11
0 1 2 3 4 5 (/c) Cng thc

Biu 1. nh hng ca mt trng n hiu qu kinh t ca lc L23 v Xun 2010 * Ghi ch: Gi lc v chi ph sn xut tnh ti thi im tin hnh th nghim ti Lng Sn
37

Trn cng mt iu kin chm sc v mc u t (phn bn, thuc BVTV, nhn cng) nh vy th cc cng thc mt khc nhau cho kt qu nng sut thc thu khc nhau v dn n mc li thun khc nhau. Trong , cng thc 3 vi mt 33 cy/m2 cho nng sut, tng thu v li thun cao nht (29,8 t/ha, 44,7 triu ng/ha v 13,52 triu ng/ha). Li thun cao hn cng thc i chng 9,41 triu ng/ha. KT LUN Mt trng c nh hng n thi gian sinh trng ca lc L23. Mt cng tha th thi gian sinh trng cng di. Mt cng c nh hng n kh nng phn cnh ca cy. Kh nng phn cnh cng ln khi mt cng tha. Nng sut thc thu ca lc L23 tng dn v t cao nht cng thc mt trng 33 cy/m2. Khi mt tng cao hn t 33 cy/m2 n 50 cy/m2 th nng sut thc thu gim dn. Mt gieo trng ging lc L23 thch hp trn t mt v la huyn Hu Lng, Lng Sn l 33 cy/m2 (30 x 10 cm).
TI LIU THAM KHO

[1]. Ng Th Dn (ch bin), Nguyn Xun Hng, Th Dung, Nguyn Th Chinh, V Th o, Phm Vn Ton, Trn nh Long, C.L.L. Gowda (2000), K thut t nng sut lc cao Vit Nam. Nxb Nng nghip, H Ni. [2]. ng Hng Dt (2007), Cy lc v bin php thm canh nng cao hiu qu sn xut, Nxb Thanh Ha. [3]. Trn nh Long, Nguyn Vn Chinh, Nguyn Vn Thng, Hong Minh Tm (1999), Tng quan tnh hnh nghin cu pht trin tin b trng lc Vit Nam trong thi gian qua v phng hng trong nhng nm ti, Hi tho v k thut trng lc ton quc Thanh Ho. [4]. Boote K.J., Keting DL. (1990), Growth stages of pranut, Arachis hypogaea L, Jounrnal series, Florida Agricultural Experiment stations. [5]. Gregory W.C; Krapovickas A. and Gregory M. P (1980), Structure variation evoluation and clasification in Arachis; Advances in Legume science. Proceedings of the International Legume Conference. [6]. Sankara Reddi G.H (1988), Cultivation, storage and marketing in groundnut, India Council of Agricultural Research, kridhi Anusandhan Bhavan, Pusa, New Delhi, pp. 318 - 382.
SUMMARY THE INFLUENCE OF PEANUT DENSITY ON THE YIELD OF L23 VARIETY ON ONE-CROP LAND, HUU LUNG DISTRICT, LANG SON PROVINCE, SPRING 2010
Nguyen Viet Hung
Peanut has an important role in rotation with rice, contributing to soil improvement, increasing economic efficiency and revenue per unit area. L23 peanut variety was grown in the experiment of spring 2010 in Huu Lung - Lang Son with different 05 densities from 25 to 50 plants/m2. Between them, the smaller density of L23 results in the longer the growing time and greater ability to branch. Density planting peanut variety L23 on the most suitable one-crop land was 33 cay/m2 (30x10cm). Key words: Groundpeanu, density, yield, one-crop land
38

NGHIN CU KH NNG SINH TRNG CA CY PHN XANH H U TRN T SAU KHAI THC KHONG SN TI TNH THI NGUYN
ng Vn Minh*, o Vn Ni
Trng i hc Nng - Lm H Thi Nguyn
TM TT
t sau khai thc khong sn ti Thi Nguyn chim din tch ln, b thoi ha v bc mu. Hin nay c nhiu phng php khc nhau c p dng ci to t b thoi ho, bc mu, ngho kit v c t b nhim, trong c vic s dng cc bin php sinh hc. Mc tiu chnh ca nghin cu ny l th nghim cc loi cy phn xanh h u ci to t ngho kit dinh dng v thoi ha do khai thc khong sn. Bng vic la chn mt s cy phn xanh h u v trng th nghim trn t sau khai khong, nghin cu xc nh c cy trinh n khng gai v cy mung l nhn c kh nng sinh trng tt v to sinh khi cao ci to t sau khai khong. T kha: Ci to t, t sau khai khong, cy phn xanh h u
GII THIU Khai thc khong sn Thi Nguyn chim 1 din tch ln v lm thu hp din tch t sn xut nng nghip. Qu trnh khai thc lm mt kh nng canh tc ca t nng lm nghip nh: t ln t trng trt, nc thi bn t do qu trnh tuyn qung vi lp t canh tc, Mt yu cu cp thit t ra lm th no phc hi li kh nng canh tc ca t, khc phc hu qu do khai thc khong sn li. t sau khai thc khong sn hu ht khng cn kh nng canh tc nng lm nghip, b hoang, lm thu hp din tch t sn xut nng nghip. Phc hi li kh nng canh tc ca t, khc phc hu qu do khai thc khong sn li bng bin php sinh hc l mt hng i mi, s dng cc loi cy h u ci to t [1], [4], [5]. Mc ch ca nghin cu ny l xc nh mt s loi cy phn xanh h u c kh nng sinh trng tt trn t sau khai khong ti tnh Thi Nguyn ci to v phc hi loi t ny cho sn xut nng lm nghip . PHNG PHP NGHIN CU Cy ci to t bn a v nhp ni c trng trn t sau khai thc qung st v c hon th. Nghin cu c tin hnh 2009-2010. a im nghin cu b tr th
nghim l cc bi thi t sau khai thc khong sn khu vc m st Tri Cau, huyn ng H, tnh Thi Nguyn. Th nghim c tin hnh gm 8 cng thc vi 3 ln nhc li, c b tr theo kiu hon ton ngu nhin (CRD) [3]: CT 1: Mung l nhn (Cassia occidentalis L.); CT 2: u cng (Flemingia congesta); CT 3: u ren (Rensonic); CT 4: Trinh n khng gai (Mimosa sp); CT 5: Sunnhep (Crotalaria juncea); CT 6: Xc xc (Sesbania javaica Mi); CT 7: Ct kh cao (Tephrosia candida); CT 8: i chng (C - khng trng cy). Cy trng c theo di, o m cc ch tiu sinh trng nh chiu cao, phn cnh theo phng php thng dng ca nghin cu th nghim ng rung (1 thng 1 ln). Vi cc ch tiu v nng sut cht xanh, cht th, s lng nt sn c tin hnh 6 thng 1 ln [3]. S liu sau khi theo di c x l thng k theo cc phng php thng k hin hnh (anova) trn phn mn exel v irristat. KT QU V THO LUN t th nghim l t sau khai thc qung st, t ngho kit v b thoi ha do s o bi trong qu trnh khai khong. Kt qu phn tch t cho thy t c pH thp (5,0), hm lng cc cht dinh dng mc ngho v trung bnhnghin cu ban u (Bng 1). 39

Theo di kh nng sinh trng cc loi cy phn xanh h u trn t sau khai khong cho thy. Sinh trng chiu cao trong nhng thng u ca tt c cc ging nghin cu
chm, tuy nhin trong cc thng th 3 tr i s sinh trng nhanh hn. Trong cy trinh n khng gai l cy thn bi c kh nng sinh trng chiu di thn nhanh nht (Bng 2).
Bng 1. Thnh phn dinh dng t ti khu vc bi thi Khu vc ly mu pH (H2O) Bi thi Khu vc khng c khai khong 5,0 5,5 OM (%) 1,646 2,250 Hm lng cc cht N (%) 0,080 0,090 P (%) 0,060 0,089 K (%) 0,162 0,160
Bng 2. Chiu cao (di) cy theo giai on n v: cm Cng thc CT 1 CT 2 CT 3 CT 4 CT 5 CT 6 CT 7 CV (%) LSD5% 1 7.07 4.18 3.80 11.05 43.92 14.33 8.94 17,0 3,97 2 32.75 11.11 9.15 35.42 82.63 25.87 26.18 13,7 7,66 3 62.75 20.62 23.82 87.17 105.2 43.29 43.03 15,7 15,16 Sau trng thng 4 5 87.95 127.54 40.66 44.64 41.67 69.75 118.73 155.74 126.46 147.58 62.49 75.97 58.18 72.35 13,8 14,6 18,49 25,33 6 146.82 49.25 94.13 175.98 157.67 87.36 86.03 12,8 25,57 7 158.87 54.23 120.45 198.46 164.42 91.21 92.88 14,3 31,51 8 163.20 54.99 127.12 209.89 164.59 94.43 94.81 15,2 34,59
Sinh trng chiu cao

250 200 150 100 50 0 1 2 3 4 5 6 7 8 Sau trng thng
Hnh 1. Sinh trng chiu cao ca cy
Ct1 (mung l nhn) Ct2 (u cng) Ct3 (u ren) Ct4 (Xu h khng gai) Ct5 (sunnhemp) Ct6 (xc xc) Ct7 (Ct kh cao)
40
cm

S sinh trng pht trin ca cc cc loi cy phn xanh ci to t cn th hin s ra nhnh qua cc thi im theo di. Cc ging ra nhnh nhiu th kh nng cho sinh khi s ln [2] . Kt qu theo di v s ra nhnh ca cc ging trong th nghim cho thy, sau khi trng 2 n 3 thng cc ging bt u ra nhnh (Bng 3). Trong cy trinh n khng gai v cy sunnhep kh nng ra nhnh cao nht ngay t thng th 2 sau trng. Kh nng ci to t ca cc loi cy phn xanh h u c nh gi qua cc ch tiu: nng sut cht xanh, cht kh, s lng nt sn trn cy. Ch tiu v nng sut cht xanh, cht kh v s lng nt sn th hin kh nng ci to t ca cy l s tr li cc cht xanh to mn v cung cp dinh dng cho t. Kt qu theo di hm lng cht
xanh v cht kh ca cc ging th nghim th hin bng 4 v hnh 2. Kh nng sau 6 thng trng, cy mung l nhn v cy trinh n khng gai cho sinh khi cht xanh v cht kh cao nht. Trong cy trinh n khng gai sinh trng tt nht, l cy cho nng sut cht xanh cht kh cao nht vi lng 18,9 tn/ha cht xanh v 4,46 tn/ha cht kh (Bng 4); ng thi cng l loi cy cho s lng nt sn nhiu nht vi 635,33 nt/cy (Bng 5). y l loi cy c nhp ni vo Vit Nam, loi cy ny khng ging nh loi trinh n thng c gai. Loi ny khng gai nn c th lm thc n cho gia sc. Cng theo nh tc gi Trn An Phong, cy trinh n khng gai l cy phn xanh c tc dng che ph t chng xi mn, ln t c di, ng thi lm phn xanh rt tt [2].
n v: nhnh/cy
Bng 3. S ra nhnh ca cc cy phn xanh h u trong th nghim Sau trng thng 4 5 1.17 2.03 1.33 1.73 0.87 1.30 13.87 15.97 2.80 3.90 1.66 2.58 26,7 27,5 1,45 2,58
Cng thc CT 1 CT 2 CT 3 CT 4 CT 5 CT 7 CV (%) LSD5%
1 0.00 0.00 0.00 0.00 0.00 0.00 0,0 0,00
2 0.03 0.03 0.00 4.27 2.33 0.00 37,9 0,63
3 0.40 0.47 0.00 8.43 2.27 0.30 32,5 0,97
6 2.13 1.87 1.40 17.97 4.47 3.53 28,8 3,53
7 2.53 2.07 1.67 19.3 4.77 4.44 30,0 4,43
8 2.63 2.23 2.40 20.27 4.80 5.67 25,3 5,67 n v: tn/ha
Bng 4. Nng sut cht xanh, kh ca cc ging th nghim Sau khi trng 6 thng Cht xanh Cht kh 14.23 5.40 2.39 0.99 3.87 1.83 18.29 6.46 5.56 2.18 1.77 0.66 3.98 2.06 Bng 5. S lng nt sn (nt sn/cy) Cng thc Sau trng 6 thng CT 1 69,00 CT 2 15,00 CT 3 42,67 CT 4 635,33 CT 5 12,33 CT 6 202,33 CT 7 26,67 CV (%) 6,2 LSD5% 15,62
Cng thc Ct1 (mung l nhn) Ct2 (u cng) Ct3 (u ren) Ct4 (Trinh n khng gai) Ct5 (sunnhep) Ct6 (xc xc) Ct7 (Ct kh cao)
41

KT LUN Hu ht cc cy phn xanh h u th nghim trn t sau khai thc khong sn ti Thi Nguyn u sinh trng pht trin c trn loi t ngho kit v thoi ha ny. Trong s cc loi cy phn xanh ci to t c nghin cu, cy trinh n khng gai v cy mung l nhn l cy c kh nng sinh trng nhanh, kh nng to cht xanh tr li t cao nht, c s lng nt sn/cy rt cao. Cn tip tc nghin cu hai loi cy ny trn cc loi t khai khong c a hnh khc nhau c th nhn ging v ph bin m rng m hnh trng, ci to din tch t b ngho kit.
TI LIU THAM KHO [1]. L c, Trn Khc Hip (2006), Gio trnh
t v bo v t, Nxb H Ni [2]. Trn An Phong (1977), Gieo trng v s dng cy phn xanh. Nxb Nng nghip, H Ni. [3]. Hong Vn Ph, Th Ngc Oanh (2002), Gio trnh phng php nghin cu trong trng trt, Gio trnh Cao hc. Nxb Nng nghip, H Ni. [4]. Nguyn T Sim, Thi Phin (2002), Cy ph t Vit Nam. Nxb Nng nghip, H Ni. [5]. H nh Tun (2000), Cy ph t Vit Nam. Nxb Nng nghip, H Ni.
Hnh 2. Nng sut cht xanh - cht kh
SUMMARY STUDY GROWTH OF WILD LEGUMES IN THE DEGRADED SOIL AFTER MINING IN THAI NGUYEN PROVINCE
Dang Van Minh, Dao Van Nui
Degraded soils after mining occupied a large area of Thai Nguyen province. These soils are very poor and can often not be used for agriculture. There are many different methods have been applied to improve degraded, discolored, poor and contaminated soils. One among these methods, using biological method seems to be suitable to farmers. The objective of this study is to testing some green manure plants and leguminous species to improve soil after mining in Thai Nguyen province that is considered as a sustainable method. Results of the study indicated that Cassia occidentalis L. and Mimosa sp are potential plants that can be used to grow and improve these poor soils after mining. Keywords: soil improvement, post-mining land use, legume green manuring
42

Nguyn Hu Giang Tp ch KHOA HC & CNG NGH 77(01): 43 48
THC TRNG QUN L V S THAM GIA CA CNG NG A PHNG TRONG CNG TC QUN L BO V RNG TI RNG C DNG HU LIN, HUYN HU LNG, TNH LNG SN
Nguyn Hu Giang*
Trng i hc Nng Lm - H Thi Nguyn
TM TT
Nguyn nhn dn n tnh trng din tch v cht lng rng ti rng c dng Hu Lin b suy gim lin tc l do cng tc qun l s dng ti nguyn rng cn nhiu bt cp, vic qun l s dng ti nguyn rng khng nhng cha t c hiu qu cao m cn cha p ng c nhu cu pht trin bn vng v kinh t, x hi v mi trng. Kt qu nghin cu thy rng hnh thc qun l rng v t rng do h gia nh qun l l c hiu qu nht, hiu qu thp nht l do Ban qun l rng c dng qun l. Tt c ngi dn cc thn bn sng trong RD tham gia xy dng Quy c bo v rng tuy nhin hu ht ngi dn cha quan tm n bn cam kt ny. 80,07% s h khng bit g v chng trnh 661 v cc chnh sch lin quan n c ch hng li trong trng rng, vic ch thu khon lao ng theo thi v gia Ban qun l QD vi ngi dn khng to ra sinh k n nh lu di cho h gia nh thng qua thc hin chng trnh 661. T kha: Qun l rng, rng, cng ng, rng c dng, Hu Lin; Lng Sn
T VN Rng c dng (RD) Hu Lin ln u tin c Ch tch Hi ng B trng quyt nh thnh lp vo nm 1986 c din tch 3.000ha. Nm 1992 c B Lm nghip (nay l B NN&PTNT) quy hoch li. Nm 2006 c UBND tnh Lng Sn ti thnh lp vi din tch 10.640ha, Ban qun l RD Hu Lin l mt n v s nghip trc thuc S NN&PTNT tnh Lng sn. Ton b din tch RD Hu Lin nm trn a phn ca 5 x thuc huyn Hu Lng, tnh Lng Sn. S bng n dn s, s pht trin khng ngng ca x hi dn n nhu cu sinh hot ca ngi dn sng trong khu vc RD Hu Lin ngy cng tng c bit l nhu cu v g lm nh, ng , ci un... Mt khc nhu cu g, lm sn ngoi g trn th trng nht l cc loi g qu him rt cao nn ngi dn b cc i tng xi gic li ko, tip tay cho cc hnh vi khai thc, mua bn vn chuyn lm sn tri php dn n hu qu l TNR ti RD Hu Lin b xm hi. T yu cu thc t trn, rt cn thc hin nghin cu v thc trng qun l v s tham gia ca cng ng a phng trong cng tc qun l rng (QLR) ti RD Hu Lin, huyn Hu Lng, tnh Lng Sn nhm tm ra hnh thc QLR c hiu qu nht.
Tel: 0982688286; Email: huugiangkn@gmail.com
MC TIU, NI DUNG V PHNG PHP NGHIN CU Mc tiu nghin cu Phn tch, nh gi thc trng QLR v s tham gia ca cng ng a phng trong cng tc qun l bo v rng trn c s i su tm hiu cc hot ng bo v, s dng rng, t xc nh c kh khn, bt cp v xut mt s gii php nhm nng cao hiu qu QLR. Ni dung nghin cu - Thc trng qun l rng c dng; - S tham gia qun l, bo v rng ca cng ng; - xut mt s gii php nhm nng cao hiu qu QLR. Phng php nghin cu - K tha ti liu t mt s bo co tng kt, nh gi v tnh hnh qun l rng do Ban qun l rng c dng, UBND cc x cung cp (trong 5 nm gn y); - Phng php RRA phng vn c nh hng vi tng s 25 lnh o ca c quan qun l trc tip (S Nng nghip v PTNT, huyn Hu Lng, Ban qun l rng v 5 x c rng); - S dng mt s cng c PRA: i lt ct, S ti nguyn, S venn, phng php phn tch im mnh im yu, c hi thch thc (SWOT) v iu tra phng vn trc tip 120 h gia nh tiu biu trong khu vc; 43

- Phng php x l s liu: S dng thng k ton hc di dng cc bng biu tng hp cc thng tin thu c. KT QU V THO LUN Thc trng qun l rng c dng Rng c dng Hu Lin hin ang c 4 hnh thc QLR ch yu l: (i) Rng v t rng do cng ng qun l (Gi l t gi rng): Mi thn bn ty theo din tch rng c qun l nhiu hay t m lp ra t 1 - 4 t gi rng, mi t c t 3-7 thnh vin. Hot ng ca t gi rng l phi hp vi kim lm v i 12 ca x thng xuyn tin hnh kim tra, gim st v n c ngi dn trong thn thc hin tt vic bo v din tch rng k hp ng bo v. T gi rng c hng th lao hng thng trch t ngun qu ca thn, mc hng do hi ngh ton thn quyt nh. Trong kim lm h tr 200.000/thng cho cng tc qun l bo v, phn qu cn li do b con ng gp hoc ly t tin x pht cc v vi phm TNR hay thu tin ca nhng ngi khng tham gia lao ng cng ch (Mc thu t 15.000 - 30.000 ng ty theo thc trng kinh t ca tng thn); (ii) Rng do ban qun l rng c dng Hu Lin qun l, tng s 3.308 ha; (iii) i 12 ca cc x (i 12 c thnh lp theo Ch th s 12/CT-TTg ca Th tng Chnh ph). Hot ng ca i 12 l t chc tuyn truyn ph bin gio dc php lut v rng ti cng ng dn c trong cc thn bn thng
S thn tham gia QLR 7 12 1 2 1 23
qua h thng loa thng tin i chng v tng cng phi hp vi kim lm tun tra bo v rng, kim tra trn khu lu thng, vn chuyn lm sn tri php, bt gi v x l cc i tng vi phm v (iv) Rng do h gia nh qun l: Kt qu k hp ng bo v rng vi h gia nh nm 2009 c th hin qua bng 1. Theo khon 8, Quyt nh s 02/CP, ngy 15/1/1994, qu trnh k kt hp ng bo v rng vi cc h gia nh trong RD Hu Lin bt u t nm 1994. n ht nm 2009, Ban qun l RD giao 7.332ha rng cho 427 h sng ti 23 thn ca 5 x qun l. Cc hp ng bo v rng c k i vi cc trng hp m cc iu kin khng ph hp di di dn c sng trong khu bo v nghim ngt, cho php cc h sng hi ha trong s bo v qun l. Trong khun kh cc hp ng ny, cc h gia nh c php thu lm ci un v cc sn phm khng thuc g khc nhng khng c php cht cy. i li h c nhn 90.000/ha/nm, cc hp ng c gi tr trong 1 nm v c th thay i. Cn b Ban qun l RD kim tra hng nm v c th hy b hp ng i vi cc h gia nh qun l khng tt, nm 2009 vn c 103/427 h vi phm hp ng. tm hiu hiu qu qun l rng, ti tin hnh phng vn 120 h v vai tr ca cc bn trong vic qun l rng, kt qu th hin bng 2.
Din tch (ha) 1.860 4.658 253 211 350 7.332 S h vi phm hp ng (h) 33 63 5 1 1 103
Bng 1. Kt qu k hp ng bo v rng vi h gia nh nm 2009 TT 1 2 3 4 5 X Yn Thnh Hu Lin Hu L Vn Linh Ha Bnh Cng S h tham gia (h) 124 263 17 10 13 427
Bng 2. Hiu qu qun l rng ca cc bn tham gia Mc Cc bn tham gia 1. H gia nh 2. T gi rng 3. Ban QLR c dng 4. i 12 Rt hiu qu 81.67 0 0 0 Hiu qu 15 0 0 0 Trung bnh 3.33 39.17 0 0 t hiu qu Khng hiu qu 0 60.83 90.83 56.35 0 0 9.17 43.65
44

Kt qu cho thy: Hiu qu qun l rng cao nht l h gia nh (96,67% kin nh gi l rt hiu qu v c hiu qu 3,33% kin mc trung bnh). cch qun l ny, mc d quyn s hu ti nguyn rng khng thuc v ngi dn nhng quan h gia ngi dn vi Ban qun l RD v cc bn tham gia khc l cht ch do cc mi quan h x hi, lng x, gia nh to dng nn. Mt khc ngi dn phi t chu trch nhim vi din tch rng k kt do vy hin tng vi phm hp ng t hn. Tip theo l n T gi rng (39,17% nh gi mc trung bnh cn li l t hiu qu). Vi ban QLR v i 12 th 100% kin nh gi mc t v khng c hiu qu. i 12 khng qun l trc tip rng m ch phi hp vi kim lm, t gi rng ph bin, tuyn truyn, tun tra kim sot. Nh vy, hiu qu QLR trc tip km nht l rng do Ban qun l RD Hu Lin qun l. Phn tch thc trng tm ra nguyn nhn s km hiu qu trong cng tc QLR ca ban qun l RD Hu Lin nh sau: - T chc nhn s: T 01/01/2008 Ban qun l c kin ton li gm c 09 ngi, trong cn b c trnh i hc 04 ngi, cn b c trnh trung cp 05 ngi. Ban qun l phn lm 02 phng l phng hnh chnh tng hp 03 ngi (gm 01 lnh o, 01 k ton, 01 vn th th qu kim tp v) v phng k thut tuyn truyn kim a bn gm 06 ngi;
Thu nhp t lm nghip so vi tng thu nhp
30,000,000 25,000,000 20,000,000 15,000,000 10,000,000 5,000,000 0 Tng thu Lm nghip H ngho 11,593,740 2,581,844 H trung bnh 18,035,802 3,613,094 H kh 26,324,313 3,919,688 Tng thu Lm nghip
- Do cng tc QLR cha ng nht t Ban qun l RD c thuc Ht Kim Lm sang Ban qun l RD mi thuc S NN&PTNT tnh Lng Sn c khe h nn bn lm tc li dng v mt s cn b Ban qun l RD mi l ch rng nhng thiu trch nhim, li dng chc quyn thu tin hi l lm lut ca bn lm tc v cu kt vi mt s t trng t gi rng lm sai quy ch bo v rng; - Cn b lnh o Ban qun l RD l ngi mi, cn nhiu hn ch v chuyn mn nghip v, cha c kinh nghim trong lnh o iu hnh n v (Trng Ban qun l v nhn cng tc t 10/10/2007, hin cha c Ph trng ban); - Nhn vin trong Ban QLR cng l ngi mi tham gia cng tc nn cn b ng, cha c kinh nghim, cha ai c tham gia tp hun v qun l rng; - a bn hot ng rng, a hnh phc tp, xa s gim st ca lnh o, phng tin i li khng c. C s vt cht v cc trang thit b phc v cho cng tc cn qu ngho nn nn cng nh hng ln n tm l ca cn b v cht lng cng vic. Kt qu nghin cu v cc hot ng khai thc, s dng rng ca ngi dn cho thy thu nhp t lm nghip chim t l nh so vi tng thu nhp ca h. Vi h ngho thu nhp t lm nghip khong 2,5 triu ng chim 22,27%, h trung bnh 3,5 triu ng chim 20,03% v h kh l gn 4 triu ng chim 14,89%.
Loi lm sn c thu hi t rng
100 90 80 70 60 50 40 30 20 10 0 92 68 57 40
T l % s h
ng/nm
13
Cy thuc
Thc phm
Nguyn liu th cng
Vt liu xy dng
Khc
Hnh 1. Thu nhp t lm nghip so vi tng thu
Hnh 2. T l % cc loi lm sn c thu hi t rng
45

Lm sn ngi dn thu hi t rng rt a dng v c chia thnh 5 loi l lm thuc, thc phm, nguyn liu th cng, vt liu xy dng v mt s cng dng khc. Trong s ny nhiu sn phm c s dng a phng, phn cn li nh ng vt rng v cy thuc c ngi dn a phng em bn. Vic cht cy lm nh, ng , lm hng ro v ci un l nhu cu chnh ng ca ngi dn, tuy nhin trn thc t vic lm dng khai thc nhng loi cy g c gi tr ( Nghin, Hong n) ang din ra ht sc phc tp v quyt lit mc d ngi dn hiu c rng vic cht cy ly g c coi l phm php cho d vi bt c mc ch g, ngoi tr dng cho vic lm nh nhng phi c s ng ca chnh quyn a phng. Ma cao im khai thc g l vo nhng thng cui nm trong khong t thng 8-12 m lch. Lm sn ngoi g rt a dng v c hu ht cc h gia nh thu hi s dng v bn. Kt qu iu tra cho thy: C tng s 81 loi thc vt lm sn ngoi g c ngi dn khai thc s dng, trong c ti 48 loi c ngi dn s dng lm dc liu, chim 59,3%; Nhm loi lm rau n c 20 loi, chim 24,7%; Nhm loi ly bt c 5 loi, chim 6,2% v nhm loi lm th cng m ngh c 8 loi, chim 9,9%. Nh vy, ngi dn khai thc cc loi lm sn ngoi g lm dc liu chim t l cao nht, y l im cn lu trong qun l ti nguyn cy thuc v kin thc bn a v s dng tho mc lm thuc ca cc cng ng dn tc thiu s c bit l trong cng ng ngi Dao. S tham gia qun l bo v rng ca cng ng Tham gia xy dng Quy c bo v rng cp thn bn: Tt c cc thn bn u xy dng xong quy c bo v rng, bn cnh vic k cam kt bo v rng ca ngi dn c trin khai n tt c cc thn bn c ngi dn sng trong RD, tuy nhin hu ht ngi dn cha quan tm n bn cam kt ny do h khng nhn c s h tr g ci thin cuc sng. Cc bn cam kt ny c lp bng ting ph thng trong khi trn a bn c 70% dn s l ngi dn tc thiu s, trong s khong 30% khng bit ting ph thng nn h khng hiu. Vai tr ca cc 46
gi lng cha c pht huy trong cc hot ng vn ha, x hi v cng tc bo v rng (do gi lng khng c ph cp g). S tham gia ca cc h gia nh vo chng trnh 661: Qua phng vn cho thy 80,07% s h khng bit g v chng trnh 661 v cc chnh sch lin quan n c ch hng li trong trng rng. Ngi dn ch bit tham gia trng rng, bo v rng theo thu khon ca Ban qun l. iu ny cho thy chnh sch cha c ph bin n dn, Ban qun l nm gi chnh sch v thc hin theo k hoch ring, ngi dn mt c hi chn la cc gii php thch hp cho mnh. Nghin cu cho thy s hng li ca cc h ch yu l (i) c thu v tr cng trng, chm sc, bo v rng trng tuy nhin s h tham gia cng khng nhiu, ti a l 15%. S thu khon lao ng theo thi v gia Ban qun l RD vi ngi dn khng to ra sinh k n nh lu di cho h gia nh thng qua thc hin chng trnh 661 v (ii) K hp ng bo v rng t nhin: Vic k hp ng bo v rng gia h gia nh vi ban qun l RD c thc hin hng nm, tuy nhin vn cn mt s h vi phm hp ng m nguyn nhn chnh l thiu tin chi tr cho cc hot ng sinh hot hng ngy. Khi thiu tin, ngi dn c th cht cy ly g bn mc d h bit lm nh vy l vi phm. R rng l trch nhim ca mt s ngi dn cha cao, ngi dn khng c chuyn mn nn ngoi vic s dng cc sn phm t rng th h khng c tc ng no xy dng v pht trin rng. Cng tc bo v rng c nh hng tiu cc n i sng nng h nh gim thu nhp v gim sn lng khai thc cc sn phm khc t rng, bn cnh cng c nhng nh hng tch cc t cng tc ny. Kt qu iu tra 120 ngi v s nh hng ca hot ng bo v rng n i sng h, cho thy. (i) C 5 vn c ngi dn nh gi v s nh hng tiu cc ca hot ng bo v rng n i sng h c xp theo th t t cao n thp nh sau: Gim sn lng khai thc cc sn phm t rng (c 82% kin); Gim thu nhp (67% kin); Gim din tch chn th gia sc (48% kin); Gim din tch t sn xut (46% kin); Cc kin khc (21% kin).

R rng l khi rng c bo v nghim ngt hn th ngi dn khng th t do khai thc cc sn phm t rng, h khng th ph rng ly t sn xut nng nghip v khng th t do chn th gia sc. Tt c cc yu t ny u lm gim thu nhp ca h. (ii) C 6 vn c ngi dn nh gi v nhng tc ng tch cc ca bo v rng n i sng h l: Mi trng tt hn (69% kin); Ngun nc n nh cho sinh hot, sn xut (68% kin); Gim l vo ma ma (51% kin); Tng thu nhp t cng bo v rng (36% kin); Ci thin c s h tng (21% kin); Cc kin khc (16% kin). Nh vy ngi dn cng nhn thy c vai tr to ln ca rng vi mi trng v trc tip n cuc sng, sinh hot ca h. * Nhng hn ch trong vic cun ht cng ng tham gia vo qun l rng: - Ngi dn sng trong v xung quanh RD cha thy c li ch do vic thnh lp RD mang li. H ch thy vic thnh lp RD l gy ra nhiu kh khn trong cuc sng ca h; - Ranh gii ca RD, ranh gii ca vng m c xc nh r rng trn bn tuy nhin trn thc a th rt kh khn xc nh nn nhiu khi ngi dn khng bit mnh c xm phm vo ranh gii khu bo tn khng; - Thiu s phi hp vi cc chng trnh quc gia hay cc d n trong lnh vc qun l bo v ti nguyn thin nhin v pht trin rng (Giao t, giao rng, khon khoanh nui bo v, trng rng...);
Bo v rng lm nh hng tiu cc n i sng nng h
90 80 70 60 50 40 30 20 10 0 Gim din tch t Gim sn lng Gim din tch sn xut khai thc cc sn chn th gia sc phm khc t rng Gim thu nhp Khc 82 67 46 48
- Ngi dn thiu vn u t sn xut, thiu kin thc k thut v trng, gieo m v cc k thut trong sn xut lm nng nghip. Mt s gii php nhm nng cao hiu qu qun l rng Trn c s phn tch thc trng QLR v s tham gia qun l bo v rng ca ngi dn, ti xut mt s gii php nhm gp phn nng cao kh nng QLR ti RD Hu Lin nh sau: - Tip tc thc hin giao khon bo v rng cho h gia nh qun l, gn trch nhim hn na vi cc h v c ch ti mnh hn x l cc h vi phm hp ng, nu h no vi phm hp ng trong 2 nm lin lc th khng giao khon bo v trong nm tip theo; - Kin ton li b my lnh o ban qun l RD, c ln lt cn b i tp hun nng cao nng lc v cng tc qun l bo v rng; - i mi cch thc hot ng ca i 12 bng cch phi hp t chc cc lp tp hun, tuyn truyn cho cng ng dn c v lut bo v v pht trin rng, cc vn bn lin quan n bo v rng...; - Ban qun l RD cn phi hp cht ch hn na vi chnh quyn v cc t chc trong x, thn thc hin cng tc QLR, phi hp vi ngn hng hng dn ngi dn vay vn u t vo sn xut, nng cao nng xut, cht lng cc mt hng nng sn.
Bo v rng c tc ng tch cc n i sng nng h
80 70 60 50 40 30 20 10 0 68 51 36 21 16 69
% s h
21
% s h
Ngun nc n Gim l vo Tngthmthu Ci thin cs Mi trngtt nh cho sn ma ma nhp tcng h tng hn xut v sinh khon BVR hot
Khc
Hnh 4. nh hng ca hot ng bo v rng n i sng nng h
47

Nguyn Hu Giang Tp ch KHOA HC & CNG NGH 77(01): 43 - 48
TI LIU THAM KHO

[1]. Bo Huy v cng s (2005), Bo co nghin cu tham vn hin trng khu vc ty nguyn v Lm nghip, gim ngho v sinh k nng thn Vit nam, Chng trnh h tr ngnh lm nghip v i tc, H Ni. [2]. Nguyn Ngc Lung (1998), Forest management system and forestry policies in Vietnam. Proceeding of the national seminar on sustainable
forest management and forest certification (Ho Chi Minh City 1-12 February 1998) [3]. Furey, N., L.X.Cnh v Fanning, E (2000) Kho st a dng sinh hc v nh gi cng tc bo tn ti khu bo tn thin nhin Hu Lin, Chng trnh nghin cu rng Frontier-Vit Nam do T chc khm ph mi trng LONDON v Vin Sinh thi v Ti nguyn sinh vt H Ni
SUMMARY THE CURRENT SITUATION OF FOREST MANAGEMENT AND THE PARTICIPATORY OF LOCAL COMMUNITY IN FOREST PROTECTION AT HUU LIEN SPECIAL-USE FOREST, HUU LUNG DISTRICT, LANG SON
Nguyen Huu Giang
College of Agriculture and Forestry TNU
Inappropriate management of forest resources is a reason leads to continuous degradation of area and quality of forest in Huu Lien special use forests. The low efficiency of forest resource management doest not meet the needs of sustainable development in economic, social and environment. The result of study shows that household management of forest and forest land is the most effective management and Special used forest management board is the most low effective management. All people living in villages of the special-used forest have participated in the construction "Protecting forest convention" but most people have not interested in this pledge. 80,07% of households have not known anything about 661 programs and policies related to the mechanism of benefit in the reforestation, the only hire seasonal labor exchange between the special used-forest management with the people has not created the long-term stability of livelihoods to households through the program 661 Keywords: Forest management, forest, community, special use forests, Huu Lien - Lang Son
Tel: 0982688286; Email: huugiangkn@gmail.com
48

INDIGENOUS STUDY ABOUT NATIVE PLANT SPECIES ERYTHROPALUM SCANDENS BL (BO KHAI) IN THE NORTHERN MOUNTAINOUS REGION OF VIETNAM
Dang Van Minh, Dang Kim Vui, Nguyen Chi Hieu
College of Agriculture and Forestry - Thai Nguyen University
SUMMARY
Erythropalum scandens BL (local name is Bo Khai) are native plant species in Northern mountainous region of Vietnam. These plant species have been widely used by local people as vegetable and medicinal herb. However, there are still very few research and little information about these plants. The overall project objective of this study is to apply farmer approach to understand the natural growth and distribution, value and scarcity of native plant species Erythropalum scandens BL in the Northern mountainous region of Vietnam. Results of the research indicated that these plants were found in both limestone and hill land ecosystems. Erythropalum scandens BL was found mostly in foot slope and catchment areas. Young plants of Erythropalum scandens BL grow well in shade light under thick forest. Market demand of these vegetables is high as being good taste and considering clean vegetables. These plant species have been over exploited, increasing scarcity in the region. Farmers have collected seedlings and seeds from forests to grow in their gardens as new crops but without much success due to lack of knowledge and technology. Keyword: Native plant species, indigenous knowledge, natural growth and distribution, scarcity
INTRODUCTION The Northern Mountainous Region (NMR) is home to a large proportion of Vietnams population and includes representatives of thirty-five ethnic minority groups. Poor literacy and low education levels create a poverty trap that is difficult to overcome. Way of living of people in this region still follows self-sufficient method with heavily depending on forest. However, the forests in this region have come under increasing pressure by many interrelated forces as overexploiting, shifting cultivation, exploitation for agriculture. Non timber forest products (NTFP) are one main source of income of local people in mountain areas. In this region, the NTFPs have been traditionally exploited by local people for food and other uses, such as medicine or materials for handicraft. NTFPs, therefore, are considered as an important income generation source for local people, particularly for those whose living is much dependent on forest (Vu Van Dung et al., 2002).
Among NTFPs, there are some native plant species in NMR are popularly being used by local people as food stuff and vegetable, e.g. Erythropalum scandens BL (local name is Bo Khai) that have been widely used by local people as vegetable and medicinal herb. Recently, some local people have collected these plants from forest and sold to traders in city. These vegetables are expensive as considering clean and special vegetable with very good taste. Consequently, these wild plant species in forest are being over exploited and in some places they are nearly disappeared. Many farmers in the NMR now can recognize the importance of these species for their life, but there are increasing difficulties for collection of plants from natural forests. This is understandable, since these species are exploited by many people. Farmers, who have been working and living on their place for a long time, usually understand the plants in their place well. Chamber (1983) stated that farmers knowledge about the specific conditions in which they produce may be more exact than and often superior to that of researchers who 49

are outsiders. Farmers knowledge is sometimes referred to indigenous knowledge or rural peoples knowledge. Eyzaguirre (1988) defined indigenous knowledge (here referring to indigenous technical knowledge) as a body of information applied to the management of natural resources and labor at a specific place. Scoones and Thompson (1994) considered farmers knowledge to be highly specific and contextually bound knowledge emerging from localized and practical experience. Farmers knowledge and scientific knowledge usually complement each other in sustainable programs as they are both general and specific, theoretical and practical (Scoones and Thompson, 1994). Eyzaguirre (1988) suggested that the use of indigenous technical knowledge would be useful in adapting new technologies. Farmers in many developing countries have a great potential to identify new crops and technologies that can provide the basis of more specialized, non-traditional and highvalue exports. For example, in the rice farming system in Asia, rice researchers tried to incorporate farmers perspectives into identification of research issues and setting research priorities. The concept farmer-backto-farmer, farmer-first, or farmer-based experimentation was successfully applied in many places (Fujisake, 1992). The overall project objective of this study is to apply farmer approach to understand the natural growth and distribution, value and scarcity of native plant species Erythropalum scandens BL. in the Northern mountainous region of Vietnam. The results of this study will be good reference to develop scientific research priority to conserve these plants in forests and develop techniques to grow them in gardens as new crop.. METHODOLOGY The study was taken places in the Bac Kan province, which is approximately 160 kilometers north of Hanoi, the capital of Vietnam.. The study places are rich in natural resources with various native plant species growing due to diverse climate and other physical conditions (Castella and Dang, 2002). 50
Participatory method was highly appropriate approach to collect information. Survey was conducted to get fully understanding indigenous knowledge of local farmers regarding natural growth and distribution, value and scarcity of native plant species, as well as market orientation of these products in the local areas. The questionnaire was developed based on the minimum socioeconomic survey approach described by Moran (1989). The questionnaire was used as an interview guide, in which the questions were structured in a way that was understood easily by the farmers. The questionnaire guide was pretested and corrections were then made to ensure that questions incorporated into the final survey were understandable by the farmers and satisfied the research objectives. Sample size of the farmer survey was 62 farmers from two selected districts named Bach Thong and Cho Don districts of Bac Kan province. Both qualitative and quantitative information described and recorded by farmers were synthesized. The results were then presented in a cross-tabular form as means and percentages. RESULTS AND DISCUSSION Farmer perceptions about natural distribution and growth of plants Erythropalum scandens BL (local name is Bo Khai) are wild plant species and very popular in the study areas. Erythropalum scandens BL has line stem shape with 5-10 m long. This plant species can be found in places with altitude from 100-1000 m above sea level. According to farmers observation, 26 and 38% interviewed farmers indicated that Erythropalum scandens BL species are usually found in limestone ecosystem respectively, while only 2 % interviewed farmers see these plant in hill lands. Remaining interviewed farmers have no idea about specific land ecosystem that these plants grown (Table 1). These results indicated that Erythropalum scandens BL can grow in diverse land ecosystems, but it is likely that . limestone ecosystem would be more suitable to these plant species.

