GENETIC TESTING AND MOLECULAR BIOMARKERS Volume 13, Number 6, 2009 Mary Ann Liebert, Inc. Pp.

. 729734 DOI: 10.1089=gtmb.2009.0045

Single-Nucleotide Polymorphisms in Genes Encoding Toll-Like Receptor -2, -3, -4, and -9 in CaseControl Study with Breast Cancer
1, 1,3,4,* Jasminka Pavelic,2 Godfrey E. Etokebe, * Jelena Knezevic,2,* Branka Petricevic, 3 Damir Vrbanec, and Zlatko Dembic1

Background: Genetic susceptibility to cancer is multifactorial, and it is known that impairment of the immune system could contribute to risk for getting cancer. Aim of the Study: Single-nucleotide polymorphisms (SNPs) of Toll-like receptor (TLR) 2, TLR3, TLR4, and TLR9 genes, which are important for innate immunity, were analyzed for the association with breast cancer. Methods: The SNPs comprised TLR2 (c.597T>C), TLR2 (c.1350T>C), TLR3 (c.1377C>T), TLR4 (c.896A>G), and TLR9 (c.1635A>G). The allelic and genotypic frequencies of these TLR SNPs were compared between patients (n 130) and controls (n 101) in a casecontrol study from Croatia. Results: TLR SNPs were not signicantly different. From the population genetics viewpoint, we found that a hypomorphic variant of TLR4 (p.Asp299Gly) allele has no specic allelic frequency (8.4%) in the Croatian population (n 496) compared to other Caucasians (6.510%). Conclusion: These results suggest that polymorphisms in tested TLR genes are not likely to be associated with increased risk for developing breast cancer.

Introduction t is well known that persons with mutations in oncogenes and tumor-suppressor genes are at increased risk of developing cancer. In the immunosurveillance hypothesis, the immune system is regarded as a guardian of tissues protecting their integrity from undesired mutant cells (Zitvogel et al., 2006). A dwindling immune system has been shown to increase the risk of getting cancer in animal models and humans with immunodeciencies or undergoing posttransplantation immunosuppressive therapy (Smyth et al., 2000; Girardi et al., 2001; Street et al., 2002; Smyth et al., 2004). The genetic susceptibility to cancer is multifactorial, with some factors known to function in the cell cycle, apoptosis, or cell differentiation. However, the risk may also comprise additional factors that are related to the activation of the immune system and chronic inammation, as, recently, gene polymorphisms in Toll-like receptor 4 (TLR4) and the TLR6TLR1-TLR10 gene cluster have been associated with prostate cancer (Zheng et al., 2004; Chen et al., 2005; Sun et al., 2005) and gastric lymphoma (Hellmig et al., 2005). Under selective pressure from infectious microorganisms, multicellular organisms have evolved immunological defense mechanisms,

generally categorized as innate or adaptive. Recent insights into the complex mechanisms of human innate immunity suggest that genetic variability in genes encoding its components may play a role in the development of infectious and related diseases including cancer (Lazarus et al., 2002; Chen et al., 2005; Schroder and Schumann, 2005). It is not known to what extent innate immunity can contribute to immunosurveillance. TLRs in mammals represent phylogenetically conserved transmembrane proteins known to bind conserved molecular patterns usually present in distantly related species like bacteria, viruses, and parasites. They are therefore pattern recognition receptors. TLRs can signal to T-cells via dendritic cells (DCs) that such molecular patterns are present within the damaged body tissues. These include peptidoglycan, bacterial lipopolysaccharide, double-stranded RNA, and unmethylated DNA as ligands for TLR2, 4, 3, and 9, respectively. Signals provided by DCs can then initiate the adaptive immune responses against microbial infections. Activation of DCs by TLRs are essential for T-cell activation, up-regulation of costimulatory molecules, inhibition of regulatory T-cell activity, and also for activation and maturation of B-cells (Rakoff-Nahoum and Medzhitov, 2009).