Regarding to landscape position, Erythropalum scandens BL was found mostly in lower slope position. 74% interviewed farmers recognized that Erythropalum scandens BL species grow mostly in foot slope and level (catchment areas). Erythropalum scandens BL species found in lower slope position is an indication that this kind of plants requires more fertile soils and high soil moisture. This result is suitable to other research results that indicated Erythropalum scandens BL usually grow in alluvial soils and riverine forests (http://www.efloras.org/). As wild plant species, the growth of these plant species have been affected by various environmental factors in forests such as sunlight regime, moisture, etc. However, the affects of such environment factors on growth of plants vary among species. 85 % interviewed farmer recognized that young seedlings of Erythropalum scandens BL were found in shade light areas under thick forest (Table 3). It is likely that young seedlings of Erythropalum scandens BL require more shade light to grow. It is apparent that deforestation will result in reducing population of Erythropalum scandens BL species.
This result is suitable with other observations from farmers when they brought young plants from forest to grow in their gardens. Farmers recognized that plants planting in the gardens grow much slower compared to growth of young plants in forest. This is explained that the young plant Erythropalum scandens BL growing in the forest is always in the shade of the trees canopy, while growing in the garden, plants have received more direct sunlight. Farmers perception about values and market access of these plants products Erythropalum scandens BL have been widely used by local people as vegetable and medicinal herb. 100% interviewed farmers indicated that they have used these plants for vegetable (Table 4). These species are considered as clean and special vegetable with very good taste. Erythropalum scandens BL can also be good medicinal herb as recognized by 67% of interviewed farmers, respectively. As being high valuable vegetable and medicinal herb, Erythropalum scandens BL and Phyllanthus elegans L. become popular in market not only in rural areas but also in urban areas.
Table 1. Farmers perception on growing places in natural forest of native plant species Erythropalum scandens BL and Phyllanthus elegans L Land ecosystem Hill lands Limestone Ecosystem No specific sites Total Number farmers answer yes 1 16 45 62 Percentage 2 26 73 100
Table 2. Farmers perception on plants growing in different slope positions Topography foots lope and level (Catchments areas) Shoulder and upper level No specific place Total Number of farmers agreed 46 12 4 62 Percentage 74 19 6 100
Table 3. Farmers perception of young plants growing in different sunlight Sunlight regime Shade area in thick forest In more direct sunlight areas (e.g. thin forests, barren lands, bush areas after deforestation) Total Number of farmers agreed 52 9 61 Percentage 85 15 100
51

Recently, some local people have collected these plants from forest and sold to traders in city (table 5). These vegetables are expensive as considering clean and special vegetable with very good taste. Many collectors from city come to villages to buy these vegetables and then sell them in city markets, Consequently, these wild plant species in forest are being over exploited and in some places they are nearly disappeared. Farmers perception about harvesting and the scarcity of the plants in natural forest Harvest method is important to conserve natural plant resources. Unsuitable method may cause to unsustainable harvesting. Data in table 6 indicated that most of farmers
Purpose for use Vegetable Medicinal herb Total interviewees
harvested Erythropalum scandens BL by cutting young leaves and buds. Its consequence would lead to rapidly reduce plant population in the region and cause to disappear of these species in some places. Data in table 7 present some indicators indicating scarcity of these plant species in the region. Compared to last 7 years and last 5 years, number of people and frequency going to collect these vegetables from forest increased, travelling time to forests to get vegetables was longer, quantity of vegetable collected for one going significant increased. All of these indicators indicated scarcity of these natural resources increasing every year.
Table 4. Farmers perception about value of native plant species Erythropalum scandens BL Number of farmers agreed 62 42 62 Percentage 100 67 -
Table 5. Market access of native plant species Erythropalum scandens BL Number of farmers agreed 26 7 19 Percentage 100 27 73
Number of farmer have sold vegetable Place of selling: - Selling for collector - Selling in commune market
Table 6. Method of harvest from natural forest Harvest method Harvest young leaves and buds Cutting trees to get young leaves and buds Total Number of farmers agreed 50 8 58 Percentage 86 14 100
Table 7. Comparison of number of people, time and frequency to collect native plant species Erythropalum scandens BL and Phyllanthus elegans L from forest 7 years ago Number of farmers involved harvest Travel time to harvest (hour) Frequency to collect vegetable in forest (times per month) Quantity of vegetable collected per travel (bunch of vegetable) 31 1.8 3 35 5 years ago 54 2 3.33 32 current year 58 2.4 4.4 25
52

Farmer planting these native plants Farmers now can recognize the importance of these species for their life, but there are increasing difficulties for collection of plants from natural forests. Many farmers want to grow these native plant species as vegetable crop. 40% of interviewed farmers indicated that they have grown plant species Erythropalum scandens BL respectively in their home garden (Table 8). Farmers have collected seedlings and seeds from forests to grow in their gardens. Results from the farmer survey indicated that more farmers are wanting to grow these plants in their garden as a crop, but without much success due to lack of knowledge and technology. CONCLUSION Erythropalum scandens BL (local name is Bo Khai) are native plant species in Northern mountainous region of Vietnam. These plants were found in limestone and hill land ecosystems, but it is likely that limestone ecosystem would be more suitable than hill land ecosystem. Erythropalum scandens BL was found mostly in foot slope and catchment areas, Young plants of Erythropalum scandens BL grow well in shade light under thick forest. These plant species have been widely used by local people as vegetable and medicinal herb. There is good market access for these vegetables due to being good taste and considering clean vegetables. These plant species have been over exploited, increasing scarcity in the region. Farmers have collected seedlings and seeds from forests to grow in their gardens as new crops but without much success due to lack of knowledge and technology. ACKNOWLEDGEMENTS The author would like to thank for the Seed Fund for Research and Training (SFRT) of the Southeast Asian Regional Center for Graduate Study and Research in Agriculture (SEARCA) for funding. Thanks for Faculty stuff and Graduate students and undergraduate students of Thai Nguyen
University of Agriculture and Forestry, as well as Forestry department of Bac Kan province, Vietnam for their help during survey and collection of data.
REFERENCE
[1]. Castella, J.C. and D.Q. Dang. 2002. Renovation of Mountainous Region: Changes of land Use System and Development Strategy for Farmers in Bac Kan, Vietnam. Agricultural Publishing House, Hanoi. Pp. 149-173 (by Vietnamese). [1]. Chambers R. 1983. Rural Development: Putting the Last First. Longman Inc., London. Pp.75-103. [2]. Eyzaguirre, P. 1988. Farmers knowledge, world science, and the organization of agricultural research systems. In Moock, J.L. and R.E. Rhoades (eds). Diversity, Farmer Knowledge, and Sustainability. Cornell University Press. Pp. 11-34. [3]. Fujisaka, S. 1992. Farmer knowledge and sustainability in rice-farming systems: blending science and indigenous knowledge innovation. In Moock, J.L. and R.E. Rhoades (eds). Diversity, Farmer Knowledge, and Sustainability. Cornell University Press. Pp. 69-84. [4]. Moran, E. 1989. Socioeconomic survey methods. Part 1: The minimum socioeconomic survey. In Anderson, J.M. and J.S.I. Ingram (eds). Tropical Soil Biology and Fertility. A Handbook of Methods. C.A.B. International, Oxon (UK). Pp. 89-100. [5]. Scoones, I. and J. Thompson. 1994. Knowledge, power and agriculture- towards a theoretical understanding. In Scoones, I. and J. Thompson (eds). Beyond Farmer First: Rural Peoples Knowledge, Agricultural Research and Extension Practice. Intermediate Technology Publications Ltd., London. Pp. 29-40.
[6]. Vu Van Dung, Jenne De Beer, Pham Xuan

Phuong. 2002. Overview of non timber forest products in Vietnam. Document of the Project: Sustainable utilization of non-timer forest products. Project Secretariat. 8-Chuong Duong Do, Hoan Kiem, Hanoi, Vietnam.
53

Table 8. Situation of farmers planting native plant species Erythropalum scandens BL Content Number of farmers have grown plants in gardens (of total 62 interviewees) Planting places: - Home gardens - Forest lands after clearing Sources of seedlings/seeds - Seedlings taken from forest - Collection seeds from forest Number farmers 25 23 2 20 5 Percentage 40 92 8 80 20
TM TT NGHIN CU KIN THC BN A V CY RAU B KHAI ERYTHROPALUM SCANDENS BL TI VNG NI PHA BC VIT NAM
ng Vn Minh*, ng Kim Vui, Nguyn Ch Hiu
Trng i hc Nng Lm H Thi Nguyn
Erythropalum scandens BL (tn a phng l B Khai) l loi cy bn a c khu vc min ni pha Bc Vit Nam. Loi cy ny t lu c ngi dn a phng s dng lm rau v thuc. Tuy nhin, hin nay cc thng tin cng nh cc nghin cu v loi cy ny vn cn t v thiu. Mc tiu ca nghin cu ny l ng dng phng php tip cn thc a tm hiu s sinh trng cng nh s phn b t nhin ca cy B Khai, tm hiu gi tr v mc khan him ca loi Erythropalum scandens BL ti khu vc min ni pha Bc Vit Nam. Kt qu ca nghin cu cho thy cy B Khai c mt c h sinh thi ni vi v i t thp. Erythropalum scandens BL c pht hin mc ch yu chn i v cc b sui. Cy Erythropalum scandens BL non c th sinh trng tt di tn rng rm. Nhu cu ca th trng v loi rau ny rt cao do rau c v thm ngon v c coi l rau sch. Hin nay rau B Khai ang c khai thc qu mc, lm suy kit s lng loi. Ngi dn tin hnh thu thp ht rau trong rng sau em gieo trng trong vn nh, tuy nhin kt qu thu c rt thp do thiu kin thc cng nh k thut trng rau B Khai. T kha: Loi thc vt bn a, kin thc bn a, tng trng t nhin v phn b, s khan him
54

Nguyn Hng Quang v cs Tp ch KHOA HC & CNG NGH 77(01): 55 - 58
STUDY ON DIFFERENT FEED FORM ON THE PERFORMANCE OF BROILERS CHICKEN

Quang N. H.1* and Ebrahimi R2
1
College of Agriculture and Forestry - Thai Nguyen University 2 Ramin University of Agriculture and Natural Resources
ABSTRACT
In this study, it was conducted to evaluate the effects of three various physical diet forms (whole pellet, whole crumble, and mix crumble and pellet) on broilers performance. It was performed by using 150 broilers (male and female mix) from commercial Arbor Acres breed in a completely randomized design with 3 diets by 2 replications (25 chickens per each replication). Daily gain, feed intake and FCR were measured in whole period, furthermore, carcass mean, breast, leg meat, abdominal fat, liver, and gizzard were measured and analyzed at end of the experiment. Body weight was not significant different among the tests. Feed intake was highest in the pellet groups. FCR in the crumble groups was higher than that of the other groups. The results indicate that the physical form of the diet had a significant effect on abdominal fat, which was highest in broilers that fed with pellet diet. Keywords: Particle size, performance, broiler chicken, body weight, FCR
INTRODUCTION In poultry diets, cereal grains such as yelow corn, rice, wheat are the primary energy source. Therefore, not only must producers be concerned about the composition of the grain, but also how it is processed so the animal may fully utilize the nutrients. Researches shown that the physical form of diets and feed particle size have a great effect on poultry yield (Behnke and Beyer, 2004) [3]. The effects of particle size on feed quality and quality of poultry has been researched in a number of settings (Behnke, 1994) [2]. Small particle size increases the surface area of the grain, thus allowing for greater interaction with digestive enzymes. It also improves the ease of handling and the mixing characteristics. In poultry diets, the effects of feed particle size appear to be confounded with complexity of the diet as well as further processing such as pelleting or crumblizing. Cabrera (1994) [4] found no effect of feed particle size (1,000 to 400 microns) on growth performance of broiler chicks fed a complex (added tallow, meat and bone meal, and feather meal) diet fed in a crumblized form. In the second trial, feed efficiency was
Tel:0985.588.164; Email: hungquangcnty@yahoo.com
improved 3 percent by reducing particle size from 1,000 to 500 microns in simple diets fed as a meal form but not in crumblized diets. Therefore, the response to reduced particle (600 to 500 microns) size in broiler chicks appears to be greatest when fed simple (grainsoybean meal) diets in a meal form. Feeding a complex diet in a crumblized form did not appear to require particle size below 1,000 microns. Studies with laying hens suggest no advantages in reducing particle size below 800 microns. In analyzing results of several experiments evaluating the effects of dietary particle size on pig performance, it is clear that the greatest effect of particle size is on feed efficiency. Most researchers would agree that reducing mean particle size of cereal grains to 600 m results in marked improvements in nutrient digestibility and efficiency of growth. Decreasing the particle size of ingredients results in a greater surface area to volume ratio. Smaller particles will have a greater number of contact points within a pellet matrix as compared to larger particles (Behnke, 1994) [2]. Some reports suggest that the effects of feed particle size on performance may be maintained even after pelleting. There appears to be a general consensus that particle sizes of broiler diets 55

based on maize or sorghum, optimum particle size should be between 600 and 900 m. Available data clearly show that grain particle size is more critical in mash diets than in pelleted or crumble diets. Although it has been postulated that finer grinding increases substrate availability for enzymatic digestion, there is evidence that coarser grinding to a more uniform particle size improves the performance of birds maintained on mash diets. This counter-intuitive effect may result from the positive effect of feed particle size on gizzard development. A more developed gizzard is associated with increased grinding activity, resulting in increased gut motility and greater digestion of nutrients. Although grinding to fine particle size is thought to improve pellet quality, it will markedly increase energy consumption during milling. Systematic investigations on the relationships of feed particle size and diet uniformity with bird performance, gut health and pellet quality are warranted if efficiency is to be optimized in respect of the energy expenditure of grinding (Amerah et al, 2007) [1]. In this research we investigated the Effects of feed particle size on the
performance and carcass characteristics of broilers. MATERIALS AND METHODS Birds and Diets Experiments were performed using 150 broilers (male and female) from a commercial Arbor acres breed. Starter and grower diets were prepared and manufactured from a local factory. All diets (Table 1) were cornsoybean-based and were formulated to meet or exceed NRC recommendations. All diets and water were provided for ad libitum consumption. Statistical Analysis The birds allocated in a completely randomized design with 3 diets by 2 replications (25 chickens/each replication). The chicken was grown till 42 days. The diets that were used are shown in table (1). The data collected were analyzed by using SAS (SAS Institute, 2002) [8]. The average daily gain and FCR were measured. At the end of the experimental period 4 birds were dissected from each treatment group to allow carcass, leg meat, breast meat, abdominal fat, gizzard and liver weight to be measured.
Table 1. Ingredient of diets formulated to NRC (1994) [6] specifications (kg per tone) No 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 Ingredient Yellow corn Soybean meal Rice bran Shell Sodium bicarbonate Salt Fish meal Peanut meal Phosphate Methionine Vitamin - Mineral premix Oil Calcium (%) Phosphorus (%) Methionine (%) Lysine (%) ME (kcal/kg) Crude protein (%) Starter 462 276 120 10 1.5 1 50 50 9 1.8 6 5 Nutrient contents 1.04 0.55 0.83 1.90 2885 22.00 Grower 512 226 120 9 1 50 50 12 1.8 6 5 1.04 0.54 0.78 1.80 2925 20.50
56

RESULTS AND DISCUSSION Effects of Feed Particle Size on Weight Gain Just as presented in Table 2, the average daily gain of chickens fed with pelleted diet was greater than those fed with the crumbled, and mixture of crumble and pellet diets. The effects of the pelleted diet seemed to be through enhancing feed intake and improving FCR (Table 2). These results are support by the work of Salari et al 2006 [7], Van biljohn (2005) [9], Galobart and Moran (2005) [5]. Blobasy et al (2005), which showed that the form of the diet hadnt significant effect on weight gain and FCR. Effects of Feed Particle Size on Feed Intake According to the average of daily feed intake (Table 2), we can understand that the daily feed intake in birds that used pellet was higher than that of bird fed other diets. Walstroom et al (1999) [10] reported that crumble diets as compared with mashed diets had most effects on feed intakes of hybrid layers. Increasing feed intake in pelleted diets is due to increased of digestibility, gelatinization of diet elements and increased palatability. On the basis of these results the effect of processing on improving performance of broiler is clear, making it important growers pay attention to the particle size of chicken food stocks because of its influence on FCR and weight gain.
No Items 1 Daily weight gain (g) 2 Feed intake (g/chicken/day) Feed conversion ration (FCR) 3 (kg feed/kg body weight) Whole pellet 60.86 2.32 105.83 6.43 1.73 0.27
Effects of Feed Particle Size on FCR As shown in Table 2, in the whole period, FCR were improved for pellet diet. These results are supported by Salari et a. (2006) [7]; Galobart and Moran (2005) [5]. Van biljan (2005) [9] showed that the Feed particle size did not significantly effect on feed efficiency however caused to improve the FCR. Effects of Feed Particle Size on carcass characteristics As show in Table 3, the texture/physical form of the diet has a significant effects on abdominal fats (p<0.05); however weight of carcass, breast meat, leg meat, liver, gizzard did not differ by feed particle size. Salari et al (2006) [7] has shown that pellet diets had significant effect on an increasing abdominal fats and decreasing femur percent of broiler compared to other diets. CONCLUSION The results of this study indicate that feeding of pellet diet did not have significant effect on body weight, body weight gain, feed intake and feed conversion ration. However it showed the improvement of feed intake and FCR compare to bird feeding with whole crumble or crumble and pellet mixture. The physical form of the diet had a significant effect on abdominal fat, which was highest in broilers that fed with pellet diet.
Whole crumble Crumble and pellet mixture 55.52 2.44 58.76 3.8 101.87 7.45 102.78 6.43 1.84 0.18 1.80 0.00
Table 2. Effects of feed particle size on Average Daily Gain, Feed Intake and FCR
Table 3. Effects of feed particle size on carcass characteristics (g) No 1 2 3 4 6 7 Items Carcass meat Breast meat Leg meat Abdominal fats Liver Gizzard Whole pellet 1242.70 22.50 551.25 27.50 459.76 35.00 50.09a 0.00 70.77 1.00 50.46 0.00 Whole crumble 1509.70 30.00 486.10 5.00 468.08 7.00 38.20b 4.00 63.12 6.20 51.60 2.00 Crumble and pellet mixture 1612.52 15.00 524.10 40.00 496.70 41.00 32.20b 5.50 72.70 2.15 42.03 5.65
* Different description letter in the same row is significantly differed with P<0.05
57

REFERENCES
[1]. Ameraha1, A.M., V. Ravindrana1 c1, R. G. Lentlea1 and D.G. Thomas, 2007. Feed particle size: Implications on the digestion and performance of poultry. World's Poul. Scie. J, 63:439-455. Doi: 0.1017/S0043933907001560. [2]. Behnke, K. C. 1994. Factors affecting pellet quality. Maryland Nutrition Conference. Dept of Poultry Science and animal Science, collage of Agricultural, University of Maryland, collage Park. [3]. Behnke, K. C. and R. S. Beyer. 2004. Effect of feed processing on broiler performance. Dissertation, Kansas State University, Manhattan. http://www.veterinaria.uchile.cl/publicacion/VIIIp atologia/SEMINARIOS/semi2.pdf [4]. Cabrera, M. R. 1994. Effects of sorghum genotype and particle size on milling characteristics and performance of finishing pigs, broiler chicks, and laying hens. M.S. Thesis. Kansas State University, Manhattan, KS 66506. [5]. Galobart. J. and E. T. Moran. 2005. Influence of stocking density and feed pellet quality on heat stressed broilers from 6 to 8 weeks of age. International Journal of Poultry Sci. 4(2): 55-59.
ISSN 1682-8356. http://www.pjbs.org/ijps/fin307.pdf [6]. National Research Council. 1994. Nutrient Requirements of Poultry. 9th rev. ed. National Academy Press, Washington, DC. ISBN-13: 9780-309-04892-7. [7]. Salari, S., H, Kermanshahi and H. N. Moghadam. 2006. Effect of sodium bentonite and comparison of pellet vs. mash on performance of broiler chickens. Int. J. Poul. Sci. 5 (1): 31-34. ISSN 1682-8356. 198.63.53.154 [8]. SAS Institute. 2002. Statistical Analysis System Proprietary Software. Release 8.1. SAS Inst.Inc., Cary, NC. [9]. Van biljon, J. N. 2005. The effect of feed processing and feed texture on body weight, feed conversion and mortality in male broiler. Department of production Animal and community Health faculty of Veterinary Science University of Pretoria. Dissertation of University of Pretoria. http://en.scientificcommons.org/45542782 [10]. Wahlstrm, A., K. Elwinger and S. Thomke. 1999. Total tract and ileal nutrient digestibility of a diet fed as mash or crumble pellets to two laying hybrids. Animal feed Sci and Tech. 77: 229-239. DOI: 10.1016/S0377-8401(98)00255-7.
TM TT NGHIN CU NH HNG CA CC DNG THC N N KH NNG SN XUT CA G THT

Nguyn Hng Quang1 v Ebrahimi R2
2
Trng i hc Nng Lm H Thi Nguyn Trng i hc Nng nghip v cc ngun t nhin Ramin
Nghin cu c tin hnh nhm nh gi nh hng ca ba loi hnh thc n c cu trc khc nhau (thc n vin, thc n mnh vn v hn hp thc n vin v thc n mnh vn) n kh nng sn xut tht ca g broiler. Th nghim c tin hnh trn 150 g tht broiler ging AA ln trng mi chia thnh 3 l th nghim vi 2 ln lp li (25 g/ th nghim lp li). Cc ch s c tin hnh theo di nh gi nh hng ca 3 loi hnh thc n: sinh trng tch ly, tng khi lng, tiu th thc n, tiu tn thc n/kg tng khi lng, khi lng v t l tht x, tht ngc, tht i, m bng, gan v d dy c. Kt qu ch ra rng khi lng sinh trng tch ly ca cc l th nghim l khng sai khc thng k. G l th nghim s dng thc n vin c tiu th thc n cao, tuy nhin tiu tn thc n g l th nghim s dng thc n mnh li cao hn 2 l cn li. Kt qu cng ch ra rng g s dng thc n vin c khi lng m bng cao nht v sai khc c ngha thng k so vi 2 l th nghim s dng thc n mnh vn v hn hp mnh vn vi thc n vin. T kha: Kch c thc n, ch s sinh trng, g broiler, sinh trng tch ly, tiu tn thc n
Tel:0985.588.164; Email: hungquangcnty@yahoo.com
58

Nguyn Th Thy M v cs Tp ch KHOA HC & CNG NGH 77(01): 59 - 64
NGHIN CU NH HNG CA GING, MT BI TH N KH NNG SN XUT THT CA G BN NUI NHT NNG H

Nguyn Th Thu M1*, Trn Thanh Vn2, Nguyn Tin t1
1
Trng i hc Nng Lm H Thi Nguyn; 2i hc Thi Nguyn
TM TT
Nghin cu c tin hnh nng h x Quyt Thng v Phc Xun, thnh ph Thi Nguyn trn 900 con g lai F1 (Ri x Sasso) v g a phng, vi 3 mt bi th khc nhau: 2, 3 v 4 m2/con. Kt qu cho thy: Mt bi chn th khc nhau c nh hng n kh nng ca g F1 (Ri x Sasso) v g a phng. mt bi th 3 m2/con, hai loi g u cho kt qu tt nht, cc ch tiu u cho kt qu tt hn so vi mt bi th 2 v 4 m2/con. Ging g khc nhau c nh hng r rt n kt qu, g lai F1 ( Ri x Sasso) cho kt qu sc sn xut tht tt hn v gi chi ph trc tip cho kg g tht thp hn so vi g a phng tt c cc mt bi th. Nng h nn s dng g lai c mu g nhp ni vi mt bi th 3 m2/con nui g tht bn chn th cho kt qu tt. T kha: bn nui nht, mt bi th, g lai, g a phng
T VN Chn nui g an ton sinh hc l p dng cc bin php k thut nhm m bo cho n g khe mnh, khng dch bnh. Hin nay, chn nui g th vn ang rt pht trin cc a phng. Theo Trn Thanh Vn v cs (2002) [7], mt bi th thch hp cho g tht lng mu nhp ni l 3m2/con. Tuy nhin, mt bi th thch hp vi g lai v g a phng vn cha c xc nh. nghin cu nh hng ca loi g v mt bi chn th n sc sn xut tht ca phng thc nui g bn chn th, lm c s khuyn co v nh hng k thut cho ngi chn nui g, gp phn vo xy dng m hnh chn nui g an ton sinh hc ti Thi Nguyn, chng ti tin hnh thc hin ti ny. I TNG, NI DUNG V PHNG PHP NGHIN CU i tng, thi gian v a im nghin cu G a phng v g lai F1 ( Ri x Sasso) nui bn chn th vi mt bi th ln lt l 2, 3, 4 m2/con ti nng h ca 2 x Quyt Thng, Phc Xun, TP Thi Nguyn. Thi gian t thng 10/2009 n thng 10/2010.
Tel: 0912 28 28 16; Email: tranthanhvantnu@gmail.com
Ni dung, phng php v cc ch tiu nghin cu * Ni dung nghin cu nh hng ca mt bi th khc nhau n kh nng sn xut tht ca g lai F1 ( Ri x Sasso) v g a phng nui trong nng h ti 2 x Quyt Thng, Phc Xun. * Phng php nghin cu Th nghim c b tr theo phng php phn l so snh, m bo ng u v cc yu t, ch khc nhau v i tng g v mt bi th. * Cc ch tiu theo di - T l nui sng; Sinh trng tch lu, sinh trng tuyt i; H s chuyn i thc n; Ch s sn xut v gi chi ph trc tip cho 1 kg tng. Phng php x l s liu S liu th nghim c x l theo phng php nghin cu trong chn nui ca Nguyn Vn Thin v cs, 2002 [6] v phn mm Minitab. KT QU NGHIN CU V THO LUN T l nui sng ca g th nghim G th nghim cc l u c t l nui sng cao, dao ng t 94,67 n 96,67 %. T l nui sng gia cc l th nghim l tng ng. T tun 7 n 12, khng c g cht tt c cc l th nghim. Tnh chung cho 3 mt , t l nui sng ca g lai v g a phng sai khc khng r rt. 59

Nguyn Th Thy M v cs Tp ch KHOA HC & CNG NGH S b tr th nghim L th nghim Din gii Loi g S lng (con) S ln lp li Tng s g th nghim Thi gian TN Phng thc nui + 1- 4 tun tui + 5 12 tun tui - Chung nui (g/m2) - Bi chn (m2/g) L th nghim L i chng 77(01): 59 - 64
L I L II L III L IV L V L VI g lai F1 ( Ri x Sasso) g a phng 50 50 50 50 50 50 3 3 3 3 3 3 150 150 150 150 150 150 1 12 tun tui Bn chn th Nht hon ton Th vn ban ngy 8 2 3 4 2 3 4 Bng 1. T l nui sng cng dn ca g th nghim (%)
F1 ( Ri x Sasso) Tun tui 3 7 8 9 10 11 12 L I L II

x
G a phng L III L IV
x
L V
x
L VI
x
X m
X m
X m
X m
X m
X m
96,00 1,15 95,33 0,67 95,33 0,67 95,33 0,67 95,33 0,67 95,33 0,67 95,33a 0,67
96,67 1,67 94,67 0,67 94,67 0,67 94,67 0,67 94,67 0,67 94,67 0,67 94,67a 0,67
96,00 0,00 94,67 0,67 94,67 0,67 94,67 0,67 94,67 0,67 94,67 0,67 94,67a 0,67
96,67 0,67 96,00 1,15 96,00 1,15 96,00 1,15 96,00 1,15 96,00 1,15 96,00a 1,15
97,33 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67a 0,67
97,33 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67 0,67 96,67a 0,67
*Ghi ch: Theo hng ngang nhng s mang cc ch ci ging nhau th sai khc gia chng khng c ngha thng k (P>0,05).
So snh vi kt qu nghin cu ca Nguyn Th Thy M v cs, 2009 [4] trn g Sasso bn nui nht v Xun H v v Thu ng, c t l nui sng dao ng 96,89 % 97,33 % th kt qu ca chng ti thp hn khng ng k. iu ny chng t, mt bi th khc nhau khng nh hng r rt ti t l nui sng ca c g a phng v g lai. Sinh trng ca g th nghim * Sinh trng tch lu Kt qu th hin bng 2 cho thy: Sinh trng tch lu ca g th nghim tng dn qua cc tun tui, tt c cc l th nghim vi ng u cao. Ti thi im 12 tun tui, khi lng g th nghim cao nht l II l 2022,1 g, tip n l l I 1984,8 g, v thp nht l IV, 1231,1 g. 60
Kt qu th nghim cho thy: Trong cng mt mt bi th, sinh trng tch lu gia g F1 ( Ri x Sasso) lun cao hn so vi g a phng. Tnh chung, khi lng g lai (1990,1 g) cao hn g a phng (1268,3 g), s sai khc ny c ngha thng k vi p<0,001. g lai, khi lng l II cao nht, thp nht l III, s sai khc c ngha thng k (P<0,05). L I v l II sai khc khng c ngha thng k vi P>0,05. g a phng, khi lng l V cao nht, thp nht l l IV vi sai khc c ngha thng k (P<0,05). L V v l VI c sai khc khng c ngha thng k vi P>0,05. Nh vy, mt bi th khc nhau nh hng ti sinh trng ca g th nghim. Sinh trng tch ly ca g lai v g a phng cho kt qu tt nht mt bi th 3m2/con. So snh vi nghin cu ca L Huy Liu, 2004 [3], nghin cu trn g Ri x Lng Phng v (Ri x kabir) th kt qu ca chng ti cao hn.

So snh vi kt qu ca Nguyn Huy t, 2001 [2] nghin cu trn g Lng Phng v Ri nui bn chn th. Nguyn Vn i v cng s 2001 [1] nghin cu trn g lai (Ma x Kabir), u c kt qu tng ng vi kt qu nghin cu ca chng ti. Kt qu nghin cu ca chng ti cng tng ng vi kt qu nghin cu ca B Kim Thanh, 2002 [5]; ca tc gi Trn Thanh Vn
2002 [7] trn g Sasso mt bi th 3m2/con cho kt qu sinh trng tt nht. * Sinh trng tuyt i Bng 3 cho thy cng mt bi th, sinh trng tuyt i trung bnh t 0-12 tun tui ca l I l 23,17 g/con/ngy cao hn l IV l 14,29 g/con/ngy, l II l 23,64 g/con/ngy cao hn l V l 15,15 g/con/ngy, l III l 22,93 g/con/ngy cao hn l VI l 14,74g/con/ngy.
Bng 2. Sinh trng tch ly ca g th nghim (gam) (n = 3 n) G F1 ( Ri x Sasso) TT L I L II

x
G a phng Trung bnh L IV L V

x
L III
x
L VI
x
Trung bnh
x
X m
N 4 10 11 12
X m
X m
X m
X m
X m
X m
X m
38,17 0,07 419,15 4,07 1625,0 5,83 1814,4 6,03 1984,8ab 7,70
38,16 0,06 418,89 1,83 1657,7 8,30 1849,8 8,56 2022,1a 11,8
38,26 0,28 419,02 3,08 1600,1 6,66 1787,1 6,15 1963,4b 7,79
38,20 0,03 419,02 0,08 1627,6 16,7 1817,1 18,10 1990,1*a 17,20
31,25 0,28 238,21 2,99 938,74 6,16 1089,0 5,32 1231,1d 5,17
30,70 0,38 235,46 2,78 988,92 3,40 1143,8 5,93 1302,6c 8,37
31,08 0,27 238,90 4,16 967,10 5,02 1123,1 7,76 1271,2cd 14,70
31,01 0,16 237,52 1,05 964,90 14,5 1118,6 16,0 1268,3*b 20,70
* Ghi ch: Theo hng ngang (tr 2 ct trung bnh so snh ring vi nhau) nhng s mang cc ch ci ging nhau th sai khc gia chng khng ngha thng k. Bng 3. Sinh trng tuyt i ca g th nghim (g/con/ngy) (n = 3 n) G F1 ( Ri x Sasso) Mt bi th L I L II
x
G a phng Trung bnh L IV L V

x
L III
x
L VI
x
Trung bnh
x
X m
8-9 9-10 10-11 11-12 0-12 29,78 0,51 28,64 0,38 27,06 0,04 24,34 0,24
X m
31,07 0,30 30,17 0,60 27,44 0,17 24,62 0,55 23,62a 0,14
X m
28,57 0,12 28,00 0,13 26,70 0,27 25,19 0,47 22,93b 0,09
X m
X m
17,54 0,19 18,96 0,84 21,46 0,35 20,30 0,19 14,29d 0,06
X m
21,20 0,32 21,28 0,77 22,16 0,64 22,82 0,86 15,15c 0,11
X m
X m
29,80 0,72 28,93 0,64 27,07 0,21 24,71 0,25 23,24*a 0,20
19,62 0,49 20,20 0,42 22,29 0,65 21,16 1,31 14,76cd 0,17
19,45 1,06 20,14 0,67 21,97 0,26 21,43 0,74 14,74*b 0,25
23,17ab 0,10
* Ghi ch: Theo hng ngang (tr hai ct trung bnh so snh ring) nhng s mang cc ch ci ging nhau th sai khc gia chng khng c ngha thng k.
61

Tnh chung, sinh trng tuyt i ca g lai (23,24 g/con/ngy) cao hn g a phng (14,74 g/con/ngy), s sai khc c ngha thng k vi P<0,001. g lai, sinh trng tuyt i l II cao nht, thp nht l l III. L I sai khc khng c ngha thng k so vi l II v l III (P>0,05). g a phng, sinh trng tuyt i l IV cao nht, thp nht l l VI. L VI sai khc khng c ngha thng k so vi l IV v l V (P>0,05). L V v l IV sai khc c ngha thng k vi P<0,05). Kt qu trn cho thy, g lai v g a phng cho kt qu sinh trng tt nht mt bi th 3m2/con. Kh nng chuyn ho thc n Qua bng 4 cho thy tiu tn thc n (TTTA)/kg tng khi lng ca g th nghim tng dn qua cc tun tui v c s khc nhau gia cc l. Trong cng mt bi th ti thi im 12 tun tui, TTTA ca l I l 2,92 kg thp hn l IV l 3,98 kg, l II thp hn l I l 3,60 kg, l III l 3,00 kg thp hn l VI l 3,69
kg. Tnh chung, TTTA ca g lai (2,89 kg) thp hn so vi g a phng (3,76 kg), s sai khc ny c ngha thng k vi P<0,01. g lai, TTTA ca l II thp nht, cao nht l l III. S sai khc gia cc l khng c ngha thng k vi P>0,05. g a phng, TTTA ca l V thp nht, l IV cao nht. L V v l VI sai khc so vi l IV c ngha thng k vi P<0,05. L V v l VI sai khc khng c ngha thng k vi P>0,05. Kt qu trn cho thy, mt bi th 3m2/con, TTTA ca c g lai v g a phng u thp hn so vi cc mt bi th cn li. Ch s sn xut Kt qu bng 5 cho thy, t 8 n 12 tun tui ch s sn xut ca g lai cao hn hn g a phng. g lai, ch s sn xut ca l II l 85,18 cao hn so vi l I l 79,76 v l III l 79,40, s sai khc ny c ngha thng k vi P<0,05.
Bng 4. Tiu tn thc n cng dn ca g th nghim (kg) (n = 3 n) Tun tui 8 9 10 11 12 G F1 ( Ri x Sasso) L I 2,39 2,50 2,61 2,76 2,92c L II 2,28 2,37 2,47 2,60 2,75c L III 2,44 2,56 2,70 2,84 3,00c Trung bnh 2,37 2,48 2,59 2,73 2,89 L IV 3,55 3,66 3,81 3,87 3,98a G a phng L V 3,29 3,36 3,44 3,52 3,60b L VI 3,34 3,43 3,52 3,58 3,69b Trung bnh 3,39 3,49 3,59 3,66 3,76
* Ghi ch: Theo hng ngang (tr 2 ct trung bnh so snh ring vi nhau) nhng s mang cc ch ci ging nhau th sai khc gia chng khng ngha thng k. Bng 5. Ch s sn xut ca g th nghim (n = 3 n) L TN Tun tui 8 9 10 11 12 G F1 ( Ri x Sasso) L I L II L III b a 117,54 125,71 111,86b 110,11b 103,64b 92,69b 79,76b 125,18a 116,53a 100,64a 85,18 a 105,69b 98,28b 88,96c 79,40b G a phng L V L VI c 49,00 48,70c 61,13c 59,97c 61,14d 61,40c 56,64c 55,96c 62,27d 56,88c
L IV 49,87c 46,81d 45,80d 54,50d 48,60d
* Ghi ch: Theo hng ngang nhng s mang cc ch ci ging nhau th sai khc gia chng khng c sai khc trong thng k.
62

g a phng, ch s sn xut ca l V l 61,40 cao hn so vi l IV l 48,60 v l VI l 56,88. iu ny cho thy, mt bi th 3m2/con ch s sn xut ca g lai v g a phng cho kt qu tt hn so vi mt 2 v 4m2/con. S b tnh gi chi ph trc tip Qua bng 6 cho thy, chi ph trc tip cho 1 kg g xut bn ca g lai thp hn so vi g a phng. Tnh chung, chi ph cho 1 kg g xut bn ca g lai l 28489,3 /kg, g a phng l 38701,2 /kg. c g lai v g a phng, chi ph cho 1 kg g xut bn mt 3m2/con thp hn so vi mt 2 v 4m2/con. mt bi th 3m2/con, chi ph/kg g xut bn ca g lai l 27245,4 /kg, g a phng l 37189,4 /kg. KT LUN Mt bi chn th khc nhau c nh hng n kh nng ca g F1 (Ri x Sasso) v g a phng. mt bi th 3 m2/con, hai loi g u cho kt qu tt nht, cc ch tiu u cho kt qu tt hn so vi mt bi th 2 v 4 m2/con; ti thi im 12 tun tui, khi lng
F1 ( Ri x Sasso) Din gii L I Phn chi ph trc tip (/kg g) Chi ph ging Chi ph thc n Chi ph thuc TY Chi ph khc Tng chi (/kg) 3459,9 24417 500 400 3372,4 3497,7 22973 500 400 25049 500 400 L II L III
bnh qun ca g lai l 2022,1 g v g a phng l 1302,6 g; sinh trng tuyt i ca g lai l 23,62 g/con/ngy v g a phng l 15,15 g/con/ngy; TTTA ca g lai l 2,75 kg/kg tng khi lng v g a phng l 3,60 kg/kg tng khi lng; ch s sn xut ca g lai l 85,18 v g a phng l 61,40; chi ph trc tip/kg g tht ca g lai l 27245,4 /kg v g a phng l 37189,4 /kg. Ging g khc nhau c nh hng r rt n kt qu, g lai F1 ( Ri x Sasso) cho kt qu sc sn xut tht tt hn v gi chi ph trc tip cho kg g tht thp hn so vi g a phng tt c cc mt bi th: n 12 tun, khi lng l 1990,1 g ca g lai so vi 1268,3 g ca g a phng; sinh trng tuyt i tng ng l 23,24 g/con/ngy v 14,74 g/con/ngy; h s chuyn ho thc n l 2,89 v 3,76; Ch s sn xut l 81,45 v 55,63; Gi chi ph trc tip l 28.489,3 /kg g tht v 38.701,2 /kg g tht. Nng h nn s dng g lai c mu g nhp ni vi mt bi th 3 m2/con nui g tht bn chn th cho kt qu tt.
Bng 6. S b tnh gi chi ph trc tip (/kg g tht) (n = 3 n) G a phng Tnh chung L IV L V L VI Tnh chung
3443,3 24146 500 400
6078,8 33830 500 400 40808,8
5689,4 30600 500 400
5840,4 31365 500 400
5869,5 31932 500 400 38701,2
28776,9 27245,4 29446,7 28489,3
37189,4 38105,4
TI LIU THAM KHO

[1]. Nguyn Vn i, Trn Thanh Vn, Trn Long, ng nh Hanh (2001), c im ngoi hnh v kh nng sinh trng, cho tht ca g lai F1 (Trng Ma x Mi Kabir) nui nht v bn chn th ti Thi Nguyn, Tp ch Chn nui s 5 2001, trang 9-13.
[2]. Nguyn Huy t, H Xun Tng v cng tc vin (2001), Nghin cu lai gia g Lng Phng vi g Ri nhm chn to ra ging g th vn phc v chn nui nng h, Bo co khoa hc, Vin Chn nui, tr.106-120. [3]. L Huy Liu (2004), Nghin cu kh nng sinh trng, cho tht ca g lai F1 ( Lng Phng x Ri) v F1( Kabir x Ri) nui th
63

vn ti Thi Nguyn, Lun n tin s nng nghip, i hc Thi Nguyn. [4]. Nguyn Th Thy M, Hong Th Hng Nhung, Nguyn Th Hi, Trn Thanh Vn (2009), "Nghin cu nh hng ca ma v v phng thc nui ti kh nng sinh trng v cho tht ca g thng phm Sasso", Tp ch Khoa hc v Cng ngh s 1 (49) nm 2009, trang 90-95. [5]. B Kim Thanh (2002), Xc nh mt bi th ti u cho g tht thng phm lng mu Sasso, Lng Phng nui bn chn th v h thu ti Thi Nguyn, Lun vn Thc s khoa hc
Nng nghip, trng i hc Nng Lm Thi Nguyn, trang 50-52. [6]. Nguyn Vn Thin (2008), Thng k sinh vt hc ng dng trong chn nui, Nxb Nng nghip, H Ni.
[7]. Trn Thanh Vn (2002), Nghin cu nh

hng ca mt s bin php ging, k thut n kh nng sn xut tht ca g lng mu Kabir, Lng Phng, Sasso nui bn chn th ti Thi Nguyn, Bo co ti cp B B 2001- 02-10, trang 50-55.
SUMMARY EFFECT OF BREEDS, GARDEN DENSITIES ON PERFORMANCE OF CHICKEN RAISING IN SEMIINTENSIVE SYSTEM AT HOUSE HOLD
Nguyen Thi Thuy My1, Tran Thanh Van2, Nguyen Tien Dat1
1
College of Agriculture and Forestry - TNU 2 Thainguyen University
The trial was carried out at house holds in Quyet Thang & Phuc Xuan Communes, Thai Nguyen city on 900 crossed breed and local breed chickens raising in semiintensive system with variety of garden density of 2, 3 and 4 square meters per chicken. Garden densities per chicken had influenced on performance of both crossed breed and local breed chickens raising semi intensive system. Garden density of 3 square meters per chicken showed the best results which is was, better than that of 2 and 4 square meters per chicken. Chicken breeds had influenced on performance, crossed breed F1 ( Ri x Sasso) there were better results of producing meat, direct cost of producing live chicken meat was lower when compare to local breed at all level garden densities. Households should raise crossed beed chicken with blood of imported breed and at 3 square metters garden per chicken in semiintensive system. Keywords: Semi intensive system, chicken density on garden, local breed, crossed breed.
Tel: 0912 28 28 16; Email: tranthanhvantnu@gmail.com
64

Trn Th Hoan v cs Tp ch KHOA HC & CNG NGH 77(01): 65 - 68
NGHIN CU NH HNG CA KHONG CCH TRNG SN LY L N SN LNG L SN V GI THNH CA BT L SN

Trn Th Hoan*, T Trung Kin
Trng i hc Nng lm - H Thi Nguyn
TM TT
Chng ti nghin cu trng sn ly l lm thc n cho vt nui vi 3 khong cch trng khc nhau l 1,0m x 0,4m; 0,8m x 0,4m; 0,6m x 0,4m. Kt qu nghin cu cho thy: nng sut l sn trung bnh t cao nht khong cch trng (0,8m x 0,4m) l 52,66 t/ha/la, ca khong cch trng (0,6m x 0,4 m) ng hng th hai, t 42,74 t/ha/la, khong cch trng (1,0m x 0,4m) c nng sut thp hn c, t 41,11 t /ha/la. V sn lng l ti, vt cht kh, protein khong cch trng 0,8m x 0,4m cng t cao nht (tn/ha/2 nm), ln lt l: 31,594; 8,239; 1,840, v c chi ph sn xut cho 1kg bt l sn thp nht : 3,871 ng. T kha: Khong cch, trng, sn ly l, sn lng, bt l sn
T VN cc nc pht trin, bt l thc vt l mt thnh phn gn nh khng th thiu c trong thc n hn hp ca vt nui. Hin nay, Vit Nam bt l thc vt cha c sn xut a vo thc n hn hp. Trong tng lai nc ta cng phi sn xut bt l thc vt a vo thc n hn hp nh cc nc pht trin. Trong cc loi cy trng, chng ti thy cy sn c trin vng sn xut bt l. Cy sn c sn lng l ln, t l protein trong l kh cao rt thch hp cho vic ch bin thnh bt l phi trn vo thc n hn hp ca gia sc v gia cm. V vy, chng ti d kin tin hnh mt s th nghim v cy sn vi mc tiu l sn xut bt l sn. Trong th nghim ny chng ti nghin cu nh hng ca khong cch trng sn ly l n sn lng l v gi thnh ca bt l sn. NI DUNG, PHNG PHP NGHIN CU Ni dung nghin cu Nghin cu khong cch trng sn ly l khc nhau tm ra khong cch thch hp, c sn lng cao v gi thnh sn phm thp. i tng, a im, thi gian nghin cu - i tng nghin cu: Ging sn KM94 - a im nghin cu: Trung tm Thc hnh Thc nghim, trng i hc Nng lm Thi Nguyn, tnh Thi Nguyn. - Thi gian nghin cu: Nm 2009 - 2010
Tel: 0988.520 086; Email: tranthihoan_tuaf@yahoo.com.vn
Phng php nghin cu Th nghim vi ba khong cch trng: 1,0 m x 0,4m (hng cch hng 1,0m, cy cch cy 0,4m); 0,8m x 0,4m v 0,6m x 0,4 m. Mi khong cch trng c b tr trn din tch 30m2 v c lp li 3 ln, b tr th nghim theo kiu ngu nhin hon ton. Liu lng bn phn cho 1ha/1 nm l: Phn chung: 10 tn, m l: 120 kg N, ln: 40 kg P2O5, Kali: 80 kg K2O. Nm th hai bn cng liu lng nh trn. Cc ch tiu v phng php theo di - Thnh phn dinh dng ca t th nghim v kh tng khu vc nghin cu (tnh Thi Nguyn). - Nng sut v sn lng l sn, thnh phn dinh dng ca l sn v gi thnh sn phm. - Phng php theo di cc ch tiu l cc phng php thng dng c s dng trong nghin cu trng trt v chn nui. * Phng php x l kt qu: Cc s liu thu thp c x l bng phng php th nghim trong chn nui ca Nguyn Vn Thin (2000) [3] v trn phn mm thng k Minitab 14. KT QU THO LUN Kh tng khu vc th nghim Khu vc th nghim (tnh Thi Nguyn) c nhit trung bnh nm l: 24,2oC, m trung bnh nm l 80,2%, lng ma trung bnh nm l: 1700 mm. Nh vy, kh tng 65

ca khu vc th nghim hon ton ph hp vi s sinh trng ca cy sn trng sn ly c. Tuy nhin, thi gian cui nm nhit v lng ma thng thp, khng hon ton ph hp vi trng sn ly l. Thnh phn dinh dng t th nghim t khu vc th nghim c pH l 4,51, Nit tng s l 0,03 %; P2O5 tng s: 0,06%, P2O5 d tiu l 11,81 mg/100g, K2O tng s 0,14 %; K2O d tiu : 3,52 mg/100g; OM: 2,20 %. Theo T Quang Hin v CS (2002) [1] th y l loi t chua va v ngho dinh dng, v vy cy trng c nng sut cao cn phi bn thm phn cho cy trng. Nng sut l sn Chng ti theo di nng sut l sn lin tc trong hai nm (2009 -2010), mi nm thu hoch c 3 la. Kt qu v nng sut l ca tng la c tnh trung bnh t hai nm, xem ti bng 1. S liu ca bng 1 cho thy: Nng sut l sn ca la 1 cao hn la 2, nng sut la th 3 ch bng 30% ca la u v khong 50% ca la th 2. S d nng sut la th 3 thp, v thi k ny lng ma thp, cc cht dinh dng cng cn kit dn do cung cp cho hai la u. Nng sut l sn trung bnh t cao nht khong cch trng (0,8m x 0,4m) l 52,66 t/ha/la, ca khong cch trng (0,6mx0,4m)
ng hng th hai, t 42,74 t/ha/la, khong cch trng (1,0m x 0,4m) c nng sut thp hn c, t 41,11 t /ha/la. Nng sut trung bnh ca khong cch trng (0,8m x 0,4m) c s sai khc r rt so vi hai khong cch trng cn li vi P< 0,05, nng sut ca hai khong cch trng (1,0m x 0,4 m) v (0,6m x 0,4m) khng c s sai khc r rt vi p>0,05. Thnh phn ha hc ca l sn L sn c thnh phn hc nh sau: 26,08 % VCK, trong vt cht kh c t l protein l: 22,70 %, lipit: 7,92 %, x: 12,21 %, dn xut khng cha ni t: 47,40 %, khong tng s: 7,49 %. Kt qu ny ph hp vi kt qu nghin cu ca Nguyn Th Lc v CS (2008) [2], Y. Froehlich v CS. (2001) [4] T l protein ca l sn kh cao, t l ny ch thua km so vi bt l keo giu (26-30%), cn ln hn so vi hu ht cc l h u khc. V vy, cng c th s dng bt l sn nh mt ngun cung cp protein cho vt nui. Sn lng l sn Cn c vo nng sut l sn ca tng la, t l vt cht kh v protein trong l sn chng ti tnh c sn lng l sn ti, vt cht kh, protein ca 1ha trong hai nm v c trnh by ti bng 2.
Bng 1. Nng sut l sn trung bnh theo cc la thu hoch (t/ha/la) 1,0 x 0,4 (X La 1 La 2 La 3 NSTB Khong cch trng v nng sut 0,8 x 0,4 (X 0,6 x 0,4 (X
La thu hoch
mX )
mX )
mX )
57,03 0,96 44,01 0,85 22,29 0,60 41,11
67,66 1,68 59,11 1,35 31,20 1,26 52,66
57,81 1,47 47,40 1,08 23,02 0,34 42,74
Bng 2. Sn lng l sn (tn/ha/2 nm) SL ti Khong cch 1,0 x 0,4 0,8 x 0,4 0,6 x 0,4 (X VCK (X Protein (X
mX )
mX )
mX )
24,667 0,35 31,594 1,6 0 25,646 1,74
6,432 0,06 8,239 0.26 6,688 0,29
1,436 0,02 1,840 0,09 1,493 0,10
66

Trn Th Hoan v cs Tp ch KHOA HC & CNG NGH Bng 4. Chi ph cho mt n v sn phm Ch tiu Chi ph 1ha/2 nm Sn lng BLS/ha/2 nm Chi ph cho 1kg BLS n v VN Kg VN Khong cch trng v nng sut 1,0 x 0,4 0,8 x 0,4 0,6 x 0,4 35.613.000 37.979.000 35.933.000 7.010 8.990 7.298 4.650 3.871 4.512 77(01): 65 - 68
Sn lng l sn ti t cao nht khong cch trng (0,8m x 0,4m) l 31,594 tn/ha/2 nm. Khong cch trng (0,6m x 0,4m) ng hng th hai l 25,646 tn/ha/2 nm, khong cch trng tha nht (1,0m x 0,4m) t sn lng l thp nht: 24,667 tn/ha/2 nm. Kt qu hon ton ph hp vi kt qu cng b ca D Wyllie, 1979 [5]. Sn lng vt cht kh ca l sn cng xp theo th t nh sn lng l ti, khong cch trng (0,8m x 0,4m) l: 8,239 tn/ha/2 nm, khong cch (0,6m x 0,4m) ng th hai l 6,688 tn/ha/2 nm, khong cch (1,0m x 0,4m) t thp nht l: 6,432 tn/ha/2 nm. Sn lng protein cng t cao nht khong cch trng c sn lng l cao nht (0,8m x 0,4m) l 1,840 tn/ha/2 nm v thp nht khong cch trng c sn lng l ti thp nht ( 1,0m x 0,4m) l: 1,436 tn/ha/2 nm. Sn lng l sn ti, vt cht kh v protein ca khong cch trng (0,8m x 0,4 m) c s sai khc r rt so vi cc khong cch trng (0,6m x 0,4m) v (1,0m x 0,4m) vi p< 0,05. C 3 sn lng nu trn (ti, vt cht kh, protein) ca khong cch trng (0,6m x 0,4m) so vi (1,0m x 0,4m) khng c s sai khc nhau r rt vi p> 0,05. Nh vy, khong cch trng (0,8m x 0,4m) t c 3 sn lng l ti, vt cht kh, protein cao nht. Chi ph sn xut cho 1 kg bt l sn Cn c vo chi ph phn bn, cng lao ng, hom ging, nghin bt l sn cho 1ha trong hai nm v sn lng bt l sn (BLS) ca 2 nm, chng ti tnh c chi ph sn xut 1kg bt l sn v kt qu c trnh by ti bng 4. Chi ph sn xut trng sn ly l cho 1ha trong vng hai nm nhiu nht i vi khong cch trng (0,8m x 0,4m) l 37,979 triu ng v khong cch trng (0,6m x 0,4m) l 35,933 triu ng, cn khong cch trng (1,0mx0,4m): 35,613 triu ng, nhng sn
lng bt l sn cng t cao nht khong cch trng (0,8m x 0,4m): 8,990 tn/ha/2 nm v th hai l khong cch trng (0,6m x 0,4m): 7,298 tn/ha/2 nm, v th 3 l khong cch (1,0m x 0,4m): 7,010 tn/ha/2 nm. V vy, chi ph cho 1kg bt l sn thp nht khong cch trng (0,8m x 0,4m) l : 3,871 ng (VN) v cao nht khong cch trng: (1,0m x 0,4m) l 4,650 VN. KT LUN Trng sn vi mc ch ly l sn xut bt l lm thc n chn nui vi 3 khong cch trng khc nhau l 1,0m x 0,4m; 0,8m x 0,4m v 0,6m x 0,4m, kt qu nghin cu cho thy khong cch trng 0,8m x 0,4m t sn lng l ti, vt cht kh, protein cao nht v chi ph cho sn xut cho 1kg bt l sn thp nht. V vy, c th p dng khong cch trng ny trng sn ly l vi mc ch lm thc n chn nui. TI LIU THAM KHO
[1]. T Quang Hin, Nguyn Khnh Quc, Trn Trang Nhung (2002), ng c v cy thc n gia sc, Nxb Nng nghip H Ni, tr.8-49. [2]. Nguyn Th Lc v L Vn An. Nghin cu s dng c v l sn xanh trong khu phn ln tht F1 (B x MC), Tp ch Khoa hc i hc Hu, (2008) 43- 48. [3]. Nguyn Vn Thin (2000), Phng php th nghim trong chn nui. Nxb Nng nghip. [4]. Froehlich. Y v Thi Vn Hng. S dng l khoai m trong cng nghip ch bin thc n gia sc, Sn Vit Nam hin trng nh hng v gii php pht trin nhng nm u th k XXI, Vin Khoa hc k thut Nng nghip min Nam (2001) 173 -174.
[5]. Wyllie D. (1979), Cassava leaf meals in

broiler diets, Faculty of Agriculture, Forestry and Veterinary Science, University of Dar es Salaam, Morogoro, Tanzania.
67

SUMMARY STUDY ON EFFECT OF CROP DENSITY ON CASSAVA LEAF YIELD AND COST OF LEAF POWDER
Tran Thi Hoan, Tu Trung Kien
College of Agriculture and Forestry - TNU
Three densities of cassava (1,0m x 0,4m; 0,8m x 0,4m; 0,6m x 0,4m) were planted. It showed that the density of 0,8m x 0,4m provided the highest leaf yield which was 5.266 ton/ha; the density of 0,6 m x 0,4 m provided 4.211 ton/ha, the density of 1 m x 0,4 m provided the lowest yield which was 4.111 ton/ha. In term of fresh leaves, dry matter, protein the density of 0,8m x 0,4m provided highest values which were 31,594; 8,239; 1,840 respectively with the lowest cost which was 3.871 VND/kg leaf powder. Keywords: Spacing, planting, cassava leaves, production, cassava leaf meal
Tel: 0988520086; Email: tranthihoan_tuaf@yahoo.com.vn
68

Trng Hu Dng v cs Tp ch KHOA HC & CNG NGH 77(01): 69 - 75
THE INFLUENCE OF WEANING TIME ON THE GROWTH OF PIGLETS AND REPRODUCTIVE PERFORMANCE OF SOWS IN VIET YEN DISTRICT, BAC GIANG PROVINCE
1 College of Agriculture and Forestry - TNU Viet Yen Bac Giang College of Agriculture and Forestry
Truong Huu Dung1*, Nguyen Thi Hanh2
ABSTRACT
Findings of the influence of weaning age on the growth of piglets and reproductive performance of Landrace, Yorkshire sows showed: When weaned at 18 days old, weaners grew better than those weaned at 25 days of age, in particular: In the period of 45 and 60 days, weaners bodyweight was, 13,62; 21,19 kg - 13,29 and 20.70 kg/head respectively with (P <0,05). In addition, the early weaning had no negative effect on the susceptibility rate of piglets for some gastrointestinal diseases, such as diarrhea and coccidiosis. Weaned at 18 days of age does not reduce the fertility of sows in the next litters, result of reproductive performance of herd of sows in the two comparative and experiment groups showed that the number of newborn piglets/ litter; number of alive newborn piglets/ litter and number of weaned pigs/ litter is similar: 11,42 -11,33 head/ litter; 10,45 - 10,44 head/ litter; 9,47- 9, 38 head/ litter(P> 0,05), respectively. Weaned piglets at 18 days of age also help the sow re-estrus sooner, which reduces weight loss and improves feed consumption ratio (FCR) of weaners at 60 days of age compared with weaned pigs at 25 days of age, these values were: 5,11 - 6,75 days (P <0,05): 10,17 - 11,80% (P <0,05) and FCR: 2,47 - 2,75 , respectively. Keywords: Early weaning; sow fertility, FCR, Etc
INTRODUCTION In animal production sector, pigs production is a conventional practice and it plays an important role in livestock production as its products mainly supplied to the market are pork, which accounted for 75-76% of the total meat supplied. Currently, pigs production in Viet Nam had grown very well, the numbers of sows increased from 2.9 million in 2001 to 4.09 million in 2009, which accounted for 13.10% of exotic sows, expecting to reached 14.20% by 2010. Although pig production in Viet Nam has grown rapidly in term of quantity as well as in term of quality. However, the quality of pork produced is relatively low, with lower percentate of lean meat, especially those produced in the midland provinces in the northern mountainous region. Thus, it does not only meet the consumer demand for lean, soft, little fat meat, with delicious taste and
Tel: 0912221821; E.mail: truonghuudung_tuaf@yahoo.com
flavor, but also fail to compete with regional markets and the worlds ones. As one of nine districts of Bac Giang, Viet Yen district was interested in developing herd of exotic sows on the farm, however, farmers who switched from growing domestic pigs or cross-bred pigs to high productivity pigs were limited or lack of information such as feeding, management, disease prevention etc... but the most urgent issue that they confront with is the weaning age of piglets in order to achieve most economical efficiency. Currently, farmers practice of weaning piglets at between 21 and 25 days old. But this is for the purpose of improving the productivity of exotic sows, reducing feed cost for 1 kg of weaned pigs, and to increase the number of litters/sow/year, eliminating some diseases transmission from sows to piglets, then the decision of the appropriate time to wean the piglets is a necessary task. Based on the above facts we conducted the trial: Effect of weaning age on the growth performance of piglets and the fertility of sows in Viet Yen District, Bac Giang province. 69

MATERIALS AND METHODS Materials - Exotic swine of Landrace and Yorkshire breeds (72 sows) through the third and fourth litters. - Piglets are Landrace, Yorkshire breeds from birth to 60 days old. Methods and Measurements * Methods: The experiment was assigned according to groups comparison. The tests ensure the principle of batches uniformity , feeding, housing conditions ... CP's feed for mother and baby pig in the weaning period was used.
Formula The numbers of piglet litter monitored Parent pigs litter number Sows Weight Number of piglets Breeds Male / female ratio Experimental factor Unit litter n/a litter kg head n/a M/F
Between two groups there are different lots of weaning time just for piglets Experimental group: weaning age was 18 days (experimental factor). Control group: weaning age was 25 days (It is currently a common practice at pig farms). In this experiment, we took the current weaning applied for reference in the ranches for more than a week early weaning (18 days). *Measurements: - The growth, feed consumption of the experimental piglets - The rate of diseases infection - The fertility of sows
Experimental group 36 (18 L, 18Y) Control group 36 (18 L, 18Y)
Landrace, Yrokshire 3rd 200 - 210 377 371 Landrace, Yorkshire 175/202 178/193 wean at 18 days Wean at 25 days
Period new born 15 30 45 60
Table 1. Accumulative growth of the experimental pigs (kg / pig) Experimental group Control group n (head) CV (%) n (head) X mx X mx a 377 1,62 0,01 3,11 371 1,63a 0,02 a 371 5,19 0,05 5,96 366 5,15a 0,06 a 362 8,57 0,06 3,99 354 8,44a 0,07 a 358 13,62 0,05 2,27 349 13,29b 0,06 a 355 21,19 0,13 3,74 345 20,70b 0,14
CV (%) 5,82 7,62 4,64 2,81 3,99
* Note: The different subdescription letters in the same row are significantly differed with (P <0,05).
Weight
30
( kg)
Experimental Th nghi?m Control
25
20
15
10
0 ss 15 30 45 60
Days of age
Diagram 1. The cumulative growth of pigs over periods
70

RESEARCH RESULTS Effect of early weaning on grow performance * Accumulative growth of experimental pigs: Bodyweight of newborn piglets between the two groups was similar at the start of experiment (P> 0,05) and increased gradually through the periods, exactly reflected the normality of the cumulative growth of piglets. During period from birth to 30 days old, piglets grew in two equal groups, which were 1,62- 8,57 kg/ head and 1,63 - 8,44 kg/ head respectively. So in this period, the early weaning did not only reduce the capacity of growing, but also promoted the growth of piglets in the next stage. Results obtained during the period from 30 45 days of age showed that growing pigs in experimental group and the control group had different bodyweight,:13,62 and 13,29 kg/ head, respectively (P<0,05). Thus, in this period, pigs in experimental group significantly grown faster than those in the control group by 0,33 kg/ head. (Checking for statistic is needed).
At 60 days of age, the average bodyweight of pigs in experimental group was 21,19 kg/ head which was significantly (P<0,05) higher than that of control group (20,70 kg). So in experiment group, piglets were weaned early would grow better than those in control group. (As a result, piglets are weaned early in experimental group ,so they can be fed other feed. * Absolute growth rate of experimental pigs: During period from 31 - 45 days old, the absolute growth of pigs increased rapidly, in particular: the absolute growth of experimental group and the control group was 336,30 grams/head/day and 323, 30 grams/head/day, respectively. the growth rate during this period of the second group was significant different. During period from 46-60 days: in the two experimental and control groups, piglets recieved similar nurture and care conditions, but growth rate of pigs in two groups was significant different: 504,70 grams/head/day; 494,20 grams/head/day (P <0,05), respectively. The result is illustrated in Figure 1.
Control group Cv (%) 9,04 7,80 5,23 8,92 n (head) 371 366 354 349
Table 2. Absolute growth of experimental pigs (grams/head/day) Experimental group Period New born - 15 16 - 30 31 - 45 46 - 60 n (head) 377 371 362 358
Weigth (gram) Khi l-ng (gam)
650 Th nghim i chng
X mx
237,90a 3,60 225,70a 2,90 336,30a 2,80 504,70a 7,50
X mx
234,60a 4,20 219,30a 2,90 323,30b 2,90 494,20b 8,20
Cv (%) 10,74 7,93 5,38 9,92
Note: The different subdescription letters in the same row are significantly differed with (P <0,05)
600
550
500
450
400
350
300
250
200 ss-15 16-30 31-45 46-60
Giai on (ngy tui)
Day of age
Figure 1. Absolute growth of experimental pigs
71

* Relative growth rate of experimental pigs: Relative growth rate is the percentage of body weight or size of the measured dimensions increased before and after survey. In Table 3 shows the relative growth rate of pigs was decreased. Relative growth rate of two experimental and control groups comply with the normality of growth which is reduced by an increase of age. During period from birth - 15 days old, relative growth rate of experimental group was 104,67% while that of the control group was 103,52%. During period from 16-30 days old, as this experimental factor has begun to be conducted on the two groups, the relative growth rate of the experimental and control groups was 49,28% and 48,53%, respectively. During period of 31-60 days old piglets had weaned and gradually adapted to new living conditions. Relative growth rate of pigs in two experimental and control groups is fairly uniform, with no significant differences. The result is shown in Figure 2. Influence of weaning age to the possibility of the incidence of diarrhea of experimental piglets * The incidence of diarrhea of experimental pigs:
Period new born - 15 16 - 30 31 - 45 46 - 60
T l (%)
140
The Findings showed that during period from birth to weaning, the prevalence of diarrhea in both groups was very high: 5,57 - 7,55% (P> 0,05), respectively. After weaning, the experimental and control groups showed that the incidence of diarrhea decreased over the corresponding periods was: 3,49 - 3,85% and 1,10 - 1,14% (P> 0,05), respectively. This finding suggests that, in the later stages of weaning, the infection rate for digestive pathogen of both groups were reduced and there was no difference found amoung the group, it might be due to pigs had equiped with the developer digestive system than they had before and this was capable to prevent the invasion of digestive pathogen better than in the previous period and weaning early at 18 days of age of pigs did not affect the prevalence of diarrhea. * The incidence of coccidiosis of experimental pigs: Results in Table 5 shows that the incidence of coccidiosis in experimental and control groups occurred in several stages from birth to weaning, the differences between the two groups did not have statistical significance (P > 0.05). This demonstrates that 18- day weaning period did not affect the incidence of coccidiosis in piglets compared to 25 day weaned pigs.
Control group Rate (%) 103,52 48,53 44,64 43,57
Table 3. Relative growth of experimental pigs Experimental group n (head) Rate (%) n (head) 377 104,67 371 371 49,28 366 362 45,51 354 358 43,45 349
120
Th nghim i chng
100
80
60
40
20 ss-15 16-30 31-45 46-60
Giai on (ngy tui)
Figure 2. Relative growth rate of experimental pigs
72