Faculty of Dentistry, Institute for Oral Biology, University of Oslo, Oslo, Norway. Division of Molecular Medicine, Laboratory of Molecular Oncology, Rudjer Boskovic Institute, Zagreb, Croatia. Departments of 3Medical Oncology and 4Oncology, Clinical Hospital Center Zagreb, University of Zagreb, Zagreb, Croatia. *These authors contributed equally to this work.
2

729

730 Malignant cancers can express tumor-specic or tumorassociated markers (antigens) that could be used as targets for immune attack during immunosurveillance (Bogen et al., 2000). By having the immune system recognize such tumor antigens, the repeated onset of exactly the same cancer could be prevented. However, malignant tumor cells, possibly by having an inherent ability to constantly change genotypic and phenotypic characteristics, are able to escape immunity and=or inhibit the specic (adaptive) immune system defenses by establishing peripheral and sometimes also central tolerance to such antigens (de Visser et al., 2006). As a part of systematic investigation of susceptibility to cancer within its relationship to the immune system, we rst chose candidate genes from those that are important for the maintenance of the innate immunity. Likewise, we rst selected the most prevalent form of malignancy in womenbreast cancer. We designed a casecontrol study with individuals from Croatia and analyzed associations of some single-nucleotide polymorphisms (SNPs) of the TLR2, TLR3, TLR4, and TLR9 genes with the incidence of breast cancer. Materials and Methods Patients and controls Blood samples were collected from 130 breast cancer patients at the Department of Medical Oncology, Department of Oncology, Clinical Hospital Center Zagreb, Zagreb, and 101 healthy women (Department of Transfusiology, Rijeka, Croatia). Diagnosis was made by medical, radiological, and biochemical assessment of patients. Most patients presented at early stages of breast cancer and the initial treatment was started at the Department. Patients ages ranged from 30 to 85 years at the time of taking a sample with a mean of 62.8 11.0 (standard deviation). Controls were with a mean age of 42.5 11.1 (standard deviation) years. All study participants provided oral and written informed consent. The ethics committee of the Medical Research Council at the School of Medicine, Universities of Zagreb and Rijeka approved the studies. The DNA analysis DNA was isolated from frozen blood by salting out method. The polymorphisms of TLR2 (NM_003264) c.597C>T (rs3804099) and c.1350C>T (rs3804100), TLR3 (NM_003265) c.1377C>T (rs3775290), TLR4 (NM_138554) c.896A>G (rs4986790), and TLR9 (NM_017442) c.1635A>G (rs352140) (Noguchi et al., 2004) were done by TaqMan allele-specic polymerase chain reaction assay using two different polymerase chain reaction machines with their own corresponding software: MX4000 and MX3005 (Stratagene, San Diego, CA) and Applied Biosystems (ABI) 7000 (ABI, Foster City, CA). TLR3 and TLR9 SNPs were additionally mapped by restriction enzyme digestions, which turn out to be identical. The primers and probes for TLR2, 3, 4, and 9 were purchased from ABI. TLR4 (c.896A>G) primers and 6-carboxyuorescein (FAM) and VICTK (proprietary)-labeled probes were as previously published (Schmitt et al., 2002). TLR2, TLR3, and TLR9 gene primers and probes for reporter dyes (FAM=VIC) had the following sequences:

ETOKEBE ET AL. The primers and reporter probes for TLR2 (c.597T>C) were as follows (50 -30 ): Forward: 50 -CAGATCTACAGAGCTATGAGCCAAAA Reverse: 50 -TCTCCAGCAGTAAAATATGCTGCTT Reporter 1: VIC-TCAGATGACTTACATTCTGA Reporter 2: FAM-CAGATGACTTACGTTCTGA The primers and reporter probes for TLR2 (c.1350T>C) were as follows (50 -30 ): Forward: GAAATATTTGAACTTATCCAGCACACGAA Reverse: GTTGCTAACATCTAAAATTTCCAGTGTCTT Reporter 1: VIC-CAGCCTGTTACACTGTGT Reporter 2: FAM-AGCCTGTTACGCTGTGT The primers and reporter probes for TLR3 (c.1377C>T) were as follows (50 -30 ): Forward: GCCAGGAATGGAGAGGTCTAGAAA Reverse: TCAGCTGCAGGTACTTGTTGTAG Reporter 1: VIC-AAAGATAGATTTCGAAAATA Reporter 2: FAM-AAAGATAGATTTCAAAAATA The primers and reporter probes for TLR9 (c.1635A>G) were as follows (50 -30 ): Forward: TCTACCACGAGCACTCATTCAC Reverse: GGGCTGGCTGTTGTAGCT Reporter 1: VIC-TCCAGTCGTGGTAGCT Reporter 2: FAM-CAGTCGCGGTAGCT Statistical analysis For statistical signicance, analyses were done with the use of a chi-square test using the computer software program Statcalc (22 or 33 tables) (Acastat software). Hardy Weinberg and linkage disequilibrium analyses were performed using Arlequin versus 2.0 software (Genetics and Biometry Laboratory, University of Geneva, Geneva, Switzerland). All loci were in HardyWeinberg equilibrium. Results TLR SNPs and breast cancer Genotypic frequencies of TLR24 and TLR9 SNPs are listed in Table 1. The statistical analyses showed no signicant differences in frequencies between breast cancer patients and controls, indicating a lack of association with the disease. The allelic frequencies of TLR24 and TLR9 alleles at various SNPs are presented in Table 2. Allelic frequencies of selected TLR SNPs were not signicantly different between breast cancer patients and healthy women controls. This too indicated no correlation with breast cancer. The DNA samples used as controls (n 101 women), for comparisons with patients, were selected out of the 496 healthy individuals who were also typed for indicated TLR SNPs. Comparisons between patients and all healthy controls similarly showed no signicant differences in allelic and genotypic frequencies of TLR SNPs (data not shown). The latter result could have been predicted, as allelic or genotypic frequencies of each TLR SNP in healthy women did not differ much from the whole population (data not shown). Discussion Association of inherited polymorphisms of the innate immune gene TLR4 with the risk of prostate cancer was the rst

TLR-GENE SNPS AND BREAST CANCER Table 1. Genotypic Frequencies of Various Toll-Like Receptor Single-Nucleotide Polymorphisms in Patients with Breast Cancer (Mostly Ca. Mammae Ductale Invasivum and Lobulare) and Controls Controls n (%)a SNP TLR2 TLR2 TLR3 TLR4 TLR9 (597 C=T)b (1350 T=C) (1377 C=T) (896 A=G) (1635 A=G) wt=wt 26 84 46 84 36 (29.2) (88.4) (47.9) (84.8) (37.1) wt=var 48 11 42 15 49 (53.9) (11.6) (43.8) (15.2) (50.5) var=var 15 0 8 0 12 (16.9) (0) (8.3) (0) (12.4) wt=wt 29 76 58 110 45 (32.6) (85.4) (45.3) (84.5) (34.6) Patients n (%)a wt=var 44 13 56 20 60 (49.4) (14.6) (43.8) (15.4) (46.2) var=var 16 0 14 0 25 (18.0) (0) (10.9) (0) (19.2)

731

pb 0.7 0.6 0.8 1 0.23

a Wild type (wt; common allele) and variant forms (var; rare allele) of listed SNPs. Total number (n) of tested patients was 130, apart from TLR2 (n 89) and TLR3 (n 128). Total number (n) of tested controls was 101, but distributed differently: TLR2597 (n 89), TLR21350 (n 95), TLR3 (n 96), TLR4 (n 99), and TLR9 (n 97). b 2 degrees of freedom (df)-analysis; controls versus patients. SNP, single-nucleotide polymorphism; TLR, toll-like receptor.

evidence that a putative weakness in innate immunity could predispose for cancer (Chen et al., 2005). However, it is well known that viruses can predispose for cancer (human papilloma viruses), so it is reasonable to suggest that some other cancers might be linked to hereditary traits in the immune system. Although no known virus has ever been linked to breast cancer, perhaps, they might in the future, because this eld is one of the less actively investigated areas of cancer research. We hypothesized that predisposition to develop cancer might be due to faults in innate immunity as a part of a multigenetic risk for cancer. Association studies using polymorphic genome tags such as microsatellite repeats and SNPs could impart knowledge whether inherent weakness in the innate immune system might inuence the risk of getting the disease in the rst place, and whether this can, in addition, modulate the course of cancer. We found that there were no associations between breast cancer and selected TLR polymorphisms. However, due to inherent complexity of a multigenetic risk, it is possible that various populations have different combinations of genes comprising susceptibility for this type of cancer. Here we showed that frequency of rare TLR4 hypomorphic allele 299Gly is 8.4% (n 496), suggesting that the frequency of this variant in Croatian population is in concordance with other Caucasians (6.510%). Polymorphisms found in TLRs have the potential to be associated with complex human disease (for a review see Lazarus et al., 2002; Schroder and Schumann, 2005; Garantziotis et al., 2008), and especially chronic inammatory states that