Trng Hu Dng v cs Tp ch KHOA HC & CNG NGH Table 4. The incidence of diarrhea of experimental pigs Experimental Group Comparative Group Number of Number of Number of Number of The incidence The incidence monitered infected pigs monitered infected pigs (%) (%) pigs (head) (head) pigs (head) (head) 377 21 5,57 a 371 28 7,55 a a 372 13 3,49 364 14 3,85 a a 363 4 1,10 352 4 1,14 a a 358 3 0,88 349 3 0,86 a 77(01): 69 - 75
Period new born-wean Wean - 30 31 45 46 - 60
Note: The different subdescription letters in the same row are significantly differed with (P <0,05) Table 5. The incidence of coccidiosis of experimental pigs Period Experimental Group Number of Number of The monitored infected incidenc pigs(head) pigs (head) e (%) 377 131 34,75 a 372 2 0,54 a 363 0 0,00 358 0 0,00 Comparative Group Number of Number of monitored infected pigs(head) pigs (head) 371 120 364 1 352 0 349 0 The incidence (%) 32,35 a 0,27 a 0,00 0,00
new born-wean Wean - 30 31 - 45 46 - 60
Note: The different subdescription letters in the same row are significantly differed with (P <0,05)
Through this results we could see that early weaned pigs did not affect the incidence of coccidiosis and diarrhea in pigs. However, the period after weaning is the susceptible stage which is very high, therefore, avoiding stress is unnecessary at this point. (Vague: needa be reviewed) Affect of weaning age on sows fertility The result of monitoring the fertility of the sow of two experimental and control groups showed that the number of newborns/ litter, the number of alive newborns/litter and the number of weaned pigs/ sows litter in the groups is similar,, which were 11,42 - 11,33 head/ litter; 10,45 - 10,44 head/ litter; 9,47 9,38 head/ litter (P > 0,05), respectively. The weight loss of sows in both groups showed significant differences, , from 10,17 to 11,80% (P<0,05), respectively. In experimental group, the weight loss is lower than that of the control group, it might due to the nursing time is 7 days shorter, therefore, early weaning had reduced the weight loss of sows. Re-estrus time of sows after weaning in experimental groups was 5,11 days and 6,75 days in the control group (P <0,05). Thus weaned pigs at 18 days had helped sows reestrus sooner.
The above analysis shows that the indicators on the fertility of the two groups do not differ markedly. Proved early weaning period of piglets does not reduce the reproductive performance of sows, on the other hand it also prevent the weight loss of sows, and sows soon returned to estrus cycle after weaning. Effect of early weaning age to feed consumption / kg of 60-day-old pigs FCR of 60-day-old piglets is an indicator of economic and of an important technique. For farmers, this indicator reflects the level of care, level of feeding of gilts and pigs post weaning to 60 days old, and it also reflects the breeding effective (production efficiency?). For sows, this indicator reflects her ability to utilize feed for the metabolic process to supply the needs for pregnancy and lactation. Results of FCR at 60-day-old pigs in the next litter is shown in Table 8. Amount of feed for pigs up to 60 days of age in experimental group was higher than that for the control group, which were: 210,54 and 200,49 kg/ litter, respectively. The reason is that in experimental group, with earlier weaning practice, the piglets were accessed to feed one week earlier than those in the control group. 73

Table 6. Results of monitoring reproductive performance of exotic sows in the fourth litter Experimental group Targets Number of newborn pigs/ litter Number of alive new born pigs/ litter Rate of alive new born pigs Weight of new born pigs / litter Weight of new born pigs/head Number of weaners / litter Weight of weaners Weight of weaners Weight loss of sow Re-estrus after separated unit n 36 11,42a 10,45a 92,24a 16,94a 1,62a 9,47 53,81 5,72 10,17a 5,11a Cv (%) 10,95 Comparative group Cv X mx (%) 11,33a 10,44a 92,87a 17,05a 1,63a 9,38 67,50 7,41 11,80b 6,75b 0,24 12,44
X mx
0,21
n 36
head
head
36 36 36 36 36 36 36 36 36
0,08 1,30 0,14 0,01 0,34 0,16 0,21 0,56 0,34
4,83 8,78 4,97 3,89 15,55 15,24 16,98 17,56 39,73
36 36 36 36 36 36 36 36 36
0,15 1,30 0,24 0,01 0,27 1,98 0,12 0,43 0,68
8,40 8,40 8,56 3,30 14,00 15,20 10,97 25,59 60,59
% kg kg head kg kg % day
* Note: The different subdescription letters in the same row are significantly differed with (P <0,05)
Con 13
12
Th nghim i chng
11
10
S con ss/
S con ss cn sng/
S con cai sa/
Figure 3. Number of newborns/litter, the number of alive newborn pigs and number of weaned pigs/litter of experimental sows in the next litter Table 8. FCR of pigs till 60-day-of age Categories Feed for sows Feed for waiting for copulating sows Feed for pregnant sows, period 1 Feed for pregnant sows, period 2 Feed for breeding child sows Feed for 60 day- old piglets / litter Total feed for a sow and for piglets until 60 day- of age Total bodyweight of 60-day-old piglets/ litter Total of feed / kg until 60 - day-old pigs Experimental group n Amount of (head) feed (kg) 36 36 36 36 36 36 36 36 12,77 153,00 60,00 80,00 210,54 516,31 208,93 2,47 Control group n Amount of feed (head) (kg) 36 36 36 36 36 36 36 36 16,87 153,00 60,00 115,00 200,49 545,36 198,31 2,75
74

FCR up to 60-day-old pigs in experimental group was lower than that of the control group, which were from 2,47 and 2,75 respectively, The difference of 0,28 in FCR suggests that early weaning had reduced feed consumption of 1 kg per pig up to 60 -day- old piglets, this is a very important factor in pig production to reduce production cost, to improve economic efficiency in sows keeping. CONCLUSION Early weaning had a positive effect on piglets performance during the stage of 45 and 60 days of age. Early weaning did not affect the susceptibility rate of some gastrointestinal diseases such as diarrhea and coccidiosis. Early weaning did not reduce the reproductive performance of sows in the next litter. Early weaning had stimulated the sow to reestrus sooner.
REFERENCES [1]. Dang Vu Binh (1999), Phn tch mt s nh

hng ti cc ch tiu nng sut sinh sn trong mt la ca ln ni ngoi Findings of scientific research (1996-1998), Agricultural Publishing House, p.: 5-8. [2]. Chm sc ln con s sinh Journal of science and life, No. 48, 06.17.2005, p.10. [3]. Phan Xuan Hao (2006), nh gi kh nng sn xut ca ln ngoi i b m v con lai nui tht Report of writing in science and technology in the level of ministry [4]. Truong Lang (2004), Cai sa sm cho ln con Da Nang Publishing House. [5]. Tran Quoc Vietnam, Ninh Thi Len, Pham Duy Pham and collaborators (1997) Nghin cu mt s bin php k thut nui dng v cai sa ln con ging ngoi 30 35 ngy tui, Scientific results of breeding scientific and technical studies (1996-1997). Agricultural Publisher, p.: 12-20.
TM TT NH HNG CA THI GIAN CAI SA N SINH TRNG CA LN CON V KH NNG SINH SN CA LN NI TI VIT YN, BC GIANG
Trng Hu Dng1, Nguyn Th Hnh2
1
Trng i hc Nng Lm H Thi Nguyn 2 Trng Cao ng Nng Lm Bc Giang
Kt qu nghin cu nh hng ca thi gian cai sa n sinh trng ca ln con v nng sut sinh sn ca ln m ging Landrace, Yorkshire cho thy: Cai sa 18 ngy tui, ln con sinh trng tt hn so vi vi cai sa 25 ngy, c th: giai on 45 v 60 ngy tui, khi lng ln con cai sa tng ng l 13,62; 21,19 kg/con - 13,29 v 20,70 kg/con vi (P< 0,05). ng thi, cai sa sm cho ln con khng nh hng n t l cm nhim mt s bnh ng tiu ha nh bnh tiu chy v cu trng. Cai sa 18 ngy tui khng lm gim nng sut sinh sn ca ln m la tip theo v gip ln m ng dc tr li sm hn, gim t l hao mn v gim tiu tn thc n/kg ln con 60 ngy tui so vi cai sa 25 ngy tui, tng ng l: 5,11 - 6,75 ngy (P< 0,05); 10,17 - 11,80%, (P< 0,05); 2,47 - 2,75kg thc n/kg tng khi lng. T kha: Cai sa sm; ln ni sinh sn, FCR, Etc
Tel: 0912221821; E.mail: truonghuudung_tuaf@yahoo.com
75

76

Chu Hong Mu v cs Tp ch KHOA HC & CNG NGH 77(01): 77 - 82
THE DROUGHT TOLERANT CHARACTERISTICS OF SOME UPLAND LOCAL MAIZE CULTIVARS (ZEA MAYS L.) IN THE NORTH OF VIET NAM
Chu Hoang Mau1*, Nguyen Vu Thanh Thanh2, Pham Thi Thanh Nhan1
1*
Department of Genetics and Modern Biology, College of Education - TNU 2 Department of Genetics, College of Science - TNU
SUMMARY
Maize (Zea mays L.) is one of the widely grown grains in Viet Nam. The local upland maize cultivars play an important role for the life of people living in mountainous regions in the North of Viet Nam. The quality of seed and drought tolerance ability of local upland maize cultivars are good. In this work, we have studied drought tolerance character and dehydrin gene of some local upland maize cultivars. Among them these are six cultivars with high drought tolerance ability (BK, HL, QH, YM, TL, and QU) and two maize cultivars BG and VN2 with low drought tolerance ability. Dehydrin LEA (lete embryogenesis abundant) D11 is a plant protein family in a number of higher plants, a species of protein produced by plants during drought or low temperature stress. These are six dehydrin protein types of maize: dhn1, dhn2, dhn3, dhn4, dhn5, and dhn6. DHNs are unified by the presence of one or more copies of a putative amphipathic helix-forming domain (the K-segment), which is highly conserved in higher and lower plants and has a 15 residue consensus sequence EKKGIMDKIKEKLPG. We had cloned dhn1 gene from DNA of genome of local upland maize cultivars. The 0.6 kb of dhn1 gene was amplified by PCR and carry out successfully with LeaZeM1 primers. Cloning of PCR products and DNA sequencing is carrying out. Keywords: Dehydrin, drought, upland local, maize,Dhn1, cloning, PCR
INTRODUCTION Maize is widely cultivated throughout the world. Maize (Zea mays L.) is also one of the widely grown grains in Viet Nam. The local upland maize cultivars play an important role for the life of people living in mountainous regions in the North of Viet Nam. The quality of seeds, drought tolerance ability and resistant ability for of local upland maize cultivars are good. Therefore, the preservation of the gene resource of the local upland maize cultivars is now very necessary. To research on drought tolerance ability of local upland maize cultivars, we isolated dehydrin gene. Dehydrin LEA (late embryogenesis abundant) D11 and dehydrins are products of multigene families in a number of higher plants (Close, 1996) [2], a species of protein produced by plants during drought or low temperature stress. These are six dehydrin protein types of maize: dhn1, dhn2, dhn3, dhn4, dhn5, and dhn6. DHNs are unified by
Tel:0913 383 289; Email:mauchdhtn@gmail.com
the presence of one or more copies of a putative amphipathic -helix-forming domain (the K-segment), which is highly conserved in higher and lower plants and has a 15 residue consensus sequence EKKGIMDKIKEKLPG (Allagulova et al.,2003 [1]; Hong-Bo et al., 2005 [6]; Yuxiu et al. 2007 [15]). Dehydrins (DHNs; late embryogenesis abundant D-11) are a family of plant proteins induced in response to abiotic stresses such as drought, low temperature, and salinity or during the late stages of embryogenesis (Close, 1989 [3]; Allagulova et al., 2003 [1], Roat, 2006 [14]). In Viet Nam, quality of seeds, drought tolerance ability and resistant ability for of local upland maize cultivars in the North have are good (Mau and Anh, 2005 [10]; Nhan et al., 2007 [13]), they are diversity of phenotype and genotype (Mau and Anh., 2006 [11]). The genetic diversity and diversity of dehydrin gene of Viet Nam maize cultivars has been researched (Lien et al., 2005 [8]; Mau et al, 2007 [12]). 77

MATERIALS AND METHODS Eight local maize cultivars (BK, HL, QH, YM, TL, QU, BG and VN2) provided by the mountainous region of North in Viet Nam (Table 1). One specific primer pair, including:
LeaZeM1F 5' ATGGAGTACGGTCAGCAGGGGC 3 LeaZeM1R 5' TCAGTGCTGTCCGGGCAGC 3'
Cloning pTZ57R/T vectors. Both primers and vector are supplied by Fermentas. Definition of sugar content and - amylase activity value at the germinating stage by 5% sorbitol treatment. Assessment of drought tolerance ability of eight maize cultivars at the plantlet stage by factitious drought treatment. Definition of the dissimilar coefficients of maize cultivars by the NTSYSpc- 2.02i program. Total DNA is separated from leaf of eight maize cultivars following the method of Gawel and Jarnet (Gawel et al., 1991) [4]. PCR is performed in a total volume of 50 l. PCR conditions are: an initial denaturation step of 940C for 3 min, followed by 30 cycles
Order 1 2 3 4 5 6 7 8 Maize cultivars BG BK HL QH YM TL VN2 QU Wax/flint Wax Wax Wax Wax Wax Wax Wax Flint
of 940C for 30 sec, 570C for 1 min and 720C for 1 min. The final extension step is 720C for 10 min. The PCR products are checked by 1% agarose gel electrophoresis. PCR products are cloned into pTZ57R/T (Glick et al., 1998) [5]. RESULTS AND DISCUSSIONS The drought tolerance ability of some local Vietnamese maize cultivars * The analysis of biochemistry characters at the germinating stage: We researched on sugar content and amylase activity in 8 maize cultivars at the germinating stage by 5% sorbitol treatment. The results have shown in table 2 and table 3. When treating physiological drought by 5% sorbitol treatment, sugar content and amylase activity were also increased from 1 to 11 day germ maize, and decreased at 14 day germ maize, highest at 11 day germ maize. HL cultivar had the highest sugar content and - amylase activity, VN2 cultivar was lowest.
Origin Local Bacgiang cultivar Local Backan cultivar Local Halang-Cao Bang cultivar Local Quanghoa- Caobang cultivar Local Yenminh- Ha Giang cultivar Local Tralinh- Cao Bang cultivar Hybrids Vietnam cultivar Local Quanguyen- Cao Bang cultivar
Table 1. Origin of eight maize cultivars in the North of Vietnam
Table 2. The variation of sugar content of 8 maize cultivars by 5% sorbitol treatment Maize Cultivars BG BK HL QH YM TL VN2 QU The variation of sugar content at the germinating stage by 5% sorbitol treatment (%) 1 day 3 day 5 day 7 day 9 day 11 day 14 day germ germ germ germ germ germ germ maize maizet maizet maize maize maize maize 0.53 0.08 0.65 0.02 0.67 0.06 1.04 0.01 1.05 0.01 1.32 0.05 0.58 0.01 0.34 0.03 0.40 0.08 0.790.01 1.04 0.02 1.05 0.01 1.33 0.03 0.60 0.01 0.23 0.03 0.30 0.05 0.29 0.02 0.33 0.03 0.18 0.04 0.18 0.07 0.52 0.10 0.59 0.06 0.57 0.02 0.60 0.10 0.50 0.03 0.65 0.07 0.79 0.01 0.82 0.03 0.85 0.03 0.84 0.11 0.68 0.05 0.86 0.05 1.05 0.01 1.05 0.01 1.05 0.01 1.05 0.02 1.02 0.02 1.03 0.02 1.06 0.01 1.06 0.00 1.07 0.00 1.06 0.00 1.05 0.01 1.06 0.00 1.39 0.02 1.34 0.06 1.32 0.04 1.35 0.04 1.30 007 1.38 0.04 0.64 0.03 045 0.09 0.55 0.09 0.47 0.07 0.40 0.09 0.66 0.01
78

Table 3. The variation of - amylase activity of 8 maize cultivars by 5% sorbitol treatment

Maize The variation of - amylase activity at the germinating stage by 5% sorbitol treatment (activity unit/mg) 3 day germ maize 0.00810.00 0.00330.00 0.00140.00 0.00400.00 0.00620.00 0.00510.00 0.00030.00 0.00220.00 5 day germ maize 7 day germ maize 9 day germ maize 11 day germ maize 14 day germ maize
Cultivars 1 day germ maize BG BK HL QH YM TL VN2 QU 0.00030.00 0.00040.00 0.00040.00 0.00040.00 0.00020.00 0.00030.00 0.00020.00 0.00040.00
0.01200.00 0.09300.04 0.14620.00 0.16410.00 0.00710.00 0.01240.00 0.06400.02 0.07330.00 0.20240.00 0.00430.00 0.01310.00 0.20630.06 0.22400.00 0.24300.00 0.01620.00 0.00540.00 0.01140.00 0.02810.00 0.20730.01 0.02910.00 0.00810.00 0.06420.00 0.06740.00 0.19340.00 0.04420.00 0.00700.00 0.04630.01 0.07030.00 0.19420.00 0.03940.00 0.00220.00 0.04110.01 0.06810.00 0.13400.00 0.01100.00 0.00610.00 0.05420.01 0.06120.00 0.14740.01 0.00420.00
* Study on the drought tolerance ability of maize cultivars: We assessed the drought tolerance ability of maize cultivars at the plantlet stage by factitious drought treatment. The results showed the difference of the drought tolerance ability (table 4). The dryness index in maize cultivars were from 10715.40 to 33763.98 and was highest drought tolerance ability in HL cultivar. The dissimilar coefficients of response of 8 maize cultivars were determined by NTSYSpc- 2.02i program. The dendrogram was established for two groups: BG, VN2 in one, and BK, HL, TL, QU, QH, YM in other. The similar coefficients of maize cultivars were from 0% to 30.43% (fig 1). By physiological and factitious drought treatment, we selected HL cultivar with the highest drought tolerance ability, and VN2 cultivar with the lowest. Amplification and cloning of dehydrin genes Dehydrins are a group of proteins that are accumulated during environmental stress such as drought and low temperature or during late embryogenesis. However, DHNs contain at least one copy of a consensus 15-amino acid sequence, the "K segment," which resembles a class A2 amphipathic alpha-helical, lipidbinding domain found in other proteins such
as apolipoproteins and alpha-synuclein. The presence of the K segment raises the question of whether DHNs bind lipids, bilayers, or phospholipid vesicles (Allagulova et al., 2003 [1]; Yuxiu et al., 2007 [15]). With the analysis of dehydrin gene sequence in a maize cultivar in NCBI which has code X15290, we design specific primer pair to amplify and see dehydrin genes in maize cultivars (http://www.ncbi.nlm.nih.gov/X15290) [7]. To isolate gene encoding dehydrin in genome of maize cultivars, we segregated the DNA total. The DNA concentration of 50 ng of all sample was suitable to amplify the dehydrin gene fragments. There are no visual difference in the size of PCR products of all DNA sources from eighth cultivars, the size of the PCR product expected to be around 600 bp (Fig 2). We selected HL and VN2 cultivar to clone. The PCR products were inserted into the cloning vector pTZ57R/T and transformed into E.coli strain DH5 and selected by blue/white technique. The results of gene transfomation and selection shows in figure 3. We choose white fungus colony grewn in LB liqid medium containing 100 mg/l ampicillin all night. PCR products of cloning are checked by 1% agarose gel electrophoresis (figure 3). 79

Table 4. The drought tolerance ability of maize cultivars at the plantlet stage Maize cultivars Dryness index BG BK HL QH 18631.25 YM 16727.51 TL 25193.69 VN2 10715.40 QU 17535.57 12799.96 22148.68 33763.98
Figure 1. Phylogenetic tree of 8 maize cultivars
600bp
Figure 2. PCR products amplified using dehydrin genes specific primers and genomic DNA samples of BK, HL, TL, QU, BG and VN2 maize cultivars; M: Marker 1kb
800bp
Figure 3. Result of PCR cloned products M: Marker . 1. HL; 2.VN2
80

We can see the result of electrophoresis shown in fig 3 that these PCR products which are issued from white fungus colony are positive. Most of the products are only one band with right size. This improves that the results of transfomation and cloning selection are good and PCR is optimistic. We can confirm that connecting PCR products with clone vectors has good result. We choose white fungus colony of researching samples with these Plasmids were purified by QIAprep Spin Miniprep Kit. LEA is proteins group have playing important on the water loss and the droughtresistant ability of cell. When dehydration occurs, messenger RNA appears in the seed and is forming and increase of quantity, including many different messenger RNA of in the seeds and are decomposition all in the process of germinating. The dehydrin (dhn) are associated with phospholipid particles in the final stages of embryo formation and disappear very quickly start to germinate. This capability of dhn enables prediction about protection functions in the cell membrane of phospholipid particles. The level of transcription of LEA gene is controlled by the absisis acid (ABA) and dehydration and osmotic pressure of the cells. A characteristics of the group of LEA proteins include from 82 to 575 amino acids, rich in hydrophobic amino acids (lysine, glycine), does not contain cysteine and tryptophan, is the - helix and heat resistance (Close, 1996) [2]. It replace the position of water in cells and perform different functions such as ion isolation and protection of proteins of membrane, degrade denatured proteins and adjust the osmotic pressure. Introns exist in most of the genetic structure of eukaryote cells and are noted research to find out its function. In structure of intron is rich of AT and have jump elements (transposone element). The diversity in quantity and length of introns can affect the function of gene expression. Most of dehydrin genes have no introns, but in some cases they also discovered the small introns or SK2 Y2SK2 structured.
Dehydrin gene was isolated from genomic DNA of maize Viet Nam in size is 0.65 kb and have 121 bp of region introns, shorter than 16 bp of the Rab17 gene (Lien et al., 2007) [9]. The scientists found that some introns are in positions of genes can promote of expression in plants increases several times. Therefore necessary to have further studies to elucidate the role of introns in the structure of dehydrin gene. Local glutinous maize cultivars in mountainous northern of Vietnam have high quality seeds and the drought-resistant ability, in addition, local glutinous maize seeds are resistant to termites. The problem is the structure of dehydrin genes and other genes isolated from the local glutinous maize related to drought tolerance have what different with the genes of other maize cultivars? COCLUSIONS By physiological and factitious drought treatment, we selected HL cultivar with the highest drought tolerance ability, and VN2 cultivar with the lowest. We have designed one specific primer pair and isolated dehydrin genes from two maize cultivars (Zea mays L.) with PCR analysis. A 600 bp dehydrin gene fragment from DNA genome of local maize was successfully amplified. The PCR products containing the dehydrin fragment was cloned in pTZ57R/T vector and plasmids were purified by QIAprep Spin Miniprep Kit and sequenced. Should continue to clarify the differences in genetic structure of local mountain maize folds with other corn varieties. REFERENCES [1]. Allagulova Ch. R., Gimalov F. R., Shakirova F. M., Vakhitov V. A. 2003. The Plant Dehydrins: Structure and Putative Functions, Biochemistry (Moscow), 68(9): 945-951. [2]. Close T.J., 1996. Dehydrin: Emergence biochemical role family plant dehydrin proteins, Plant Physiol 97, 795-803. [3]. Close T.J., 1989, Zea mays mRNA for dehydrin (dhn1 gene), Plant Mol. Biol, 13 (1), 95- 108. 81

[4]. Gawel N.J., Jarret R.L., 1991. Genomic DNA isolation. http://www.igd.cornell.edu/ [5]. Glick R.B., Pasternak J.J., 1998, Molecular Biotechnology, American Society Microbiology. [6]. Hong-Bo S., Zong-Suo L., Ming-An S., 2005. LEA proteins in higher plants: Structure, function, gene expression and regulation, Colloids and surfaces B: Biointerfaces, 45 (3-4): 131-135. [7]. Http://www.ncbi.nlm.nih.gov/X15290. [8]. Lien TTP., Ton ND., Huong LTT., Cuong BM., Tinh NH., 2005, Isolation of dehydrin gene from Zea mays , Journal of Biotechnology, 3(3): 347- 352. [9]. Lien TTP., Thu VH., Cuong BM., 2007. Polymorphism of dehydrin genes of several Vietnamese maize cultivars. Journal of Biotechnology 5(4): 485-491. [10]. Mau CH., Anh NV, 2005. The assessment of the quality of seeds and the responsive ability to drought condition of some local maize cultivars in mountainous region. Science & Technology Journal of Agriculture & Rural develpment, 66: 20-22.
[11]. Mau CH., Anh NV., 2006, The genetic diversity of some local stichky and white maize cultuvars with different drought ability. Journal of Science &Technology, Thai Nguyen University, 2 (38): 77-84 [12]. Mau CH., Thanh NTT., Nhan NT., 2007. Reseach on gene of drought tolerance of some upland local maize cultivars (Zea mays L.) in the North of Vietnam. Bio-Hanoi 2007 - International Conference, December 18-19, 2007 Hanoi, Vietnam. [13]. Nhan PT., Mau CH., Tam NT., 2007. The response of some upland local sticky corn cultivars (Zea mays L.) in tissue and young phase. Proceeding, the 2007th National Conference on Life Science. Science and Technics Publishing House Hanoi, 784-788. [14]. Rorat T., 2006. Plant dehydrin tissue location structure and function. Cell Mol Biol Lett 11: 536-556. [15]. Yuxiu Z., Zi W., Jin X., 2007. Molecular mechanism of dehydrin in response to environmental stress in plant, Progress in Natural Science, 17 (3): 237- 246.
TM TT C TNH CHU HN CA MT S GING NG A PHNG (ZEA MAYS L.) MIN NI PHA BC VIT NAM
Chu Hong Mu1, Nguyn V Thanh Thanh2, Phm Th Thanh Nhn1
1*
B mn Di truyn v Sinh hc hin i, Khoa Sinh-KTNN, Trng i hc S phm 2 B mn Di truyn, Khoa Khoa hc S sng, Trng i hc Khoa hc
Ng (Zea mays L.) l mt trong nhng loi ng cc c trng rng ri Vit Nam. Cc ging ng a phng ng vai tr quan trng trong i sng ca ngi dn sng khu vc min ni pha Bc Vit Nam. Cc ging ng a phng min ni c cht lng ht cao v c kh nng chu hn tt. Trong bi bo ny, chng ti trnh by kt qu nghin cu kh nng chu hn v phn lp gen dehydrin ca mt s ging ng np a phng min ni. V kh nng chu hn, 6 ging ng c kh nng chu hn cao l: BK, HL, QH, YM, TL, v QU v hai ging ng VN2 vi BG c kh nng chu hn thp. Dehydrin - LEA (lete embryogenesis abundant) - D11 l loi protein trong h protein ca thc vt bc cao, mt loi protein c tng hp khi gp hn hn hoc stress nhit thp, chng gm c 6 loi protein dehydrin: dhn1, dhn2, dhn3, dhn4, dhn5, v dhn6. DHNs c nhiu bn sao, nhng u c mt vng bo th ging nhau c thc vt bc cao v thc vt bc thp gm 15 acid amine: EKKGIMDKIKEKLPG (the K-segment). Chng ti nhn bn thnh cng gen dhn1 t ADN h gen ca cc ging ng a phng min ni vi kch thc l 0,6kb bi cp mi LeaZeM1. Sn phm PCR c tch dng v gii trnh t. T kha: Dehydrin, hn hn, min ni, ng, Dhnl, nhn bn, PCR
Tel:0913 383 289; Email:mauchdhtn@gmail.com
82

Nguyn Th Thu Phng v cs Tp ch KHOA HC & CNG NGH 77(01): 83 - 87
NGHIN CU QUAN H DI TRUYN TM S (PENEAUS MONODON) BNG K THUT RAPD

Nguyn Th Thu Phng, Nguyn Ph Hng, Hong Th Thu Yn *
Trng i hc Khoa hc, i hc Thi Nguyn
TM TT
RAPD (Random Amplified Polymorphic - DNA) l mt trong nhng k thut c s dng trong phn tch a dng, bo tn v nhn dng ging loi. Trong ti ny chng ti s dng k thut RAPD xc nh quan h di truyn ca cc mu tm s thu thp mt s tnh: Nam nh, Qung Ninh, Hi phng v Thanh Ha. Mu tm thu c bo qun trong cn 98 % v lu gi - 200C. S dng k thut RAPD phn tch quan h di truyn ca tm s vi 6 mi ngu nhin: RA36, RA40, RA143, RA142, RA45, kt qu nhn c 45 phn on a hnh trong 54 phn on ngu nhin vi kch thc c tnh t 0.35 3.0kb. Kt qu x l bng phn mm NTSYS version2.0, cho thy 8 mu tm c chia lm hai nhm chnh vi h s sai khc l 0,17. Nhm chnh cn li bao gm 7 mu tm cn li. T kha: Tm s (Penaeus monodon), a hnh, h s ng dng di truyn, RAPD
M U Ngh nui tm s v ang pht trin rt nhanh trn th gii. Hin ti, loi ny c nui hn 22 quc gia, tm s ng vai tr rt ln trong vic ci thin i sng ca cc cng ng dn c ven bin v to ngun thu nhp ngoi t. Ti Vit Nam, nui trng thu sn ngy cng khng nh v th quan trng trong nn kinh t quc dn. T s thun li v iu kin t nhin, kh hu nn cc tnh ven bin tin hnh nui trng nhiu mt hng thu sn c gi tr kinh t cao, trong nui tm s tr thnh ngnh sn xut hng ho c hiu qu cc tnh ven bin nc ta. Hin nay, Vit Nam tr thnh mt trong 5 quc gia xut khu tm ln nht th gii [6]. Mc d vy, vic nui tm s ang b hn ch bi nhng kh khn nh: s lan trn cc dch bnh, cht lng tm ging sa st, thiu ht ngun tm s b m... Ti Vit Nam, theo B Thu sn nhu cu ging tm s khong 30 t con, hin ti cc nh cung cp ging ch p ng mt na nhu cu. cn bng ngun cung v cu, cc nh nui trng thu sn nht thit phi m bo ngun tm ging b m c cht lng sn xut. Yu cu sn xut ca tm s Vit Nam i hi phi gp rt gii quyt tnh trng thiu tm s b m v nng cao cht lng tm ging. Ging tm phi sch bnh v c cht lng cao [3].
Tel:0912896298 ; Email: yenhoangthithu@gmail.com
c c ging tm kho v sch bnh, cc nh khoa hc c nhiu nghin cu chn to ging. Trong , nghin cu mt s ch th phn t l cng c h tr chnh xc trong phn tch a dng, bo tn v nhn dng ging loi [5], [7]. Mt s ch th ang c quan tm nghin cu nh RAPD (Random Amplified Polymorphic DNA), AFLP (Amplified Fragments Length Polymorphism. Vit Nam nhm tc gi Quyn nh Thi v cng s (2003), Nguyn Th Tho v cng s (2004) s dng k thut RAPD, RFLP, microsattlelite nh gi s a dng di truyn tm s nui Vit Nam [1], [2]. Do , chng ti tin hnh s dng k thut RAPD gp phn nh gi s a dng di truyn ca tm s c nui ti mt s tnh min Bc nc ta. NGUYN LIU V PHNG PHP Nguyn liu Mu nghin cu: L nhng mu tm s thu thp t mt s tnh khc nhau: Nam nh (1 mu - N), Thanh Ho (1 mu - SS), Hi Phng (3 mu S1, S2, HA ), Qung Ninh (1 mu - QN). Mu sau khi thu thp c bo qun trong cn, lu gi - 200C. Phng php * Phng php tch chit DNA tng s Quy trnh tch chit DNA tng s theo phng php ca Ausubel v cng s (1993) c ci tin [4]. 83

* Phng php phn tch quan h di truyn cc mu tm s Phn tch quan h di truyn cc mu tm s thu thp t cc tnh khc nhau bng cch s dng 6 mi ngu nhin c trnh by bng sau.
Bng 1. Trnh t cc mi ngu nhin Mi RA36 RA40 RA45 RA142 RA143 RA159 Trnh t 5 GGGGGTCGTT 3 5GGCGGACTGT 3 5 TACCACCCCG 3 5CAATCGCCGT 3 5 TCGGCGATAG 3 5 GTTCACACGG 3
c cht lng tt, v tp cht khng nhiu. DNA tng s thu c m bo cho tin hnh cc th nghim tip theo. T 8 mu tch DNA tng s, chng ti tin hnh k thut RAPD vi 6 mi ngu nhin RA36, RA40, RA45, RA142, RA143, RA159. Kt qu thu c 45 phn on a hnh trong s 54 phn on ngu nhin c kch thc c tnh t 0.35 3.0 kb. Trong tt c cc phn on thu c khi s dng mi RA45, RA143, RA142 u l cc phn on a hnh. c bit mi RA36 c s phn on a hnh thp nht (chim 50%). Kt qu phn tch RAPD c trng nht c th hin ti hnh 1, 2 v 3. Mi RA45
Kb M 1 2 3 4 5 6 7 8
Phn ng RAPD Phn ng RAPD c thc hin bng enzyme Taq DNA polymerase (Fermentas) vi chu trnh nhit nh sau: 95oC -3 pht; (95oC -30 giy; 36oC - 45 giy; 72oC -1 pht) x 45 chu k; 72o, 10 pht; kt thc v gi 4oC. Sn phm c kim tra trn gel agarose 2%. Kt qu c chp bng my gel doc. Phn tch s liu Da vo hnh nh in di sn phm RAPD, s xut hin cc bng in di c c lng kch thc da vo marker chun v thng k cc bng in di vi tng mi tng mu nghin cu. S xut hin hay khng xut hin cc bng in di c tp hp phn tch s liu theo nguyn tc: s 1- xut hin phn on DNA v s 0 khng xut hin phn on DNA. Cc s liu ny c x l trn my tnh theo chng trnh NTSYSpc version pc 2.0 (Applied Biostatistics Inc., USA., 1998) xc nh quan h di truyn ca cc mu nghin cu. KT QU V THO LUN Kt qu phn tch quan h di truyn bng phn ng RAPD DNA tng s c tch chit theo phng php ca Ausubel v cng s (1993) c ci tin [4]. Sn phm DNA tng s c kim tra trn gel agarose 0,8% v xc nh trn my quang ph. DNA tng s tch chit c 84
6,0 3,0 2,0 1,5 1,0 0,75 0,5
0,25
Hnh 1. Kt qu in di sn phm RAPD ca 8 mu tm s vi mi RA45, M: Marker 1 kb, 1: HP1, 2: HA, 3: SS, 4: QN, 5: S1, 6: N, 7: S2, 8: HP2
Qua kt qu in di sn phm RAPD ca mi RA45 ta thy s phn on DNA ngu nhin nhn bn c t 2 10 phn on. V c kch thc c c tnh t 0.6 3 kb. Trong ch c mu HP1 l c nhn bn t nht (2 phn on) cn mu S2 c s phn on DNA c nhn bn nhiu nht (10 phn on). Vi mi RA45 c tnh a hnh cao vi 8 mu tm. Trong , phn on DNA c nhn bn v tr 2.8 kb ch xut hin vi hai mu S2 v HP2 cn cc mu khc th khng xut hin. V v tr 2.5 kb phn on DNA ch xut hin vi mu HP2 v ti 0.7 kb ch xut hin vi mu SS cn tt cc mu khc u khng xut hin bng.

Mi RA142
1 2 3 4 5 6 7 8 M Kb
6,0 3,0 2,0 1,5 1,0 0,75 0,5 0,25
Hnh 2. Kt qu in di sn phm RAPD ca 8 mu tm s vi mi RA142, M: Marker 1 kb, 1: HP1, 2: HA, 3: SS, 4: QN, 5: S1, 6: N, 7: S2, 8: HP2.
T kt qu in di sn phm RAPD ca 8 mu tm vi 6 mi ngu nhin, ta thy s phn on DNA nhn bn c cc mu tm ca mi RA142 dao ng t 1 4 phn on. Cc phn on c kch thc c tnh t 0.5 1.9 kb. Trong cc mu N, HP2 c s phn on c nhn bn nhiu nht l 4. Trong khi mu SS ch c 1 phn on DNA c nhn bn. Cc phn on DNA c nhn bn u c tnh a hnh. Ta thy ti v tr 0.55kb u xut hin phn on DNA c nhn bn ngu nhin tr mu SS, phn on 1.8 kb ch c mu N v 1.5 kb ch c HP2 l xut hin bng cn mu khc khng c bng xuthin. Ti v tr 0.6 kb cc mu u xut hin bng tr hai mu SS v N. Mi RA143
Kb M 1 2 3 4 5 6 7 8
Qua kt qu in di sn phm RAPD cho thy s phn on DNA ngu nhin nhn bn c 8 mu tm ca mi RA143 dao ng t 2 4 phn on. Cc phn on c kch thc giao ng t 0.35 - 1.8 kb. Trong mu N c s phn on DNA ngu nhin c nhn bn nhiu nht (4 phn on), cn mu HP1 c s lng phn on DNA nhn bn t nht (2 phn on). Ti v tr 0.6 kb ch c mu S1 v ti 0.5 kb ch c mu N c phn on DNA c nhn bn, cc mu cn li khng xut hin. Phn on c kch thc 1.0 kb v 0.35 kb xut hin phn on DNA tt c cc mu tr mu S1, N. Nhng ti v tr 1.7 kb v 1.1kb th mu S1, N xut hin bng cn cc mu khc th khng. Tng hp cc bng on xut hin hay khng xut hin trn in di sn phm RAPD ca 8 mu tm vi 6 mi ngu nhin ta thu c s phn on a hnh v khng a hnh c thng k di bng 2.
Bng 2. S phn on DNA xut hin v s phn on DNA a hnh Mi Phn on DNA nhn bn 8 6 15 7 7 11 54 Phn on DNA a hnh 4 5 15 7 7 7 45 T l phn trm phn on a hnh 50 83.3 100 100 100 64 83,3
RA36 RA40 RA45 RA142 RA143 RA159 Tng
6,0 3,0 2,0 1,5 1,0 0,75 0,5
0,25
Hnh 3. Kt qu in di sn phm RAPD ca 8 mu tm s vi mi RA143 M: Marker 1kb, 1: HP1, 2: HA, 3: SS, 4: QN, 5: S1, 6: N, 7: S2, 8: HP2
Phn tch mi quan h di truyn gia cc mu tm da trn kt qu phn tch RAPD Da trn s xut hin hay khng xut hin cc phn on DNA ca cc mu khi phn tch in di sn phm RAPD, chng ti xc nh c h s ng dng di truyn ca cc mu tm cp phn t. S liu c phn tch theo chng trnh NTSYSversion 2.0 (theo quy c 1= xut hin bng, 0= khng xut hin bng). Kt qu nhn c h s tng ng gia cc mu tm th hin bng 3. H s di truyn phn nh quan h di truyn gia cc cp ging vi nhau. Hai mu tm ging nhau v mt di truyn th h s tng 85

ng gia chng cng ln v ngc li hai ging c h s tng ng di truyn thp th mi quan h di truyn gia chng l xa nhau. T bng trn ta thy h s di truyn dao ng t 0.537 0.833 tc l cu trc h gen gia cc mu tm ging khc nhau t 0.167 0.463. Trong h s ng dng ln nht (0.833) l hai mu tm S1 v S2. iu ny cho thy cu trc gen ca hai mu ny c s sai khc rt t. H s ng dng thp nht (0.537) c th hin gia mu HP1 vi mu S1,2 v mu QN vi N. Chng t cu trc gen gia cc mu tm sai khc xa nhau. Kt qu ny c ngha trong di truyn chn to ging. T kt qu phn tch h s di truyn chng ti xc nh c quan h di truyn cp phn t, th hin bng ph h ca 8 mu tm trn hnh 4. Kt qu trn ch ra mc sai khc v mt di truyn gia cc mu tm. Cc mu tm c h s tng ng cao di truyn cao s c sp xp mt nhm, gia cc nhm li c mi lin h vi nhau. T s hnh cy trn ta thy s
sai khc v cu trc gen ca cc mu nghin cu dao ng t 17% - 40%. Phn tch hnh cy cho thy 8 mu tm c chia thnh 2 nhm chnh. Nhm chnh I: ch c mu N thu thp t nng trng Dng ng Nam nh . Mu ny c h s di truyn sai khc ln nht so vi nhm khc l 0.4 (1-0.6). Nhm chnh II: bao gm cc mu HP1, HA, SS, QN, S1, S2 v HP2. Cc mu ny c chia vo 2 nhm ph khc nhau: + Nhm ph 1: Bao gm 3 mu HP1, SS v QN. H s sai khc gia chng vi nhm ph cn li l 0.34. + Nhm ph 2: Bao gm cc mu HA, S1, S2, HP2. Trong 2 mu S1 v S2 c h s sai khc l 0.17. y l hai mu c h s di truyn sai khc thp nht trong ph h. Cn hai mu HA v HP2 c ngun t Hi Phng c h s di truyn sai khc l 0.2 ng gn nhau trn s ph h.
Bng 3. H s tng ng gia cc mu tm nghin cu HP1 HP1 1.000 HA 0.685 SS 0.759 QN 0.741 S1 0.537 N 0.500 S2 0.629 HP2 0.667 HA 1.000 0.740 0.722 0.704 0.704 0.796 0.796 SS QN S1 N S2 HP2
1.000 0.796 0.556 0.629 0.685 0.648
1.000 0.648 0.537 0.778 0.629
1.000 0.667 0.833 0.574
1.000 0.574 0.611
1.000 0.741
1.000
Nhnh chnh II
Nhnh chnh I
Hnh 4. S quan h di truyn gia cc mu tm 1: HP1, 2: HA, 3: SS, 4: QN, 5: S1, 6: N, 7: S2, 8: HP2
86

KT LUN xc nh c quan h di truyn ca 8 mu tm vi 6 mi ngu nhin v t c kt qu sau: + nhn c tng s phn on DNA l 229 phn on c kch thc t 0.35 3.0 kb. + xc nh c 6 mi s dng u c tnh a hnh. Tng s phn on DNA a hnh thu c l 45 phn on chim 83.3 %. T l cc phn on a hnh ca cc mi giao ng t 50 % 100 %. Trong c mi RA142, RA45 v RA143 t l cc phn on a hnh t 100% + H s di truyn sai khc gia cc mu tm HP1, HP2, SS, QN, HA, S1, S2, N giao ng 0.17 0.4. T s sai khc h s di truyn gia cc mu tm s thy rng hai mu tm S1, S2 c quan h di truyn gn nht vi h s sai khc 0,17. Cn cc mu tm N v QN, HP1 v S1 c quan h di truyn xa nht vi h s sai khc 0,4. TI LIU THAM KHO
[1]. Nguyn Th Tho, Quyn nh Thi, o Th Tuyt, L Th Thu Giang, Phm Anh Tun (2004) nh gi tnh a hnh ca 3 qun on tm s
(Penaeus monodon) nui Vit Nam bng phng php microsattlelite. Tp ch Cng ngh Sinh hc 2(3): 315-324 [2]. Quyn nh Thi, o Th Tuyt, L Th Thu Giang, Nguyn Th Tho, Phm Anh Tun (2003). S dng microsatterlite, mtRFLP v RAPD phn tch tnh a hnh tm s. Tp ch Cng ngh Sinh hc 1: 287-298 [3]. Nguyn Xun Thu (2005) Nghin cu Hi Sm kt hp ao nui tm s nhm ci thin mi trng, Nxb Nng nghip. [4]. Ausubel F, Brebt R, Kingston R, Mocra D, Seidman JG, Simth JA, Stiurl (1996) Short protocol in molecular biology, The Journal of Steroid Biochemistry and Molecular Biology 59(3-4), 356 [5]. Bazzicalupo M, Renato F. (1996) The Use of RAPD for generating specific DNA probes for microorganisms. In: Species Diagnostics Protocols. Ed. Clapp, J.P. Humana Press Inc. New Jersey, 155-175. [6]. Tanticharoen M, Flegel TW, Meerod W, Grudloyma U, Pisamai N (2008) Aquacultural biotechnology in Thailand: the case of the shrimp industry. Int. J. Biotechnology 10(6), 588-603. [7]. Welsh J, McClelland M (1990) Fingerprinting genomes using PCR with arbitrary primers. Nucl Acids Res 18(24), 7213 7218.
SUMMARY STUDY ON GENETIC DIVERSITY OF SHRIMP (PENAEUS MONODON) BY RAPD TECHNIQUE

Nguyen Thi Thu Phuong, Nguyen Phu Hung, Hoang Thi Thu Yen
College of Sciences, Thai Nguyen University

RAPD (Random Amplified Polymorphic DNA) is one technique used in the analysis of diversity, conservation and species identification. In this research, we use the RAPD technique to determine the genetic relationship of the shrimp samples collected in some provinces: Nam Dinh, Quang Ninh, Hai Phong, Thanh Hoa. Shrimp samples collected and preserved in 98% ethanol and stored at 200C. Use of RAPD technique to analysis of genetic relationships with 6 random primers: RA36, RA40, RA143, RA142, RA45. Results obtained 45 polymorphic fragments in 54 random segments obtained size estimates from 0,35 - 3.0kb. The result is processed by software NTSYS persion2.0. The results of analysis of genetic relationships of eight shrimp sample was divided into two main groups. One major group consists of ND sample coefficient of genetic differences with other groups is 0.17. Left main group consists of 7 samples of shrimp remaining.
Keywords: Penaeus monodon, polymorphism, genetic similarity coefficients, RAPD
Tel:0912896298 ; Email: yenhoangthithu@gmail.com
87

88

Nguyn Vn Hon v cs Tp ch KHOA HC & CNG NGH 77(01): 89 - 96
C IM MT S KIU THM THC VT PHC HI T NHIN TNH BC GIANG

Nguyn Vn Hon1, L Ngc Cng2, Bi Th Du2, Nguyn Th Thu H2, inh Th Phng2
1
S Nng nghip v Pht trin nng thn tnh Bc Giang 2 Trng i hc S phm - i hc Thi Nguyn
TM TT
S loi cy ti sinh t nhin trong cc kiu thm thc vt Khu bo tn thin nhin Ty Yn T (Bc Giang) sau 6-10 nm tui c 262 loi, 189 chi v 87 h, thuc 3 ngnh thc vt bc cao c mch (Pteridophyta, Gymnospermae, Angiospermae). C 16 h giu loi nht (t 5 loi tr ln) l Lauraceae, Euphorbiaceae, Poaceae, Fagaceae, Rubiaceae, Melastomataceae, Fabaceae, Moraceae, Vitaceae, Rutaceae, Caesalpiniaceae, Apocynaceae, Arecaceae, Theaceae, Myrtaceae v Dipterocarpaceae, gm 131 loi (chim 50% tng s loi). Rng c cu trc hai tng n gin. Rng phc hi sau khai thc c s loi bin ng t 125-142 loi, cy g ti sinh bin ng t 62-74 loi, mt t 10.596 15.947 cy/ha. Rng phc hi sau nng ry s loi bin ng t 119-127 loi, loi cy g ti sinh t 37 49 loi, mt t 6960 9813 cy/ha. Cc loi thn c gim t 27 loi xung cn 16 loi, cc loi dy leo bin ng t 15 n 22 loi. T kho: Thm thc vt, ti sinh t nhin, sau nng ry, sau khai thc, cu trc
T VN nc ta, nhn dn cc dn tc t ngi sng vng ni cao thng c tp qun du canh, du c, t ph rng lm nng ry. Tnh trng ny din ra trong mt thi gian di cng vi vic khai thc rng qu mc dn ti ngun ti nguyn cn kit, che ph ca rng b gim st nghim trng. T nm 1992 tr li y, Nh nc c nhng chnh sch, chin lc pht trin ti nguyn rng, nh chng trnh 327, d n trng mi 5 triu ha rng.... tng din tch v che ph ca rng. Trong khoanh nui, xc tin ti sinh t nhin phc hi rng l bin php rt quan trng. Khu bo tn thin nhin Ty Yn T v vng ph cn thuc hai huyn Lc Nam v Sn ng (tnh Bc Giang) c din tch rng sau nng ry v sau khai thc kh ln (6.716ha, chim 30,5% din tch t nhin ca khu bo tn)[5]. T khi c bo v, khoanh nui, xc tin ti sinh t nhin, rng ang dn phc hi tr li. Trong bi bo ny chng ti a ra nhng dn liu c th v thnh phn loi, nhm dng sng, cu trc ca mt s kiu thm thc vt phc hi sau khai thc v sau nng ry, gp
Tel: 0915462404; Email: conglengockstn@yahoo.com.vn
phn lm c s cho vic khoanh nui phc hi rng c hiu qu tnh Bc Giang. I TNG V PHNG PHP NGHIN CU i tng L thnh phn loi, nhm dng sng, cu trc ca cc trng thi thm thc vt phc hi t 6-10 nm trn t sau nng ry v sau khai thc khu bo tn thin nhin Ty Yn T v vng m thuc tnh Bc Giang. Phng php Phng php tiu chun (OTC): Ti mi trng thi thm thc vt t 3 OTC, mi c din tch 400m2 (20m 20m) o m cc cy g c ng knh t 6cm tr ln (D1.3 6cm), cc OTC t theo v tr chn, sn v nh i. Trong mi OTC lp 9 dng bn, mi c din tch 16m2 (4m 4m) iu tra cy ti sinh, cy bi (c chiu cao Hvn 20cm), dy leo v cy c. Phng php tuyn iu tra (TT): Cc TT c lp rng 2m i qua cc vng i din cho qun x nghin cu. TT nhm thu mu k hn v thnh phn loi thc vt. Phng php xc nh tn loi thc vt: S dng cc ti liu ca Nguyn Tin Bn 1997 [1], 2005[2]; B NN&PTNT, 2000 [3]; Phm Hong H, 1991-1993 [4]. 89

KT QU NGHIN CU Thnh phn loi Trong cc trng thi thm thc vt nghin cu, chng ti thng k c 262 loi, 189 chi v 87 h thuc ba ngnh thc vt bc cao c mch: Ngnh Khuyt thc vt (Pteridophyta) c 9 loi (3,44% tng s loi), 7 chi (3,7%), 7 h (8,05%); Ngnh Ht trn (Gymnospermae) c 3 loi (1,15%), 2 chi (1,06%), 2 h (2,3%), Ngnh Ht kn (Angiospermae) c 250 loi (95,42%), 180 chi (95,24%), 78 h (89,65%). S h giu loi ( 5 loi) c 16 h (18,4%) l h Lauraceae 17 loi, 2 h Euphorbiaceae, Poaceae mi h c 14 loi, h Fagaceae 12 loi , h Rubiaceae 10 loi, h Melastomataceae 8 loi, 2 h Fabaceae, Moraceae u c 7 loi, h Vitaceae v Rutaceae mi h c 6 loi, cc h c 5 loi l Caesalpiniaceae, Apocynaceae, Arecaceae, Theaceae, Myrtaceae, Dipterocarpaceae, tng s 131 loi (50% tng s loi). S liu c ghi bng 1. Trong cc trng thi thm thc vt cc ch tiu v s h, chi kh dao ng (bng 2), thm thc vt ti sinh trn 6 nm tui s loi, h, chi tng dn, v thi gian ny cc c th mi lin tc c b sung thm ng thi lp cy ti sinh pht trin tt, tn che tng i cao. Cc cy ti sinh cng loi c s iu tit
ln nhau v gia cc c th khc loi c s cnh tranh nhau cng vi qu trnh t ta tha m rng khng gian dinh dng, dn ti lp cy ti sinh gim dn. Theo nhiu nh nghin cu trng thi rng c tui cao, tn che cao s lng loi cy ti sinh gim dn. i vi rng non s lng loi ti sinh chuyn dn t tng sang gim v cui cng l n nh. Cu trc thm thc vt phc hi theo thi gian Theo thi gian phc hi, thnh phn loi v cu trc cc trng thi thm thc vt c trnh by bng 3 v bng 4. a. Thm thc vt phc hi 6 nm * Sau nng ry: Rng ang thi gian phc hi mnh c 119 loi, cu trc hai tng, che ph t 60%. Tng cy g c 11 1 loi, tn che 25 30%. Trong mi OTC c din tch 400m2, s lng cy g c s bin ng khng ln. nhiu nht c 26 cy, t nht c 19 cy. Trung bnh c 22 cy/OTC (tng ng vi mt 475 - 650 cy/ha). Mt trung bnh 558 92 cy/ha, chiu cao trung bnh 7,4 m, ng knh 7,7 cm vi trung bnh tng tit din ngang 2,74 m2/ha. Ch yu l nhng loi
Bng 1. S phn b cc h, chi, loi Ngnh Pteridophyta Gymnospermae Angiospermae H S h 7 2 69 9 87 % 8,05 2,30 79,31 10,34 100 Chi S chi 7 2 156 24 189 % 3,70 1,06 82,54 12,70 100 Loi S loi % 9 3,44 3 1,15 217 82,81 33 12,60 100 262
Dicotyledones Monocotyledones Tng cng
Bng 2. H, chi, loi cy ti sinh trong cc thm thc vt Thi gian (nm) 6 8 10 6 8 10 H S h 53 55 60 66 61 58 % S chi Sau nng ry 60,92 96 63,22 95 68,97 102 Sau khai thc 75,86 107 70,11 107 66,67 95 Chi % 50,79 50,26 53,97 56,61 56,61 50,26 S loi 119 122 127 135 142 125 loi % 45,42 46,56 48,47 51,53 54,20 47,71
90

g nh v trung bnh cng tui, tin phong a sng tm nh c, loi u th gm Thu tu (Aporosa dioica), Thnh ngnh (Cratoxylum cochinchinense), Dn (Xylopia vielana), Thng mc (Wrightia tomentosa), Sau sau (Liquidambar formosana), Bng bc (Vernonia arborea), Hu ay (Trema orientalis), Cho (Engelhardtia roxburghiana),... S loi cy g ti sinh c 37 loi (trong cy g nh v trung bnh 26 loi, cy g ln l 11 loi). Cc loi ch yu l cy con v cy m vi mt 6960 1760 cy/ha. Cc loi thuc h Cam (Rutaceae), h Vang (Caesalpiniaceae), h T hp (Altingiaaceae), h Xoi (Anacardiaceae), h D (Fagaceae), h Thu du (Euphorbiaceae), h H o (Juglandaceae), h Long no (Lauraceae), h Sim (Myrtaceae), h Ch (Theaceae), h Du (Ulmaceae),... Tng cy bi c 40 loi, gm cy bi v bi trn c mt t 5769 2702 cy/ha, c chiu cao trung bnh t 1,5 - 2,6 m, che ph 40%. Cc loi thuc cc h Thu du (Euphorbiaceae), h Mua (Melastomataceae), h Bng (Malvaceae), h n nem
Thi gian (nm) 6 8 10 6 8 10 Thi gian (nm)
(Myrsinaceae), h Du tm (Moraceae) h Sim (Myrtaceae), h Cam (Rutaceae),... c s lng c th ln, gm cc loi nh n nem (Maesa perlarius), Sim (Rhodomyrtus tomentosa), Mua (Melastoma normale), B cu v (Breynia fruticosa), Ngi (Ficus hirta var, roxburghii), B my (Clerodendrum cyrtophyllum, Clerodendrum fortunatum),... Tng thm ti c 42 loi, trong c 27 loi gm c leo, c ng,... thuc h Thin l (Asclepiadaceae), h Dn (Amaranthaceae), h Ho Tho (Poaceae), h T iu (Aspleniaceae), h Cc (Asteraceae), h Chua me t (Oxalidaceae), h Bng bong (Schizeaceae),... Cc loi thng gp gm c Ch v (Miscanthus floridulus), C ch (Eriachne chinensis), Hunh thim (Sigesbeckia orientalis), C cht (Thysanolaena maxima), C ba cnh (Cyperus trialatus), C xc (Achyranthes aspera), Bng bong (Lygodium flexuosum). Dy leo c 15 loi thuc h Khoai lang (Convolvulaceae), h S (Dilleniaceae), h Khc khc (Smilacaceae), h Trng iu (Connaraceae)...
Bng 3. Thnh phn loi cy ti sinh theo nhm dng sng Cy g S loi % 37 47 49 65 74 62 31,09 38,52 38,58 48,15 52,11 49,60 S loi xut hin theo nhm dng sng Cy bi Dy leo C S loi % S loi % S loi % Sau nng ry 40 33,61 15 12,61 27 22,69 39 31,97 20 16,39 16 13,12 40 31,50 22 17,32 16 12,60 Sau khai thc 33 24,44 16 11,85 21 15,56 32 22,54 17 11,97 19 13,38 28 22,40 17 13,60 18 14,40 Bng 4. Cu trc thm thc vt phc hi S loi Tng cy g Mt cy g ti sinh Mt D 1,3 H vn (Cy/ha) cy g 6(cm) (m) (Cy/ha) Sau nng ry 55892 7,7 7,4 69601760 1150100 8,4 8,9 92201540 1292417 9,9 9,1 98132587 Sau khai thc 1725525 11,2 13,9 159471707 2150650 12,4 14,1 148001680 2075325 13,7 15,1 105961271 Tng cy bi Mt Hbi cy bi 20cm (Cy/ha) 57692702 50761191 3422222 60402200 39201520 31071093 1,5-2,6 1,9-2,7 1,3-2,1 2,3-2,7 2,1-2,3 1,7-2,2 Tng S loi % 119 122 127 135 142 125 100 100 100 100 100 100
6 8 10 6 8 10
11 1 13 2 15 1 14 1 19 4 17 3
91

Nhng loi c s lng c th ln nh Kim cang (Smilax china, Smilax ferox), Bm bm (Merremia bimbim), Bm bm (Mussaenda cambodiana), m m (Rubus alcaefolius), Chc chu (Tetracera asiatica),... nhiu thm ti Cop3. * Sau khai thc: Thng k c 135 loi, che ph 75%, c cu trc 2 tng. Tng cy g c 14 1 loi, tn che 50%. Trong mi OTC c din tch 400 m2, s lng cy g bin ng ln t 48 90 cy, trung bnh c 69 cy/OTC (tng ng vi mt t 1200 - 2250 cy/ha). Mt trung bnh 1725 525 cy/ha, ng knh l 11,2 cm, chiu cao 13,9 m t tng tit din ngang trung bnh l 21,52m2/ha. Loi u th gm Lim xanh (Erythrophloeum fordii), Trm ta (Syzygium cinereum), D (Lithocarpus ducampii), Mn a (Archidendron lucidum), Cm tru (Elaeocarpus floribundus), Trm chim (Canarium tonkinense),... Cy g ti sinh c 65 loi, trong cy g nh v trung bnh c 44 loi, g ln c 21 loi, mt 15.947 1707 cy/ha. Loi cy ti sinh ch yu thuc cc h T hp (Altingiaaceae), h Xoi (Anacardiaceae), h Vang (Caesalpiniaceae), h Thu du (Euphorbiaceae), h D (Fagaceae), h H o (Juglandaceae), h Long no (Lauraceae), h Cm (Elaeocarpaceae), h Trm (Burseraceae), h Du (Dipterocarpaceae), h Du tm (Moraceae),... Tng cy bi c 33 loi, mt 6040 2200 cy/ha, chiu cao t 2,3 - 2,7 m, che ph 30%, cc loi c s lng c th nhiu gm Trng a (Ardisia lindleyana), Bn bt (Camellia sp.), Kho bi (Machilus oreophila), Bng bng (Calotropis gigantea), Sm trng (Memecylon edule), Sm (Memecylon scutellatum), Phn en (Phyllanthus reticulatus), Bo en (Goniothalamus vietnamensis), Mua (Melastoma normale), Ct chut (Brucea mollis), Xuyn tiu (Zanthoxylum nitidum),... Cc loi cy bi a m thuc h Na (Annonaceae), h Trc o (Apocynaceae), h Thu du (Euphorbiaceae), h n nem (Myrsinaceae), h Thin l (Asclepiadaceae), h Hoa hng (Rosaceae), h Cam (Rutaceae), h Du tm (Moraceae),... 92
Thm ti gm dy leo c 16 loi, cc loi thng gp ch yu thuc h Trc o (Apocynaceae), h Nho (Vitaceae), h Trng iu (Connaraceae), h Tit d (Menispermaceae), h Khoai lang (Convolvulaceae), h u (Fabaceae), h Mao lng (Ranunculaceae),... Cc loi ph bin nh My rng (Calamus rhabdocladus), Kim cang (Smilax davidiana, Smilax china, Smilax ferox), Dy gm (Gnetum latifolium), Chc chu (Tetracera asiatica), Kim ngn (Lonicera dasystyla), Dy giun (Quisqualis indica), Dy cc (Derris elliptica), ... Cy thn c c 21 loi, cc loi thng gp nh Sa nhn (Amomum xanthioides), Dng x (Dryopteris sp.), Phong lan t (Malaxis ophrydis), C ba cnh (Cyperus trialatus), Rau dn (Callipteris esculenta), C di trng (Eriocaulon sexangulare), C gng (Panicum repens), C mt (Chloris barbata), C cht (Thysanolaena maxima), C ch (Eriachne chinensis), C ng (Paspalum longifolium),... thuc cc h Rau dn (Amaranthaceae), h Ho tho (Poaceae), h T iu (Aspleniaceae), h Khoai lang (Convolvulaceae), h Hoa tn (Apiaceae), h Di trng (Eriocaulaceae), h Hnh (Liliaceae), h H tiu (Piperaceae), h Gng (Zingiberaceae)... vi nhiu Cop2. b. Thm thc vt phc hi 8 nm * Sau nng ry: Rng c cu trc hai tng vi che ph 70%, chng ti thng k c 122 loi. S loi cy g c 13 2 loi, tn che 50%. Trong mi o m c din tch 400m2 s cy v s loi cy g bin ng khng ln, s lng cy g t 42 - 50 cy, trung bnh c 46 cy/OTC (tng ng vi mt t 1050 1250 cy/ha). Mt trung bnh 1150 100 cy/ha, c chiu cao trung bnh 8,9 m, ng knh bnh qun l 8,4 cm, vi tng tit din ngang trung bnh l 5,04 m2/ha. Ch yu vn l nhng loi g nh v trung bnh nh thi gian phc hi 6 nm. cc OTC xut hin nhng loi cy a sng nh c c i sng di tham gia vo t thnh tng cy g nh Lim vang (Peltophorum pterocarpum), Bng bc (Vernonia arborea), Trm trng (Canarium album), Ba (Garcinia oblongifolia),.... Loi cy g ti sinh c 47

loi, s loi cy g nh v trung bnh l 32 loi, g ln l 15 loi, mt l 9220 1540 cy/ha, ch yu l nhng loi cy c i sng di nhng lc nh cn che bng, thuc cc h Du (Dipterocarpaceae), h Trm (Burseraceae), h H o (Juglandaceae), h Vang (Caesalpiniaceae), h S (Dilleniaceae), h Hoa hng (Rosaceae), h Long no (Lauraceae), h D (Fagaceae), h Cam (Rutaceae), h C ph (Rubiaceae), h Du (Ulmaceae),.... Tng cy bi c 39 loi, mt trung bnh 5076 1191 cy/ha, chiu cao trung bnh t 1,9 - 2,7 m, che ph 30%, Cc loi cy bi a m thuc h Thu du (Euphorbiaceae), h n nem (Myrsinaceae), h Trc o (Apocynaceae), h Cam (Rutaceae), h Nht (Elaeagnaceae), h C roi nga (Verbenaceae), h Ch (Theaceae), h Na (Annonaceae),.... gm cc loi nh Ch tc (Lindera tonkinensis), Phn en (Phyllanthus reticulata), Nht rng (Elaeagnus bonii), Sm (Memecylon scutellatum), Gng (Randia spinosa), B my (Clerodendrum fortunatum), Thng mc l nh (Wrightia laevis), Trng a (Ardisia lindleyana), Xuyn tiu (Zanthoxylum nitidum), Bn bt (Camellia sp.) Mng rng (Artabotrys hexapetalus),... Tng thm ti c 16 loi thuc h T iu (Aspleniaceae), h Rau dn (Amaranthaceae), h Cc (Asteraceae), h Ci (Cyperaceae), h C nu (Dioscoreaceae), h M tin (Loganiaceae), h H tiu (Piperaceae), h Ho tho (Poaceae), h C ph (Rubiaceae)...Cc loi thng gp l C ba cnh (Cyperus trialatus), Cht (Thysanolaena maxima), C gng (Panicum repens), Dng x (Dryopteris filix-mas), C nu (Discorea cirrhosa), Hunh thim (Sigesbeckia orientalis), Hng bi (Vetiveria zizanioides), C xc (Achyranthes aspera), L ngn (Gelsemium elegans), Tru rng (Piper gymnostachyum), C l tre (Centotheca latifolia), Ba kch (Morinda officinalis),... Dy leo c 20 loi, cc loi thng gp nh Kim cang (Smilax davidiana, Smilax china, Smilax ferox), Dy my nc (Calamus amarus), Dy gm (Gnetum latifolium), Hong ng (Fibraurea tinctoria), Sm lam (Millettia speciosa), Dy cc (Derris
elliptica), Nm cm (Kadsura coccinea), Chc chu (Tetracera asiatica), Dy mu (Bauhinia bracteata), Dy lang rng (Merremia staphylina),...thuc cc h Khc khc (Smilacaceae), h Nho (Vitaceae), h Trc o (Apocynaceae), h Vang (Caesalpiniaceae), h S (Dilleniaceae), h Khoai lang (Convolvulaceae), h Trng iu (Connaraceae), h u (Fabaceae), h Mao lng (Ranunculaceae), h C ph (Rubiaceae), h Ng v (Schisandraceae), h Tit d (Menispermaceae), h Cau (Arecacceae),... vi nhiu Cop1. * Sau khai thc: Trng thi ny chng ti thng k c 142 loi, che ph l 80%, cu trc hai tng, tng cy g gm 19 4 loi, tn che 70%. Trong mi OTC c din tch 400m2, s lng cy g bin ng rt ln t 60 - 112 cy, trung bnh c 86 cy/OTC (tng ng vi mt t 1500 - 2800 cy/ha). Mt 2150 650 cy/ha, ng knh l 12,4 cm, chiu cao l 14,1 m vi tng tit din ngang trung bnh l 29,87 m2/ha. T thnh tng cy g c cc loi nh Kho vng (Machilus bonii), Lim xanh (Erythrophloeum fordii), D si (Lithocarpus bacgiangensis), Ct nga (Archidendron eberhardtii), Trm ta (Syzygium cinereum), D (Lithocarpus ducampii), Cm tru (Elaeocarpus floribundus),... Cy g ti sinh c 74 loi, mt 14.800 1680 cy/ha (g nh v trung bnh 50 loi, g ln 24 loi). Thnh phn loi cy ti sinh ch yu thuc h Vang (Caesalpiniaceae), h Du tm (Moraceae), h Hng xim (Sapotaceae), h Ba (Clusiaceaeceae), h Trm (Burseraceae), h Du (Dipterocarpaceae), h D (Fagaceae), h Long no (Lauraceae), h Hoa hng (Rosaceae), h Trinh n (Mimosaceae), h C ph (Rubiaceae), h T hp (Altingiaaceae), h Th (Ebenaceae), h Trm (Sterculiaceae),... Tng cy bi c 32 loi, mt 3920 1520 cy/ha, chiu cao t 2,1 - 2,3 m, che ph 30%. Cc loi c s lng c th nhiu nh Bn bt (Camellia sp.), Trng a (Ardisia lindleyana), Mng rng (Artabotrys hexapetalus), Phn en (Phyllanthus reticulatus), Nht rng (Elaeagnus bonii), Sm (Memecylon scutellatum), Nit gi (Wikstroemia indica), n nem (Maesa 93

perlarius), Sang (Zanthoxylum nitidum),... Cc loi cy bi ch yu thuc h Thu du (Euphorbiaceae), h n nem (Myrsinaceae), h Trm (Thymelaeaceae), h Du tm (Moraceae), h Nht (Elaeagnaceae), h Cam (Rutaceae), h Ch (Theaceae),... Dy leo c 17 loi, cc loi thng gp nh Dy au lng (Tinospora sinensis), Kim cang (Smilax davidiana, Smilax china, Smilax ferox), Chc chu (Tetracera asiatica), Dy cc (Derris elliptica), My ho (Calamus pseudoscutellaris), Bnh nem (Bowringia callicarpa), Dy mt (Derris elliptica), Sm lam (Millettia speciosa), Tru rng (Piper sarmentosum), Ch dy (Ampelopsis cantoniensis), Dy quch (Bauhinia khasiana),... C c 19 loi, cc loi thng gp nh C ba cnh (Cyperus trialatus), Dng x (Dryopteris filix-mas), Phong lan t (Malaxis ophrydis), Ch v (Miscanthus floridulus), Sa nhn (Amomum xanthioides), C mt (Chloris barbata), Cao cng l mc (Ophiopogon dracaenoides),...thuc h Rau dn (Amaranthaceae), h Hnh (Liliaceae), h Gng (Zingiberaceae), h T iu (Aspleniaceae), h Ci (Cyperaceae)... vi nhiu cop1. c. Thm thc vt phc hi 10 nm * Sau nng ry: Rng c cu trc hai tng, che ph t 90% vi 127 loi thc vt. Tng cy g c 15 1 loi, tn che 80%. Trong mi OTC s lng cy g bin ng ln, nhiu nht c 69 cy, t nht c 35 cy, trung bnh trong 1 c 52 cy (tng ng vi mt t 875 1725 cy/ha). Mt trung bnh l 1.292 417 cy/ha, chiu cao trung bnh 9,1 m, ng knh bnh qun l 9,9 cm, t tng tit din ngang trung bnh l 9,35 m2/ha. T thnh loi ch yu gm cc loi nh Bng bc (Vernonia arborea), Kho vng (Machilus bonii), Lim vang (Peltophorum pterocarpum), D (Lithocarpus ducampii), Ba (Garcinia oblongifolia), Cho (Engelhardtia roxburghiana), Sn ta (Toxicodendron succedanea),...Cy g ti sinh c 49 loi (trong loi g ln c 19 loi, g nh v trung bnh l 30 loi), mt l 9813 2587 94
cy/ha, thuc cc h Long no (Lauraceae), h Ba (Clusiaceae), h Vang (Caesalpiniaceae), h Du tm (Moraceae), h B hn (Sapindaceae), h Hng xim (Sapotaceae), h Xoi (Anacardiaceae), h H o (Juglandaceae), h Trm (Burseraceae), h Du (Dipterocarpaceae), h D (Fagaceae), h Trinh n (Mimosaceae), h Sim (Myrtaceae), h Hoa hng (Rosaceae), h Cam (Rutaceae),... Tng cy bi c 40 loi vi mt 3422 222 cy/ha, chiu cao trung bnh t 1,3 - 2,1 m, che ph 20%, ch yu l nhng loi cy a m, chu bng thuc h Trc o (Apocynaceae), h Thu du (Euphorbiaceae), h n nem (Myrsinaceae), h Cam (Rutaceae), h Ch (Theaceae),... Cc loi c s lng c th nhiu nh Phn en (Phyllanthus reticulatus), Bn bt (Camellia sp.), Mng rng (Artabotrys hexapetalus), Gng (Randia spinosa), Bo en (Goniothalamus vietnamensis), Trng a (Ardisia lindleyana), n (Excoecaria cochinchinensis), Hoa d (Desmos chinensis), Sm (Memecylon scutellatum), Thng mc tru (Kibatalia laurifolia), Xuyn tiu (Zanthoxylum nitidum), Bm bp (Mallotus barbatus), Nht rng (Elaeagnus bonii), Nho t (Vitis balansaeana), Ct chut (Brucea mollis),... Tng thm ti c 16 loi, thuc cc h nh Cc (Asteraceae), h Trc o (Apocynaceae), h u (Fabaceae), h Rau dn (Amaranthaceae), h T iu (Aspleniaceae), h Ci (Cyperaceae), h C nu (Dioscoreaceae), h Hnh (Liliaceae), h Ho tho (Poaceae), h Gai (Urticaceae), h Gng (Zingiberaceae),... Cc loi thng gp l C ba cnh (Cyperus trialatus), Sa nhn (Amomum xanthioides), C lc (Cyperus cephalotus), C l tre (Centosteca latifolia), C rc (Panicum sarmentosum), C nu (Dioscorea cirrhosa), Sa nhn (Amomum xanthioides), C lng nng (Polytrias indica), C xc (Achyranthes aspera), C mn tru (Eleusine indica), Cao cng (Ophiopogon dracaenoides), Hng bi (Dianella ensifolia),... Dy leo c 22 loi, cc loi c s lng c th nhiu nh: Chc chu