can probably predispose to development of cancer. To get a clearer picture of the associations reported in literature thus far, it is important to review the current state of disease associations and polymorphisms in TLR family of genes used in this study. The TLR2, TLR3, and TLR9 SNPs used in the present study were rst identied in a healthy Japanese population (Noguchi et al., 2004). The TLR4 p.Asp299Gly SNP is the best studied SNP thus far, which has numerous disease associations. Others were not associated with any disease, except for TLR2 (c.1350T>C). The TLR2 (c.1350T>C) rare variant (C) was associated with protection for developing type I diabetes mellitus (Park et al., 2004). Other TLR2 SNPs were correlated with several diseases. The hypomorphic variants TLR2 p.Arg753Gln and p.Arg677Trp correlated with the incidence of sepsis in a white population and with the incidence of lepromatous leprosy in an Asian population, respectively (Schroder et al., 2003). TLR2 p.Arg753Gln was also associated with coronary restenosis (Hamerman et al., 2005) and increased incidence of tuberculosis in Turkish population (Ogus et al., 2004). The latter was not associated with susceptibility to tuberculosis in Tunisian population, but p.Arg677Trp was (Ben-Ali et al., 2004). Interestingly, TLR2 p.Arg753Gln heterozygosity seems to impart protection to Lyme disease (Schroder and Schumann, 2005). The TLR4 (c.896A>G) (p.Asp299Gly) mutation directly affects the TLR4 function, as the rare 299Gly allele has only 510% of the common alleles signaling activity in transfection experiments in vitro (Arbour et al., 2000; Schmitt et al., 2002). In

Table 2. Allelic Frequencies of Various Toll-Like Receptor Single-Nucleotide Polymorphisms in Breast Cancer Patients and Controls Controls n (%)a SNP TLR2 TLR2 TLR3 TLR4 TLR9 (597 T=C)b (1350 T=C) (1377 C=T) (896 A=G) (1635 A=G) 100 179 134 183 121 wt (56.2) (94.2) (69.8) (92.4) (62.4) 78 11 58 15 73 var (43.8) (5.8) (30.2) (7.6) (37.6) 102 165 172 240 150 wt (57.3) (92.7) (67.2) (92.3) (57.7) Patients n (%)a var 76 13 84 20 110 (42.7) (7.3) (32.8) (7.7) (42.3) pb 0.9 0.6 0.8 1 0.25

a Wild-type alleles (wt; common alleles) and their variant forms (var). Total numbers of tested patients and controls were the same as in Table 1. b 22 tables (w2) statistical analysis (controls vs. patients).

732 contrast, no reduction in sensitivity to endotoxin (lipopolysaccharide [LPS]), inammatory cytokine production, or antimicrobial effects was found ex vivo in peripheral blood mononuclear cells (Imahara et al., 2005; van der Graaf et al., 2005). Possibly other factors that can affect the expression of antiinammatory cytokine genes like interleukin-10 and interleukin-4 need to be stratied before we could fully assess the in vivo inuence of this mutant. It was reported that 299Gly mutation confers benecial effects at the population level, because TLR4 (p.Asp299Gly) is associated with hyporesponsiveness to inhaled lipopolysaccharide in humans (Arbour et al., 2000), reduced atherosclerosis (Kiechl et al., 2002), reduced vascular inammation and clinical diabetes (Kolek et al., 2004), decreased susceptibility of rheumatoid arthritis (Radstake et al., 2004), lower incidence of myocardial infarction (Balistreri et al., 2004; Holloway et al., 2005), diminished severity of the systemic inammatory response syndrome (Child et al., 2003), reduced neuropathy in type 2 diabetes (Rudofsky et al., 2004), resistance to Legionnaires disease (Hawn et al., 2005), protection against late-onset Alzheimer disease (Minoretti et al., 2006), and longevity (Balistreri et al., 2004). However, it has also detrimental effects, since it correlates with predisposition to developing septic shock with Gram-negative bacteria (Lorenz et al., 2002b), severe sepsis after burn injury (Barber et al., 2004), severe respiratory syncytial virus disease (Tal et al., 2004), susceptibility to periodontitis (Schroder et al., 2005), increased risk of premature birth (Lorenz et al., 2002a), susceptibility to inammatory bowel disease (Franchimont et al., 2004; Braat et al., 2005; Brand et al., 2005) especially its colonic localization (Ouburg et al., 2005), brucellosis (Rezazadeh et al., 2006), and asthma (Fageras Bottcher et al., 2004). Importantly, Hellmig et al. (2005) found a lower frequency of heterozygotes with the rare 299Gly allele in patients with gastric lymphomas. Recently, in Swedish (Zheng et al., 2004) and Chinese (Chen et al., 2005) study groups another TLR4 polymorphism (c.11381G>C) was associated with modest risk of developing prostate cancer. The authors hypothesized that increased risk of chronic infection and chronic inammation (provided by the variant TLR4 allele at 11381) in prostate might also increase the susceptibility to developing prostate cancer. However, in the present study, allelic and genotypic frequencies of the TLR4 (p.Asp299Gly) SNP showed almost no differences between patients and controls (Table 1). The Chinese population has almost nonexistent TLR4 299Gly allele (Hang et al., 2004). However, another TLR4 polymorphism seems to play a role in disease association, as intronic (119 C=A) SNP was recently correlated with ischemic stroke (Lin et al., 2005). The other TLR SNPs investigated in the present work were found in 50 - and 30 -anking regions of the genes (Noguchi et al., 2004), and it is not known whether they inuence the transcriptional activity of these genes. Such polymorphisms might be helpful as markers to other more functionally relevant allelic variants within these loci, provided they are in linkage disequilibrium. The TLR3 gene polymorphisms (c.2593C>T, c.2642C>A, and c.2690A>G) were associated with diabetes mellitus type I in South African Blacks (Pirie et al., 2005). The TLR9 gene polymorphism was associated with hyperimmunoglobulin M in primary billiary cirrhosis (Kikuchi et al., 2005).

ETOKEBE ET AL. So far, casecontrol studies have indicated that various TLR SNPs are perhaps detrimentally associated with some infectious diseases, immune-related syndromes, and autoimmunity, while being benecial in some other conditions and diseases (Schroder and Schumann, 2005). By contrast, some researchers were not able to conrm some favorable and some disadvantageous effects of TLR4 Asp299Gly polymorphism as pointed out by a recent study (van der Graaf et al., 2005). For instance, a large study in France revealed neither benecial nor detrimental inuence of TLR4 299Gly SNP on coronary heart disease (myocardial infarction) (Morange et al., 2004). Further, some studies even found the opposite, that is, increased risk for myocardial infarction in carriers of TLR4 299Gly variant (Edfeldt et al., 2004). Similar conicts were reported for the involvement of TLR4 Asp299Gly in inammatory bowel disease (Torok et al., 2004; Lakatos et al., 2005; Oostenbrug et al., 2005), rheumatoid arthritis (Kilding et al., 2003), preterm delivery (Hartel et al., 2004), periodontitis (Folwaczny et al., 2004), atherosclerosis (Netea et al., 2004), and asthma (Noguchi et al., 2004; Adjers et al., 2005). There might be several reasons why casecontrol studies can yield false-positive or false-negative, and therefore not reproducible results (Kathiresan et al., 2004). Apart from possible variations in diagnostic procedures, patient selection, and methodological problems, it is well known that differences in population history have produced characteristic patterns of SNP allele frequencies when ethnic groups are compared, and perhaps such population stratication might be one of the causes for the differences. To conclude, there were no associations between breast cancer and selected TLR polymorphisms. However, it is still possible that various populations may have different combinations of immunologically important genes comprising susceptibility for breast cancer. This should invite multicenter-based design and analysis of disease association studies, as the role of innate and adaptive immunity in predisposition to breast cancer should be addressed in the future. Acknowledgments This work was nancially supported by the Croatian Ministry of Science, Education and Sports, grant number 0980982464-2394. We thank technical assistance of medical staff at the Clinical Hospital Centre Rebro, Zagreb, for help with patients. We thank Sanja Balen, Department of Transfusiology, Medical Faculty, University of Rijeka, for collecting control samples. Disclosure Statement No competing nancial interests exist. References
Adjers K, Karjalainen J, Pessi T, et al. (2005) Epistatic effect of TLR4 and IL4 genes on the risk of asthma in females. Int Arch Allergy Immunol 138:251256. Arbour NC, Lorenz E, Schutte BC, et al. (2000) TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet 25:187191. Balistreri CR, Candore G, Colonna-Romano G, et al. (2004) Role of Toll-like receptor 4 in acute myocardial infarction and longevity. JAMA 292:23392340.