(Tetracera asiatica), Kim cang (Smilax davidiana, Smilax china, Smilax ferox), Sm nam (Millettia speciosa), Dy ng lo (Clematis armandi), Rut g (Clematis chinensis), Kh rng (Rourea ssp. Microphylla), Dy gm (Gnetum latifolium), Dy mu (Bauhinia bracteata), Ch dy (Ampelopsis cantoniensis), Dy mu (Sargentodoxa cuneata), Khc khc (Heterosmilax gaudichaudiana), Hong ng (Fibraurea tinctoria), Ngnh kh (Cnestis palala),... thuc cc h nh Trc o (Apocynaceae), h Vang (Caesalpiniaceae), h S (Dilleniaceae), h Nho (Vitaceae), h Khoai lang (Convolvulaceae), h Trng iu (Connaraceae), h Ng v (Schisandraceae), h C ph (Rubiaceae), h u (Fabaceae), h Mao lng (Ranunculaceae), h Huyt ng (Sargentodoxaceae), h Tit d (Menispermaceae), h Gm (Gnetaceae), h Cau (Arecaceae), h Khc khc (Smilacaceae), h Gai (Urticaceae),... vi nhiu mc Sp. * Sau khai thc: Trng thi ny c 125 loi, cu trc 2 tng, che ph 95%. Tng cy g c 17 3 loi, tn che 80%. Trong mi OTC s lng cy g bin ng t 70 - 96 cy, trung bnh trong 1 c 83 cy (tng ng vi mt t 1750 2400 cy/ha). Mt 2075 325 cy/ha, chiu cao trung bnh 15,1 m, ng knh 13,7 cm, t tng tit din ngang l 38,10 m2/ha. Ch yu l nhng loi c kch thc ln v trung bnh nh Cm tru (Elaeocarpus floribundus), Ct nga (Archidendron chevalieri), Lim xanh (Erythrophleum fordii), D si (Lithocarpus bacgiangensis), Vng trng (Endospermum chinense), De vng (Lithocarpus tubulosus), Xoan o (Prunus arborea),...Cy g ti sinh c 62 loi, mt 10596 1271 cy/ha (g ln l 20 loi, g nh v trung bnh l 42 loi). Cc loi thuc h Vang (Caesalpiniaceae), h D (Fagaceae), h Trm (Burseraceae), h Du (Dipterocarpaceae), h Long no (Lauraceae), h Sim (Myrtaceae), h Du tm (Moraceae), h Hoa hng (Rosaceae), h Trm (Sterculiaceae), h Mc lan (Magnoliaceae),...
Tng cy bi c 28 loi, mt 3107 1093 cy/ha, chiu cao t 1,7- 2,2m, che ph 10%, cc loi thng gp nh Trng a (Ardisia lindleyana), Xuyn tiu (Zanthoxylum nitidum), Kho bi (Machilus oreophila), Hoa mng rng (Artabotrys hexapetalus), Bo trng (Gomphandra mollis), Bn bt (Camellia sp), Ch tc (Lindera tonkinensis), Phn en (Phyllanthus reticulatus), Nit gi (Wikstroemia indica), B my trng (Clerodendrum cyrtophyllum), n nem (Maesa perlarius),... Dy leo c 17 loi, cc loi thng gp nh: Kim cang (Smilax davidiana, Smilax china, Smilax ferox), My ho (Ampelopsis cantoniensis), Hong ng (Fibraurea tinctoria), Dy gm (Gnetum latifolium), Ch dy (Ampelopsis cantoniensis), Chc chu (Tetracera asiatica), Huyt ng (Sargentodoxa cuneata)... C c 18 loi, cc loi thng gp nh: Rau rn (Callipteris esculenta), Phong lan t (Malaxis ophrydis), L ngn (Gelsemium elegans), Cao cng (Ophiopogon latifolius), Dng x (Dryopteris sp.), Sa nhn (Amomum xanthioides),...Ngoi ra cn gp cc loi thuc h Cc (Asteraceae), h Thin l (Asclepiadaceae), h C ph (Rubiaceae), h Ci (Cyperaceae), h Ho tho (Poaceae), h Gng (Zingiberaceae),...vi nhiu mc Sp. KT LUN Thm thc vt phc hi Khu bo tn thin nhin Ty Yn T (Bc Giang) kh a dng v thnh phn loi, thi gian phc hi t 6 10 nm c 262 loi, 189 chi ca 87 h, thuc 3 ngnh thc vt (Pteridophyta, Gymnospermae, Angiospermae). H giu loi nht (5 loi) c 16 h gm Lauraceae, Euphorbiaceae, Poaceae, Fagaceae, Rubiaceae, Melastomataceae, Fabaceae, Moraceae, Vitaceae, Rutaceae, Caesalpiniaceae, Apocynaceae, Arecaceae, Theaceae, Myrtaceae, Dipterocarpaceae (chim 18,4% tng s h) vi 131 loi (chim 50% tng s loi). Cu trc thm thc vt phc hi n gin gm hai tng. Rng phc hi sau khai thc c s loi bin ng t 125-142 loi, cy g ti sinh bin ng t 62-74 loi, mt t 10.596 15.947 cy/ha. Tng cy cao s loi 95

t 14-19 loi, mt t 1725 2075 cy/ha, tn che t 40 80%. Tng cy bi c t 28 33 loi, mt t 3107 6040 cy/ha, che ph gim t 30% xung 10%. Rng phc hi sau nng ry s loi bin ng t 119127 loi, loi cy g ti sinh t 37 49 loi, mt t 6960 9813 cy/ha. Tng cy cao t 11 15 loi, mt t 558 1292 cy/ha, tn che tng dn t 25 60%. Tng cy bi t 39 40 loi, mt t 3422 5769 cy/ha, che ph gim dn t 40 xung 20%. Cc loi c gim dn khi rng c phc hi t 27 loi xung cn 16 loi, dy leo bin ng trong khong t 15 22 loi.
TI LIU THAM KHO [1]. Nguyn Tin Bn (1997), Cm nang tra cu

v nhn bit cc h thc vt ht kn Vit Nam, Nxb Nng nghip, H Ni. [2]. Nguyn Tin Bn (2005), Danh lc cc loi thc vt Vit Nam, tp 3, Nh xut bn Nng nghip, H Ni. [3]. B NN & PTNT (2000), Tn cy rng Vit Nam, Nxb Nng nghip, H Ni. [4]. Phm Hong H (1991-1993), Cy c Vit Nam, Nxb tr TP H Ch Minh. [5]. U ban nhn dn tnh Bc Giang (2001), D n xy dng khu bo tn thin nhin Ty Yn T tnh Bc Giang giai on 2001-2010.
SUMMARY CHARACTERISTICS OF SOME NATURAL FOREST REHABILITATION IN BAC GIANG PROVINCE

Nguyen Van Hoan1, Le Ngoc Cong2*, Bui Thi Dau2, Nguyen Thi Thu H2, Dinh Thi Phuong2
1
Department of Agriculture and Rural Development Bac Giang Province 2 College of Education, Thai Nguyen University
The species composition of the natural regenerative vegetation in Bac Giang province. Restored forests after 6 10 years there are 262 species, belonging to 189 genus of 87 families. The most species-rich families are Lauraceae, Euphorbiaceae, Poaceae, Fagaceae, Rubiaceae, Melastomataceae, Fabaceae, Moraceae, Vitaceae, Rutaceae, Caesalpiniaceae, Apocynaceae, Arecaceae, Theaceae, Myrtaceae, Dipterocarpaceae. These families occupying 50% total of species in vegetation. The structure of the regenerative vegetation is quite simple, comprise two layers. According to the regenerative time, the regenerative vegetation after clear cutting has the number of species from 125 to 142 species. After-exploitation forest offers the number of regenerative wood species from 62 to 74 species, the density of regenerative trees from 10596 to 15947 trees/ha. In wood tree layer, the species number from 14 to 19 species, the density of wood trees from 1725-2075 trees/ha, vegetation cover increases from 40% - 80%. In shrub layer, the species number from 28 - 33 species, the density from 3107 6040 trees/ha, Vegetation decreases from 30% to 10%. Restored forest after shifting cultivation area the number of species from 119 to 127 species, species of regenerative wood species from 37 - 49 species, the density of wood trees from 6960 9813 trees/ha. The layer of wood trees from 11 to 15 species, the density from 558 to 1292 trees/ ha, the cover of this layer increases from 25% - 60%. Shrub has the number of species from 39 to 40 species, the density from 3422 5769 trees/ha, the cover reduces from 40% to 20%. The density of regenerative trees from 5397 - 7031 trees/ha. Key words: Flora, natural regenetion, after shifting cultivation, after extraction, structure
Tel: 0915462404; Email: conglengockstn@yahoo.com.vn
96

m Vit Bc v cs Tp ch KHOA HC & CNG NGH 77(01): 97 - 102
FOREST LAND-USE CHANGE IN NGOC PHAI COMMUNE, CHO DON DISTRICT, BAC KAN PROVINCE, VIETNAM (1990-2005)
Dam Viet Bac, Dam Xuan Van*
SUMMARY
The study was conducted at the Ngoc Phai Commune, Cho Don District, Bac Kan Province, Vietnam. The aimed to determine land-use changes (LUCs) for the last 15 years (1990-2005) of Doi Moi (renovation) ra in the mountainous region of northern Vietnam. For spatial data, the Geographic Information System (GIS) was applied as a tool for determining LUCs. Three land-use maps (1990, 1998 and 2005) were overlaid and grouped into two intervals (1990-1998 and 19982005). Several thematic maps were created such as slope, elevation, drainage and road maps. Moreover, the study site was divided into 204-grid cells with 500 m x 500 m/cell or 25 ha/cell to identify and quantity the area and location of the land-use changes associated with the grid cell level. For the period 1990-1998, the total area of forest degradation was 109.31 ha. This occurred at 15-35 slope, 500-700 masl and at a distance of 500-1000m from location of LUCs to the main road. Forest restoration for the same time period was 108.30 ha mainly at 15-35 slope, 400-700 mal and at a distance of 100-250 m followed by 250-500 m and 500-750 m. For the period 19982005, forest degradation had a total area of 625.47 ha mainly at 15-35slope, 400-600 masl and at a distance of 250-500 m followed by 500-750 m and 750 1000 m. Forest restoration for the same time period was 657.94 ha mainly at 15-35 slope, 400-700 mal and at a distance of 250-500 m followed by 500-750 m and 750-1000 m. Keywords: Land use change, mountainous region, northern Vietnam
INTRODUCTION* Three-quarters of Vietnams total land area of 33.104 million hectares is occupied by hills and mountains. The remaining one-third is home to the national population which have undergone rapid changes following socioeconomic developments. Forest and land, the main sources of local production system, has been impacted severely over the last decades. Researches on land-use and land-use planning have been carried out in Northern Vietnam but have not fully looked into the driving forces of land-use change as influenced by renovation policies. For this reason, research in this area was conducted. The study attempted to review the biophysical and socio-economic conditions, estimate land-use change across three-time periods by using Geographic Information System (GIS), identify the driving forces of land-use change both at the local and exogenous levels and create GIS database. Results of the study would contribute to policymakers in creating
*
Tel: 0982166696; Email: damxuanvan@yahoo.com
guidelines relevant to forestry and rural development sectors. MATERIALS AND METHODS GIS Processing for Analysis of Land-Use Changes For spatial data, existing digital GIS files of land-use maps (1990, 1998, and 2005) from SAM Project and Natural and Environmental Office of Bac Kan province were used. This was combined with ground verification generated during the time of data gathering by intersecting land-use themes 1990-1998, and 19982005. Aside from these, topographical, drainage and slope maps were interpreted in Philippines and intersected with several thematic maps by ArcGIS 9.0. Finally, grid cell level (25 ha/cell) for the study site was made. For temporal data, all the attribute tables on Arcview GIS 3.2a and AcrGIS 9.0 were exported to dBase IV files of Excel program, and then to SPSS 12.0 for statistical analysis of output tables. Means, frequencies, ranges, percentages land-use change matrices and charts were used to compare the data of land97

m Vit Bc v cs Tp ch KHOA HC & CNG NGH 77(01): 97 102
use change areas of eight forest and land-use types; (dense forest, open forest, shrubs, upland crops, grasslands, mosaic and other lands). Descriptive statistics was used to analyze data on biophysical and socio-economic conditions of the study site. The results were presented as percentages, averages or means, ranges and graphs, where applicable. RESULTS AND DISCUSSION Determinants of Land-Use Changes The change in land-use was determined by overlaying land-use maps of 1990-1998, and 1998-2005. Overlaid maps was done in ArcView GIS 3.2a and AcrGIS 9.0. The results of overlaid maps are shown in Figure 1 and Figure 2. Dynamics of Land-Use Changes The land-use changes in Ngoc Phai for the past eight-year period are shown in Table 1. The data indicates that forestland and shrub areas have small reduction in the area of dense forest. It accounted for 191.02 ha or a -14.58% drop while there was a steady rise between 1990 and 1998, +395 ha or 73.84%. In the open forest and shrublands, There was a reduction of 87.18 ha or -7.52%. There was a marked increase in the area of paddy
field with +40 ha or 29.95%. In upland crops, a reduction was also observed, 139 ha or 34.50%. A decline of 21 ha or -10.34% in grasslands was also noted. Between 1998-2005, a high rate of forest disturbance occurred in the dense forest; the forest decreased by 103.21 ha or -9.22%, followed by shrubs with -110.91 ha or 10.34%. The open forest declined by 2.51 ha or -0.27% and the mosaic lands by 3.32 ha or -0.29%. For the other kinds of landuses, sharp increases were observed. In the upland crops, an increase of +110.88 ha or 41.78 and in paddy field with 62.76 ha or +36.10%. Moreover, a rise of +29 ha or +41.89% in other lands and +16.62 ha or +9.22 % in the grasslands was also realized. Overall, the rate of forest disturbance in the period of 1990-1998 were as follows: dense forest declined by -23.87 ha or -1.82% annually and shrublands by 10.89 ha or 0.94% annually. During 1998-2005 period, forest degradation was down to 14.74 ha or -1.32% annually in the dense forest, and 15.84 ha or -1.47% annually in the shrublands. However, there was an increase in the open forest during first period of +9.23 ha or +0.31% annually (Table 1).
Figure 1. Land-use change map, 1990-1998
Figure 2. Land-use change map, 1998-2005
98

m Vit Bc v cs Tp ch KHOA HC & CNG NGH Table 1. Land-use changes across three-time periods TYPES OF LAND-USE Dense Forest Open Forest Shrubs Paddy Field Upland Crops Grasslands Mosaic Other Lands 1990 1998 2005 CHANGE IN 1990-1998 CHANGE IN 1998-2005 (ha) (ha) (ha) (ha) % (ha) % 1310.14 1119.12 1015.91 -191.02 -14.58 -103.21 -9.22 535.97 931.71 929.20 +395.74 +73.84 -2.51 -0.27 1159.52 1072.34 961.43 -87.18 -7.52 -110.91 -10.34 133.8 173.87 236.63 +40.07 +29.95 +62.76 +36.10 405.15 265.37 376.25 -139.78 -34.50 +110.88 +41.78 201.3 180.30 196.92 -21.00 -10.43 +16.62 +9.22 369.86 359.86 356.54 -10.00 -2.70 -3.32 -0.92 57.72 70.88 100.57 +13.16 +22.80 +29.69 +41.89 77(01): 97 - 102
*Figures preceed with + sign indicates an increase; - sign indicates a decrease Table 2. Transition matrix of land-use change for 1990 1998 1990 Dense Open Shrubs Forest Forest Paddy Field 1998 Upland Crops Grass Land 1990 Mosaic Other Land TOTAL 1310.14 535.97 1159.52 133.80 40.08 133.80 405.15 201.30 369.86 57.72 4173.45
Dense Forest 1110.83 199.31 Open Forest Shrubs 8.29 527.69 100.01 1059.51
Paddy Field Upland Crops 99.71 Grass Land 5.00 Mosaic Other Lands 12.83 1998 TOTAL 1119.12 931.71 1072.34 Change in (ha) -191.02 +395.74 -87.18 Change in (%) -14.58 +73.84 -7.52
265.37 180.29 359.86 16.00 10.00 44.89 70.89 +13.17 +22.82
173.87 +40.08 +29.95
265.37 -139.79 -34.50
180.29 359.86 -21.00 -10.00 -10.43 -2.70
Process of Land-Use Transitions Period 1990-1998 (During Forest Land Allocation Program). Table 2 shows the transition matrix where 199.31 ha or 15.21% of the total of dense forest are was converted to open forest; a slight conversion in open forest to dense forest (8.29 ha or 1.55%). For shrubs, 100.01 ha were converted to open forest and 1059.51 ha or 91.37% remained unchanged. The rate of land-use change between 19901998 (Table 2) shows that there was no conversion to paddy fields during 1990-1998. Paddy field remained its original area of 133.80 ha. A total of 40.08 ha (3.83%) of upland crops was converted to paddy field and 99.71 ha (24.61%) to open forest. A small
area of grassland, 5.00 ha (2.48%) was converted to open forest and 16.00 ha (7.95%) to other lands. Period 1998-2005 (After Forest Land Allocation Program). The transition matrix (Table 3) shows the land-use change over a period of seven years. The dense forest area was transformed into shrubs area by 290.25 ha or 25.94% of total dense forest land. Other lands increased by 61.79 ha or 5.52 %, grasslands by 16.68 ha or 1.49%, paddy fields by 7.16 ha or 0.64% and mosaic lands by 0.46 ha or 0.04%. The high rate of forest disturbance was from conversion of 124.52 ha open forest (13.36%) into shrubs, conversion of 169.24 ha of open forest (18.16%) into dense forest, 106.39 ha of open forest 99

(11.42%) into upland crops, 11.34 ha of open forest (1.22%) into paddy fields. The other converted areas of open forestland were less than 1%. There was a dramatic reduction shrublands. Only 381.39 ha or 35.57% devoted to shrubs remained its original area, with 415.86 or 38.37% of shrublands converted to open forest land, with 156.84 ha or 14.63% of shrublands converted to grasslands, 72.81 ha or 6.78 % shrublands changed to dense forest and 33.15 ha or 3.09% of shrublands diverted
to paddy fields. There were no change to both the paddy field and upland crops. Paddy fields remained at173.87 ha and upland crops remained at 265.37 ha or 100% of their original lands. Grasslands were reduced drastically to 14.10 ha or 7.82%, with 130.87 ha or 72.58% of grasslands transformed into shrublands, 20.80 ha of grasslands (11.54%) changed to dense forest, 9.27 ha or 5.14% of grasslands changed into other land-use category, and 3.61 ha or 2.00% of grasslands changed to upland crops (Table 3).
Table 3. Transition matrix of land-use change, 19982005 2005 1998 Dense Forest Open Forest Shrubs Paddy Field Upland Crops Grass Land Mosaic Other Lands 2005 TOTAL Change in (ha) Change in (%) 20.8 130.87 13.98 1.43 5.68 Dense Forest 742.77 Open Forest Shrubs 290.25 Paddy Upland Field Crops 7.16 11.34 33.15 173.87 265.37 3.61 14.10 0.81 0.22 332.7 9.27 6.69 106.39 0.68 Grass Land 16.68 4.30 156.84 Mosaic 0.46 2.56 10.91 Other Land 61.79 0.02 0.69 1998 TOTAL 1119.12 931.71 1072.34 173.87 265.37 180.3 359.86 70.88 4173.45
169.24 513.34 124.52 72.81 415.86 381.39
10.29 20.42 4.00 0.20 4.19 9.69 22.10 1015.91 929.20 961.43 236.63 376.25 196.92 356.54 100.56 -103.21 -2.51 -110.91 +62.76 +110.88 16.62 -3.32 29.68 -9.22 -0.27 -10.34 +36.10 +41.78 9.22 -0.92 41.87
Net Changes Detected by PostClassification Method

Table 4. Land-use change by post-classification method AREA CHANGE AREA CHANGE IN 1990-1998 IN 1998-2005 NATURE OF CHANGE (ha) (ha) Loss of forest Gain of forest 199.31 108.30 625.47 657.94
program, 12 important land- use changes were found consistent in both sub-periods. The results further showed that the forest disturbance was 199.31 ha in the first period and in the second period, 625.47 ha. Forest increased 108.30 ha and 657.94 ha in the first and second periods, respectively (Table 4). The original area of the dense forest class and the open forest class, 84.79% and 98.45% of respectively did not change in the first period (1990-1998). Likewise, in the second period (1998-2005), 66.37% and 55.10% of the dense forest and the open forest did not change, respectively (Table 5).
Based on the post-classification method of land-use change in two periods during and after implementation of the land allocation 100

m Vit Bc v cs Tp ch KHOA HC & CNG NGH Table 5. Land-use areas which did not change LAND-USE TYPE Dense Forest Open Forest Shrubs Paddy Field Upland Crops Grass Land Mosaic Other Lands Total AREA IN 1990- PERCENT OF 1990 AREA IN 1998- PERCENT OF 1998 1998 TOTAL 2005 TOTAL (ha) (%) (ha) (%) 84.79 66.37 1110.83 742.77 527.69 98.45 513.34 55.10 1059.51 91.37 381.39 35.57 133.80 100.00 173.87 100.00 265.37 65.50 265.37 7.82 180.29 89.56 14.10 92.45 359.86 97.30 332.70 22.10 44.89 77.77 22.10 31.18 3682.24 2445.64 77(01): 97 - 102
CONCLUSIONS During 1990-1998, the output result of GIS interpretation shows that: The total area of forest degradation was 199.31 ha (24.91 ha annually). In more specific terms, the following results were noted: Forest degradation was 34.80% of total area at the slope range 150-250 and 37.10% at the slope range 250-350; 31.70% of total area of forest degradation took place at 500-600 masl and 28.30% at 600-700 masl; 20.40% of total area of forest degradation occurred at the distance range 500-750m and 11.20% at 7501000 m distance. The total area of forest restoration was 108.30 ha (13.54 ha annually). Of which, In terms of forest restoration coverage, 43.50% occurred at the slope range 150-250 and 35.60% at the slope range 250-350; 34.10% of forest restoration happened occurred at the elevation range 400m-500m and 33.00 % at the 500m600m; and 24.90% of forest restoration occurred at 250-500 m distance, 20.00% at the distance of 100-250 m and 18.00% 500750 m from the location of land-use change to the main road. During 1998-2005, the total area of forest degradation was 625.47 ha (89.35 ha annually). Of which, The total area with forest degradation, 37.10% was observed to occur at the slope range 150-250 and 34.40% at 250-350 slope; 31.70% of the forest degradation area happened at 500-600 masl elevation, 29.50% at 400-500 masl; and 19.10% of the area of forest loss was at the distance of 250-500m and 500-750m, and 9.60% at 1250-1500 m distance);
The total area of forest restoration was 657.94 ha (93.99 ha annually). Of which, 37.90% of the total forest restoration area took place mainly at the slope range 150-250 and 37.50% at the slope range 150-250; 27.30% at the elevation 500-600 masl, 24.00% at 600-700 masl and 23.50% at 400-500 masl; and 15.90% of total area of forest restoration was at the distance of 250-500 m to the main road; 13.60% at the distance of 500-750 m and 13.00% at the 750-1000 m. REFERENCES
[1.] HUNG, P. T. 2000. Monitoring land use changes with the help of landsat-tm image and geomatic technologies. The case of Loc Chau Commune, Bao Loc District, Lam Dong Province, High Land of Vietnam. International Rice Research Institute, Los Banos, Laguna, Philippines. November 2-3, 2000. [2.] MALYVANH, M. and C. FELDKTTER. 2000. Application of remote sensing and GIS for forest cover monitoring in Lao PDR. http://www.mekonginfo.org. [3.] WU, Q. H.Q. LI, R. S. WAN, J. PAULUSSEN, Y. HE, M. WANG, B. H. WANG and Z. WANG. 2006. Monitoring and predicting land use change in Beijing using remote sensing and GIS. Landscape and Urban Planning 78 (2006) 322333. [4.] XIE, Y. and J. FELLOWS. 1996. application in natural reserve management. 259-265. In: PETER, WANG J. and Y. Conserving Chinas Biodiversity Environmental Science Press. Beijing. GIS Page XIE. (II).
101

TM TT
BIN NG S DNG T LM NGHIP TI X NGC PHI, HUYN CH N, TNH BC KN, VIT NAM (1990-2005)
m Vit Bc, m Xun Vn*
Trng i hc Nng lm H Thi Nguyn
Nghin cu c tin hnh ti x Ngc Phi, huyn Ch n, tnh Bc Kn, Vit Nam. Mc tiu ca nghin cu l xc nh s thay i s dng t trong 15 nm qua (1990-2005) ca thi k i mi khu vc min ni pha Bc Vit Nam. i vi d liu khng gian, vic ng dng h thng thng tin a l (GIS) nh mt cng c xc nh s bin ng s dng t. Ba bn s dng t (1990, 1998 v 2005) c chng ghp v chia thnh hai giai on (19901998 v 1998-2005). Mt s bn chuyn c to ra nh bn dc, ch nc, cao v bn giao thng. Hn na, cc im nghin cu c chia thnh cc li gm 204 vi kch thc 500 mx 500 m/ hoc 25 ha/ xc nh s lng v nhng khu vc, v tr ca s thay i s dng t gn lin vi mc li. i vi giai on 1990-1998, tng din tch rng b suy thoi rng l 109,31 ha. iu ny xy ra dc 15 -35, cao 500-700 v khong cch 500-1000m t v tr ca loi t thay i n ng chnh. Vic phc hi rng trong khong thi gian ny c 108,30 ha ch yu dc 15 -35, cao 400-700 v khong cch 100250 m, sau l 250-500 m v 500-750 m so vi ng chnh. i vi thi k 1998-2005, tng din tch rng suy thoi l 625,47 ha, ch yu dc 15 -35, cao 400-600 v khong cch 250-500 m , sau l 500-750 m v 750-1000 m so vi ng chnh. Phc hi rng trong khong thi gian ny c 657,94 ha ch yu dc 15 -35 , cao 400-700 v khong cch 250-500 m, sau l 500-750 m v 750-1000 m so vi ng chnh. T kha: Bin ng s dng t, khu vc min ni, min Bc Vit Nam
102

Th Ngc Oanh Tp ch KHOA HC & CNG NGH 77(01): 103 - 106
FARMING SYSTEMS OF THE POOR IN MOUNTAINOUS AREAS OF QUANG NAM PROVINCE AND POSSIBLE SOLUTIONS
Do Thi Ngoc Oanh*
SUMMARY
The poor in mountainous areas of Quang Nam province give priority to food security in farming. Main food crops on upland were rice, cassava and banana; on lowland were rice and cassava; in home garden was jackfruit; in forest were acacia and cinnamon. Strategies to ensure food security and sustainable income for the poor are improve upland agriculture production by crop diversification, short-time crops support long- time plants, sustainable intensifications of local varieties and breeds, and enforce local people integrated in chain values of banana, cassava and mungbean. Suggestion models for upland are intercrop local rice with mungbean and local cinnamon; intercrop cassava with acacia; for lowland are intensive cassava, intensive banana and hybrid breed maize; for home garden are improve chicken and pig production. Key words: Poor, upland farming, food security, upland rice,Quang Nam
INTRODUCTION* Qung Nam province is located in a central costal part of Vietnam (latitude and longitude are 16050N and 107012E respectively). The province covers an area of 1.040.878 ha of which mountainous area occupies 81% (845.763 ha). Population in the mountainous areas was 410.000 people of which about was ethnic minorities including C tu, Ca Doong; Bhnoong, X ng, Cor, M Noong, Ve and T Ring. To find out possible farming solutions for the poor in mountainous areas of the province this study was conducted in May 2010. PRA technique was used and studying sites were Tra Tap and Tra Don Communes in Nam Tra My district; Tra Tan and Tra Cot communes in Bac Tra My district. GENERAL BACKGROUND OF NAM TRA MY AND BAC TRA MY DISTRICTS Nam Tra My and Bac Tra My are considered as mountainous districts with a high proportion of the poor. By the end of 2009, Nam Tr My had 60% of poor household (3.316/5.462 households), 62% of the poor people (15.141/24.274 people); Bac Tr My had 76% of poor household (3.011/3.913 households), or 62% of the poor people
*
(14.603/18.945 people) (DRAD, 2010). The urgent needs of the poor were food and cash for daily expensive. Crop production was the major farming activity and the main mean of generate income in the mountainous areas. Some local people participated in value chains of local products. Dominant crops were rice, cassava and banana; dominant forest plants were acacia and cinnamon, dominant animals were pig, cattle and chicken. Cash crops were banana and cassava. Acacia was also a cash plant in areas which was easy to assess main roads. Most of the agricultural land was on upland. For example, in Tr Tp commune in a total of 136 ha land for seed crops there was 71% of upland rice and only 26% was paddy rice (People committee of Tra Tap, 2010). The main characteristics of farming were priority given to rice production, extensive and low diversity farming. Comment farming techniques were no or low level of fertilizer application even on paddy rice; self produce seeds and no means of soil and water conservation on upland. Agricultural development strategies for the mountainous area were promoted forestry, cattle, pig, poultry and medicinal herbs. Suggested species were forestry plants, cinnamon, pepper, pineapple and fruit, cassava (DARD, 2007). 103
Tel: 0168.670.2448;Email: dongocoanh@gmail.com

Th Ngc Oanh Tp ch KHOA HC & CNG NGH 77(01): 103 106
The most difficulties in farming were soil degradation lead to a reduction of crop yields; A long travel distance from villages resulting in a high labor cost per harvest unit; Extreme weather such as cold (December to February), drought, stone rain (5-6) storm (July and Augurs) and flood (September and October) resulting in unattainable crop yields. FAMING SYSTEMS Upland rice based systems Land use strategy depends on soil fertility, soil moisture content, and accessibility. Priorities (fertile soil and labor) were dedicated for rice. Cassava was the second important crop as it was used in a shortage of rice and for animal feed. Banana was planted as a cash crop. Other food crops including various bean and maize with a small proportion were planted mostly for house consumption. Three comment types of crop rotation were found on upland as follows: Rice (1 year) fallow (2-5 years) rice (1 year) cinnamon. The fallow period will be shorten if a plot was near village (about 1 km). Rice (1 year) banana (2 years) - fallow 3 years rice if soil moisture content was high. Rice (1 year) cassava acacia if road assess was possible. Monoculture of rice was dominant with two types of rice. Early harvest rice was from April or May to September or October. Late harvest rice was from June to October or December. These two types of rice produced a similar yield which was 1-2 ton/ha. These were practiced to avoid total failure in case of a bad weather. Local varieties were seeded with a very high density (50 kg/ha; 10 seeds/hole). Hand weeding was carried out 12 times per season and there was no application of fertilizer. Intercrop rice with mungbean or vegetable was found with a small proportion as follows: Mungbean (from March or April and to May or June) rice (from May to October or December) if it was a fertile soil. About 10% of households practiced this system. 104
Vegetable (from February to April) rice (from May to October or December) if soil moisture content was high. Traditionally, to save labor a mixed seeds of rice and mungbean was seeded in March, at a harvest of mung bean in May rice started heading. A new technique of intercrop rice mung bean was introduced by DARD but was not widely practiced. Mungbean was seeded in March with a density of 2 seeds/hole. Rice was seeded at a time of weeding for mungbean in May. Mungbean was a traditional crop; its advantages were it allows quick harvest (in 2 months), easy transport and harvest at time of food shortage. At present a value of 1 kg mungbean (10000-12000 /kg) equivalent to two or three kg of upland rice. Disadvantages of this crop were labor intensive for harvesting at seeding time of upland rice. Cassava season was from May to December and that of maize was from March to July. Local variety of maize was prefer instead of hybrid variety, however, there were a few interviewers mentioned about maize. Banana was a relatively important cash crop as it provided monthly income from 20.000 to 40.000 VND/each harvest. There was a consume channel of banana to Tam Ky and to Da Nang cites. Acacia plantations were found where road access to local markets was possible whereas patchy cinnamon was found anywhere. Two cinnamon varieties (local and Thanh Hoa varieties) were planted. Of these two varieties, the local cinnamon grown slower and take longer time to be harvested but had a better quality. Market of these products was problems. In Nam Tra My many interviewers said do not know whom to sale acacia to and price of cinnamon bark was too cheap to compare with its cost. According to the interviewers, price of cinnamon was about 10.000 to 15.000 VND/kg whereas to have benefit it must be 70.000 to 80.000 VND/kg. Lowland rice-based system Average holding of paddy field was 600 m2/household. There were two rice crops per

Th Ngc Oanh Tp ch KHOA HC & CNG NGH 77(01): 103 - 106
year: Winter-Spring rice was from January to May and Summer-Autumn rice was from June to October. Some households applied chemical fertilizer but there was no application of animal manure. Rice yield which was 3-3.5 ton/ha (DARD, 2009) was low in comparison with that of provincial average. Constraints to rice production were unstable water supply, cold winter when heading and flooding at the harvest. To cope with unstable water supply, in the Tra Mai commune some farmers turned rice plots into banana plots. Annual crop based systems along river banks The most dominant crop was cassava which was planted from January to August. Cultivar KM 94 was planted at a high density of 0.6 x 0.6 m. Some households applied chemical fertilizer. Cassava yielded at 10-12 ton/ha (lower than its potential which was 20-30 ton/ha). Price of fresh cassava was 5000 to 6000 VND/kg. In many cases cassava dealers offered rice in advance then farmers paid at the harvest of cassava. The poor appreciated this offer. There was a cassava starch factory in Quang Nam where it was delivered to. Other crops included maize (January to April and May to August); peanut (January to April and April to August); various bean (January to June); and vegetables (May to June and October to December) were found along river banks. Homegarden Management of home garden was very poor with the most common crop was jackfruit. There was a channel of jackfruit consumption to Tam Ky and Da Nang cities. Unstable and low production of livestock was comment to most of interviewers. Pig, cow, chicken and goat were suffered from poor nutrition feed and management. For example, a piglet of 10 kg reached a weight of 40 kg after 6 month rising. POSSIBLE SOLUTIONS Land use strategies As it has been considered that ensuring food security is one of the most important
necessary conditions for an upland agricultural intervention (Sciortino et. al., 2008) so the first strategy improve upland agricultural production for food security and to generate surplus of cash crops for domestic and nearby regional markets. The second strategy is crop diversification to reduce household vulnerability and depending on upland rice. The third strategy is graduate replace crop plants by forestry plants. Selection criteria of upland crops which suggested by Sciortino et. al. (2008) can be applied. They are market demand exists; suitable for sloped lands; integrates into agroforetry systems; potential for community based value added processing; potential for private sector participation; potential for contract farming; potential as natural/organic product and potential suitable as a biofuel. Other criteria must be taken into account are low input and generate all year cash flow. Technical aspects Plant species for the upland are mungbean, banana, cassava local cinnamon and acacia. Applied techniques are: Sustainable intensification of crop and animal production by use of improved local varieties and breeds because they are well-adapted and allowed a stable low yield and appropriate management (nutrition management, density and protection); Appropriate proportion of hybrid varieties; Intercrop annual crops with perennial plants (rice, mung bean with cinnamon; cassava with acacia); improve animal health care and feeding. Marketing aspect Enable the local people to bargain with traders to improve the sale price of their products and promote their role in chain values of these products. Suggested models 1. Sustainable intensification of upland rice by intercrop rice with mungbean and local cinnamon. 2. Improved bananas plantation by planting and protection techniques to improve 105

Th Ngc Oanh Tp ch KHOA HC & CNG NGH 77(01): 103 106
quality, various planting time to have various maturity time. 3. Intercrop cassava with acacia where road assess is possible. 4. Improve local chicken and pig production to improve value of cassava and maize. 5. Forming farmer group to market mungbean, banana and cassava. An example of diversify income H Th Hiu, in the Second village, Tr Mai commune took advantage of living near Nam Tr My town to generate a cash flow from upland as follows: Weekly income was 50.000 VND/week/harvest from summer vegetable (rau ngot). Monthly income was 200.000 300.000 VND/month/2-3 harvests from banana (50% sale to collector, 50% sale at local market); TM TT
Seasonally income was 200.000-300.000 VND/season from fresh sticky local maize. Yearly were 200.000 VND/ year/about 1000 m2 from jackfruit and 1.5 3 million VND/year from leaves for Tet cake cover.
REFERENCES
[1]. Quang Nam Department of Rural and Agricultural. 2010. Report on implementing integrated funding in 135 areas. [2]. Tra Tap People Committee. 2010. Report on agricultural production of Tra Tap commune. [3]. Sciortino R.; Forester. A. F.; Sudsawasd S. and Aungsumalin S. 2008. Study on enhancing upland food secretary and crossboder agricultural production supply chain in the GMS. MIDAS Agronomics Company Limited. Thailand.
H THNG TRANG TRI CA NGI NGHO TI KHU VC MIN NI TNH QUNG NAM V CC GII PHP
Th Ngc Oanh* Trng i hc Nng Lm H Thi Nguyn Vn n an ninh lng thc c u tin hng u i vi ngi ngho khu vc min ni thuc tnh Qung Nam. Cy lng thc ch yu vng cao l la, sn v chui; khu vc vng thp l la v sn; trong vn nh l mt; trong rng l cy keo v qu. Cc gii php m bo an ninh lng thc v thu nhp n nh cho ngi ngho l ci to nng nghip vng ni thng qua a dng ha cy trng, cy ngn ngy gip nui cy di ngy, vn thm canh bn vng cc ging cy, con bn a v vic bt buc ngi dn a phng tham gia vo chui gi tr hng ha ca chui, sn v u xanh. Cc m hnh khuyn co i vi khu vc min ni l gi v la vi u xanh v qu; gi v sn vi keo; i vi vng thp l thm canh sn, thm canh chui v ng lai; i vi vn nh ci to sn xut chn nui g v ln. T kha: Ngi ngho, nng nghip vng cao, an ninh lng thc, Go ngc,Qung Nam
Tel: 0168.670.2448;Email: dongocoanh@gmail.com
106