TLR-GENE SNPS AND BREAST CANCER

Barber RC, Aragaki CC, Rivera-Chavez FA, et al. (2004) TLR4 and TNF-alpha polymorphisms are associated with an increased risk for severe sepsis following burn injury. J Med Genet 41:808813. Ben-Ali M, Barbouche MR, Bousnina S, et al. (2004) Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients. Clin Diagn Lab Immunol 11:625626. Bogen B, Schenck K, Munthe LA, Dembic Z (2000) Deletion of idiotype (Id)-specic T cells in multiple myeloma. Acta Oncol 39:783788. Braat H, Stokkers P, Hommes T, et al. (2005) Consequence of functional Nod2 and Tlr4 mutations on gene transcription in Crohns disease patients. J Mol Med 83:601609. Brand S, Staudinger T, Schnitzler F, et al. (2005) The role of Tolllike receptor 4 Asp299Gly and Thr399Ile polymorphisms and CARD15=NOD2 mutations in the susceptibility and phenotype of Crohns disease. Inamm Bowel Dis 11:645652. Chen YC, Giovannucci E, Lazarus R, et al. (2005) Sequence variants of Toll-like receptor 4 and susceptibility to prostate cancer. Cancer Res 65:1177111778. Child NJ, Yang IA, Pulletz MC, et al. (2003) Polymorphisms in Toll-like receptor 4 and the systemic inammatory response syndrome. Biochem Soc Trans 31:652653. de Visser KE, Eichten A, Coussens LM (2006) Paradoxical roles of the immune system during cancer development. Nat Rev Cancer 6:2437. Edfeldt K, Bennet AM, Eriksson P, et al. (2004) Association of hypo-responsive toll-like receptor 4 variants with risk of myocardial infarction. Eur Heart J 25:14471453. Fageras Bottcher M, Hmani-Aifa M, Lindstrom A, et al. (2004) A TLR4 polymorphism is associated with asthma and reduced lipopolysaccharide-induced interleukin-12(p70) responses in Swedish children. J Allergy Clin Immunol 114:561567. Folwaczny M, Glas J, Torok HP, et al. (2004) Toll-like receptor (TLR) 2 and 4 mutations in periodontal disease. Clin Exp Immunol 135:330335. Franchimont D, Vermeire S, El Housni H, et al. (2004) Decient host-bacteria interactions in inammatory bowel disease? The toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohns disease and ulcerative colitis. Gut 53:987 992. Garantziotis S, Hollingsworth JW, Zaas AK, Schwartz DA (2008) The effect of toll-like receptors and toll-like receptor genetics in human disease. Annu Rev Med 59:343359. Girardi M, Oppenheim DE, Steele CR, et al. (2001) Regulation of cutaneous malignancy by gammadelta T cells. Science 294: 605609. Hamerman JA, Ogasawara K, Lanier LL (2005) NK cells in innate immunity. Curr Opin Immunol 17:2935. Hang J, Zhou W, Zhang H, et al. (2004) TLR4 Asp299Gly and Thr399Ile polymorphisms are very rare in the Chinese population. J Endotoxin Res 10:238240. Hartel C, Finas D, Ahrens P, et al. (2004) Polymorphisms of genes involved in innate immunity: association with preterm delivery. Mol Hum Reprod 10:911915. Hawn TR, Wu H, Grossman JM, et al. (2005) A stop codon polymorphism of Toll-like receptor 5 is associated with resistance to systemic lupus erythematosus. Proc Natl Acad Sci USA 102:1059310597. Hellmig S, Fischbach W, Goebeler-Kolve ME, et al. (2005) Association study of a functional Toll-like receptor 4 polymorphism with susceptibility to gastric mucosa-associated lymphoid tissue lymphoma. Leuk Lymphoma 46:869872.

733
Holloway JW, Yang IA, Ye S (2005) Variation in the toll-like receptor 4 gene and susceptibility to myocardial infarction. Pharmacogenet Genomics 15:1521. Imahara SD, Jelacic S, Junker CE, OKeefe GE (2005) The TLR4 896 polymorphism is not associated with lipopolysaccharide hypo-responsiveness in leukocytes. Genes Immun 6:3743. Kathiresan S, Newton-Cheh C, Gerszten RE (2004) On the interpretation of genetic association studies. Eur Heart J 25:1378 1381. Kiechl S, Lorenz E, Reindl M, et al. (2002) Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 347:185192. Kikuchi K, Lian ZX, Kimura Y, et al. (2005) Genetic polymorphisms of toll-like receptor 9 inuence the immune response to CpG and contribute to hyper-IgM in primary biliary cirrhosis. J Autoimmun 24:347352. Kilding R, Akil M, Till S, et al. (2003) A biologically important single nucleotide polymorphism within the toll-like receptor-4 gene is not associated with rheumatoid arthritis. Clin Exp Rheumatol 21:340342. Kolek MJ, Carlquist JF, Muhlestein JB, et al. (2004) Toll-like receptor 4 gene Asp299Gly polymorphism is associated with reductions in vascular inammation, angiographic coronary artery disease, and clinical diabetes. Am Heart J 148:10341040. Lakatos PL, Lakatos L, Szalay F, et al. (2005) Toll-like receptor 4 and NOD2=CARD15 mutations in Hungarian patients with Crohns disease: phenotype-genotype correlations. World J Gastroenterol 11:14891495. Lazarus R, Vercelli D, Palmer LJ, et al. (2002) Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev 190:925. Lin YC, Chang YM, Yu JM, et al. (2005) Toll-like receptor 4 gene C119A but not Asp299Gly polymorphism is associated with ischemic stroke among ethnic Chinese in Taiwan. Atherosclerosis 180:305309. Lorenz E, Hallman M, Marttila R, et al. (2002a) Association between the Asp299Gly polymorphisms in the Toll-like receptor 4 and premature births in the Finnish population. Pediatr Res 52:373376. Lorenz E, Mira JP, Frees KL, Schwartz DA (2002b) Relevance of mutations in the TLR4 receptor in patients with gram-negative septic shock. Arch Intern Med 162:10281032. Minoretti P, Gazzaruso C, Vito CD, et al. (2006) Effect of the functional toll-like receptor 4 Asp299Gly polymorphism on susceptibility to late-onset Alzheimers disease. Neurosci Lett 391:147149. Morange PE, Tiret L, Saut N, et al. (2004) TLR4=Asp299Gly, CD14=C-260T, plasma levels of the soluble receptor CD14 and the risk of coronary heart disease: the PRIME study. Eur J Hum Genet 12:10411049. Netea MG, Hijmans A, van Wissen S, et al. (2004) Toll-like receptor-4 Asp299Gly polymorphism does not inuence progression of atherosclerosis in patients with familial hypercholesterolaemia. Eur J Clin Invest 34:9499. Noguchi E, Nishimura F, Fukai H, et al. (2004) An association study of asthma and total serum immunoglobin E levels for Toll-like receptor polymorphisms in a Japanese population. Clin Exp Allergy 34:177183. Ogus AC, Yoldas B, Ozdemir T, et al. (2004) The Arg753GLn polymorphism of the human toll-like receptor 2 gene in tuberculosis disease. Eur Respir J 23:219223. Oostenbrug LE, Drenth JP, de Jong DJ, et al. (2005) Association between Toll-like receptor 4 and inammatory bowel disease. Inamm Bowel Dis 11:567575.