DRIVING FORCES OF LAND-USE CHANGE IN NGOC PHAI COMMUNE, CHO DON DISTRICT, BAC KAN PROVINCE, VIETNAM (1990-2005)
Dam Viet Bac, Dam Xuan Van*
Thai Nguyen University of Agriculture and Forestry
SUMMARY
The study was conducted at the Ngoc Phai Commune, Cho Don District, Bac Kan Province, Vietnam. The aimed to determine land-use changes (LUCs) and their driving forces for the last 15 years (1990-2005) of Doi Moi (renovation) ra in the mountainous region of northern Vietnam. The proximate (direct) driving forces of land-use change include wood extraction and slash-and-burn, shift in agricultural expansion, cattle ranching, demographic factors, biological factors (soil degradation) and physical factors (slope, elevation and distance from location of LUCs to the main road). In contrast, the underlying (indirect) driving forces of LUCs were Land Allocation Program 1992-1997, Five Million-Hectare Forest Restoration Program 1998-2010, Land Law 1993, Market-driven and Financial Aids in Forest Development. During the first period (1990-1998), the implementation of the forest allocation program became in allocated forest areas. Unfortunately, high rate of forest disturbance happened in the unallocated areas. During second period (19982005), after implementation of the land allocation program, market-driven and technological change created different effects on both gain of forest area and loss of forest areas. This period marked a strong economic transformation on agricultural production activities (shift in agricultural sector) and supports from governments program. However, the forest protection and management seemed to be less effective compared to the first period, during land allocation implementation. Keywords: Driving forces, land use change, mountainous region, northern Vietnam
INTRODUCTION* According to estimates by the United Nations Development Program (UNDP), forest area declined from 43% of total land area in 1943 to 23% in 1995. However, forestland coverage recovered to 32.3% in 2000 and 36.7% in 2004, due to active afforestation and reforestation efforts, especially in the northeast and northwest regions of the country (MARD, 2006). Almost five million hectares of forest were lost in Vietnam from 1943 to 1997. Population increased from 27 to 79 million between 1945 and 2001. At present, about three quarters of the population are engaged in agricultural production, thereby generating a massive demand for land. This demand will continue to rise as population is projected to increase to 123 million in 2030. The fast growing rural population, among the highest in South-East Asia, puts high pressure on land-use stemming from a need to expand and
*
intensify agricultural production. At the same time, the Vietnamese government is attempting to restore forest cover to the level of 1943 with huge reforestation programs and changing tenure regimes like the allocation of forest land to individuals, groups and communities. This study aimed to understand the proximate and underlying causes of land-use changes in the rural areas of Northern Vietnam uplands during the past two decades. The result from this study could be useful in the development of effective strategies for land-use planning, land allocation and implementation of various rural development and resource management policies. MATERIALS AND METHODS Driving forces of land-use change analysis: The study largely relied on the use of semistructured questionnaire and key informants at village and household levels. GIS analysis was employed in determining the driving forces of land-use/land cover change, whether direct or indirect (Figure 1.) 107

RESULTS AND DISCUSSION The following discussion shows the proximate (internal factors) driving forces in the dynamics of land-use change. Proximate or (Direct) Driving Forces The context of land-use-change in Ngoc Phai commune was greatly affected by the national renovation policies. Change in national political economy impacts indirectly the commune through time, which is closely linked to evolution of forest and land-use concerns. Wood extraction and slash-and-burn. Results of the survey show that at the beginning of forest land allocation program implementation (1992-1997) in the study site, there are still 60 cases of illegal logging which is equivalent to 360 m3. This explains that at the beginning of implementation period of the program, the effect is not always feasible. After the implementation of the land allocation program, illegal logging was still practiced. This could be attributed to weak management of forestry guards, forestry managers, and perceptions of local farmers. According to Sikor (2001), the period since the implementation of forestland allocation program showed a slight increase in overall forest cover. However, the superficial successes of the land policy hide the deeply destabilizing effect it had on shifting cultivators. Findings of the research show that after the land allocation program and forest protection contract have been implemented in the study site. The commune has marked achievements and gained a lot of success in forest management and protection. Result also shows that the number of illegal logging cases was reduced sharply during this time (from 60 CAUSES
cases during 1990-1998 to 28 cases) and slash-and-burn cases were reduced from 20 cases to only 9 cases during 1998-2005 (Table 1). Findings of the study are in agreement with that of Castella et al. (2006). He found that majority of villages (70%) occupied by Tay people with abundant paddy fields were able to secure individual ownership, sloping land and intensified paddy production. However, the Dao group, who were deprived of paddy fields because of Tay people who claimed these areas as ancestral lands. Hence, the Dao ethnic group has limited paddy land and has no choice but to engage in shifting cultivation. Cattle ranching. Livestock husbandry has been increasing in Vietnam in recent years. In the period 1995-1999, the number of cattle has increased from 3.6 to 4.0 million while the buffalo population remained steady at 2.9 million. Among the factors propelling this expansion in Cho Don district, Bac Kan province are the growing population and growing demand for beef in urban areas as well as an increase in the use of cattle as a form of capital because of increasing land scarcity (SAM Program, 2003). The northern mountains offer good conditions for livestock production and this was why in 1994 more than half the buffalo population was located there. Livestock are almost an ideal cash crop for the uplands because they fill an empty niche in swidden systems; livestock fodder is available in fallow plots and secondary forests. Some upland regions have a reputation for high value cattle products. 1991-1997
Table 1. Wood extraction and slash-and-burn cultivation as driving forces of land-use change
1997-2005 28
100
1. Illegal logging + Case + Forest products damaged (m3) 2. Slash and burn cultivation + Case + Damage forest area (ha)
* Source: Bac Kan Forest Governance Department and Field Survey
60
180 20
60
9 20
108

Figure 1. Framework for driving forces of forest land-use change analysis
The forest provides a large source of income for Hmong farmers. Bac Kan province offers a good source of fodder and space for raising buffalo, which are traded not only throughout the delta regions but also to Laos and Thailand. The Mountain Rural Development Program suggested that there is a need to reserve some open areas for production of fodder for cattle production, especially in more remote areas where animal production is a major income generating activity (MARD, 2001).
There is some evidence linking the growth of the livestock sector to the elimination of forest cover in the northern uplands. Researchers in the SAM Program (2003), on the basis of a case study in Cho Don district, Bac Kan province in northern Vietnam, explained that the rapid growth in the herd of large ruminants (cattle and buffalo) has put unsustainable pressure on forest cover. The steep increase in the number of larger ruminants (buffalo and cattle) has created a threat to sloping land and forests. 109

The transition from collective herd management to management by individual households has led to free-grazing practices on both the lowland and hillsides, resulting in an increased number of disputes between farmers. Livestock owners returned to this traditional practice because individual households did not have enough labor force to tend a few head of livestock all year round. Based on interviews with the farmerrespondents, this is mostly due to the need to mobilize cash to purchase rice and fill in the food gap caused by reduced upland rice production. Buffalo populations have increased in recent years with 457 herds of buffalo in 1990, 690 herds in 2000 and 1, 133 herds in 2005. Herds of cow increased by 132 herds in 1990, 140 herd in 2000 and 272 in 2005 (Ngoc Phai Peoples Committee |Report, 1990; 2000; and 2005). In other parts of upland Bac Kan, livestock production is currently increasing, which may be explained by the growing demand from the lowland market, driven by the extremely rapid development of the Vietnamese economy. Shift in agricultural expansion. Forestry land allocation and protection contracts have much effect on village land and tree tenure. The question is what if no forest land allocation policies, and then what factors caused the increase in forest cover during 1998-2005 in the research site? The answer was laid in the broader dynamics of land-use and the ways in which changing market and technological opportunities affected agricultural production and expansion. Market expansion and newly available technologies motivated the people in the village to have two options of shifting: a shift in rice production from swidden to wet-rice fields and a change in cash cropping from cassava to corn. After 1998, swidden area dropped sharply due to the effective implementation of the land allocation policy. A rough estimate of labor productivity of swidden and wet-rice production indicate that this increase was not likely due to farmers spontaneous switch 110
from swidden to wet-rice production. The Cropping System component of SAM Project designed innovative cropping systems adapted to these local conditions. A large range of low-input alternatives to slash-andburn practices was tested in farming conditions. The advantages and constraints of these technical innovations were documented and made available to users through different methods such as demonstration plots, decision support systems, and participatory simulations. An action-research framework aims at facilitating a large diffusion of the proposed innovations. Shift in rice cultivation area. During 1998 to 2005, expansion of irrigation systems and use of high yielding wet-rice varieties played an important role in changing rice production in the research site. Change in macro-policies (e.g., rural road development, subsidized of seeds and micro-credit), enabled upland farmers to have access to high yielding wetrice cultivars, which were only available in the lowlands. The average productivity of paddy increased from 2.5-3 tons/ha in 1990 to 56 tons/ha in 1993 and 7-8 tons in 2000. In addition, de-collectivization, the privatization of land-use rights and market liberalization, provided incentives for farmers to invest in the expansion of wet-rice by building more terraced fields and constructing small irrigation systems with earth canals and bamboo water pipelines. The Government also financed new irrigation dams and consolidated old ones. However, physical and financial constraints of many farmers caused low adoption rates of improved wet rice. In 1995, new wet rice varieties were only planted in the communes located near along the main roads of commune with elevation range from 300 to 600 masl. Shift from cassava to hybrid corn. Changing markets and technologies also motivated a shift in cash cropping from cassava to corn. Markets for agricultural output rapidly expanded in the late 1990s. Traders began to arrive in larger numbers in search of agricultural crops to satisfy the demand for animal feed in the lowlands. Prices offered

became increasingly favorable to corn. Corn prices rose against cassava with the availability of new corn varieties. They allowed corn yields to triple within a few years, without the use of fertilizer and pesticides. By 1993, the returns for corn cropping exceeded those of cassava cultivation: 1 labor day produced an average return of VND 20000 in corn production, compared to VND 15000 in cassava. In addition, corn output was more secure since the cropping period for corn was much shorter. Overall, changes in markets and available technologies changed the relative costs and benefits of agricultural crops. In response, rice production shifted from swiddens to wetrice. Corn replaced cassava as the major cash crop. The shift in land-use reduced the demand for land, as wet-rice and corn production took place on permanent fields. They required smaller area of land for cultivation, as villagers had previously rotated swidden rice and cassava fields and reduce of pressure on land. As a consequencet, forests quickly regenerated in Ngoc Phai, as in the whole of Bac Kan, given the favorable natural growth conditions. The expansion was due to an increase in open-canopy forest. Closedcanopy forest remained unchanged. Forests grew back and the actual area under cultivation expanded. Shift in sustainable agro-forestry models in upland area. In the study site, An Thi Huong (2002) assessed the economic value of different agroforestry models in Ngoc Phai commune and found that from 20 surveyed households, there were 41 typical agroforestry models with a total of 18.61 ha. Of which, the model of cinnamon combined with upland rice accounted for 3.10 ha (16.67%), followed by cinnamon combined cassava 1.92 ha (10.32%) and smallest area models was Manglietia combined cassava, accounted for 0.90 ha 4.84% . Similarly, results show that the comparison of economic value among of agroforestry models affected the implementation of
forestland allocation and market during renovation era in the study site shifted and expanded., applied technologies like (SALT) for economic purposes and reduce poverty. This is one of the positive factors, which contribute in reducing pressure on forest resource. Demographic Factors Population dynamics and density. In the uplands of Northern Vietnam, increasing population pressure combined with privatization of the economy, land redistribution and political reforms were the main driving forces behind the rapid and profound land-use changes which occurred during the past decades. Lowland areas are now saturated while the development of nonsustainable agricultural practices on the hillsides endanger the fragile upland ecosystems. These recent trends in land-use changes demand for new production technologies that would spare the natural resource base while meeting the increase in food needs (SAM, 1998). According to the Asian Development Bank the main causes of deforestation in Vietnam have been population-driven, demand for forest products and agricultural land and logging of large tracts of forest by State Forestry Enterprises (ADB 2000). Since 1993, the implementation of Resolution No. 04-NQ/HNTW(Population and Family Planning) dated 14/01/1993 of Vietnamese Communist Party played an important role in the socioeconomic development of individuals, households and the entire society. Ngoc Phai commune marked a great achievement in population control. The total population in 1990 was 312 households (1858 people), 377 households (1991 people) in 1995, 421 households (2095 people) in 1998, 443 households (2117 people) in 2000, and 497 households (2227 people) in 2005. The rate of population growth increased by 7.15% between 1990 and 1995, increased by 6.32% between 1995 and 2000, and increased 5.19% between 2000 and 2005. In 15 years, population growth in study site increased by 111

19.86%. This clearly shows that an increase population means an increase for food demand, hence, population control should be encouraged and lessen its impact to land-use change. Results show that the population density varied in each of village (Table 2). Despite the remarkable achievement in population control in the study site, there are still more than 30% of households living below the poverty line in 2005. With the current situation on population density and population growth rate in the commune, it could not be considered as the main cause of decline in forest area. Differences between ethnic groups particularly Tay versus Dao ethnic groups, brought about land-use change. The Tay ethnic group claimed that Daos paddy fields were their ancestral lands. This is in agreement with the findings of Castella et al.
AREA (HA) 378.527 389.632 368.141 613.225 566.682 741.593 416.764 699.014 AREA (KM2) 3.785 3.896 3.681 6.132 5.667 7.416 4.168 6.990
(2002) on the declining role of ethnicity in farm households differentiation in Ngoc Phai. Other Factors Biological Factors Soil degradation. Results of this study show that changes in soil fertility over time may have affected a farmers land-use decision to incorporate erosion control measures into an existing system or to adopt a new land-use system in the area. Possible causes of change in soil fertility included the application of fertilizers, insecticides and herbicides, erosion and climatic changes, and slash-and-burn cultivation. In the sloping upland areas, erosion is considered one of the main causes of soil fertility reduction. Farmer-respondents reported their perception about the changes in the soil fertility of their parcels. Interview results are presented in Table 3.
HOUSEHOLD NUMBER (PERSONS) 83 71 47 62 63 80 41 53
Table 2. Population dynamics and its density in Ngoc Phai commune, 2005 VILLAGE Ban Cuon 1 Na Tum Phieng Lieng 1 Ban Cuon 2 Ban Om Ban Dieu Phieng Lieng 2 Coc Thu POPUALTION DENSITY (PERSONS/KM2) 104 83 55 49 45 47 44 31
Source: Field survey, 2006 Table 3. Farmers perceptions on change in soil fertility FREQUENCY ALL CASE UPLAND RICE CASSAVA AGROFORESTRY 83 28 20 10 (100.00) (100.00) (100.00) (100.00) 17 (20.48) 55 (66.26) 15 (18.07) 3 (10.71) 22 (78.57) 1 (3.57) 6 (30.00) 17 (70.00) 3 (15.00) 3 (30.00) 1 (10.00) 6 (60.00) MAIZE 25 (100.00) 5 (20.00) 15 (60.00) 5 (20.00)
No. of respondents % Changes in soil fertility No change % Decreased % Increased %
Source: Field survey, 2006
112

Physical Factors Arcording to Dam Viet Bacs master thesis (2007), the land use change of Ngoc Phai commune from 1990 2005 indicated as following: Period 1990-1998. The total area of forest degradation was 199.31 ha. Of which, the highest percentage of forest degradation happened at slope 250-350, accounted for 37.10% (74.02/199.31 ha) of total areas of forest loss, followed by 34.80% (69.36/199.31 ha) at slope 150-250, 15.50% (30.93/199.31ha) at slope 350 and above. During this period, forest degradation happened mainly at elevation range 400-800 masl with following proportions: 19.00% (37.89/199.31ha) of total area of forest degradation at elevation 400-500 masl, 31.70% (63.14/199.31ha) at elevation 500600 masl, 28.30% (56.37/199.31 ha) at elevation 600-700 masl, and 15.20% (30.31/199.31ha) at elevation 700-800 masl In terms of distance, the highest percentage of forest degradation during this period, was 20.40% (40.57/199.31ha) at the distance 500750m to the main road, followed by 11.20% (22.39/199.31ha) at the distance 750-1000m, 10.30% (20.58/199.31ha). A 9.00% to 9.80% of total areas of forest degradation occurred at the distance 250-500m, 15001750m, 1750-2000m, and 2250-2500 m. Over a period of eight years, results reveal that the total area of forest restoration was 108.30 ha. Of which, 43.50 % (47.11/108.30 ha) at slope 150-250, 35.60% (38.57/108.30 ha) at slope 250-350, 12.50% (13.58/108.30 ha) at slope 00-150, and only 8.30% (9.04/108.30 ha) at slope 350 and above. In addition, forest restoration occurred mainly at elevation 400-700 masl with a ratio: 34.10% or (36.94/108.30 ha) of total area of forest increase at elevation 400-500 masl, 33.00% (35.714/108.30 ha) at elevation 500600 masl and 19.50% (21.17/108.30 ha) at elevation 600-700 masl. In terms of distance, forest restoration areas increased remarkably with 24.90%
(26.96/108.30 ha) at distance 250-500m, followed by 20.00% (21.64/108.30 ha) at 100-250 m distance and 18.3% (19.84/108.30ha) at 500-750m distance. Period 1998-2005. The total area of forest degradation was 625.47 ha and occurred mainly at slope 150-250 and 250-350. There was 36.40% (227.83/625.47 ha) of the total area of forest degradation at slope 150-250 and 37.10 % (232.06/625.47 ha) at slope 250-350 . Considering elevation, forest degradation, the highest percentage of forest degradation was 31.70% (198.30/625.47 ha) at elevation 500600 masl, followed by 29.50% (184.37/265.47 ha) at 400-500 masl, 16.20% (101.52/265.47 ha) at elevation 600-700 masl, and 9.40% (58.81/265.47 ha) 700-800 masl elevation. It is interesting to note that forest degradation happened on the same percentage of forest loss area at the distance 250-500m and 500750m with 19.10% (119.582/265.47 ha). At a distance of distance 1250-1500m, 9.60% (60.25/625.47 ha) and 8.80% at distance 1500-1750m, and 8.90% of the total area of loss was at 100-250m distance. Over a period of seven years, the total forest restoration area was 657.94 ha. Of these, 37.90% (249.40/657.94 ha) at slope 150-250, 37.50% (246.64/657.94 ha) at slope 250-350, 14.70% (96.43/657.94 ha) at slope 00-150, and 10.00% (65.47/657.94 ha) at slope 350 and above. Forest restoration happened mainly at elevation 400-800 masl, with the following ratios: 27.30% (179.00/657.94 ha) at 500600 masl, followed by 24.00% (158.05/657.94 ha) at 600-700 masl, 23.50% (154.41/657.94 ha) at 400-500 masl and 11.40% (74.93/657.94 ha) at an elevation of 700-800 masl. Distance-wise, high forest restoration occurred at 250-1250 followed by 5.90% (104.33/657.94 ha) at distance 250-500m, 13.60% (89.80/657.94 ha) at 500-750 m, 13.00% (85.60/657.94 ha) at 750-1000 m, and 10.5% (69.29/657.94 ha) at 1000-1250 m distances. 113

Underlying or (Indirect) Driving Forces Conceptual approaches for analyzing land-use change and identifying driving forces were to emphasize on national forest and land law, land tenure policies during the past 2 decades as external factors to dynamic of land-use change to local context. Institutions and Related Policies to Forest Restoration At the Sixth National Congress in December 1986, the Vietnamese Communist Party announced the adoption of movements towards a market-oriented economy, which is called Doi Moi (renovation). Vietnams economic transition was a relatively smooth period of structural adjustment and stabilization. Forest policies, other relevant policies, legislation agencies and policy enforcement bodies are major factors that influenced forest restoration in Vietnam and play an important role in the positive land-use change. These are the underlying driving forces of land-use change in mountainous regions of Northern Vietnam in general, and Ngoc Phai, the study site, in particular. Institutional framework. The organizational structure of Vietnams forest sector has four administrative levels: the central (national), provincial, district and commune levels. At present, Vietnam has 64 provinces and cities, about 600 districts and 10,000 communes. All administrative levels are under the control of the State. At the central level: The Ministry of Agricultural and Rural Development (MARD) is responsible for forest sector administration, including special-use and protection forest management. The Forestry Department and Forest Protection Department are MARDs agencies tasked with forest administration. MARD reflected at province level through a Department of Agriculture and Rural Development. Additional public service agencies involved in the forest sector are the Forest Inventory and Planning Institute (FIPI) and the Forest Science Institute of Vietnam (FSIV). The National Forestry University and the Forestry 114
Extension Division are attached to the Agriculture Extension Department. At the provincial level: The Peoples Committee is responsible for contracting households to manage forestland. There are two-forest administration agencies under the control of the Provincial Peoples Committee (PPC). The first of these is the Department of Agriculture and Rural Development (DARD), in which the Forestry Sub-Department operates as a specialized agency to assist the Director of DARD in forestry activities. At present, Vietnam has 34 Forestry SubDepartments with a total 530 employees. The second is the Forest Protection SubDepartment (FPsD), which serves to advise the province about forest protection. It can also enforce the Forest Protection and Development Law. Presently, there are 59 FPsD with a total of 1,300 employees. At the district level: The corresponding divisions are often combined with other technical units, the Economics Division on Agriculture and Rural Development is under the control of the District Peoples Committee (DPC) and employs one or two forestry staff responsible for monitoring forestry activities. A Forest Protection Unit (attached to FPsD) operates in a certain districts. Vietnam presently has 424 Forest Protection Units with a total of 3,500 employees. At the commune level: There is a Forestry Board under Peoples Committee and regulated by the Forest Protection and Development Law. However, because of budget constraints, most communes have so far failed to employ any commune forest staff. Where they operate, Forest Protection Units assign one forest ranger to work in one commune/commune group. At the hamlets level: This is under the jurisdiction of communes, but they are not a state administrative level. They function, however, as autonomous organizations, combining several communities in a single hamlet. Heads of hamlets are selected by the local people and are recognized by commune authorities. Hamlet heads act as peoples

representatives and contact persons for the commune authorities to communicate with local people. In some remote and isolated areas with ethnic minorities, heads of hamlets function together with village patriarchs who act as customary leaders. Extension services are part of the provincial and district agriculture extension agency. Since 1993, a network for extension service in agriculture and forestry has been established under the Provincial Department of Agriculture and Rural Development (an Extension Center) and the corresponding district units (an Extension Station). The basic administration structure is now in place at provincial and district levels, although at commune, village and hamlet levels, the system varies greatly in size and quality and structures are often typically composed of only five staff. Forest and other relevant policies (land reform after renovation policies 1986). The national context of change in Ngoc Phai commune has evolved greatly since 1986, Vietnam has transformed from subsidized mechanism to market driven or Doi Moi (renovation era). Changes in the national political economy impact local community in the study area through time and motivate a diversity of responses. After the first five years (1986-1990) of implementation of the Doi Moi (renovation) era, a series of policies and laws in the agricultural sector, especially concerning land-use, were issued. The most important policies were the Land Law (1993) and its revised versions (1998, 2001), the new Land Law (2003) and Ordinances 64/CP (1993) and 02/CP (1994) of the government dealing with the regulation of agricultural and forestry land allocation. There were also other policies that were directly related to land issues as well as supportive policies indirectly related to land issues. Forestland allocation. Decree No. 02/CP/ 01/1994 provided for the allocation of forestland to individuals and households. The main objectives of allocating forest land to
individuals and households are to involve individuals and households in the protection of the forest from fire, theft and environmental degradation and to promote the utilization of forest land and the greening of bare lands with trees by encouraging individuals and households to participate in afforestation for economic gains. A unique characteristic of the Vietnamese land tenure reform is the allocation of forestland to individual farmers. Forest lands and formerly forested areas was allocated to volunteer farm households on the basis of a 50 years lease under the condition that the beneficiaries engage in reforestation by means of tree planting and regeneration measures. However, the main recipients of forest allocation processes were still state organizations. The major part of individual households, which benefited from forest allocation, however, did not receive full management rights. Under current regulations, forestland was allocated in two different ways: (1) allocation of a land-use certificate (LUC) based on a management agreement (khe uoc) and (2) assignment of forestland based on a protection contract (hop dong). The latter does not allow extraction of firewood or wood for construction without applying to the forest owner represented by the state organization. Moreover, recipients of a protection contract are not allowed to construct a house on the contracted land, which restricts their customary use rights considerably. The beneficiary of a protection contract receives an annual protection fee of 50,000 VND per hectare (around 3 US$), which does not provide a strong incentive to take measures of regeneration. Thus, recipients are more likely to act as forest guardians. Result of allocation of forest causing positive forest expansion. In 1994, Decree No. 64 for agricultural land allocation and in 1994 Decree No. 02 for forestland allocation: The study site is one of 22 communes of Cho Don district, over a period of (1992-1997) 115

where the total area allocated to the commune was 1,581.54 ha. Of which, 663.28 ha were natural forest and 917.55 ha of nonforested status areas. Thus, survey result shows that land allocation program started in 1993 and ended in 1997. Most allocated land area was monitored and reallocated to local people due to lack of accuracy and weakness in allocation land at the beginning stage of the program. However, forestry on allocated land is not always a feasible entry point to support households in developing their farms and household economy. Apart from aspects like the access to a market for forest products, there are also other factors influencing the attractiveness of forestry. Soil fertility, size of the land as well as the overall configuration of forest land and allocated individual land influence the degree of difficulties in managing the forestland. Moreover, poor farmers are usually disadvantaged in the land allocation process itself. The argument being that these households had not enough resources (labour and capital) to develop allocated forestland. Besides, there were some areas in the commune where cutting down of trees by illegal loggers especially on unallocated area and some allocated plots far from their houses. Findings show that land and forest allocation to farmers is one of the decisive factors for the development of household economy in order to reduce pressure to forest resources. Until 1996 less than 30% of forestland had
been allocated in Ngoc Phai communes, and average forest allocated areas in the Cho Don district was 30%. After 1996, allocation number of households receiving forestland significantly increased. Many households received forestland two to three km away from their houses. Thus, they had to build a farmhouse in the forest in order to develop and protect their farms. In general, forest area allocated to farmers have been under good protection and management, and agricultural and forestry activities have been carried out on forestland. Especially, with the operation of extension service and credit scheme agroforestry farm based economy has been adopted among local farmers. For this reason, pressures on forest resources after land allocation program implementation in study area were greatly reduced. In sum, perception of local people shows that after receiving allocated land, 95% local people became enthusiastic about re-zoning the land in order to better exploit barren hill lands and establish forest tree plantations. In this case, forestland allocation not only inspired people to improve their household income, but also to overcome landlessness and poverty. After receiving land, residents had greater sense of ownership and channeled their resources into renovating production methods, seeking and investing in new technologies and more appropriate forest tree species, and enhancing productivity and quality of agroforestry products.
Table 4. Allocated forest area in the villages of Ngoc Phai commune, 19921997 VILLAGES Phieng Lieng 1 and 2 Ban Cuon 1 Ban Cuon 2 Coc Thu Na Tum Ban Om Ban Dieu Total TOTAL AREA (HA) 82.95 246.89 89.05 46.50 242.24 308.93 564.98 1581.54 ALLOCATED FOREST AREA (HA) NON-FOROSTED NATURAL FOREST AREA 17.53 64.71 172.09 74.80 34.92 54.13 27.57 18.93 110.47 131.77 174.90 134.03 125.80 439.18 663.28 917.55
Source: Forest Governance & Protection Department of Bac Kan Province
116

Impacts on slash-and-burn practice and non-optimal exploitation of forest products. Majority (95%) of the households covered by the interviews said that deforestation, slashand-burn cultivation no longer exists on the allocated forest land because most of the forest land has been already managed. In 1996, forest land allocation, forest law dissemination, sloping agricultural land technology (SALT) training, afforestation, fruit tree planting have been supported. Illegal logging and collection of fuel wood have reduced considerably, but the problem still exists in some other unallocated forestlands. The local people notice that the forest cover area has increased rapidly. Impacts on forest plantation and enrichment, and forest protection. The land allocation activities have an impact on the afforestation with high value tree species such as cinnamon, chukrasia, manglietia. These tree species grow rapidly and can adapt to climate and land conditions. Of the total households applying for loans, 48% used loans for planting forest and fruit trees. It is noted from the interviews that 50% of the households invested in planting forest and fruit trees and establishing farms. The farmers have utilized 50-60% of loans to nursery establishment and purchase of seedlings, 3040% to livestock to 10% to other activities. Findings of this study in agreement with study of program impact assessment by Dang Kim Vui and Le Tien Phong (1998). The survey showed that 263 households used loans for forest establishment, representing 70% of the total loan takers, 62% invested in forest enrichment, making up 16.5% of the overall loan-taking households, while the 179 households took credit to plant fruit trees. The farmers foresee that afforestation, and forest enrichment will intensify in the coming years, for many households are now preparing seedlings, and digging ditches. Impacts on the management and protection of unallocated forests and forestland. Majority (90%) of interviewed households said that collecting firewood, logging, and
uncontrolled grazing are common activities in unallocated forests. It is said that there is increasing pressure on unallocated forests as well as on the protection and management of allocated forests due to the provision of credit, which makes it possible for some farmers to buy more cows and buffaloes. Unallocated forests and forestland are normally those located on Limestone Mountains with very steep slope and far from residential areas. So far no management solution has been found for these forests and forestland. Impacts on households income. The interviews indicated that 28% of loan-taking households have obtained incomes principally from raising pork, breeding pig, fish, and eggoriented chicken. The income from these activities averages 24% of one households total annual income. Ngoc Phai communes households saw a slight increase in income from taking loans, used mainly for animal raising. In communes, the households could foresee a vigorous increase in future income, mainly from fruit tree, special tree, and forest tree planting. The income from such other activities as the processing of agriculture and forest products was said to be also going up but at slower speed. The farmers showed great confidence in household economy development through development of farm-level development of high economic tree species. Some 67% of interview respondents said their major incomes came from fruit, and forest trees. This is an evidence showed that the land allocation, though operating for a short time 1992-1997, contributed to households improved incomes. Five million hectares reforestation program (5MHRP) 1998-2010. Decision No. 661/QDTT dated 29 July 1998, the Tenth National Assembly of Vietnam approved a new National Forestry Program, which seeks to reforest and rehabilitate five million hectares of forest land. The 5MHRP was carried out from 1998-2005 (first phase) and 2005-2010 for (second phase), such that by 2010 the total 117

forest area of the country will reach 14.3 million hectares (equivalent to 43 percent forest cover). The five million ha is derived from the calculation that this would restore forest cover to its 1943 level. In line with this ambitious target, the GOV and donors agreed to develop a partnership to support the Five Million-hectare Reforestation Program (5MHFP). The 5MHRP showed the Governments Commitment and priority given to forestry sector and responds to the Rio Declaration and Agenda 21 that emerged from the 1992 United Conference on Environment and Development. The 5MHRP is designed to achieve the objectives, set by the Resolution 08 and the Decision 661, which are very broad and have extensive cross-sectoral implications. The 5MHRP can be regarded as the latest in a series of government efforts to promote reforestation. Forest land contracts and plantation. As stated in Decision No. 187, State Forest Enterprises (SFEs) are required to allocate and contract forestland under their control to third parties for long-term use or protection, in accordance with Decree No.01 CP. In return, these third parties are entitled to specify benefits from the main forest products. With Decree No.200 (2004), it was decided that forestry companies could select the most efficient forest and forestland contracts in accordance with the existing regulations. In practice, forestland allocated under long-term contracts accounts for only 31.2% of the land under control of the SFEs, while 53.69% has already been given out under annual contracts. The remaining area has been contracted out on periodical and work volume bases. In the case of protection forest, priority is given to contracting households; especially those that are part of a resettlement group, poor, or live adjacent to forests. When accepting a forest protection contract, households sign annual contracts with their respective District Forest Protection Unit, a Program 661 Management Board or an SFE. Payment is per ha of land under contract. 118
Regulations set the payment amount for the protection of one ha of contracted forest at 50,000 VND/year in 2005 (about USD 3), an amount widely considered to be too low. Per ha payments made under plantation contracts, however, are much higher. Sikor and Truong (2001) recorded such payments during the second half of the 1990s at 1.7 million VND but contracted households spent about VND 700,000 to buy seedlings. Final payment depends on the number of surviving trees after one year. During the initial years, people can plant alternative crops together with the tree seedlings. Nguyen (2001) estimated that the VND 1.7 million payments only accounted for 60% of the total expenses of about USD 300/ha. Reports suggested that tree plantation contracts are gaining popularity across country. Survey result shows that a total of forest plantation areas of commune were 70.22 ha in 1990, 120.07 ha in 1995, 142.89 ha in 1998 and 192.79 ha in 2005. 11.8 ha forests were planted for pulp materials, accounted for 2,950 trees with 68 participated households. And continue to investigate forests under project 661 having 682 ha and 119 participated households for manage and protection of forest through forest contacts. Enriched forest with 46.23 ha, protected 582.312 ha, harvested 250 tons of toothpick materials and other wood 150 m3. Land Law of 1993. A new Land Law was enacted in July 1993, which became effective October 14, 1993. The new law provides for the allocation of land to organizations, individuals and households for long-term and stable use. The period of land allocation is 20 years for annual crops and 50 years for other perennial crops and forestry. The tenure can be renewed on expiry, if the land-users need to do so and if they have used the land properly according to law. All land-users will be given land-use right certificates (LURCs). In addition, Decree No. 64, which the Communist Party (CP) issued in September 1993, and Decree No. 02 (issued on 15

January 1994) have provided measures for regulating the allocation of agricultural land and forestland respectively. The government passed an ordinance on 15 March 1994 for the regulation of land-use above specified ceilings. All these measures are intended to create a land tenure system that will be conducive for sustainable agricultural and rural development. The Land Law of 1993, a comprehensive land administration law, states that land belongs to the people, with the State as its sole administrator, reserving the right to allocate land and determine its usage. Every commune is required to keep up to 5 percent of its agricultural land for welfare or public benefit. The State maintains the land-use classification system, which determines landuse, which helps to preserve scarce agricultural land. The State also determines the value of land for purposes of taxes and compensation. The Land Law clarifies the rights of people to use and transfer real property and assets, based on certificates issued by local government. Families and individuals who have been allocated land have the right to exchange their land, transfer the use rights to others, rent the land for a period of three years, bequeath it or use it as collateral. Use rights are generally renewed after 20 or 50-year periods. These provisions effectively required the state administration to allocate all land to specific owners and, with the granting of the land-use certificate (LUC), to transfer responsibility for land management to individual households, groups, organisations and institutions. This policy thus implied a substantial disengagement of the State from the task of managing the countrys land and forest resources. At the same time, the State is assuming the responsibility to carry out the required land administration procedures and to provide assistance to the land-users with regard to proper land management and protection. Land policies that distribute land to individuals and assign LUR (i.e., some degree
of private property rights) allow the development of land markets that can bring about an efficient allocation of resources, given certain conditions. Because welldefined and enforceable private property rights are one of these necessary conditions, efficient allocation of resources depends on the nature of prevailing property rights (Perman et al 1999). In 1998, the government announced amendments to the Land Law, which divided land into six categories: forest land, agricultural land, rural residential land, urban land, special land and unused land. Forestland was divided into forested land and nonforested land planned for reforestation. The 1998 Land Law makes a distinction between "plantation forest" and "natural forest" (MARD, 2001). The 1998 Land Law amendment allows organizations, but not individuals, to use the value of timber growing on allocated forest land for mortgages. Organizations can also use the land as capital contribution for forestry joint venture projects. The land tenure right. The Land Law in 1993 confirmed the 1991 Law on the Protection and Development of Forests on the transfer of responsibilities for land from the State and collective organizations to nonstate/collective entities. The State retained regulatory and monitoring functions. As part of its revised land-used policies, the GOV has adopted a system of land-use planning and land-use certificates for both agricultural and forest land. Individuals, cooperatives, stateowned enterprises (SOEs) including state forest enterprises (SFEs) and other entities can obtain either provisional or permanent land-use certificates, respectively called green books and red books. Some land that was previously managed by cooperatives and SOEs is being reallocated to individual households. Land-use certificates can be issued for 20 years for annual crops (agricultural land) and 50 years for perennial crops (forest land). As of 1999, land-use rights had been allocated for almost 86 percent of agricultural land but relatively little forestland (9.8 percent) (MARD, 2001). 119