734
Ouburg S, Mallant-Hent R, Crusius JB, et al. (2005) The toll-like receptor 4 (TLR4) Asp299Gly polymorphism is associated with colonic localisation of Crohns disease without a major role for the Saccharomyces cerevisiae mannan-LBP-CD14-TLR4 pathway. Gut 54:439440. Park Y, Park S, Yoo E, et al. (2004) Association of the polymorphism for Toll-like receptor 2 with type 1 diabetes susceptibility. Ann NY Acad Sci 1037:170174. Pirie FJ, Pegoraro R, Motala AA, et al. (2005) Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes. Tissue Antigens 66:125130. Radstake TR, Franke B, Hanssen S, et al. (2004) The Toll-like receptor 4 Asp299Gly functional variant is associated with decreased rheumatoid arthritis disease susceptibility but does not inuence disease severity and=or outcome. Arthritis Rheum 50:9991001. Rakoff-Nahoum S, Medzhitov R (2009) Toll-like receptors and cancer. Nat Rev Cancer 9:5763. Rezazadeh M, Hajilooi M, Raei A, et al. (2006) TLR4 polymorphism in Iranian patients with brucellosis. J Infect 53:206 210. Rudofsky G Jr., Reismann P, Witte S, et al. (2004) Asp299Gly and Thr399Ile genotypes of the TLR4 gene are associated with a reduced prevalence of diabetic neuropathy in patients with type 2 diabetes. Diabetes Care 27:179183. Schmitt C, Humeny A, Becker CM, et al. (2002) Polymorphisms of TLR4: rapid genotyping and reduced response to lipopolysaccharide of TLR4 mutant alleles. Clin Chem 48:1661 1667. Schroder NW, Hermann C, Hamann L, et al. (2003) High frequency of polymorphism Arg753Gln of the Toll-like receptor-2 gene detected by a novel allele-specic PCR. J Mol Med 81:368372. Schroder NW, Meister D, Wolff V, et al. (2005) Chronic periodontal disease is associated with single-nucleotide polymorphisms of the human TLR-4 gene. Genes Immun 6:448 451. Schroder NW, Schumann RR (2005) Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious disease. Lancet Infect Dis 5:156164.

ETOKEBE ET AL.
Smyth MJ, Cretney E, Kershaw MH, Hayakawa Y (2004) Cytokines in cancer immunity and immunotherapy. Immunol Rev 202:275293. Smyth MJ, Thia KY, Street SE, et al. (2000) Perforin-mediated cytotoxicity is critical for surveillance of spontaneous lymphoma. J Exp Med 192:755760. Street SE, Trapani JA, MacGregor D, Smyth MJ (2002) Suppression of lymphoma and epithelial malignancies effected by interferon gamma. J Exp Med 196:129134. Sun J, Wiklund F, Zheng SL, et al. (2005) Sequence variants in Toll-like receptor gene cluster (TLR6-TLR1-TLR10) and prostate cancer risk. J Natl Cancer Inst 97:525532. Tal G, Mandelberg A, Dalal I, et al. (2004) Association between common Toll-like receptor 4 mutations and severe respiratory syncytial virus disease. J Infect Dis 189:20572063. Torok HP, Glas J, Tonenchi L, et al. (2004) Polymorphisms of the lipopolysaccharide-signaling complex in inammatory bowel disease: association of a mutation in the Toll-like receptor 4 gene with ulcerative colitis. Clin Immunol 112:8591. van der Graaf C, Kullberg BJ, Joosten L, et al. (2005) Functional consequences of the Asp299Gly Toll-like receptor-4 polymorphism. Cytokine 30:2648 Zheng SL, Augustsson-Balter K, Chang B, et al. (2004) Sequence variants of toll-like receptor 4 are associated with prostate cancer risk: results from the Cancer Prostate in Sweden Study. Cancer Res 64:29182922. Zitvogel L, Tesniere A, Kroemer G (2006) Cancer despite immunosurveillance: immunoselection and immunosubversion. Nat Rev Immunol 6:715727.

Address correspondence to: Jelena Knezevic, Dr.Sc. Division of Molecular Medicine Laboratory of Molecular Oncology Rud er Boskovic Institute Bijenicka cesta 54 Zagreb 10 000 Croatia E-mail: jknezev@irb.hr