In the study site, land-use certificates were granted to households with a total of 31.66 ha and 440.00 land-use certificates (LUC). (Table 5). On this LUC showed that state allocated rights of land-use to households with permanent use on residential and garden land. Financial aids in forestry development. Since Vietnam has implemented to transform from a subsidized central mechanism to a market economy, there were a lot of financial aids from donors in order to shift in forest and agricultural development. Under resettlement program 1990-1996. Ngoc Phai commune was granted 448,270,000VND. Of which, the grant money was 408,570,000VND and 39,700,000VND granted without interest fee, with supporting purposes of producing activity 195,170,000VND, 210,820,000VND for infrastructure construction, 42,000,000VND for local people support and 0,28 million VND for administration fees. (Report of General Project of Resettlement and New Economics Zone Development, 1998-2010, Cho Don, 1998). Under the Vietnam-Finland forestry sector cooperation program, 1997. There were 243/376 households received 417,547,500 VND credit (average 1,718,320 million VND per household) in order carry out planned activities in allocated forestland. Most farmers have been able to pay the interests without major problem, and some farmers have already started to pay back the loan, even before the maturity. The farmers have
utilized 50-60% of loans to nursery establishment and purchase of seedlings, 3040% to livestock to 10% to other activities (Technical Report No. 15, Department of Agriculture and Rural Development of Bac Kan Province). Vietnam Bank for the Poor (VBP). The volume of the Vietnam Bank for Poor (VBP) loans on 31 December 1996 was 395 million VND, of which loans for the poor was 195 million VND. Number of borrowers was 197. The outstanding loan for the poor was 29.5 million VND in Na Tum village and 6.5 million VND in Coc Thu village. Program VIE-508 of CIDSE. In Ngoc Phai commune, Na Tum village, the outstanding loan in 1996 was 3.5 million VND for 13 households of the total number of 56 households in the village. The Vietnam - France program. The outstanding loan of Ngoc Phai commune was VND 18 million in 1996. The credit scheme of the Program aimed at making the farmers to see investments in the forest area as a profitable alternative for upland forest harvesting or conversion of forestland to agricultural land. The possible investment included various production alternatives: from more or less traditional timber growing to agro-forestry (silvo-pastoral and apicultural activities and production of non-wood forest products (NWFP) as well as integration of fruit and spice producing tree. The right to use forestland has been recently given to households.
Table 5. Number of land-use certificates (red book) and its distribution in Ngoc Phai villages, 2001-2004 VILLAGES Phieng Lieng 1 Phieng Lieng 2 Ban Cuon 1 Ban Cuon 2 Coc Thu Na Tum Ban Om Ban Dieu Total ALLOCATED AREA (HA) 3.27 2.13 5.29 4.08 3.71 5.75 2.84 4.58 31.66 NUMBER OF LAND-USE CERTIFICATE (SHEET) 36 43 68 55 43 72 51 72 440
Source: Peoples committee of Ngoc Phai Commune
120

The households perceived the need to afforest, conserve and enrich the given forest land, in order to earn income from it. As a result, the demand for forestry financing is increasing. In summary, the supply of financing for forest sector development has not met the demand. The support from the government budget is mainly aimed at improving the dilapidated infrastructure. Subsidized credit from the VBP has been provided mainly for solving poverty problems. Self-accumulated capital is limited in the district. There are only few households who have invested in the use of forestlands, mainly by planting fruit trees (orange, mandarin, apricot), pineapple or special trees (cinnamon, anise). CONCLUSIONS This study sought to determine the Driving Forces of Forest Land-Use Change during Doi Moi (renovation) era in Ngoc Phai commune, Cho Don District, Bac Kan Province, Vietnam (1990-2005). Macrodrivers or (proximate causes). These include the wood extraction and slash-andburn practices, cattle ranching, and shift in agricultural expansion. Microdrivers or the (underlying causes). These consist of the indirect factors that affect forestland-use change such as Land Allocation Program 1992-1997, Five Million Hectare Forest Restoration 1998-2010, Land Law 1993, Financial Aids in Forest Development, and Market conditions, biophysical, demography. Overall, the study found the following: - Change in policies and market conditions are the major factors that could explain the rapid changes in forest land-use in Ngoc Phai. - The institutional and market driving forces have not only led to rapid deforestation (forest conversion) due to the expansion of agricultural but have affected the communes cropping pattern. - National policies are active promoters of forest land allocation to individuals, households, communes and other economic organizations. These affect the improvement forest and land management, give local people a better land-use right and ensure protection of forest resources.
- The most positive environmental impact is the reduction of the slash-andburn activities. Forest plantations and sustainable agroforestry systems with high productivity and soil conservation ability have been established in exchange. - The areas covered by new plantation have increased as a result of forest enrichment and restoration activities. - Land-use certificates were granted to most of individuals and households who qualified with the necessary conditions for granting land-use right. - Grazing posed a big problem to the production activities in the local area. Farmers released buffaloes and cows and completely destroyed their farms. - Timber cutting in unallocated areas remained and farmers refused to receive remote forest areas. Slash-and-burn practices still continue in some places which in the long run, degrade the forests. REFERENCES
[1.] CASTELLA, J. C. and D.Q. DANG (2002) Doi Moi in the mountains. Land use changes and farmers livelihood strategies in Bac Kan Province, Vietnam, The Agricultural Publishing House, Vietnam. 4771. [2.] CASTELLA, J. C, P. H. MANH, S. P. KAM, L.VILLANO, and N. R. TRONCHEA (2005) Analysis of village accessibility and its impact on land use dynamics in a mountainous province of Northern Vietnam. Applied Geography 25 (2005) 308326. [3.] Dam Viet Bac (2007). Forest land-use change in Ngoc Phai commune, Cho Don district, Bac Kan province, Vietnam (1990-2005), Msc. thesis, UPLP Phillipine. [4.] SIKOR, T. (2001) The allocation of forestry land in Vietnam: did it cause the expansion of forests in the Northwest. Journal of Forest Policy and Economics 2 (2001) 1-11. [5.] SIKOR, T. and D. M. TRUONG (2002) Agricultural policy and land use changes in Black Thai villages of Northern Vietnam, 1952-1997, in: Mountain Research and Development, 22 (2002) 248-255. [6.] DANG, K. VUI and L. T. PHONG. 1998. Programme's impact assessment. Technical Report No. 15.
121

TM TT
CC NHN T NH HNG N BIN NG S DNG T TI X NGC PHI, HUYN CH N, TNH BC KN, VIT NAM (1990-2005)
m Vit Bc, m Xun Vn* Trng i hc Nng Lm - Thi Nguyn Nghin cu c tin hnh ti x Ngc Phi, huyn Ch n, tnh Bc Kn, Vit Nam. Mc tiu ca nghin cu l xc nh cc nhn t nh hng chnh n s bin ng s dng t trong 15 nm qua (1990-2005) ca thi k i mi khu vc min ni pha Bc Vit Nam. Cc nhn t nh hng trc tip n s thay i s dng t bao gm khai thc g v pht ry lm nng, du canh, chn th gia sc, cc yu t nhn khu hc, cc yu t sinh hc (t thoi ha) v cc yu t vt l ( dc, cao v khong cch t v tr ca cc loi t thay i n ng chnh). Ngc li, nhn t gin tip ca s bin ng s dng t bao gm chng trnh giao t 19921997, chng trnh nm triu ha phc hi rng 1998-2010, Lut t ai nm 1993, tn dng v ti tr trong pht trin lm nghip. Trong giai on u (1990-1998), vic thc hin cc chng trnh giao t rng pht trin trong khu vc nghin cu. Tuy nhin, t l ph rng cao xy ra ti cc khu vc cha giao t rng. Trong giai on th hai (1998-2005), sau khi thc hin chng trnh giao t, nh hng th trng v thay i cng ngh to ra hiu ng khc nhau trn c hai l c c s phc hi din tch rng v mt i ca cc khu vc rng. Thi k ny nh du mt s chuyn bin mnh kinh t v hot ng sn xut nng nghip v h tr t chng trnh ca chnh ph. Tuy nhin, bo v v qun l rng dng nh t hiu qu hn so vi thi k u tin, trong qu trnh thc hin giao t. T kho: Cc nhn t, bin ng s dng t, khu vc min ni, min Bc Vit Nam
122

Nguyn Kim Lng Tp ch KHOA HC & CNG NGH 77(01): 123 - 130
NH GI HIU QU IU TR CA SIMVASTATIN BNH NHN I THO NG TYP2 C KHNG INSULIN

Nguyn Kim Lng*
Bnh vin a khoa T Thi Nguyn
TM TT
Mc ch nghin cu: nh gi hiu qu iu tr ca simvastatin bnh nhn i tho ng typ2 c khng insulin. i tng v phng php: 185 i tng nghin cu gm: Nhm i tho ng gm 145 bnh nhn, nhm chng gm 40 ngi khng i tho ng. nh gi tnh trng khng insulin bng ch s HOMA-IR (HOMA-IR=I0(u/ml)x G0(mmol/l)/22,5) Sau khi xc nh c 107 ngi i tho ng c khng insulin, a ngu nhin vo 2 nhm: nhm c dng Sulfonylurea n thun v nhm dng sulfonylurea kt hp vi simvastatin. nh gi hiu qu ca simvastatin thng qua cc ch s gluccose, HbA1c, lipid trc v sau 2 thng iu tr. Kt qu: Nhm dng simvastatin c cc thnh phn lipid mu trung bnh v t l trong gii hn bnh l ca cc ch s: cholesterol, triglyceride, LDL-C thp hn, HDL-C cao hn, hiu qu ca kim sot glucose mu mc tt hn nhm khng dng simvastatin: glucose, HbA1c, insulin, ch s khng insulin gim, tng t l kim sot glucose mu tt v gim t l kim sot glucose mu km, vi p < 0,05. Kt lun: iu tr kt hp simvastatin cho bnh nhn i tho ng typ2 c khng insulin s lm tng hiu qu kim sot lipid v glucose mu. T kho: i tho ng typ2, khng insulin, ch s HOMA IR, simvastatin
T VN * i tho ng typ 2 c qu trnh din bin phc tp s thiu ht insulin v khng insulin gy ra nhiu kh khn cho vic theo di, iu tr. Khng insulin c mi lin quan vi nhng yu t nguy c nh: bo ph, ri lon lipid mu tng huyt p to ra mt vng xon bnh l lm cho s tin trin ca bnh i tho ng typ 2 ngy cng phc tp. iu tr i tho ng typ 2, ngoi vic iu tr thuc gim ng mu cn phi iu tr phi hp cc yu t nguy c i km trong c bit l gim triglycerid, gim LDL C, tng HDL C th mi mang li hiu qu cao, p ng nhu cu chm sc sc kho cho ngi bnh. Simvastatin l mt thuc iu tr ri lon lipid mu, thuc c ch nh lm gim tng hp LDL, gim cholesterol, gim triglycerid t gim nguy c bin chng bnh tim mch bnh nhn i tho ng typ 2. MC TIU NGHIN CU nh gi hiu qu iu tr ri lon chuyn ho lipid bng simvastatin bnh nhn i tho ng typ2 c khng insulin.
*
I TNG V PHNG PHP NGHIN CU i tng nghin cu * Nhm bnh: bnh nhn i tho ng typ 2 ln u hoc ang c theo di nh k iu tr bng thuc ung h ng mu, theo tiu chun chn on v phn typ T ca ADA (American Diabetes Association) nm 1997 v c WHO cng nhn nm 1998. * Nhm chng Gm 40 ngi kho mnh khng b mc bnh T, tui > 40 tnh nguyn tham gia nghin cu nh gi tnh trng khng Insulin nhm nghin cu. nh gi tnh trng khng insulin bng ch s HOMA-IR = I0 (u/ml)x G0(mmol/l)/22,5. Theo khuyn co ca t chc Th Gii khng insulin c xc nh khi ch s HOMA-IR ln hn t phn v cao nht trong nhm chng. * Chn bnh nhn T typ 2 c khng insulin ngu nhin vo 2 nhm: Nhm 1: iu tr Sulfonylurea (nhm khng simvastatin). 123
Tel: 0982852165; Email:drluongtn@yahoo.com.vn

Nguyn Kim Lng Tp ch KHOA HC & CNG NGH 77(01): 123 130
Nhm 2: iu tr Sulfonylurea kt hp Simvastatin (nhm simvastatin). Tt c bnh nhn ny khng dng thuc iu tr gim lipid mu trc mt thng. Thi gian v a im nghin cu - Thi gian tin hnh nghin cu: t 3/2010 n 10/2010. - a im: Khoa khm bnh bnh vin a khoa Trung ng Thi Nguyn. X l theo phng php thng s y sinh hc bng phn mm SPSS 13.0 KT QU NGHIN CU Qua nghin cu 185 i tng: Nhm i tho ng gm 145 bnh nhn, nhm chng gm 40 ngi, chng ti thu c kt qu c th hin trn bng 1.
Tnh trng khng insulin bnh nhn i tho ng tp 2. Ch s HOMA-IR c tnh theo cng thc ca Matthews nm 1985. Theo WHO gi l c khng insulin nu ch s HOMA-IR ln hn t phn v cao nht ca nhm chng (HOMA-IR nhm chng c sp xp theo th t t thp n cao tng ng vi gi tr th (0,75n+1). Theo kt qu nghin cu ca chng ti t phn v cao nht ca nhm chng l 1,48. Nh vy chng ti ly ch s HOMAIR t mc 1,48 c gi l c khng insulin kt qu th hin trn bng 2 v bng 3. Mt s thay i bnh nhn T typ2 c khng insulin sau iu tr bng simvastatin 107 bnh nhn T typ2 c khng insulin chng ti chn ngu nhin vo 2 nhm iu tr, mt nhm dng simvastatin 54 ngi, mt nhm khng dng simvastatin 53 ngi kt qu thu c th hin trn bng 4, 5, 6, 7, 8, 9.
Nhm Bnh 59,26,4 1,650,05 61,86,5 62 (41,7%) 83 (57,3%) 145 (100) > 0,05
Bng 1. c im tui, gii, chiu cao, cn nng gia hai nhm c im Tui Chiu cao Cn nng Gii Tng Nam N Nhm chng 58,88,1 1,660,06 62,55,3 17 (42,5,0%) 23 (57,5%) 40 (100) p > 0,05 > 0,05 > 0,05
* Nhn xt: Khng c s khc bit gia 2 nhm v tui, chiu cao, cn nng v gii tnh Bng 2. T l khng insulin, ch HOMA-IR trung bnh hai nhm Nhm Ch s HOMA-IR 1,48 HOMA-IR 1,48 HOMA-IR ( X Nhm chng (n=40) n 10 30 1,321,60 % 25 75 Nhm bnh (n=145) n 107 38 2,721,71 % 73,8 26,2 P
SD )
< 0,05 < 0,05
* Nhn xt: c 73,8% bnh nhn T trong nhm nghin cu c tnh trng khng insulin. Bng 3. Nng glucose, insulin nhm T c khng insulin v T khng khng insulin Thng s Glucose (mmol/l) T khng khng insulin (n=38) 5,071,47 5,381,57 T c khng insulin (n=107) 6,451,69 12,672,95 P < 0,05 < 0,05
X SD
Insulin (U/ml)
X SD
* Nhn xt: Nng glucose, insulin mu nhm T c khng insulin cao hn hn so vi nhm T khng khng insulin. S khc bit c ngha thng k vi p<0,05.
124

Bng 4. So snh tui i, thi gian pht hin bnh(TGPHB), ch s BMI, vng bng/ vng mng, HA, glucose mu, HbA1c gia hai nhm Ch s nghin cu Tui (nm) BMI (kg/m2) VB/VM HATT (mmHg) HATTr (mmHg) Glucose (mmol) HbA1c TGPHB <1nm 1-5 nm >5nm Simvastatin (n=54) 59,40,9 24,31,4 0,890,1 139,4410,80 88,371,52 6,572,07 7,231,12 2 (3,7%) 47 (87%) 4 (7,4%) Khng simvastatin (n=53) 58,11,0 23,91,4 0,880,1 138,499,14 89,451,54 6,431,17 7,151,12 1 (1,8%) 48 (90,5%) 5 (9,4%) P > 0,05 > 0,05 > 0,05 > 0,05 > 0,05 > 0,05 > 0,05 > 0,05
* Nhn xt: Khng c s khc bit v tui i, thi gian pht hin bnh, ch s BMI, VB/VM, HA trung bnh, glucose, insulin mu gia hai nhm. Bng 5. Nng glucose, t l HbA1c trung bnh trc v sau iu tr Ch s Glucose (mmol/L) HbA1C (%) Simvastatin (n = 54) Trc T Sau T(a) 6,572,07 7,231,12 5,851,15 6,700,13 P < 0,05 < 0,05 Khng simvastatin (n = 53) Trc T Sau T(b) P 6,431,17 7,151,12 6,071,28 7,020,95 > 0,05 > 0,05 P(a,b) < 0,05 < 0,05
* Nhn xt: Nhm dng simvastatinc nng glucose mu, HbA1c sau iu tr gim c ngha thng k so vi trc iu tr. Nng glucose mu, HbA1c sau iu tr nhm dng simvastatin thp hn so vi nhm khng dng simvastatin, vi p< 0,05. Bng 6. Ch s lipid mu trung bnh trc v sau iu tr Ch s Triglycerid Cholesterol HDL-C LDL-C TrcT 3,500,26 5,020,15 1,220,12 3,130,01 Simvastatin (n=54) SauT(a) 2,200,17 4,520,16 1,290,05 2,460,10 Khng Simvastatin (n=53) TrcT SauT(b) 2,650,20 2,820,27 4,810,14 5,070,13 1,090,03 1,130,03 2,990,12 3,020,12 P(ab) P > 0,05 > 0,05 > 0,05 > 0,05 < 0,05 < 0,05 < 0,05 < 0,05
P < 0,05 < 0,05 < 0,05 < 0,05
* Nhn xt: Nhm dng simvastatin: ch s lipid mu trung bnh (triglycrid, cholesterol, LDL-C) sau iu tr gim c ngha thng k so vi trc iu tr. Nhm dng simvastatin nng lipid mu gim so vi nhm khng dng simvastatin, vi p < 0,05. Bng 7. T l ri lon lipid mu trc v sau iu tr
Ch s Lipid bnh l (mmol/l)
Simvastatin(n=54) Trc T n % n % n % n % 30 55,5 28 51,8 15 27,7 22 40,7 Sau T (a) 13 24,0 11 20,3 11 20,3 7 12,9 P <0,05 <0,05 >0,05 <0,05
Khng Simvastatin (n=53) Trc T 28 52,8 17 32,0 14 26,4 16 30,1 Sau T (b) 25 47,1 19 35,8 11 20,7 15 28,3 P >0,05 >0,05 >0,05 >0,05 P(ab) <0,05 <0,05 >0,05 <0,05
Triglycerid ( 2,3) Cholesterol ( 5,2 ) HDL-C ( 0,9) LDL-C ( 3,1 )
* Nhn xt: T l ri lon cc thnh phn lipid mu (triglyceride, cholesterol, LDL-C) nhm c dng simvastatin gim r rt so vi nhm khng dng simvastatin. S khc bit c ngha thng k vi p<0,05.
125

Bng 8. Nng insulin mu, ch s khng insulin trc v sau iu tr Simvastatin (n=54) Ch s Insulin HOMA-IR HOMA n -IR % (1,48) Trc T 12,486,77 3,581,36 54 100 SauT(a) 5,223,82 1,451,25 36 66,6 P <0,05 <0,05 <0,05 Khng Simvastatin (n=53) Trc T 12,834,90 3,261,52 53 100 Sau T(b) 11,367,88 3,071,99 42 79,2 P >0,05 >0,05 <0,05 P(a,b) <0,05 <0,05 <0,05
* Nhn xt: Nhm dng simvastatin: insulin v ch s khng insulin theo HOMA-IR sau iu tr gim so vi trc iu tr vi p< 0,05. S ngi khng insulin sau iu tr l 36 ngi (66,6%) so vi trc iu tr 54 ngi(100%), vi p<0,05. Bng 9. Nng glucose mu, t l HbA1c trc v sau iu tr Ch s Glucose Tt Trung bnh km Tt Trung bnh km Simvastatin (n = 54) Khng simvastatin (n = 53) Trc T Sau T(a) p Trc T Sau T(b) p 25(46,3) 36(66,6) <0,05 26(49,0) 30(56,6) >0,05 11(29,4) 10(18,6) >0,05 11(20,7) 11(20,7) >0,05 18(33,3) 8(14,8) <0,05 16(30,1) 14(22,6) >0,05 12(22,2) 25(46,3) <0,05 22(41,5) 16(30,1) >0,05 18(33,4) 15(27,8) >0,05 11(20,7) 24(45,2) <0,05 24(44,4) 14(25,9) <0,05 20(37,7) 13(24,5) <0,05 P(a,b) <0,05 >0,05 <0,05 <0,05 <0,05 >0,05
HbA1c
* Nhn xt: - Nhm c iu tr kt hp simvastatin c t l kim sot tt sau iu tr cao hn cao hn so vi trc iu tr c v glucose v HbA1c v t l glucose v HbA1c mc kim sot km sau iu tr nh hn so vi trc iu tr, vi p< 0,05. - Nhm khng dng simvastatin: khng thy s khc bit v t l kim sot tt v km trc v sau iu tr, vi p> 0,05. Bng 10. Nng creatinin, SGOT, SGPT, tiu cu trung bnh trc v sau iu tr Ch s Creatinin SGOT SGOP Tiu cu Simvastatin (n=54) Trc T Sau T 75,5910,56 72,8416,69 27,758,12 27,448,04 30,8711,63 30,3111,54 325,3029,08 321,43`30,19 P >0,05 >0,05 >0,05 >0,05 Khng Simvastatin (n=53) Trc T Sau T P 75,5910,44 72,8412,26 >0,05 27,467,04 28,6210,15 >0,05 32,2911,90 33,9512,60 >0,05 317,3624,85 316,0723,75 >0,05
* Nhn xt: Khng c s khc bit v nng trung bnh creatinin, SGOT, SGPT, tiu cu trc v sau iu tr gia hai nhm, vi p>0,05.
BN LUN Tnh trng khng insulin bnh nhn i tho ng. Khng insulin hin nay c coi l mt c ch bnh sinh quan trng ca tnh trng ri lon dung np glucose v i tho ng, khng insulin cng lin quan cht ch vi cc yu t nguy c khc nh bo ph, tng HA, T. Nhiu cng trnh nghin cu u cho rng khng insulin l yu t nguy c ca bnh T v khng insulin thng c trc T 126
5- 10 nm. Pht hin sm tnh trng khng insulin v ci thin nhy ca insulin c th lm chm cng nh lm gim nguy c T typ 2 v cc bin chng. nh gi khng insulin c rt nhiu phng php v ch s nh gi khng insulin. Phng php c coi l chnh xc nht hay tiu chun vng l phng php kp glucose. Nhng phng php ny rt phc tp phi ly mu nhiu ln (30ln/3gi). Rt kh thc hin nn t c p dng trong nghin cu thc hnh lm sng.

Hin nay phng php nh gi ni sinh (HOMA- Homeostasis Model Assessment) l phng php c ph bin rng ri nht c Matthews xut nm 1985 v WHO cng nhn nm 1995. y l phng php n gin, d thc hin v kh chnh xc khi so snh vi phng php kpglucose. Nhiu cng trnh nghin cu cho rng: tng nng insulin lc i, tng ch s HOMAIR ng thi gim pha tit sm ca insulin l yu t d bo cho s pht trin ca bnh nhn T. Nghin cu ca Heinz Drexel cho thy ch s HOMA-IR tng cao r rt nhm bnh T typ 2 l 5,623,79 v cao hn nhiu so nhm chng 1,741,12. Kt qu nghin cu ca chng t nhm chng l nhng ngi kho mnh khng mc bnh T, chng ti xc nh gi tr ct ca HOMA-IR (t phn v nhm chng) l 1,48. Ch s khng insulin HOMA-IR nhm bnh 2,721,17, cao hn nhm chng 1,321,60 s khc bit c ngha thng k vi p< 0,05. T l khng insulin theo ch s HOMA-IR nhm bnh T l 107 ngi chim 73,8%. T l khng insulin trong nhm nghin cu ca chng ti cao hn nghin cu ca Nguyn c Hoan, t l khng insulin theo HOMA-IR l 46,8%. S khc bit ny do i tng nghin cu ca chng ti l bnh nhn T cn i tng nghin cu ca Nguyn c Hoan l nhng bnh nhn c ri lon dung np glucose. Mt s thay i sau iu tr bng Simvastatin bnh nhn i tho ng typ2 c khng insulin. T typ 2 gy nhiu tc hi trc tip n sc kho, tnh mng ngi bnh. Nguyn nhn dn n s nguy hi ny khng ch l do tng mc glucose mu m cn do phc hp cc ri lon chuyn ho khc tham gia vo qu trnh tin trin ca bnh, c bit l ri lon chuyn ho lipid. Simvastatin l mt thuc gim lipid mu thuc c tc dng hot ho men HGM CoA reductase lm gim tng hp choleseterol trong t bo gan v tng hot ho th th LDL do lm gim LDL C ti 60% v gim Triglycerid ti 37%. Simvastatin c tc dng tng thu nhn LDL lm gim LDL huyt
tng v gim cholesterol. c nhiu cng trnh nghin cu chng minh c cc simvastatin c th lm gim t l t vong bnh nhn b bnh mch vnh c tng lipid mu, gim t l phi can thip bnh nhn sau can thip ng mch vnh hoc m cu ni ch vnh. Nghin cu ca chng ti gm107 bnh T typ2 c khng insulin c chia ngu nhin thnh 2 nhm: nhm dng simvastatin 54 bnh nhn, nhm khng dng simvastatin 53 bnh nhn. Trc iu tr gia hai nhm khng c s khc bit v cc ch s nghin cu: tui i, thi gian pht hin bnh, ch s BMI, VB/VM, HA, glucose, HbA1c, t l ri lon lipid chung tng i cao chim (79,3%). Kt qu iu tr nhm dng simvastatin cho thy: Cholesterol tng trc iu tr 51,8% bnh nhn, sau iu tr cn 20,3% bnh nhn. Triglycerid tng trc iu tr 55,5%, sau iu tr cn 24,0%. LDL-C tng trc iu tr 40,7%, sau iu tr cn 12,9%. HDL-C gim trc iu tr 27,7%, sau iu tr cn 12,7% s khc bit c ngha thng k vi p< 0,05. T l cc thnh phn lipid trung bnh so snh trc v sau iu tr nhm dng simvastatin cng c ci thin r rt. nhm khng dng simvastatin khng c s thay i v t l ri lon lipid mu trc v sau iu tr vi p> 0,05. Kt qu nghin cu ca chng ti cng tng t nh mt s nghin cu khc nh: Nghin cu ca 4S (Scandinavian Simvastatin survival study) trn 4444 bnh nhn dng simvastatin so vi placebo theo di 5,4 nm thy thuc lm gim triglycerid 25%, LDL-C 39%, cholesterol 10%, tng HDL-C 8%. Nghin cu Mass (Mullicenter Anti- Atheroma Study) iu tr simvastatin 10mg/ngy lm gim triglycerid 23%. LDL-C 31%, tng HDL-C 9%. Li ch iu tr ri lon lipid mu ca simvastatin: gim s lng phn t LDL-C oxy ho, gim lipid trong mng va x, gim kh nng nt lot mng va x, hn ch s tng v lm thoi trin mng va x, phc hi chc nng ni bo, c ch kt tp tiu cu, gim nguy c ng mu. Nghin cu bo v tim HPS (Heart Protection Study) trn 20.000 bnh nhn cho thy: simvastatin 40mg lm 127

gim nguy c bnh tim mch trn 1/3 bnh nhn T c bnh tim mch, lm gim nguy c c nhi mu c tim v t qu trn bnh nhn T. Simvastatin kim sot ci thin mc nguy c chung 21% trn bnh nhn T c lp vi kim sot glucose mu. Simvastatin lm gim nguy c bnh tim mch c hay khng c tng cholesterol. V vy bn cnh vic kim sot tt glucose mu bnh nhn T typ 2 iu tr ri lon lipid mu, gim khng insulin l mt mc tiu quan trng nhm khng ch, ngn nga bin chng ca bnh ny. Sau 2 thng iu tr chng ti nhn thy: nhm khng dng simvastatin nng glucose mu, HbA1c khng thay i so trc iu tr. Nhm dng simvastatin glucose mu l 5,851,15 gim hn so trc iu tr l 6,572,07, HbA1c l 6,700,13 gim r rt so vi trc iu tr l 7,231,12 vi p< 0,05. So snh hai nhm sau iu tr chng ti nhn thy nng glucose mu, HbA1c nhm c dng simvastatin gim hn so vi nhm khng dng simvastatin. S khc bit c ngha thng k vi p<0,05. Nhm dng simvastatin c s khc bit r rt trc v sau iu tr v nng insulin mu trc iu tr l 12,486,77 sau iu tr cn 5,223,82 v ch s khng insulin (HOMA-IR) trc iu tr l 3,581,36 sau iu tr cn 1,451,25, vi p< 0,05. Nhm khng dng simvastatin, khng thy s khc bit v nng insulin v ch s khng insulin trc v sau iu tr. Nh vy vic phi hp simvastatin trong iu tr T typ 2 c th lm gim nng glucose mu, HbA1c tt hn so vi nhm khng dng simvastatin. Mt iu ng lu l t l HbA1c c coi l c lin quan ti nng glucose mu t thi im 3 thng trc . Do iu kin nghin cu chng ti ch theo di c hai thng v iu bt ng HbA1c trong nghin cu ca chng ti gim r rt sau hai thng iu tr. Nhiu nghin cu cho thy HbA1c l ch s nh gi nng glucose mu trc ba thng. Tuy nhin theo Rohlfiny Curt L v cng s, mi quan h gia nng glucose mu v t l HbA1c rt phc tp. Nng glucose mu thi im 2 thng trc thi im xc nh HbA1c ng 128
gp ch yu vo mc HbA1c hn hn so vi glucose mu thi im xa hn ba thng trc . iu gii thch ti sao t l HbA1c c th tng, gim nhanh ph hp vi mc thay i glucose mu. Nh vy s thay i HbA1c nhm dng simvastatin trong nghin cu ca chng ti c th l do nng glucose mu gim mnh trong hai thng iu tr. Vic gim t l HbA1c rt c ngha lm sng. Phn tch dch t hc ca nghin cu UKPDS cho thy gim HbA1c 1% km theo gim nguy c hng lot cc bin chng T bao gm t vong lin quan n T (21%), nhi mu c tim (14%), bnh vi mch (37%), bnh mch mu ngoi bin (43%). S kt hp gia HbA1c v nguy c cc bin chng l lin tc. Do mi khi gim 1% HbA1c hy vng c th ci thin c cc kt qu lm sng. Khng insulin l s bt thng chuyn ho c tnh cht quyt nh bnh nhn T typ2 v c xem nh giai on sm trong qu trnh tin trin ca bnh, giai on ny thng kt hp vi nhiu ri lon khc nh tng insulin mu, tng glucose mu, ri lon lipid mu, tng HA, tng va x ng mch, lm tng nguy c bnh l tim mch. S bi tit insulin ph thuc nng glucose mu, s to thnh cc dng oxy hot ng v ri lon chuyn ho lipid c mi lin quan ht sc cht ch vi nhau, cc con ng chuyn ho c hot ho trong qu trnh bi tit insulin c s kch thch ca glucose (tng ng phn, tng t s ATP/ADP, tng nng ca++ni bo). S tng acid bo t do dn n tng triglyceride gy ri lon chc nng v cht t bo beta cht theo chng trnh. Rt nhiu cng trnh nghin cu thc nghim cng nh trn lm sng ca cc tc gi nc ngoi trong thi gian gn y cho thy tc dng rt r rng ca ri lon chuyn ho lipid ln s khng insulin v bo tn chc nng ca t bo beta. Nh vy vic iu tr simvastatin trong nghin cu ca chng ti c tc dng lm gim ri lon chuyn ho lipid trong c bit l gim LDL-C, gim TG gim tnh trng stress oxy ho ci thin nhy ca insulin lm gim mc insulin gim khng insulin, t lm tng mc kim sot glucose mu.

KT LUN Qua iu tr 107 bnh nhn T typ 2 c khng insulin chia ra hai nhm: mt nhm dng sulfonylurea n thun, mt nhm dng sulfonylurea phi hp simvastatin. Sau 2 thng theo di, chng ti nhn thy mt s hiu qu: - Nhm dng simvastatin c cc thnh phn lipid mu trung bnh v t l trong gii hn bnh l ca cc ch s: cholesterol, triglyceride, LDL-C thp hn, HDL-C cao hn so vi nhm khng dng simvastatin, vi p< 0,05. - Nhm dng simvastatin hiu qu ca kim sot glucose mu mc tt hn nhm khng dng simvastatin: glucose, HbA1c, insulin, ch s khng insulin gim. Mc kim sot glucose mu tt t 46,3 ln 66,6%, HbA1c mc tt t 22,2% ln 46,3%. Ci thin r rt glucose mu mc km t 33,3 xung cn 14,8%. HbA1c mc km t 44,4 xung cn 25,9%, vi p< 0,05. - Simvastatin dng liu nh (10mg/ ngy) an ton cao: khng c s thay i v nng trung bnh creatinin, SGOT, SGPT, tiu cu trc v sau iu tr, khng c bnh nhn no phi dng thuc trong qu trnh iu tr.
TI LIU THAM KHO [1]. Thi Hng Quang (2001), i tho ng,
Nh xut bn y hc, Tr.120 180, Tr.21-24; Tr.75-86. [2]. Trung Qun (2007), i Tho ng v iu tr, Nh xut bn Y hc H Ni, tr.12. [3]. Nguyn Hi Thu (2006), c im khng insulin trong bnh i tho ng, Y hc thc hnh, (610), tr.17-27. [4]. Hi tim mch y hc Vit Nam, Khuyn co v cc bnh l tim mch v chuyn ha giai on 2006-2010 (2006), Khuyn co v chn on v iu tr ri lon Lipid mu, Nh xut bn Y hc Thnh ph H Ch Minh, Tr.3565 [5]. Halaine E, Resnick, Kristina, Jones (2003), Insulin Resistance, the metabolic Syndrome, and risk of incident cardiovascular disease in nondiabetic American Indians, Diabetes care,(26), pp. 861-867. [6]. Juan F. Ascano, Rosavio I. lorente (2005), Diagnosing insulin resistance by simple quantitative methods in subjects With normal glucose metabolism, Diabetes care, (26),pp. 3320-3325. [7]. Matthew D.R, Hosker J.P, Rudenski A.S, Naylor B.A (1985) "Homeostasis model assessment: insulin resistance and beta-cell funtion from fasting plasma glucose and insulin concentrations in man", Diabetologia, (28), pp.412-419
129

ABSTRACT
EVALUATION OF THE EFFECTIVENESS OF TREATMENT IN PATIENTS SIMVASTATIN TYP2 DIABETES INSULIN RESISTANCE
Nguyen Kim Luong* Central Hospital, Thai Nguyen Objective: To evaluate the efficacy of the complex therapy by sulfonylurea and simvastatin in typ2 diabetic patients with insulin resistance (IR). Patients and methods: 185 subjects, including: 145 typ2 diabetic patient in disease group and 40 healthy person in control group. Assessment the IR situation by HOMA-IR index (HOMA-IR = I0(u)x G0(mmol/l)/22,5). There were 107 diabetic patients having IR state. They were taken randomized into 2 groups: one group have been treated by sulfonylurea alon (non simvastatin group), other group have been complex treated by sulfonylurea and simvastatin (simvastatin group). assessing the effectiveness of treating after 2 months though parameters: glucose, HbA1c, cholesterol, triglycerid, HDL-C, LDL-C. Results: Simvastatin group have levels of cholesterol, triglycerid, LDL-C lower and level of HDLC higher than non simvastatin group. The glucose control better in simvastatin group: glucose, HbA1c, insulin, IR index more decrease than non simvastatin group. Increasing percentage of good control of glucose and redue the rate of poor control in simvastatin group. Conclusion: The combination of treating sulfonylurea and simvastatin will increase the effective control of lipid and glucose in typ2 diabetic patients with having IR state. Keywords: Typ2 diabetes, insulin resistance, HOMA-IR index, simvastatin
Tel: 0982852165; Email:drluongtn@yahoo.com.vn
130

Tap 77 - So 1 Nam 2011

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Tap 77 - So 1 Nam 2011

Uploaded by

Copyright:

Available Formats

Tai lieu chia se tai: wWw.SinhHoc.edu.

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

THS. Ltr TIEN DUNG THS. DOAN OTJC UAT

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn THE LE GTII BAI

BAN BIEN TAP

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tp ch Khoa hc v Cng ngh

Journal of Science and Technology

15 19 23 29 35 39 43 49 55 59 65 69 77 83 89 97 103 107 123

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tp ch Khoa hc v Cng ngh

Journal of Science and Technology

AGRICULTURE BIOLOGY MEDICINE

15 19 23 29 35 39 43 49 55 59 65 69 77 83 89 97 103 107 123

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tel: 0912386574; Email: Hathuyduc2002@yahoo.com

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

1 2 (/c) 3 4 5 CV% LSD 5%

13,6 15,6 17,0 17,5 16,6 3,5 1,1

10,5 12,9 14,2 14,7 14,0 2,3 0,6

13,3 11,1 11,2 9,2 13,4 -

0,6 0,0 0,0 0,0 0,2 -

170,5 171,2 171,6 172,3 172,5 4,1 0,2

68,5 69,1 69,3 70,4 71,1 6,2 0,3

68,2 68,4 68,5 68,6 68,0 3,1 0,2

13,9 18,0 20,3 21,4 20,1 2,8 1,0

46,3 60,0 67,7 71,2 67,1 2,8 3,3

19,1 22,9 26,2 29,3 26,2 4,6 2,2

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

Tai lieu chia se tai: wWw.SinhHoc.edu.vn

50.00 40.00 30.00 20.00

39.30 31.18 33.05

Thu Chi Li thun